The acquisition of the main QTL qWTCKNR3.2 for maize yield and waterlogging tolerance, and the development and application of its molecular marker primers.

Abstract

This invention belongs to the field of molecular biology and discloses the main QTL for maize yield tolerance to waterlogging. qWTCKNR3.2 This invention provides the acquisition of [specific compound name], the development and application of its molecular marker primers, and the main effect QTL for controlling the waterlogging tolerance coefficient of maize rows. qWTCKNR3.2 Located at nucleotide 218456862 on chromosome 3 of the maize B73 reference genome, this SNP contributed 14.53% to the phenotypic contribution of row number to waterlogging tolerance. PARMS markers designed using this SNP were used to test maize inbred lines, revealing that the method is simple to operate and produces clear genotypes. Furthermore, it demonstrated good selection effects on traits such as plant height, ear position, number of tassel branches, tassel main axis length, leaf length, number of ear rows, ear weight, and single ear grain weight under waterlogging stress. Therefore, it can be used for marker-assisted selection breeding of maize yield and waterlogging tolerance traits.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the QTLs for maize yield tolerance to waterlogging. qWTCKNR3.2 The acquisition of [the substance] and the development and application of its molecular marker primers. Background Technology

[0002] With the intensification of climate anomalies and uneven rainfall during the maize growing season, waterlogging stress has become one of the major natural disasters facing maize production (Zhu Shidie et al., 2024). Developing waterlogging-tolerant varieties with high yield potential is one of the main goals of maize breeding. Understanding the mechanisms of waterlogging tolerance is of great significance for breeders to develop new waterlogging-tolerant varieties with different waterlogging tolerance traits (Zaidi et al., 2004).

[0003] The severity of waterlogging damage is related to the duration of stress, soil conditions, climate, cultivation techniques, crop growth stage, and genotype (Mano et al., 2002). Studies have shown that the root system is the first to be affected by waterlogging stress (Zaidi et al., 2004). After 6 days of waterlogging treatment, most roots, except for some adventitious roots, tend to rot, and the plants cannot absorb soil nutrients well, resulting in nitrogen deficiency, leaching, and denitrification, the latter manifesting as leaf yellowing (Ren et al., 2017). Root hypoxia leads to decreased respiration rate and root vigor, accelerating leaf senescence and reducing indicators such as photosynthetic rate, intercellular CO2 concentration, transpiration rate, and stomatal conductance. Photosynthetic indicators, such as net photosynthetic rate, decrease with prolonged flooding, and the magnitude of the decrease is directly proportional to the duration of flooding (Zhou Qingyun et al., 2020; Zhang Wei et al., 2017; Han Liangliang et al., 2011). Flooding can disrupt chlorophyll synthesis; 30 days of flooding inhibits chlorophyll a synthesis, affecting photosynthesis (Zhang Wei et al., 2017), resulting in severe energy deficiency (Kaur et al., 2020; Tian et al., 2021). Maize cannot tolerate low-oxygen conditions in the root zone, leading to a significant reduction in yield (Dennis et al., 2000).

[0004] However, the current scarcity of waterlogging-tolerant maize germplasm resources, insufficient discovery of key genes, unclear molecular regulatory mechanisms, and lack of efficient molecular breeding technologies severely restrict the cultivation of new waterlogging-tolerant varieties. Discovering and effectively utilizing waterlogging-tolerant genes, exploring the molecular mechanisms of waterlogging tolerance in maize, creating new waterlogging-tolerant maize germplasm, and cultivating new waterlogging-tolerant varieties are the most economical and effective ways to reduce maize losses, increase yield per unit area, and expand the maize planting area (Zaidi et al., 2004, 2010).

[0005] Previous studies have confirmed that the number of kernels per row is one of the key components determining maize yield. Wang Chengyu et al. conducted waterlogging and flooding treatments on summer maize during the jointing stage and found that both treatments resulted in significantly lower kernels per ear and yield compared to the control (CK). The decrease in kernels per ear was 30.61% and 44.48%, respectively, and the decrease in yield was 34.68% and 57.26%, respectively (Wang Chengyu et al., 2022). Zhang Dongmei et al. conducted flooding stress treatment on maize during the jointing stage and found that flooding stress significantly reduced the number of kernels per row, and the decrease showed a gradient trend with the extension of flooding duration. Specifically, the number of kernels per row in the 3-day, 6-day, and 9-day flooded treatment groups was 4.63%, 6.47%, and 10.19% lower than the CK, respectively (Zhang Dongmei et al., 2022).

[0006] Based on this, this study extensively collected 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain, established a population of superior germplasm with different characteristics, completed whole-genome resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and evaluated waterlogging resistance in field yields. Furthermore, through association analysis, superior allelic variations were identified, specific functional markers were developed and used to create intermediate breeding materials, providing superior allelic resources for carrying out molecular breeding for maize waterlogging tolerance. Summary of the Invention

[0007] The purpose of this invention is to provide a reagent for detecting the base at position 218456862 on the third chromosome of the maize genome, and its application in screening breeding for maize yield and waterlogging tolerance traits.

[0008] Another objective of this invention is to provide the application of a reagent for detecting the base at position 218456862 of chromosome 3 of the maize genome in the preparation of a screening kit for maize yield and waterlogging tolerance traits.

[0009] The final objective of this invention is to provide a method for screening and breeding maize varieties to improve yield and waterlogging tolerance.

[0010] To achieve the above objectives, the present invention is implemented through the following technical solution: The main effect of controlling the number of kernels per row and the waterlogging resistance coefficient of corn QTL qWTCKNR3.2 Obtaining: 1) This invention, through genome-wide association analysis, detected a factor on chromosome 3 of maize that regulates the row number of kernels and waterlogging tolerance coefficient. QTL qWTCKNR3.2 This region contains 6 significant SNP sites with a total length of 14.18 kb (Chr3: 218442678-218456862). Further investigation revealed a superior haplotype SNP marker closely linked to it, located at 218456862 bases on chromosome 3 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), which explained 14.53% of the phenotypic contribution of row and grain number tolerance coefficient.

[0011] 2) For the above-mentioned SNP molecular markers, the applicant has developed PARMS marker primers, which are as follows: qWTCKNR3.2 F :GCTCCTACAGACTACGTCCT; qWTCKNR3.2 R1 (Waterlogging resistance haplotype A): GAAGGTCGGAGTCAACGGATTAACGTCTGAAGTGGAAGGGT; and qWTCKNR3.2 R2 (Water-sensitive haplotype G): GAAGGTGACCAAGTTCATGCTAACGTCTGAAGTGGAAGGGC.

[0012] The scope of protection of this invention also includes: Application of reagents for detecting base position 218456862 on chromosome 3 of the maize genome in screening breeding for maize yield and waterlogging tolerance traits.

[0013] Application of reagents for detecting base 218456862 on chromosome 3 of the maize genome in the preparation of a screening kit for maize yield and waterlogging tolerance traits.

[0014] In the above-described applications, preferably, the reagent is a primer.

[0015] In the above-described applications, if a homozygote is detected with a base A at position 218456862 on chromosome 3 of the maize genome, the maize is determined to be a yield-tolerant maize; if a homozygote is detected with a base G at position 218456862 on chromosome 3 of the maize genome, the maize is determined to be a yield-sensitive maize.

[0016] In the above-described applications, the yield-resistant corn has a row-count grain-resistance coefficient greater than 0.6, while the yield-sensitive corn has a row-count grain-resistance coefficient less than 0.4.

[0017] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by this invention: qWTCKNR3.2 F:GCTCCTACAGACTACGTCCT; qWTCKNR3.2 R1 (Waterlogging resistance haplotype A): GAAGGTCGGAGTCAACGGATTAACGTCTGAAGTGGAAGGGT and qWTCKNR3.2 R2 (Water-sensitive haplotype G): GAAGGTGACCAAGTTCATGCTAACGTCTGAAGTGGAAGGGC.

[0018] The above-described applications, the aforementioned yield and waterlogging tolerance traits include row-to-grain waterlogging tolerance coefficient, root-to-waterlogging tolerance coefficient, yield traits, and / or root biomass.

[0019] A method for screening and breeding maize for waterlogging tolerance, comprising detecting base 218456862 on chromosome 3 of the maize genome using conventional methods in the art, including but not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

[0020] The reference genome of maize used in this invention is Zm-B73-REFERENCE-NAM-5.0.

[0021] Compared with the prior art, the present invention has the following advantages: This invention provides the first fine mapping of a novel major QTL controlling row and kernel number tolerance coefficient in maize based on genome-wide association analysis. The major QTL is located on chromosome 3, which contains six significant SNP loci with a total length of 14.18 kb (Chr3: 218442678-218456862). All of these loci are major QTL loci controlling variations in the tolerance phenotype. The closely linked superior haplotype SNP marker is located at nucleotide 218456862 on chromosome 3 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), explaining 14.53% of the row and kernel number tolerance coefficient phenotype. The PARMS marker developed based on its optimal allele can be used for marker-assisted selection breeding.

[0022] The applicant verified the row-grain-number waterlogging resistance phenotype of 567 maize inbred lines. qWTCKNR3.2 The superior haplotype can increase the row number of grains tolerance coefficient by 55.88% in natural populations, and also has a good selection effect on traits such as plant height, ear position, number of tassel branches, tassel main axis length, leaf length, number of rows per ear, ear weight, and single ear grain weight under waterlogging stress in maize. It has also been strongly selected in breeding practice. This superior haplotype provides genetic resources for the creation of waterlogging-tolerant maize lines. Attached Figure Description

[0023] Figure 1 Figure 1 shows a partial graph illustrating the yield and water resistance assessment of 567 inbred line materials. A represents corn ears that are resistant to waterlogging and yield, while B represents corn ears that are sensitive to waterlogging.

[0024] Figure 2 The distribution of the grain number and water stain resistance coefficient of the self-crossing line population.

[0025] Figure 3 for qWTCKNR3.2 Schematic diagram of site association analysis; qWTCKNR3.2 Association analysis of 13.2 million polymorphic sites with a minimum allele frequency greater than 0.05 with row number and waterlogging tolerance phenotypes in 567 different inbred lines, with each dot representing a polymorphic site.

[0026] Figure 4 A schematic diagram for the analysis of superior haplotype effects; A comparative analysis of the grain number and water stain resistance coefficients of 499 Hap1 inbred lines and 65 Hap2 inbred lines was conducted. Each box represents the median and interquartile range, extended to the maximum and minimum values. The significance of the differences was estimated by one-way ANOVA.

[0027] Figure 5 for qWTCKNR3.2 A schematic diagram of the evaluation of genetic effects on plant height, ear position, leaf length, number of tassel branches, and tassel main axis length; Scatter points represent the distribution of plant height, ear position, leaf length, number of tassel branches, and main axis length of tassels in a family. Each box represents the median and interquartile range, extended to the maximum and minimum values. Error bars represent SD. The significance of differences was estimated by one-way ANOVA.

[0028] Figure 6 for qWTCKNR3.2 A schematic diagram of the evaluation of genetic effects in the waterlogging tolerance coefficients of panicle row number, panicle weight, and single panicle grain weight; Scatter plots represent the distribution of waterlogging tolerance coefficients for family ear row number, ear weight, and single ear grain weight. Each box represents the median and interquartile range, extended to the maximum and minimum values. Error bars represent SD. The significance of differences was estimated by one-way ANOVA.

[0029] Figure 7 for qWTCKNR3.2 Schematic diagram of the development and utilization of optimal haplotype functional markers; In the image: Green: qWTCKNR3.2 This type of family has strong resistance to waterlogging; blue: qwtcknr3.2 Types and lineages with weak resistance to waterlogging; Red: hybrid material. Detailed Implementation

[0030] Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials described are all publicly available.

[0031] The reference genome for maize in this invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB GenomeCenter). Example 1:

[0032] Corn yield and waterlogging resistance QTL qWTCKNR3.2 Obtaining: 1. Materials and Methods 1.1 Materials A total of 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.

[0033] 1.2 Experimental Methods 1.2.1 Phenotypic Identification 567 related population materials were planted at the experimental base of Gucheng Agricultural Research Institute, Xiangyang City, Hubei Province. The experiment included a flooding treatment and a normal irrigation control: the flooding treatment was replicated three times, and the control was replicated twice. During the spikelet differentiation stage (V7-V8), the treatment group was subjected to waterlogging stress, with the water level maintained 10 cm above the soil surface, completely submerging the plant's growing point, for 7 days. After the treatment, routine field management was resumed until maturity. After harvest, yield-related traits such as spike diameter (cm), spike length (cm), number of rows per spike, number of grains per row, spike weight (g), grain weight per spike (g), and 100-grain weight (g) were measured, and the waterlogging tolerance coefficient for each trait was calculated.

[0034] 1.2.1 Genome-wide association analysis of the row grain number and waterlogging tolerance coefficient loci For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. This clean data was then aligned to a reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. BWA software was used to align PE reads with the B73 reference genome sequence, obtaining alignment results in AM format. The SAM format file was then converted to BAM format using samtools. Next, the reads in the BAM file were sorted using the SortSam tool in Picard, and PCR duplicates were removed to obtain the final BAM file suitable for variant calling. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Q and K were calculated using STRUCTURE and TESSEL 5.0 software, respectively. P After the value is corrected, we will P =1.0×10 -5 As a threshold for the significance of GWAS results.

[0035] 1.2.2 Development of optimal haplotype molecular markers Based on the B73 genome, combined with qWTCKNR3.2 Based on the differentially expressed site information provided by sequencing, specific primers were designed, and PARMS detection technology was used. The adapter sequence that matches FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence that matches HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0036] 1.2.3 Genotype Analysis Small-scale DNA extraction from maize was performed using the CTAB (Cetyltrimethyl Ammonium Bromide) method (Saghai-Maroof et al 1984), followed by PARMS SNP detection.

[0037] 2. Results and Analysis 2.1 Evaluation of the waterlogging resistance of 567 inbred lines Waterlogging stress significantly suppressed maize yield-related traits. Except for ear diameter, the mean values ​​of the other six traits showed highly significant differences between waterlogged and normal conditions (P < 0.01), with reductions ranging from 11.64% to 42.52%. Among these, single ear grain weight was the most severely suppressed, with a reduction of 42.52%, followed by ear weight (41.46%) and number of kernels per row (36.58%). In terms of waterlogging tolerance coefficient (WTC), single ear grain weight, ear weight, and number of kernels per row had the lowest coefficients, at 0.57, 0.59, and 0.64, respectively (Table 1), indicating that they are relatively sensitive to flooding stress and can serve as core phenotypic indicators for waterlogging tolerance genetic research.

[0038] The population was divided into 6 levels according to the row number stain resistance coefficient. Among them, there were 105 inbred lines with a row number stain resistance coefficient greater than 0.8, 63 inbred lines with a row number stain resistance coefficient less than 0.4, and 384 inbred lines with a row number stain resistance coefficient between 0.4 and 0.8. Figure 2 ).

[0039] Table 1. Evaluation of the waterlogging tolerance of inbred line populations .

[0040] WT represents the waterlogged treatment group, CK represents the normal growth group, and T-test two-way ANOVA is used for significance testing.

[0041] 2.2 Row Particle Number Waterlogging Resistance Coefficient Gene Locus qWTCKNR3.2 Identification and genetic effect analysis This application identifies a novel major QTL controlling row kernel number and waterlogging tolerance in maize based on genome-wide association analysis. This major QTL is located on chromosome 3, and the region contains six significant SNP loci with a total length of 14.18 kb (Chr3: 218442678-218456862). It is named... qWTCKNR3.2 ( Figure 3 ).

[0042] qWTCKNR3.2 locus leadSNP 218456862(A / G) A significant association was found at P = 1.84E-07, located at base 218456862 on chromosome 3 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as maize B73V5 reference genome), explaining 14.53% of the phenotypic contribution of row-grain-tolerance coefficient.

[0043] PARMS primers were designed for the above SNP sites as follows: (1) Targeting and qWTCKNR3.2Closely linked peak SNPs are labeled with leadSNPs. 218456862(A / G) The sequence of 200 bp upstream and downstream of position 218456862 on chromosome 3 of the maize B73V5 reference genome was extracted. The PARMS marker detection primer sequences were obtained according to primer design principles as follows: qWTCKNR3.2 F :GCTCCTACAGACTACGTCCT, as shown in SEQ ID NO.3; qWTCKNR3.2 R1 : GAAGGTCGGAGTCAACGGATT AACGTCTGAAGTGGAAGGGT, as shown in SEQ ID NO.4; qWTCKNR3.2 R2 : GAAGGTGACCAAGTTCATGCT AACGTCTGAAGTGGAAGGGC, as shown in SEQ ID NO.5; The underlined part of the reverse primer is the fluorescent adapter sequence.

[0044] (2) Using the genomic DNA of the maize inbred line population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the genotype was converted.

[0045] Using the primers described above, the sequence amplified in the stain-resistant material H70492 (parent of Handan 777) is: GCTCCTACAGACTACGTCCTACCATTCTGTCTACC A CCCTTCCACTTCAGACGTT, as shown in SEQ ID NO.1; The sequence amplified in the stain-sensitive material Zong31 (parent parent of Nongda 3138) is: GCTCTACAGACTACGTCCTACCATTCTGTCTACC G CCCTTCCACTTCAGACGTT, as shown in SEQ ID NO.2.

[0046] Amplification system: .

[0047] Amplification parameters: .

[0048] According to SNP 218456862(A / G) The 567 maize inbred lines were divided into two haplotypes and named as follows: Hap1 and Hap2 The samples were divided into two groups for comparative analysis of the differences in the stain resistance coefficient of the row number between the two haplotypes. Among them, 499 self-crossing lines were SNPs. 218456862(A / A) Or calledHap1 Alleles, 65 materials were SNPs 218456862(G / G) Or called Hap2 Allele type, other heterozygous sites are filtered out and not included, relative to Hap2 Haplotype, Hap1 The average increase in the row number and stain resistance coefficient of haploid self-crossing materials was 55.88%. p =5.13E-20, Figure 4 ),therefore Hap1 for qWTCKNR3.2 Superior haplotypes accounted for 88.47%, indicating that breeders indirectly selected superior haplotypes during the breeding process. qWTCKNR3.2 The superior haplotype Hap1 also reflects, from another perspective, qWTCKNR3.2 Its value in the breeding process.

[0049] at the same time, qWTCKNR3.2 It is a pleiotropic gene locus, and its superior haplotype is observed under waterlogging stress. Hap1 It can significantly reduce plant height and ear position, relative to Hap2 Haplotype, Hap1 The average plant height of haploid inbred lines decreased by 9.96 cm. p =6.34E-04), the average ear position decreased by 13.69 cm ( p =2.39E-13), while significantly reducing leaf length, number of tassel branches, and tassel main axis length, relative to Hap2 Haplotypes, respectively reduced by 5.99 cm ( p =7.03E-12), 4.30 ( p =2.46E-15) and 3.63 cm ( p =4.17E-12)( Figure 5 Regarding yield-related traits, Hap1 The average increase in the number of panicle rows and the waterlogging resistance coefficient of haploid inbred lines was 0.03. p =0.019), the average increase in the ear weight waterlogging tolerance coefficient was 0.09 ( p =1.41E-03), the average increase in the single ear grain weight waterlogging resistance coefficient was 0.12 ( p =6.37E-05)( Figure 6 ). Example 2:

[0050] Corn yield and waterlogging resistance QTL qWTCKNR3.2 Applications of superior haplotype molecular marker primers: During a week of waterlogging at the two-leaf stage of 214 maize inbred lines, 12 families with a row-kernel number waterlogging tolerance coefficient greater than 0.6 and 12 families with a row-kernel number waterlogging tolerance coefficient less than 0.4 were randomly selected. Eight plants from each family were pooled, DNA was extracted, and the F1 generation was tested using the methods described in Example 1. qWTCKNR3.2 Genotyping was performed using PARMS primers developed for optimal allele genotypes at specific loci. Results showed that families with a row grain number tolerance coefficient greater than 0.7 belonged to [the specific genotype]. Hap1 Of the 12 families with alleles and a row number tolerance coefficient of less than 0.4, 11 contained unfavorable alleles. Hap2 The remaining one and F1 were heterozygous (Table 2, [[ID= These results confirm that the developed functional markers can be used for molecular marker-assisted selection in the genetic improvement of waterlogging-resistant lines, providing selection targets for creating new waterlogging-resistant maize germplasm and breeding new waterlogging-resistant varieties.

[0051] Table 2 PARMS Markers ​ It can be used for stain resistance identification and evaluation. .

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The application of a reagent for detecting base position 218456862 on chromosome 3 of the maize genome in screening breeding for maize yield and waterlogging tolerance traits, characterized in that... If a homozygote is detected at position 218456862 of chromosome 3 of the maize genome with a base of A, the maize is determined to be a yield-tolerant maize; if a homozygote is detected at position 218456862 of chromosome 3 of the maize genome with a base of G, the maize is determined to be a yield-sensitive maize. The maize genome is Zm-B73-REFERENCE-NAM-5.

0.

2. The application of the reagent for detecting base 218456862 on chromosome 3 of the maize genome in the preparation of a screening kit for maize yield and waterlogging tolerance traits is characterized by: If a homozygote is detected at position 218456862 of chromosome 3 of the maize genome with a base of A, the maize is determined to be a yield-tolerant maize; if a homozygote is detected at position 218456862 of chromosome 3 of the maize genome with a base of G, the maize is determined to be a yield-sensitive maize. The maize genome is Zm-B73-REFERENCE-NAM-5.

0.

3. The application according to claim 1 or claim 2, characterized in that, The yield-resistant corn has a row-count grain-resistance coefficient greater than 0.6, while the yield-sensitive corn has a row-count grain-resistance coefficient less than 0.

4.

4. The application according to claim 1 or 2, characterized in that, The reagent mentioned is a primer.

5. The application according to claim 4, wherein the primer is: qWTCKNR3.2 F :GCTCCTACAGACTACGTCCT、 qWTCKNR3.2 R1 :GAAGGTCGGAGTCAACGGATTAACGTCTGAAGTGGAAGGGT and qWTCKNR3.2 R2 : GAAGGTGACCAAGTTCATGCTAACGTCTGAAGTGGAAGGGC.

6. A method for screening and breeding maize with yield tolerance to waterlogging, comprising detecting the 218456862nd base of the third chromosome of the maize genome, wherein the method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method. If a homozygote with base A at the 218456862nd base of the third chromosome of the maize genome is detected, the maize is determined to be yield-tolerant to waterlogging; if a homozygote with base G at the 218456862nd base of the third chromosome of the maize genome is detected, the maize is determined to be yield-sensitive to waterlogging. The maize genome is Zm-B73-REFERENCE-NAM-5.

0.

7. The application according to claim 1 or 2, or the method according to claim 6, wherein the yield waterlogging tolerance trait includes the row-to-grain waterlogging tolerance coefficient, the root-to-waterlogging tolerance coefficient, the yield trait, and / or the root biomass.

Images