Genetically engineered bacteria for producing zeaxanthin and construction method and application thereof

By modifying yeast strains, blocking the endogenous carotenoid synthesis pathway and introducing exogenous enzymes, combined with multi-compartment regulation, the shortcomings of existing technologies in zeaxanthin production have been overcome, achieving efficient and sustainable zeaxanthin production with high yield and low cost.

CN122303056APending Publication Date: 2026-06-30INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610331189.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-18
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In the current technology, the commercial source of zeaxanthin mainly relies on plant extraction, which has problems such as long planting cycle, large land resource occupation, and complex extraction process. Chemical synthesis method has low selectivity and heavy environmental burden, and lacks efficient and sustainable production methods.

Method used

By modifying the yeast recipient strain, blocking the endogenous carotenoid synthesis pathway, expressing exogenous enzymes targeting the cytoplasm and lipid droplets, overexpressing specific endogenous enzymes, and using Rhodotorula spp. yeast to synthesize zeaxanthin, combining cytoplasmic-lipid-endoplasmic reticulum multi-compartmental regulation and fusion proteins, enhancing the metabolic flux of the MVA pathway, and balancing the supply of cofactor NADPH, the efficient production of zeaxanthin is achieved.

Benefits of technology

It achieves efficient production of zeaxanthin, with a fermentation yield of 103.4 mg/L, simplifies the fermentation process, reduces production costs, and has good potential for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a genetically engineered bacterium for producing zeaxanthin, its construction method, and its applications. This invention provides an engineered bacterium for producing zeaxanthin, which utilizes gene editing to block the complex endogenous carotenoid synthesis pathway in yeast, exogenously introducing the specific synthetic pathway of zeaxanthin. Through systems metabolic engineering regulation strategies, it enhances zeaxanthin synthesis, strengthens the metabolic flux of the MVA pathway, balances the supply of the cofactor NADPH, and balances lipid synthesis and zeaxanthin synthesis. The engineered bacterium of this invention achieves heterologous production of zeaxanthin and increases yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a genetically engineered bacterium that produces zeaxanthin, its construction method, and its application. Background Technology

[0002] Zeaxanthin, a naturally occurring oxygenated carotenoid (a type of lutein), chemically named 3,3'-dihydroxy-β-carotene, has a central conjugated polyene chain and hydroxyl-functionalized β-ionone rings at both ends. This unique structure endows it with outstanding biological activity, demonstrating irreplaceable value, especially in the fields of human health and nutrition. In the human body, zeaxanthin and lutein selectively accumulate in the macular region of the retina, forming the core components of "macular pigment." Studies have shown that zeaxanthin can protect photoreceptor cells from oxidative stress by quenching singlet oxygen and scavenging free radicals; simultaneously, its molecules exhibit a specific orientation in the cell membrane, helping to stabilize membrane structure, regulate membrane fluidity, and signal transduction. Furthermore, emerging research suggests that zeaxanthin also has potential in cognitive health, skin photoprotection, and immune regulation.

[0003] Currently, commercially available zeaxanthin is mainly derived from plant extracts such as marigolds. This approach is limited by problems such as long planting cycles, large land resource requirements, and complex extraction processes. Chemical synthesis methods have low configuration selectivity and a heavy environmental burden. Therefore, developing efficient, sustainable, and specific alternative production methods for optically pure natural zeaxanthin has become a key focus of industry and scientific research.

[0004] Microbial synthesis is a promising solution. Eukaryotic microorganisms such as yeast, as cell factories, have natural advantages over prokaryotic systems. They possess complete eukaryotic organelles such as the endoplasmic reticulum and lipid droplets, enabling them to more efficiently complete membrane-bound enzyme reactions, substrate transport, and intracellular product storage involved in the carotenoid synthesis pathway. Unconventional yeasts—specifically, the genus *Rhodotorula* (…) Rhododendron Yeasts typically have the ability to efficiently utilize the C5 / C6 mixed sugars in lignocellulose hydrolysates and tolerate the toxic byproducts therein. Crabtree-negative yeasts avoid carbon loss during ethanol fermentation, exhibit high cell density fermentation characteristics and good environmental robustness, making them suitable for industrial-scale fermentation production.

[0005] The host's comprehensive multi-omics database and metabolic network model provide a precise design foundation for rational metabolic engineering. Its endogenous supply of acetyl-CoA and NADPH is naturally used to synthesize carotenoids and lipids, providing an ideal precursor and reducing power supply platform for constructing or enhancing exogenous terpene synthesis pathways such as zeaxanthin. Summary of the Invention

[0006] The purpose of this invention is to provide a genetically engineered bacterium for producing zeaxanthin, its construction method, and its application.

[0007] In a first aspect, the present invention claims protection for an engineered bacterium used to produce zeaxanthin.

[0008] The engineered bacteria for producing zeaxanthin claimed in this invention are obtained by modifying yeast recipient bacteria as shown in (A1)-(A3) below:

[0009] (A1) Blocking the endogenous carotenoid synthesis pathway; (A2) Express the following three exogenous enzymes that target the cytoplasm: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytopene synthase CarB; (A3) Overexpress one or more of the following endogenous enzymes: ATP-citrate lyase ACL, acetyl-CoA acyltransferase ACCT, hydroxymethylglutaryl-CoA reductase HMGR, isoprenyl pyrophosphate isomerase IDI, geranyl geranyl pyrophosphate synthase GGPPS, glucose-6-phosphate dehydrogenase ZWF1.

[0010] In (A1), the blocking of the endogenous carotenoid synthesis pathway can be achieved by inhibiting the activity of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB, including but not limited to knocking out, knocking down or functionally inactivating the target gene.

[0011] In some embodiments of the present invention, the blocking of the endogenous carotenoid synthesis pathway described in (A1) is achieved by knocking out the encoding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB.

[0012] Furthermore, the modification may also include the following (A4) in addition to the above (A1)-(A3): (A4) expresses one or more of the following exogenous enzymes: acetyl-CoA synthase NphT7, hydroxymethylglutaryl-CoA reductase MvaE, hydroxymethylglutaryl-CoA synthase MvaS, mevalonate kinase MK, and glyceraldehyde-3-phosphate dehydrogenase GAPDH.

[0013] Furthermore, the modification, based on the above (A1)-(A4), may also include the following (A5): (A5) Express the following three exogenous enzymes that target lipid droplets: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytolycopene synthase CarB.

[0014] Furthermore, the modification, in addition to the above (A1)-(A5), may also include the following (A6): (A6) Express the following three exogenous enzymes that target the endoplasmic reticulum: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytorepinephrine synthase CarB.

[0015] Furthermore, the modification, based on the above (A1)-(A6), may also include the following (A7): (A7) Knock out the gene encoding endogenous perilipin protein LDP1.

[0016] In some embodiments of the present invention, the engineered bacteria are any of the following: (B1) Engineered strain 1 (corresponding to strain Zea2 in the examples); the engineered strain 1 is a strain obtained by knocking out the encoding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB in the yeast recipient strain and introducing the following five genes: derived from Pantotheca pineapple ( Pineapple Pantoea The gene encoding β-carotene hydroxylase CrtZ, derived from Arabidopsis thaliana ( Arabidopsis thaliana The gene encoding lycopene β-cyclase LCYB, derived from Pantotheca pineapple (… Pineapple Pantoea The gene encoding phytoene synthase CarB, the gene encoding endogenous hydroxymethylglutaryl-CoA reductase HMGR in the yeast recipient bacteria, and the gene encoding endogenous geranyl-geranyl pyrophosphate synthase GGPPS in the yeast recipient bacteria.

[0017] (B2) Engineered strain 2 (corresponding to strain Zea3 in the embodiment); the engineered strain 2 is a strain obtained by introducing the following six genes into engineered strain 1 (corresponding to strain Zea2 in the embodiment): derived from Enterococcus faecalis ( Enterococcus faecalis The gene encoding hydroxymethylglutaryl-CoA synthase MvaS, derived from *Methanococcus martensii* ( Methanosarcina mazei The fusion gene formed by fusing the DNA encoding the mevalonate kinase MK, the DNA encoding the endogenous isoprene pyrophosphate isomerase IDI, the DNA encoding the endogenous acetyl-CoA acyltransferase ACCT, and the DNA encoding the polypeptide tag RIDD (named ACCT-RIDD gene), and the DNA encoding the endogenous ATP-citrate lyase ACL and the DNA encoding the polypeptide tag RIAD (named ACL-RIAD gene), derived from Streptomyces (… Streptomyces The fusion gene (named NphT7-RIDD gene) is formed by fusing the gene encoding acetyl-CoA synthase NphT7 (sp.) and the DNA encoding the polypeptide tag RIDD.

[0018] (B3) Engineered strain 3 (corresponding to strain Zea4 in the examples); the engineered strain 3 is the strain obtained by introducing the following three fusion genes into engineered strain 2 (corresponding to strain Zea3 in the examples): Olesion-CrtZ, Olesion-LCYB, and Olesion-CarB; the Olesion-CrtZ is the DNA encoding the lipid droplet localization protein Oleosin and derived from Pantotheca pineapple ( Pineapple Pantoea The Olesion-LCYB is a fusion of the gene encoding β-carotene hydroxylase CrtZ from Arabidopsis thaliana; the Olesion-LCYB is composed of the DNA encoding the lipid droplet localization protein Oleosin and the DNA derived from Arabidopsis thaliana. Arabidopsis thalian Olesion-CarB is a fusion of the lycopene β-cyclase LCYB gene and the DNA encoding the lipid droplet localization protein Oleosin. Pineapple Pantoea It is formed by fusing the gene encoding phytoene synthase CarB with phytoene.

[0019] (B4) Engineered strain 4 (corresponding to strain Zea5 in the embodiments); the engineered strain 3 is the strain obtained by introducing the following three fusion genes into engineered strain 3 (corresponding to strain Zea4 in the embodiments): CarB-KDEL, LCYB-KDEL, and CrtZ-KDEL; the CarB-KDEL is derived from Pantotheca pineapple (… Pineapple Pantoea The LCYB-KDEL is a fusion of the gene encoding phytoene synthase CarB and the DNA encoding the endoplasmic reticulum localization peptide KDEL; the LCYB-KDEL is derived from Arabidopsis thaliana ( Arabidopsis thaliana The CrtZ-KDEL is formed by fusing the gene encoding lycopene β-cyclase LCYB from Pantoea ananatis with the DNA encoding the short peptide KDEL located in the endoplasmic reticulum; the CrtZ-KDEL is formed by fusing the gene encoding β-carotene hydroxylase CrtZ from Pantoea ananatis with the DNA encoding the short peptide KDEL located in the endoplasmic reticulum.

[0020] (B5) Engineered strain 5 (corresponding to strain Zea6 in the embodiment); the engineered strain 5 is the strain obtained by introducing the following three fusion genes into engineered strain 3 (corresponding to strain Zea4 in the embodiment): GAPDH-CarB-KDEL, LCYB-KDEL, ZWF1-CrtZ-KDEL; the GAPDH-CarB-KDEL is derived from Clostridium difficile ( Clostridium The gene encoding glyceraldehyde-3-phosphate dehydrogenase GAPDH, derived from *Panthera pineapple* sp. Pantoea pineappleThe LCYB-KDEL is a fusion of the gene encoding phytoene synthase CarB and the DNA encoding the endoplasmic reticulum localization peptide KDEL; the LCYB-KDEL is derived from Arabidopsis thaliana ( Arabidopsis thaliana The gene encoding lycopene β-cyclase LCYB and the DNA encoding the endoplasmic reticulum localized short peptide KDEL are fused together; ZWF1-CrtZ-KDEL is derived from the gene encoding glucose-6-phosphate dehydrogenase ZWF1, an endogenous glucose-6-phosphate dehydrogenase from the yeast recipient strain, and is derived from *Pancreatoblastus pineapple*. Pantoea pineapple It is formed by fusing the gene encoding β-carotene hydroxylase CrtZ with the DNA encoding the endoplasmic reticulum localization peptide KDEL.

[0021] (B6) Engineered strain 6 (corresponding to strain Zea7 in the examples); the engineered strain 6 is the strain obtained by knocking out the coding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB and the coding gene of periplasmin protein LDP1 in the yeast recipient strain, and introducing the five genes in (B1), the six genes in (B2), the three fusion genes in (B3) and the three fusion genes in (B5).

[0022] Furthermore, the fungus derived from Pantothecin pineapple ( Pineapple Pantoea The amino acid sequence of β-carotene hydroxylase CrtZ is shown in SEQ ID NO:1.

[0023] Furthermore, the substance derived from Arabidopsis thaliana ( Arabidopsis thaliana The amino acid sequence of lycopene β-cyclase LCYB is shown in SEQ ID NO:2.

[0024] Furthermore, the fungus derived from Pantothecin pineapple ( Pineapple Pantoea The amino acid sequence of phytoene synthase CarB is shown in SEQ ID NO:3.

[0025] Furthermore, the strain derived from Streptomyces ( Streptomyces The amino acid sequence of acetyl-CoA synthase NphT7 (sp.) is shown in SEQ ID NO:4.

[0026] Furthermore, the bacteria derived from Enterococcus faecalis ( Enterococcus faecalis The amino acid sequence of hydroxymethylglutaryl-CoA synthase MvaS is shown in SEQ ID NO:5.

[0027] Furthermore, the bacteria derived from *Methanococcus martensii* (… Methanosarcina mazei The amino acid sequence of mevalonate kinase MK is shown in SEQ ID NO:6.

[0028] Furthermore, the amino acid sequence of the polypeptide tag RIDD is shown in SEQ ID NO:7.

[0029] Furthermore, the amino acid sequence of the polypeptide tag RIAD is shown in SEQ ID NO:8.

[0030] Furthermore, the amino acid sequence of the lipid droplet localization protein Oleosin is shown in SEQ ID NO:9.

[0031] Furthermore, the amino acid sequence of the endoplasmic reticulum localized short peptide KDEL is shown in SEQ ID NO:10.

[0032] Furthermore, the bacteria derived from Clostridium difficile ( Clostridium The amino acid sequence of glyceraldehyde-3-phosphate dehydrogenase GAPDH (sp.) is shown in SEQ ID NO:11.

[0033] Furthermore, the amino acid sequence of the endogenous hydroxymethylglutaryl-CoA reductase HMGR in the yeast recipient strain can be found in NCBI Reference Sequence: XP_016270872.1 (updated on 02-JAN-2024).

[0034] Furthermore, the amino acid sequence of the endogenous gerany gerany pyrophosphate synthase GGPPS of the yeast recipient strain can be found in GenBank: KAK4332297.1 (updated 21-DEC-2023).

[0035] Furthermore, the amino acid sequence of the endogenous isoprenyl pyrophosphate isomerase IDI of the yeast recipient bacteria can be found in NCBI Reference Sequence: XP_016270310.1 (updated on 02-JAN-2024).

[0036] Furthermore, the amino acid sequence of the endogenous acetyl-CoA acyltransferase ACCT in the yeast recipient bacteria can be found in NCBI Reference Sequence: XP_016276291.1 (updated on 02-JAN-2024).

[0037] Furthermore, the amino acid sequence of the endogenous ATP-citrate lyase ACL in the yeast recipient bacteria is available in GenBank: GEM10069.1 (updated 20-JUL-2019).

[0038] Furthermore, the amino acid sequence of the endogenous glucose-6-phosphate dehydrogenase ZWF1 in the yeast recipient strain is available in GenBank: KAJ8292682.1 (updated 12-APR-2023).

[0039] Furthermore, the fungus derived from Pantothecin pineapple ( Pineapple Pantoea The gene sequence encoding β-carotene hydroxylase CrtZ is shown in positions 1001-1525 of SEQ ID NO:13.

[0040] Furthermore, the substance derived from Arabidopsis thaliana ( Arabidopsis thaliana The gene sequence encoding lycopene β-cyclase LCYB is shown in positions 1592-2950 of SEQ ID NO:13.

[0041] Furthermore, the fungus derived from Pantothecin pineapple ( Pineapple Pantoea The gene sequence encoding phytoene synthase CarB is shown in positions 3017-3946 of SEQ ID NO:13.

[0042] Furthermore, the strain derived from Streptomyces ( Streptomyces The gene sequence encoding acetyl-CoA synthase NphT7 (sp.) is shown at positions 6974-7960 of SEQ ID NO:15.

[0043] Furthermore, the bacteria derived from Enterococcus faecalis ( Enterococcus faecalis The gene sequence encoding hydroxymethylglutaryl-CoA synthase MvaS is shown in positions 1001-2149 of SEQ ID NO:14.

[0044] Furthermore, the bacteria derived from *Methanococcus martensii* (… Methanosarcina mazei The gene sequence encoding mevalonate kinase MK is shown in positions 2213-3115 of SEQ ID NO:14.

[0045] Furthermore, the DNA encoding the polypeptide tag RIDD is shown in positions 3077-3274 of SEQ ID NO:15.

[0046] Furthermore, the DNA encoding the polypeptide tag RIAD is shown at positions 6803-6910 of SEQ ID NO:15.

[0047] Furthermore, the DNA encoding the lipid droplet localization protein Oleosin is shown in positions 1001-1558 of SEQ ID NO:16.

[0048] Furthermore, the DNA encoding the endoplasmic reticulum localization short peptide KDEL is shown at positions 1934-1945 of SEQ ID NO:17.

[0049] Furthermore, the bacteria derived from Clostridium difficile ( ClostridiumThe gene sequence encoding glyceraldehyde-3-phosphate dehydrogenase GAPDH (sp.) is shown in positions 1001-2446 of SEQ ID NO:20.

[0050] Furthermore, the gene sequence encoding the endogenous hydroxymethylglutaryl-CoA reductase HMGR of the yeast recipient bacteria is shown in positions 1001-2554 of SEQ ID NO:12.

[0051] Furthermore, the gene sequence encoding the endogenous gerany gerany pyrophosphate synthase GGPPS of the yeast recipient strain is shown at positions 2621-3700 of SEQ ID NO:12.

[0052] Furthermore, the gene sequence encoding the endogenous isoprenyl pyrophosphate isomerase IDI of the yeast recipient bacteria is shown at positions 3182-3940 of SEQ ID NO:14.

[0053] Furthermore, the gene sequence encoding the endogenous acetyl-CoA acyltransferase ACCT of the yeast recipient bacteria is shown in positions 1001-3076 of SEQ ID NO:15.

[0054] Furthermore, the gene sequence encoding the endogenous ATP-citrate lyase ACL in the yeast recipient bacteria is shown at positions 3332-6802 of SEQ ID NO:15.

[0055] Furthermore, the gene sequence encoding the endogenous glucose-6-phosphate dehydrogenase ZWF1 in the yeast recipient bacteria is shown in positions 1001-2551 of SEQ ID NO:21.

[0056] Furthermore, the sequence of the gene encoding the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB in the yeast recipient strain that was knocked out in (B1) is shown in SEQ ID NO:22; the sequence of the gene encoding the periplasmin protein LDP1 that was knocked out in (B6) is shown in SEQ ID NO:24.

[0057] Furthermore, the nucleotide sequence of the ACCT-RIDD gene is shown in positions 1001-3274 of SEQ ID NO:15; the nucleotide sequence of the ACL-RIAD gene is shown in positions 3332-6910 of SEQ ID NO:15; and the nucleotide sequence of the NphT7-RIDD gene is shown in positions 6974-8161 of SEQ ID NO:15.

[0058] Furthermore, the nucleotide sequence of Olesion-CrtZ is shown in positions 1001-2083 of SEQ ID NO:16; the nucleotide sequence of Olesion-LCYB is shown in positions 2150-4066 of SEQ ID NO:16; and the nucleotide sequence of Olesion-CarB is shown in positions 4133-5620 of SEQ ID NO:16.

[0059] Furthermore, the nucleotide sequence of CarB-KDEL is shown in positions 1007-1945 of SEQ ID NO:17; the nucleotide sequence of LCYB-KDEL is shown in positions 1414-2784 of SEQ ID NO:18; and the nucleotide sequence of CrtZ-KDEL is shown in positions 1007-1543 of SEQ ID NO:19.

[0060] Furthermore, the nucleotide sequence of GAPDH-CarB-KDEL is shown in positions 1001-3442 of SEQ ID NO:20; and the nucleotide sequence of ZWF1-CrtZ-KDEL is shown in positions 1001-3155 of SEQ ID NO:21.

[0061] In some embodiments of the present invention, in (B1), the gene encoding the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB in the yeast recipient strain is knocked out by CRISPR-Cas9 technology, and the target sequence is SEQ ID NO:23.

[0062] In some embodiments of the present invention, when the five genes are introduced into the yeast recipient strain, the encoding genes for endogenous hydroxymethylglutaryl-CoA reductase HMGR and endogenous geranyl-geranyl pyrophosphate synthase GGPPS from the yeast recipient strain are present in expression cassette 1 (pENO1-HMGR-GGPPS-tHSP), which is derived from Pantotheca pineapple (…). Pineapple Pantoea The gene encoding β-carotene hydroxylase CrtZ, which is derived from Arabidopsis thaliana ( Arabidopsis thaliana The gene encoding lycopene β-cyclase LCYB from *Panthera pineapple* (…) and the gene from *Panthera pineapple* (…) Pineapple PantoeaThe gene encoding phytopenic oleoresin synthase CarB is located in expression cassette 2 (pENO1-CrtZ-LCYB-CarB-tHSP). Specifically, the nucleotide sequence of expression cassette 1 is shown in SEQ ID NO:12, and the nucleotide sequence of expression cassette 2 is shown in SEQ ID NO:13. More specifically, when the five genes are introduced into the yeast recipient strain, expression cassette 1 and expression cassette 2 are integrated into the same recombinant vector (pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP recombinant plasmid) and introduced in the form of this recombinant vector.

[0063] In some embodiments of the present invention, in (B2), when the six genes are introduced into the engineered strain 1 (corresponding to strain Zea2 in the embodiment), the genes derived from Enterococcus faecalis ( Enterococcus faecalis The gene encoding hydroxymethylglutaryl-CoA synthase MvaS, derived from *Methanococcus masculinus* (… Methanosarcina maze The gene encoding mevalonate kinase MK and the gene encoding isoprenyl pyrophosphate isomerase IDI, both endogenous in the yeast recipient strain, are present in expression cassette 3 (pENO1-MvaS-MK-IDI-tHSP). A fusion gene is formed by fusing the gene encoding acetyl-CoA acyltransferase ACCT, endogenous in the yeast recipient strain, and the gene encoding RIDD (a polypeptide tag). A fusion gene is also formed by fusing the gene encoding ATP-citrate lyase ACL, endogenous in the yeast recipient strain, and the gene encoding RIAD (a polypeptide tag). The gene originating from Streptomyces (… Streptomyces A fusion gene, consisting of the gene encoding acetyl-CoA synthase NphT7 (sp.) and the DNA encoding the polypeptide tag RIDD, is present in expression cassette 4 (pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP). Specifically, the nucleotide sequence of expression cassette 3 is shown in SEQ ID NO:14, and the nucleotide sequence of expression cassette 4 is shown in SEQ ID NO:15. More specifically, when the six genes are introduced into the engineered strain 1, expression cassette 3 and expression cassette 4 are integrated into the same recombinant vector (pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP recombinant plasmid) and introduced in the form of this recombinant vector.

[0064] In some embodiments of the present invention, when the three fusion genes are introduced into the engineered strain 2 (corresponding to strain Zea3 in the embodiments) in (B3), the Olesion-CrtZ, Olesion-LCYB, and Olesion-CarB are present in expression cassette 5 (pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP). Specifically, the nucleotide sequence of expression cassette 5 is shown in SEQ ID NO:16. More specifically, when the three fusion genes are introduced into the engineered strain 2, expression cassette 5 is introduced in the form of a recombinant vector (pZPK-G418-pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP recombinant plasmid).

[0065] In some embodiments of the present invention, when the three fusion genes are introduced into the engineered strain 3 (corresponding to strain Zea4 in the embodiments) in (B4), CarB-KDEL is present in expression cassette 6 (pENO1-CarB-KDEL-tHSP), LCYB-KDEL is present in expression cassette 7 (pGPD-NAT-LCYB-KDEL-Tnos), and CrtZ-KDEL is present in expression cassette 8 (pENO1-CrtZ-KDEL-tHSP). Specifically, the nucleotide sequence of expression cassette 6 is shown in SEQ ID NO:17, the nucleotide sequence of expression cassette 7 is shown in SEQ ID NO:18, and the nucleotide sequence of expression cassette 8 is shown in SEQ ID NO:19. Furthermore, when the three fusion genes are introduced into the engineered strain 3, the expression cassette 6, the expression cassette 7, and the expression cassette 8 are integrated into the same recombinant vector (pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP[LZ2 recombinant plasmid)) and introduced in the form of this recombinant vector.

[0066] In some embodiments of the present invention, when introducing each gene into the engineered strain 3 (corresponding to strain Zea4 in the embodiment) in (B5), the GAPDH-CarB-KDEL is present in expression cassette 9 (pENO1-GAPDH-CarB-KDEL-tHSP), the LCYB-KDEL is present in expression cassette 10 (pGPD-NAT-LCYB-KDEL-Tnos), and the ZWF1-CrtZ-KDEL is present in expression cassette 11 (pENO1-ZWF1-CrtZ-KDEL-tHSP). Specifically, the nucleotide sequence of expression cassette 9 is shown in SEQ ID NO:20, the nucleotide sequence of expression cassette 10 is shown in SEQ ID NO:18, and the nucleotide sequence of expression cassette 11 is shown in SEQ ID NO:21. Furthermore, when the above-mentioned genes are introduced into the engineered strain 3, the expression cassette 9, the expression cassette 10 and the expression cassette 11 are integrated into the same recombinant vector (pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP recombinant plasmid) and introduced in the form of this recombinant vector.

[0067] In some embodiments of the present invention, in (B6), the gene encoding the periplasmin-like protein LDP1 is knocked out using CRISPR-Cas9 technology, with the target sequence being SEQ ID NO:25.

[0068] Furthermore, the yeast recipient strain is Rhodotorula rubra.

[0069] Furthermore, the red yeast may be selected from any of the following: Rhodotorula glutinis (Rhodotorula glutinis) R. toruloides ), sticky red yeast ( R. glutinosa ), red yeast ( R. mucilaginosa ), Heben Red Yeast ( R. graminis ), dark red yeast ( Red rose ), lactose red yeast ( R. lactosa ), spherical red yeast ( R. sphaerocarpum ), marine red yeast ( R. marina ), slender fruit red yeast ( R. acheniorum ) and Bogor red yeast ( R. bogoriensis ).

[0070] In some embodiments of the present invention, the yeast recipient strain is *Rhodotorula buergerianum* (…). Rhodosporidium round-shaped NP11.

[0071] Secondly, the present invention claims a method for constructing the engineered bacteria described in the first aspect above.

[0072] The method for constructing the engineered bacteria described in the first aspect of the preceding text, as claimed in this invention, may include the modification of the yeast recipient bacteria described in the first aspect of the preceding text, thereby obtaining the engineered bacteria.

[0073] Thirdly, the present invention claims protection for the use of the engineered bacteria described in the first aspect above in any of the following: (C1) Production of zeaxanthin; (C2) Prepare products containing zeaxanthin; (C3) Increase the yield of maize xanthine.

[0074] Fourthly, the present invention claims a method for producing zeaxanthin.

[0075] The method for producing zeaxanthin claimed in this invention may include the following steps: fermenting and culturing the engineered bacteria described in the first aspect above, and obtaining zeaxanthin from the fermentation product.

[0076] Furthermore, when fermenting the engineered bacteria, the carbon-nitrogen ratio in the culture system is (8-120):1, such as (30-120):1, or (60-120):1, specifically 60:1.

[0077] The term "carbon-nitrogen ratio" refers to the ratio of the total mass of available carbon to the total mass of available nitrogen in a culture medium.

[0078] Furthermore, in the method, the fermentation conditions can be 18-32℃ (e.g., 28-30℃) and cultured at 180 rpm for 60-120 h.

[0079] Furthermore, in the method, the culture medium for the fermentation culture is a nitrogen-limiting (NL) medium, the solvent is water, and the solutes and concentrations are: glucose 20 g / L, yeast extract 0.5 g / L, NH4Cl 0.33 g / L, MgSO4·7H2O 1.5 g / L, KH2PO4 1 g / L, Na2HPO4·12H2O 1 g / L, pH 6.0 (corresponding to a carbon-nitrogen ratio of 60:1).

[0080] This invention is based on R. toruloidesUsing the host bacterium, we first used gene editing to block the complex endogenous carotenoid synthesis pathway in yeast, and then introduced a specific synthesis pathway for zeaxanthin exogenously. Through systems metabolic engineering regulation strategies, we enhanced the synthesis of zeaxanthin, such as spatial regulation (co-production in multiple compartments of cytoplasm-lipid droplets-endoplasmic reticulum, application of fusion proteins and RIDD-RIAD scaffold proteins), enhanced metabolic flux of the MVA pathway, balanced the supply of cofactor NADPH, balanced lipid synthesis and zeaxanthin synthesis (weakening lipid synthesis), and increased the yield of zeaxanthin.

[0081] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following aspects: 1) The application of the genetically engineered strain for producing zeaxanthin provided by this invention is the first to obtain a zeaxanthin engineered strain in *Rhizopus circinus* using a multi-layered regulation method involving cytoplasm, lipid droplets, and endoplasmic reticulum. This achieves heterologous production of the target product in multiple compartments, requiring fewer genetic operations that are simple, efficient, and have a short strain modification cycle. 2) The zeaxanthin engineered strain provided by this invention exhibits stable heterologous gene expression, requires no antibiotics or inducers during fermentation, reduces production costs, and features a simple, controllable, and economically viable fermentation process. 3) The zeaxanthin engineered strain provided by this invention, using glucose as a substrate, achieves a yield of 103.4 mg / L after 120 h of shake-flask fermentation, demonstrating good potential for industrial application. Attached Figure Description

[0082] Figure 1 This is a schematic diagram of the de novo synthesis pathway of zeaxanthin in this invention.

[0083] Figure 2 The identification results are for the engineered strain ΔCAR-NP11.

[0084] Figure 3 The plasmid map of the recombinant plasmid pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP.

[0085] Figure 4 The plasmid map of the recombinant plasmid pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP.

[0086] Figure 5 The plasmid map of the recombinant plasmid pZPK-G418-pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP.

[0087] Figure 6The plasmid map of the recombinant plasmid pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP.

[0088] Figure 7 The plasmid map of the recombinant plasmid pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP.

[0089] Figure 8 The identification results for the engineered strain ΔCAR-ΔLDP1-NP11.

[0090] Figure 9 This is a bar chart showing the yield of engineered maize xanthine strains. Detailed Implementation

[0091] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0093] The following examples use Rhodotorula buergerianum (Rhodotorula buergerianum) R. toruloides NP11: It is described in the article “Lin X,Wang Y, Zhang S, et al. Functional integration of multiple genes into the genome of the oleaginous yeast Rhodosporidium toruloides. Fems YeastResearch, 2014(4): 547-555.” and is available to the public from the applicant for use in reproducing the experiments of this invention.

[0094] The plasmids PZPK-pPGK-HYG-Tnos, PZPK-pGPD-NAT-Tnos, and PZPK-pPGK-BLE-Tnos used in the following examples are all described in the article “Xinping Lin, et al. Functional integration of multiple genes into the genome of the oleaginous yeast Rhodosporidiumtoruloides. FEMS Yeast Res. 2014 Jun;14(4):547-55..”, which are available to the public from the applicant.

[0095] In this invention, multiple genes expressed by plasmids are linked by self-cleaved 2A peptide sequences (P2A or T2A peptides); these 2A peptide sequences are located between open reading frames of adjacent genes, enabling monocistronic transcription of multiple genes and independent expression of multiple proteins. While the resistance selection markers for *Rhodotorula glutinis* in this invention are limited, resulting in a relatively large number of genes inserted into a single vector, good expression efficiency has been demonstrated.

[0096] This invention employs in-fusion cloning and restriction-free cloning methods for plasmid construction. The in-fusion cloning method is as follows: First, prepare the reaction system by adding the DNA fragment at a molar ratio of 1:2 to the vector, totaling 5 μl, along with 5 μl of MULassembly mix. The reaction program is 50 ℃ for 30 min. After the reaction, transform *E. coli*, extract the plasmid, and sequence it. The restriction-free cloning method is as follows: Design and synthesize a pair of heterozygous primers, each consisting of a 5' vector homologous sequence and a 3' target gene-specific sequence. Using DNA containing the target gene as a template, perform a first round of polymerase chain reaction (PCR) using high-fidelity DNA polymerase to amplify a double-stranded DNA fragment with homologous arms at both ends. Mix this fragment with a circular plasmid vector at a specific molar ratio, with an excess of the fragment. Using the mixture as a template, perform a second round of PCR using high-fidelity DNA polymerase. The products amplified by the second round of polymerase chain reaction were treated with DpnI restriction endonuclease. After the reaction, E. coli were transformed, plasmids were extracted, and sequencing was performed.

[0097] In this invention, all yeast strains were constructed using Agrobacterium-mediated transformation. The transformation steps are as follows: Pre-aliquoted Agrobacterium competent cells were removed from the container at -80℃ for electroporation. First, 50 μL of competent cells in a 2 mL centrifuge tube was thawed, and 1 μL of the correctly sequenced plasmid to be transformed was added. The mixture was gently mixed and placed on ice for 10 min. Then, the mixture was transferred to an electroporation cuvette, and after electroporation, 1 mL of sterile LB medium was immediately added. Finally, the mixture with medium was incubated in a shaker at 28℃ for 4–6 h, then plated onto LB agar plates containing kanamycin. After incubation at 28℃ for 1.5 days, transformant colonies were collected for PCR verification. The verified Agrobacterium transformants and the yeast to be transformed were incubated at 28℃ for 16–20 h. After the strain reached the logarithmic growth phase, the cells were washed with sterile water and the OD was adjusted. 600 Adjust the pH to 0.4-0.6. Take 100 μL of Agrobacterium and yeast dilutions respectively, mix them in sterile centrifuge tubes, and then spot them evenly onto IM medium plates with filter paper. Incubate the IM induction plates upside down in a 25 ℃ incubator for 1.5 days. Then, use sterile forceps to transfer the filter paper to the corresponding resistance YPD plates and continue incubating at 28 ℃ for 2-3 days. Perform stability verification on the transformants. The IM medium is prepared as follows: Add 3.625 g K2HPO4, 5.125 g KH2PO4, 0.375 g NaCl, 1.250 g MgSO4·7H2O, 1.250 g (NH4)2SO4, 1.8 g glucose, and 0.5% (w / v) glycerol to 800 mL of deionized water, adjust the pH to 7.0, add water to 900 mL, and sterilize at 121 ℃ for 15 min. Next, dissolve 0.165 g CaCl2·2H2O, 6.2 mg FeSO4·7H2O, and 9.76 g 4-morpholinoethanesulfonic acid (MES) in 100 mL of deionized water, adjust the pH to 5.3, and filter the solution through a 0.22 μm aqueous phase filter membrane for sterilization. Then add this solution to the above sterile solution to form the MM salt solution. Dissolve 100 mM acetylsuccine in DMSO, filter the solution through a 0.22 μm organic phase filter membrane for sterilization, and add this solution to the MM salt solution to a final concentration of 200 μM. Add 20 g / L agar powder to solid plates.

[0098] The culture medium used for the fermentation culture and screening of the strains in this invention is a nitrogen-limiting (NL) medium. The solvent is water, and the solutes and their concentrations are as follows: glucose 20 g / L, yeast extract 0.5 g / L, NH4Cl 0.33 g / L, MgSO4·7H2O 1.5 g / L, KH2PO4 1 g / L, Na2HPO4·12H2O 1 g / L, pH 6.0. The carbon-to-nitrogen ratio of this medium is 60:1.

[0099] The primers used in this invention were synthesized by Beijing Nuosai Genome Research Center Co., Ltd. The PCR products were sequenced by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0100] The extraction and detection method of zeaxanthin in this invention is as follows: (1) Product extraction: Take 500 μL of fermentation broth, centrifuge at 10000 × g for 1 min, discard the supernatant, wash the cells with acetone, centrifuge again and discard the organic phase. Add 0.3 g of glass beads and 500 μL of acetone to the cells, vortex for 2 min, incubate on ice for 1 min, and repeat this step 3 times. Place the vortexed system in a non-contact cell disruptor, disrupt for 10 min, with a 10 s disruption interval of 5 s, power at 40%, and temperature at 20℃. After ultrasonic disruption, vortex again for 2 min, and repeat the acetone extraction step until the cells turn white. After the cells turn white, centrifuge at 10000 g for 1 min, take the supernatant organic phase and pass it through a 0.22 μm membrane for high performance liquid chromatography detection. Extraction was performed in the dark throughout the process.

[0101] (2) Quantitative detection: A Shimadzu LC-2030 PLUS high-performance liquid chromatography system equipped with a Waters T-nature C18 column (4.6 × 250 mm, 5 μm) was used, with an ultraviolet detector. The mobile phase was acetonitrile:methanol:isopropanol = 1:1:1 (volume ratio), the flow rate was 1 mL / min, the injection volume was 10 μL, the column temperature was 40℃, and the detection wavelength was 470 nm. Product standards with different concentration gradients were prepared, and a standard curve relating peak area to concentration was obtained according to the sample detection procedure. The product concentration in each sample was calculated by substituting the values ​​into the standard curve.

[0102] The strains and their genotypes involved in the following examples are shown in Table 1, and the primers are shown in Table 2.

[0103] A schematic diagram of the de novo synthesis pathway of zeaxanthin in this invention is shown below. Figure 1 As shown.

[0104] Table 1. Strains used in this invention

[0105] Table 2. Primers used in this invention

[0106] Example 1: Knockout of the endogenous pigment production pathway in red yeast 1. In this embodiment, Rhodosporidium NP11 was used as the chassis cell. In order to block its endogenous carotenoid synthesis pathway, the coding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB was knocked out using CRISPR-Cas9 technology (CarYB gene sequence is shown in SEQ ID NO:22). The target sequence of the sgRNA used to knock out this gene was TACCTCGCGTTGATTGTTGG (SEQ ID NO:23). The vector used in this part was PZPK-pPGK-BLE-Tnos, and the specific operation was performed in accordance with the article "Jiao X, Zhang Y, Liu X, et al. 2019. Developing a CRISPR / Cas9 system for genome editing in the basidiomycetous yeast Rhodosporidium toruloides[J].Biotechnology Journal, 14(7): 1900036".

[0107] 2. Genomic DNA was extracted using a yeast DNA extraction kit. Using the genomic DNA as a template, the genomic region surrounding the CarYB target site was amplified using primers CarYB-F and CarYB-R (see Table 2). The transformant that underwent a frameshift mutation during sequencing was identified as the engineered strain ΔCAR-NP11. The identification results of the engineered strain ΔCAR-NP11 are shown below. Figure 2 .

[0108] Example 2: Construction and identification of Ly1, a cytoplasmic heterologous lycopene synthesis strain. 1. Based on the codon preference of Rhodotorula circophylla, artificial synthesis was carried out from Pantotheca pineapple (… Pantoea pineapple The encoding gene sequence of phytoene synthase CarB (positions 3017-3946 of SEQ ID NO:13) is shown in SEQ ID NO:3.

[0109] 2. Using the artificially synthesized gene fragment (positions 3017-3946 of SEQ ID NO:13) in step 1 as a template, PCR amplification was performed using primers ENO1-fu-CarB-F and tHSP-fu-CarB-R (see Table 2) to obtain the target gene fragment CarB with homologous arms at both ends.

[0110] 3. The plasmid PZPK-pPGK-HYG-Tnos, which carries hygromycin resistance (Hyg), was selected as its expression vector. The target gene fragment CarB obtained in step 2 was inserted into the restriction enzyme sites HpaI and SpeI of the plasmid using in-fusion cloning. The cells were then heat-transformed into E. coli DH5α competent cells at 42 °C. After single colonies grew on LB selection solid plates containing kanamycin, colony PCR was performed using the upstream primer ENO1-fu-CarB-F of the target gene and the downstream primer tHSP-R of the terminator (see Table 2). Transformants with the correct band (927 bp) were inoculated into 5 mL of LB medium containing the corresponding resistance and cultured for 12-16 h. The corresponding plasmid was extracted and sequenced. The recombinant plasmid that was verified was named pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-CarB-tHSP.

[0111] 4. Electroporate the pZPK-Hyg-pENO1-CarB-tHSP recombinant plasmid into competent Agrobacterium tumefaciens cells. After single colonies grow on LB selection solid plates containing the corresponding resistance, colony PCR verification is performed using the upstream primer ENO1-fu-CarB-F of the target gene and the downstream primer tHSP-R of the terminator (see Table 2) (amplification product size is 927 bp).

[0112] 5. Inoculate the single colony of Agrobacterium tumefaciens verified in step 4 into 5 mL of LB liquid medium containing kanamycin and incubate for approximately 15 h until OD (Organic Discharge). 600 =0.4-0.6, and the strain ΔCAR-NP11 obtained in Example 1 was inoculated into YPD liquid medium and cultured for about 15 hours until OD. 600 =0.4-0.6. Wash the bacterial cells twice with sterile water, resuspend them, and then take 100 μL of the bacterial suspension from each wash. Mix the two solutions and drop them onto sterile filter paper of an IM induction plate. Incubate at 25 °C for 48 h, then transfer them to YPD plates containing hygromycin resistance and cephalosporin. Continue incubation at 28 °C for 2-3 days until transformants grow.

[0113] 6. Select as many transformants as possible from step 5 and passage them multiple times on screening plates to obtain single colony transformants with stable resistance, which are named Ly1.

[0114] Example 3: Construction and identification of β-carotene cytoplasmic heterologous synthesis strain Bc1 1. Based on the codon preference of Rhodotorula rubrum, artificial synthesis was performed using materials derived from Arabidopsis thaliana (…). Arabidopsis thalianThe encoding gene sequence of lycopene β-cyclase LCYB is shown in positions 1592-2950 of SEQ ID NO:13, and the amino acid sequence of lycopene β-cyclase LCYB is shown in SEQ ID NO:2.

[0115] 2. Using the artificially synthesized gene fragment (positions 1592-2950 of SEQ ID NO:13) in step 1 as a template, PCR amplification was performed using primers ENO1-fu-LCYB-F and CarB-fu-LCYB-R (see Table 2) to obtain the target gene fragment LCYB with homologous arms at both ends.

[0116] 3. Using the recombinant plasmid pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-CarB-tHSP (see Example 2) digested with HpaI as a vector, the target gene fragment LCYB obtained in step 2 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid that was verified by PCR (the primers used for colony PCR verification were ENO1-fu-LCYB-F and tHSP-R from Table 2, and the target band size was 2352bp) and sequencing was named pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-LCYB-CarB-tHSP.

[0117] 4. Similar to steps 4-6 of Example 2 (the primers used for colony PCR verification are ENO1-fu-LCYB-F and tHSP-R from Table 2, with a target band size of 2352bp), the Agrobacterium tumefaciens strain ΔCAR-NP11 carrying the recombinant plasmid pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-LCYB-CarB-tHSP was used to infect the strain ΔCAR-NP11, resulting in the engineered strain Bc1.

[0118] Example 4: Construction and identification of Zea1, a heterologous synthetic strain of maize xanthophyll cytoplasm. 1. Based on the codon preference of Rhodotorula circophylla, artificial synthesis was carried out from Pantotheca pineapple (… Pantoea pineapple The gene sequence of β-carotene hydroxylase CrtZ (as shown in positions 1001-1525 of SEQ ID NO:13), and the amino acid sequence of β-carotene hydroxylase CrtZ is shown in SEQ ID NO:1.

[0119] 2. Using the artificially synthesized gene fragment (positions 1001-1525 of SEQ ID NO:13) in step 1 as a template, PCR amplification was performed using primers ENO1-fu-CrtZ-F and LCYB-fu-CrtZ-R (see Table 2) to obtain the target gene fragment CrtZ with homologous arms at both ends.

[0120] 3. Using the recombinant plasmid pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-LCYB-CarB-tHSP (see Example 3) digested with HpaI as a vector, the target gene fragment CrtZ obtained in step 2 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid that was verified by PCR (the primers used for colony PCR verification were ENO1-fu-CrtZ-F and tHSP-R from Table 2, and the target band size was 2943 bp) and sequencing was named pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-CrtZ-LCYB-CarB-tHSP).

[0121] 4. Similar to steps 4-6 of Example 2 (the primers used for colony PCR verification are ENO1-fu-CrtZ-F and tHSP-R from Table 2, with a target band size of 2943 bp), the Agrobacterium tumefaciens strain ΔCAR-NP11 carrying the recombinant plasmid pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-CrtZ-LCYB-CarB-tHSP was used to infect the strain ΔCAR-NP11, resulting in the engineered strain Zea1.

[0122] Example 5: Construction and identification of Zea2 and Zea3 strains, which enhance the carbon metabolism flux of the mevalonate pathway. 1. With Rhodotorula buergerianum ( R. toruloidesUsing NP11 cDNA as a template, primers ACL-F and ACL-R (see Table 2) were used to amplify a fragment containing the encoding gene of endogenous ATP-citrate lyase ACL (as shown in positions 3332-6802 of SEQ ID NO:15). Primers ACCT-F and ACCT-R (see Table 2) were used to amplify a fragment containing the encoding gene of endogenous acetyl-CoA acyltransferase ACCT (as shown in positions 1001-3076 of SEQ ID NO:15). Primers HMGR-F and HMGR-R (see Table 2) were used to amplify a fragment containing the encoding gene of endogenous hydroxymethylglutaryl-CoA reductase HMGR (as shown in positions 1001-2554 of SEQ ID NO:12). Primers IDI-F and IDI-R (see Table 2) were used to amplify a fragment containing the encoding gene of endogenous isoprenyl pyrophosphate isomerase IDI (as shown in SEQ ID NO:15). The fragment containing the encoding gene of endogenous geraniol geraniol pyrophosphate synthase GGPPS (as shown in positions 2621-3700 of SEQ ID NO:14) was amplified using primers GGPPS-F and GGPPS-R (see Table 2). The amino acid sequence of the endogenous ATP-citrate lyase ACL of *Rhodotorula circophylla* is available in GenBank: GEM10069.1 (updated: 20-JUL-2019). The amino acid sequence of the endogenous acetyl-CoA acyltransferase ACCT of *Rhodotorula circophylla* is available in NCBI Reference Sequence: XP_016276291.1 (updated: 02-JAN-2024). The amino acid sequence of the endogenous hydroxymethylglutaryl-CoA reductase HMGR of *Rhodotorula circophylla* is available in NCBI Reference Sequence: XP_016270872.1 (updated: 02-JAN-2024). The amino acid sequence of the endogenous isoprenyl pyrophosphate isomerase IDI of *Rhodotorula circophylla* is available in NCBI Reference Sequence: The amino acid sequence of the endogenous geraniol pyrophosphate synthase GGPPS of *Rhodotorula circophylla* is available in GenBank: KAK4332297.1 (updated 02-JAN-2024).

[0123] 2. Based on the codon preference of Rhodotorula rubrum, artificial synthesis is derived from Streptomyces (… Streptomyces The gene sequence encoding acetyl-CoA synthase NphT7 of *Enterococcus faecalis* sp. (as shown at positions 6974-7960 of SEQ ID NO:15) is derived from *Enterococcus faecalis*. Enterococcus faecalisThe gene sequence encoding hydroxymethylglutaryl-CoA synthase MvaS (as shown in positions 1001-2149 of SEQ ID NO:14) is derived from *Methanococcus masculinus*. Methanosarcina maze The amino acid sequences encoding mevalonate kinase MK (as shown in positions 2213-3115 of SEQ ID NO:14), the DNA encoding peptide tag RIDD (as shown in positions 3077-3274 of SEQ ID NO:15), and the DNA encoding peptide tag RIAD (as shown in positions 6803-6910 of SEQ ID NO:15) are described. The amino acid sequences of acetyl-CoA synthase NphT7 are shown in SEQ ID NO:4, MvaS is shown in SEQ ID NO:5, mevalonate kinase MK is shown in SEQ ID NO:6, RIDD is shown in SEQ ID NO:7, and RIAD is shown in SEQ ID NO:8.

[0124] 3. Using the HMGR gene fragment obtained by PCR in step 1 as a template, PCR amplification was performed using primers ENO1-fu-HMGR-F and GGPPS-fu-HMGR-R (see Table 2) to obtain the target gene fragment HMGR with homologous arms at both ends; using the GGPPS gene fragment obtained by PCR in step 1 as a template, PCR amplification was performed using primers HMGR-fu-GGPPS-F and tHSP-fu-GGPPS-R (see Table 2) to obtain the target gene fragment GGPPS with homologous arms at both ends.

[0125] 4. Using the SnaBI-digested plasmid pZPK-EnoI-SnaBI-tHSP-Hyg-pENO1-CrtZ-LCYB-CarB-Thsp (see step 4 of Example 4) as a vector, the target gene fragments HMGR and GGPPS obtained in step 3 were ligated to the linear vector via seamless cloning. Similar to step 3 of Example 2, the recombinant plasmid that was verified by PCR (the primers used for colony PCR verification were LB-F and tHSP-fu-GGPPS-R from Table 2, and the target band size was 3697 bp) and sequencing was named pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP). The plasmid map of recombinant plasmid pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP is as follows: Figure 3As shown. This vector carries two expression boxes, as detailed below: (1) The expression cassette “pENO1-HMGR-GGPPS-tHSP” has the nucleotide sequence shown in SEQ ID NO:12. Among them, positions 1-1000 are the pEnoI promoter sequence, positions 1001-2554 are the HMGR encoding gene, positions 2555-2620 are the P2A peptide encoding sequence, positions 2621-3700 are the GGPPS encoding gene, and positions 3701-4140 are the tHSP terminator.

[0126] (2) The expression cassette “pENO1-CrtZ-LCYB-CarB-tHSP” has the nucleotide sequence shown in SEQ ID NO:12. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-1525 are the CrtZ encoding gene, positions 1526-1591 are the P2A peptide encoding sequence, positions 1592-2950 are the LCYB encoding gene, positions 2951-3016 are the P2A peptide encoding sequence, positions 3017-3946 are the CarB encoding gene, positions 3947-3952 are the SpeI restriction site, and positions 3953-4392 are the tHSP terminator.

[0127] In practice, those skilled in the art can synthesize the relevant plasmids artificially based on the above expression cassette sequences without relying on the above construction steps.

[0128] 5. Similar to steps 4-6 of Example 2 (the primers used for colony PCR verification are LB-F and tHSP-fu-GGPPS-R from Table 2, with a target band size of 3697 bp), the Agrobacterium tumefaciens strain ΔCAR-NP11, which carries the recombinant plasmid pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP, was used to infect the engineered strain Zea2.

[0129] 6. The coding DNA sequence of RIDD was artificially synthesized into the C-terminus of the ACCT coding gene to obtain ACCT-RIDD (positions 1001-3274 of SEQ ID NO:15); the coding DNA sequence of RIAD was artificially synthesized into the C-terminus of the ACL coding gene to obtain ACL-RIAD (positions 3332-6910 of SEQ ID NO:15); the coding DNA sequence of RIDD was artificially synthesized into the C-terminus of the NphT7 coding gene to obtain NphT7-RIDD (positions 6974-8161 of SEQ ID NO:15). Using ACCT-RIDD as a template, PCR amplification was performed with primers EnoI-fu-ACCT-F and ACL-fu-RIDD-R (see Table 2) to obtain the target gene fragment ACCT-RIDD with homologous arms at both ends; using ACL-RIAD as a template, PCR amplification was performed with primers RIDD-fu-ACL-F and NphT7-fu-RIAD-R (see Table 2) to obtain the target gene fragment ACL-RIAD with homologous arms at both ends; using NphT7-RIDD as a template, PCR amplification was performed with primers RIAD-fu-NphT7-F and tHSP-fu-RIDD-R (see Table 2) to obtain the target gene fragment with homologous arms at both ends.

[0130] 7. Using the artificially synthesized glufosinate resistance gene Bar (SEQ ID NO:26) as a template, PCR amplification was performed using primers PGK-RF-Bar-F and Tnos-RF-Bar-R (see Table 2) to obtain the target gene fragment Bar with homologous arms at both ends. Using this target gene fragment as a giant primer and plasmid PZPK-pPGK-HYG-Tnos as a template, a second round of PCR amplification was performed. The second-round amplification product was digested with DpnI, and then heat-transformed into *E. coli* DH5α competent cells at 42 °C. After single colonies grew on LB selection solid plates containing kanamycin, colony PCR verification was performed using primers Bar-F and Tnos-R (see Table 2). Transformants with the correct band (610 bp) were inoculated into 5 mL of LB medium containing the corresponding resistance and cultured for 12-16 h. The corresponding plasmid was extracted and sequenced. The correctly verified recombinant plasmid was named pZPK-pPGK-Bar-Tnos.

[0131] The plasmid pZPK-pPGK-Bar-Tnos, digested with HpaI and SpeI, was used as its expression vector. The target gene fragments ACCT-RIDD, ACL-RIAD, and NphT7-RIDD obtained in step 3 were ligated to the linear vector using a seamless cloning method. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-SnaBI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP after being double-digested with HpaI and SpeI. The recombinant plasmid was named pZPK-pENO1-SnaBI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP after being obtained by double-digestion of the target gene fragments ACCT-RIDD, ACL-RIAD, and NphT7-RIDD-tHSP after being obtained by seamless cloning.

[0132] 8. Using the artificially synthesized MvaS gene fragment from step 2 as a template, PCR amplification was performed using primers ENO1-fu-MvaS-F and MK-fu-MvaS-R (see Table 2) to obtain the target gene fragment MvaS with homologous arms at both ends; using the artificially synthesized MK gene fragment from step 2 as a template, PCR amplification was performed using primers Mvas-fu-MK-F and IDI-fu-MK-R (see Table 2) to obtain the target gene fragment MK with homologous arms at both ends; using the IDI gene fragment obtained by PCR in step 1 as a template, PCR amplification was performed using primers MK-fu-IDI-F and tHSP-fu-IDI-R (see Table 2) to obtain the target gene fragment IDI with homologous arms at both ends.

[0133] 9. Using the recombinant plasmid pZPK-pENO1-SnaBI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP digested with SnaBI as a vector, the target gene fragments MvaS, MK, IDI obtained in step 8 were ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP after verification by PCR (the primers for colony PCR were LB-F and tHSP-fu-IDI-R in Table 2, and the target band size was 3940 bp) and sequencing.

[0134] The plasmid map of recombinant plasmid pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP is as follows: Figure 4 As shown. This vector carries two expression boxes, as detailed below: (1) The expression cassette “pENO1-MvaS-MK-IDI-tHSP” has the nucleotide sequence shown in SEQ ID NO:14. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-2149 are the Mvas encoding gene, positions 2150-2212 are the T2A peptide encoding sequence, positions 2213-3115 are the MK encoding gene, positions 3116-3181 are the P2A peptide encoding sequence, positions 3182-3940 are the IDI encoding gene, and positions 3941-4379 are the tHSP terminator sequence.

[0135] (2) The expression cassette “pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP” has the nucleotide sequence shown in SEQ ID NO:15. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-3076 are the ACCT encoding gene, positions 3077-3274 are the RIDD encoding DNA sequence, positions 3275-3331 are the P2A peptide encoding sequence, positions 3332-6802 are the ACL encoding gene, positions 6803-6910 are the RIAD encoding DNA sequence, positions 6911-6973 are the T2A peptide encoding sequence, positions 6974-7960 are the NphT7 encoding gene, positions 7961-8161 are the RIDD encoding DNA sequence, and positions 8162-8601 are the tHSP terminator sequence.

[0136] In practice, those skilled in the art can synthesize the relevant plasmids artificially based on the above expression cassette sequences without relying on the above construction steps.

[0137] 10. Similar to steps 4-6 of Example 2 (the primers for colony PCR are LB-F and tHSP-fu-IDI-R in Table 2, and the target band size is 3940 bp), the Agrobacterium tumefaciens strain Zea2 carrying the recombinant plasmid pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP was used to infect the engineered strain Zea3.

[0138] Example 6: Construction and identification of Zea4 strain, a cytoplasmic-lipid droplet dual-regulated zeaxanthin synthesis strain. 1. Using the artificially synthesized sequence Oleosion-CrtZ (positions 1001-2083 of SEQ ID NO:16) as a template, PCR amplification was performed using primers ENO1-fu-Ole-F and Ole-fu-CrtZ-R (see Table 2) to obtain the target gene fragment Oleosion-CrtZ with homologous arms at both ends; using the artificially synthesized sequence Oleosion-LCYB (positions 2150-4066 of SEQ ID NO:16) as a template, PCR amplification was performed using primers CrtZ-fu-Ole-F and Ole-fu-LCYB-R (see Table 2) to obtain the target gene fragment Oleosion-LCYB with homologous arms at both ends; using the artificially synthesized sequence Oleosion-CarB (SEQ ID NO:16) as a template, PCR amplification was performed using primers CrtZ-fu-Ole-F and Ole-fu-LCYB-R (see Table 2) to obtain the target gene fragment Oleosion-LCYB with homologous arms at both ends; using the artificially synthesized sequence Oleosion-CarB (SEQ ID NO:16) as a template, PCR amplification was performed using primers CrtZ-fu-Ole-F and Ole-fu-LCYB-R (see Table 2) to obtain the target gene fragment Oleosion-LCYB with homologous arms at both ends; Using positions 4133-5620 of IDNO:16 as a template, PCR amplification was performed using primers LCYB-fu-Ole-F and tHSP-fu-CarB-R (see Table 2) to obtain the target gene fragment Olesion-CarB with homologous arms at both ends. The amino acid sequence of the lipid droplet localizing protein Oleosin is shown in SEQ ID NO:9.

[0139] 2. Using the artificially synthesized G418 resistance gene (SEQ ID NO:27) as a template, PCR amplification was performed using primers PGK-RF-G418-F and Tnos-RF-G418-R (see Table 2) to obtain the target gene fragment G418 with homologous arms at both ends. Using this target gene fragment as a giant primer and plasmid PZPK-pPGK-HYG-Tnos as a template, a second round of PCR amplification was performed. The second-round amplification product was digested with DpnI, and then heat-transformed into *E. coli* DH5α competent cells at 42 °C. After single colonies grew on LB selection solid plates containing kanamycin, colony PCR verification was performed using primers G418-F and Tnos-R (see Table 2). Transformants with the correct band (851 bp) were inoculated into 5 mL of LB medium containing the corresponding resistance and cultured for 12-16 h. The corresponding plasmid was extracted and sequenced. The correctly verified recombinant plasmid was named pZPK-pPGK-G418-Tnos. The pZPK-pPGK-G418-Tnos, which was double-digested with HpaI and SpeI, was used as its expression vector. The target gene fragments Oleosion-CrtZ, Oleosion-LCYB, and Oleosion-CarB obtained in step 1 were ligated to the linear vector using a seamless cloning method. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-G418-pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP after verification by PCR (the primers used for colony PCR were ENOI-F and tHSP-fu-CarB-R in Table 2, and the target band size was 4619 bp) and sequencing.

[0140] The plasmid map of recombinant plasmid pZPK-G418-pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP is as follows: Figure 5As shown in the diagram, this vector carries the expression cassette “pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP”, whose nucleotide sequence is shown in SEQ ID NO:16. Specifically, positions 1-1000 are the pENOI promoter sequence, positions 1001-1558 are the Olesion coding DNA sequence, positions 1559-2083 are the CrtZ coding gene, positions 2084-2149 are the P2A peptide coding sequence, positions 2150-2707 are the Olesion coding DNA sequence, positions 2708-4066 are the LCYB coding gene, positions 4067-4132 are the P2A peptide coding sequence, positions 4133-4690 are the Olesion coding DNA sequence, positions 4691-5620 are the CarB coding gene, and positions 5621-6060 are the tHSP terminator sequence. In practice, those skilled in the art can synthesize the corresponding plasmids artificially based on the sequence of the expression cassette, without relying on the above construction steps.

[0141] 3. Similar to steps 4-6 of Example 2 (the primers used for colony PCR are ENOI-F and tHSP-fu-CarB-R from Table 2, and the target band size is 4619 bp), the Agrobacterium tumefaciens carrying the recombinant plasmid pZPK-G418-pENO1-Olesion-CrtZ-Olesion-LCYB-Olesion-CarB-tHSP was used to infect strain Zae3, resulting in the engineered strain Zea4.

[0142] Example 7: Construction and identification of Zea5, a cytoplasmic-lipid-endoplasmic reticulum multi-regulated zeaxanthin synthesis strain. 1. Using the recombinant plasmid pZPK-Hyg-pENO1-CrtZ-LCYB-CarB-tHSP from Example 4 as a template, PCR amplification was performed using primers ENO1-fu-KDEL-CrtZ-F and tHSP-fu-KDEL-CrtZ-R (see Table 2) to obtain the target gene fragment CrtZ-KDEL with homologous arms at both ends; using the recombinant plasmid pZPK-Hyg-pENO1-CrtZ-LCYB-CarB-tHSP from Example 4 as a template, primers NAT- PCR amplification was performed using fu-LCYB-F and Tnos-fu-LCYB-R (see Table 2) to obtain the target gene fragment LCYB-KDEL with homologous arms at both ends. Using the recombinant plasmid pZPK-Hyg-pENO1-CrtZ-LCYB-CarB-tHSP from Example 4 as a template, the target gene fragment CarB-KDEL with homologous arms at both ends was cloned using primers ENOI-fu-KDEL-CarB-F and tHSP-fu-KDEL-CarB-R (see Table 2). The amino acid sequence of the endoplasmic reticulum-localized short peptide KDEL is shown in SEQ ID NO:10.

[0143] 2. Using the NAT-resistant plasmid PZPK-pGPD-NAT-Tnos, which was double-digested with HpaI and SpeI, as its expression vector, the target gene fragment CrtZ-KDEL obtained in step 1 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-SnaBI-tHSP-pGPD-NAT-XbaI-Tnos-pENO1-CrtZ-KDEL-tHSP after verification by PCR (the primers used for colony PCR were ENOI-F and tHSP-fu-KDEL-CrtZ-R from Table 2, with a target band size of 540 bp) and sequencing.

[0144] 3. Using the recombinant plasmid pZPK-pENO1-SnaBI-tHSP-pGPD-NAT-XbaI-Tnos-pENO1-CrtZ-KDEL-tHSP digested with XbaI as a vector, the target gene fragment LCYB-KDEL obtained in step 1 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-SnaBI-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP after verification by PCR (the primers used for colony PCR were NAT-fu-LCYB-F and Tnos-R from Table 2, with a target band size of 1450 bp) and sequencing.

[0145] 4. Using the recombinant plasmid pZPK-pENO1-SnaBI-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP digested with SnaBI as a vector, the target gene fragment CarB-KDEL obtained in step 1 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP after verification by PCR (the primers used for colony PCR were LB-F and tHSP-fu-KDEL-CarB-R from Table 2, and the target band size was 1962 bp) and sequencing.

[0146] The plasmid map of recombinant plasmid pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP is as follows: Figure 6 As shown. This recombinant plasmid carries the following three expression cassettes: (1) The expression cassette “pENO1-CarB-KDEL-tHSP” has the following nucleotide sequence as shown in SEQ ID NO:17. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-1006 are the SnaBI restriction site, positions 1007-1933 are the CarB coding gene, positions 1934-1945 are the KDEL coding DNA sequence, positions 1946-1948 are the stop codon TGA, and positions 1949-2388 are the tHSP stop sequence.

[0147] (2) The expression cassette “pGPD-NAT-LCYB-KDEL-Tnos” has the following nucleotide sequence as shown in SEQ ID NO:18. Among them, positions 1-786 are the pGPD promoter sequence, positions 787-1356 are the NAT resistance gene coding sequence, positions 1357-1413 are the P2A coding sequence, positions 1414-2772 are the LCYB coding gene, positions 2773-2784 are the KDEL peptide coding sequence, positions 2785-2787 are the stop codon TGA, and positions 2788-3040 are the Tnos stop codon sequence.

[0148] (3) The expression cassette “pENO1-CrtZ-KDEL-tHSP” has the following nucleotide sequence as shown in SEQ ID NO: 19. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-1006 are the HpaI restriction site, positions 1007-1531 are the CrtZ encoding gene, positions 1532-1543 are the KDEL encoding DNA sequence, positions 1544-1546 are the stop codon TGA, and positions 1547-1986 are the tHSP stop sequence.

[0149] In practice, those skilled in the art can synthesize the corresponding plasmids artificially based on the sequence of the expression cassette, without relying on the above construction steps.

[0150] 5. Similar to steps 4-6 in Example 2 (refer to steps 2-4 for primers and corresponding target band sizes used in colony PCR identification), the Agrobacterium tumefaciens strain Zea4 carrying the recombinant plasmid pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP was used to infect the engineered strain Zea5.

[0151] Example 8: Construction and identification of Zea6, a strain of zeaxanthin-enhancing NADPH-producing bacteria. 1. With Rhodotorula buergerianum ( R. toruloides Using NP11 cDNA as a template, and ZWF1-F and ZWF1-R (see Table 2) as primers, a fragment containing the encoding gene sequence of endogenous glucose-6-phosphate dehydrogenase ZWF1 (as shown in positions 1001-2551 of SEQ ID NO:21) was amplified. Based on the codon preference of *Rhodotorula buergerianum*, a fragment derived from *Clostridium perfringens* was artificially synthesized. Clostridium The gene sequence encoding glyceraldehyde-3-phosphate dehydrogenase GAPDH of *Rhodotorula glutinis* sp. is shown as positions 1001-2446 of SEQ ID NO:20. The amino acid sequence of the endogenous glucose-6-phosphate dehydrogenase ZWF1 from *Rhodotorula glutinis* sp. is available in GenBank: KAJ8292682.1 (updated 12-APR-2023); the sequence is derived from *Clostridium* sp. Clostridium The amino acid sequence of glyceraldehyde-3-phosphate dehydrogenase GAPDH (sp.) is shown in SEQ ID NO:11.

[0152] 2. Using the ZWF1 gene fragment obtained in step 1 as a template, PCR amplification was performed using primers ENOI-fu-ZWF1-F and CrtZ-fu-ZWF1-R (see Table 2) to obtain the target gene fragment ZWF1 with homologous arms at both ends; using the GAPDH gene fragment obtained in step 1 as a template, PCR amplification was performed using primers ENOI-fu-GAPDH-F and CarB-fu-GAPDH-R (see Table 2) to obtain the target gene fragment GAPDH with homologous arms at both ends.

[0153] 3. Using the recombinant plasmid pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-CrtZ-KDEL-tHSP (see Example 7) as a vector, the target gene fragment ZWF1 obtained in step 2 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP after verification by PCR (the primers used for colony PCR were ENOI-F and CrtZ-fu-ZWF1-R from Table 2, with a target band size of 1617 bp) and sequencing.

[0154] 4. Using the recombinant plasmid pZPK-pENO1-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP digested with SnaBI as a vector, the target gene fragment GAPDH obtained in step 2 was ligated to the linear vector via seamless cloning. Similar to step 3 in Example 2, the recombinant plasmid was named pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP after verification by PCR (the primers used for colony PCR were LB-F and CarB-fu-GAPDH-R from Table 2, and the target band size was 2506bp) and sequencing.

[0155] The plasmid map of recombinant plasmid pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP is as follows: Figure 7 As shown. This recombinant plasmid carries the following three expression cassettes: (1) The expression cassette “pENO1-GAPDH-CarB-KDEL-tHSP” has the nucleotide sequence shown in SEQ ID NO:20. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-2446 are the GAPDH coding gene, positions 2447-2503 are the P2A peptide coding sequence, positions 2504-3430 are the CarB coding gene, positions 3431-3442 are the KDEL coding DNA sequence, positions 3443-3445 are the stop codon TGA, and positions 3446-3885 are the tHSP stop sequence.

[0156] (2) The expression cassette “pGPD-NAT-LCYB-KDEL-Tnos” has the following nucleotide sequence as shown in SEQ ID NO:18. Among them, positions 1-786 are the pGPD promoter sequence, positions 787-1356 are the NAT resistance gene coding sequence, positions 1357-1413 are the P2A coding sequence, positions 1414-2772 are the LCYB coding gene, positions 2773-2784 are the KDEL peptide coding sequence, positions 2785-2787 are the stop codon TGA, and positions 2788-3040 are the Tnos stop codon sequence.

[0157] (3) The expression cassette “pENO1-ZWF1-CrtZ-KDEL-tHSP” has the following nucleotide sequence as shown in SEQ ID NO:21. Among them, positions 1-1000 are the pENOI promoter sequence, positions 1001-2551 are the ZWF1 coding gene, positions 2552-2617 are the P2A peptide coding sequence, positions 618-3142 are the CrtZ coding gene, positions 3143-3155 are the KDEL coding DNA sequence, positions 3156-3158 are the stop codon TGA, and positions 3159-3598 are the tHSP stop sequence.

[0158] In practice, those skilled in the art can synthesize the corresponding recombinant plasmids artificially based on the sequences of the above expression cassettes, without relying on the above construction steps.

[0159] 5. Similar to steps 4-6 in Example 2 (refer to steps 3 and 4 for the primers used in colony PCR and the corresponding target band size), the Agrobacterium tumefaciens strain Zea4 carrying the recombinant plasmid pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP was used to infect the engineered strain Zea6.

[0160] Example 9: Construction and identification of Zea7 strain, which balances lipid-zeaxanthin production by knocking down lipid synthesis pathways. 1. In this embodiment, *Rhodotorula glutinis* NP11 was used as the chassis cell. To block its endogenous carotenoid synthesis pathway and knock down the lipid synthesis pathway, the coding genes for CarYB and LDP1 (LDP1 gene sequence is shown in SEQ ID NO:24) were knocked out using CRISPR-Cas9 technology. The target sequence of the sgRNA used to knock out this gene was atgccgcgttccagacggccc (SEQ ID NO:25). The specific operation was the same as in Example 1, thereby obtaining a frameshift mutant.

[0161] 2. Genomic DNA was extracted using a yeast DNA extraction kit. Using the genomic DNA as a template, the genomic region surrounding the CarYB target site was amplified using primers CarYB-F and CarYB-R (see Table 2), and the genomic region surrounding the LDP1 target site was amplified using primers LDP1-F and LDP1-R (see Table 2). The transformant exhibiting a frameshift mutation during sequencing was identified as the engineered strain ΔCAR-ΔLDP1-NP11. The identification results of the engineered strain ΔCAR-ΔLDP1-NP11 are shown below. Figure 8 .

[0162] 3. The recombinant plasmids pZPK-pENO1-HMGR-GGPPS-tHSP-pPGK-Hyg-Tnos-pENO1-CrtZ-LCYB-CarB-tHSP and pZPK-pENO1-MvaS-MK-IDI-tHSP-Bar-pENO1-ACCT-RIDD-ACL-RIAD-NphT7-RIDD-tHSP from Example 5, and the recombinant plasmid pZPK-G418-pENO1-Olesion-CrtZ from Example 6 were used. The Agrobacterium tHSP strains in soil, including the recombinant plasmids pZPK-pENO1-GAPDH-CarB-KDEL-tHSP-pGPD-NAT-LCYB-KDEL-Tnos-pENO1-ZWF1-CrtZ-KDEL-tHSP from Example 8, simultaneously infected the engineered strain ΔCAR-ΔLDP1-NP11. Colony PCR (see Examples 5, 6, and 8) and sequencing confirmed the correct strain, Zea7.

[0163] Example 10: Production of Zeaxanthin by 250mL Shake Flask Fermentation of Various Genetically Engineered Bacteria The strains ΔCAR-NP11 obtained in Example 1, Ly1 obtained in Example 2, Bc1 obtained in Example 3, Zea1 obtained in Example 4, Zea2 and Zea3 obtained in Example 5, Zea4 obtained in Example 6, Zea5 obtained in Example 7, Zea6 obtained in Example 8, and Zea7 obtained in Example 9 were fermented in 250 mL shake flasks. The specific procedures are as follows: Single colonies of the strain were inoculated into 5 mL of NL medium (solvent: water; solute concentrations: glucose 20 g / L, yeast extract 0.5 g / L, NH4Cl 0.33 g / L, MgSO4·7H2O 1.5 g / L, KH2PO4 1 g / L, Na2HPO4·12H2O 1 g / L, pH 6.0) and cultured at 28 °C and 180 rpm for 36–48 h to obtain primary seed culture. The initial OD was used as the starting point for the culture. 600 =0.5g was inoculated into a 250mL Erlenmeyer flask containing 50mL NL medium and incubated at 28℃ and 180rpm for 120h. After fermentation, extracts were taken and the yield of zeaxanthin was quantitatively determined by external standard method (see above for details).

[0164] Test results as follows Figure 9 As shown, knocking out the CarYB gene blocks the endogenous pigment synthesis pathway in NP11. Co-expression of CarB, LCYB, and CrtZ successfully synthesized zeaxanthin. By enhancing the metabolic flux of the MVA pathway, balancing NADPH supply, and balancing lipid synthesis and zeaxanthin synthesis, the zeaxanthin yield of the engineered strain was increased. These results indicate that *Rhodotorula glutinis* NP11 can serve as a chassis strain for zeaxanthin production and has promising prospects for industrial application.

[0165] Example 11: Effects of different carbon-nitrogen ratios on zeaxanthin production by genetically engineered bacteria Zea7 1. Set carbon-nitrogen ratios (mass ratio of carbon to nitrogen) of 15 / 1, 30 / 1, 60 / 1, and 120 / 1 respectively.

[0166] The formulations of culture media with different carbon-nitrogen ratios are shown in Table 3.

[0167] Table 3. Culture medium formulations with different carbon-to-nitrogen ratios (50 ml; unit: g)

[0168] Note: YNB (1.7 g / L, without ammonium sulfate and amino acids); initial pH of the culture medium = 6.0.

[0169] 2. Inoculate a single colony of the genetically engineered Zea7 bacterium into 50 mL of YPD medium and incubate at 28 ℃ and 180 rpm for 12-16 h to prepare a seed culture. Take an appropriate volume of the seed culture, wash twice with sterile water, and then, according to the initial OD... 600 =0.5 was inoculated into culture media with different carbon-nitrogen ratios and cultured at 28 ℃ and 180 rpm for 120 h.

[0170] 3. After fermentation, the yield of zeaxanthin was extracted and tested, and the quantification was performed using the external standard method (see Example 10 for details).

[0171] The test results are shown in Table 4. It is evident that different carbon-to-nitrogen ratios in the culture medium affect the yield of zeaxanthin. This result indicates that a carbon-to-nitrogen ratio of 60 / 1 is beneficial for the production of zeaxanthin by the engineered strain.

[0172] Table 4. Effect of carbon-nitrogen ratio on maize xanthine yield (mg / L)

[0173] Example 12: Application of the method for constructing zeaxanthin-engineered bacteria in other red yeasts 1. Using red yeast ( R. glutinosa ), red yeast ( R. mucilaginosa ), Heben Red Yeast ( R. grass ), dark red yeast ( Red rose ), lactose red yeast ( R. lactosa ), spherical red yeast ( R. spherocarp ), marine red yeast ( R. marina ), slender fruit red yeast ( R. acheniorum ) and Bogor red yeast ( R. Bogorian The host strain was used to express the recombinant plasmids in Examples 5-7.

[0174] 2. The method for constructing genetically engineered bacteria is as shown in Example 2 (the only difference is the recipient bacteria). The results show that all the obtained engineered strains can produce a certain amount of zeaxanthin.

[0175] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An engineered microorganism for producing zeaxanthin, characterized in that: The engineered bacteria are obtained by modifying the yeast recipient bacteria as shown in (A1)-(A3) below: (A1) Blocking the endogenous carotenoid synthesis pathway; (A2) Express the following three exogenous enzymes that target the cytoplasm: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytopene synthase CarB; (A3) Overexpress one or more of the following endogenous enzymes: ATP-citrate lyase ACL, acetyl-CoA acyltransferase ACCT, hydroxymethylglutaryl-CoA reductase HMGR, isoprenyl pyrophosphate isomerase IDI, geranyl geranyl pyrophosphate synthase GGPPS, glucose-6-phosphate dehydrogenase ZWF1.

2. The engineered bacteria according to claim 1, characterized in that: The modifications also include the following (A4): (A4) expresses one or more of the following exogenous enzymes: acetyl-CoA synthase NphT7, hydroxymethylglutaryl-CoA reductase MvaE, hydroxymethylglutaryl-CoA synthase MvaS, mevalonate kinase MK, and glyceraldehyde-3-phosphate dehydrogenase GAPDH.

3. The engineered bacteria according to claim 2, characterized in that: The modifications also include the following (A5): (A5) Express the following three exogenous enzymes that target lipid droplets: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytolycopene synthase CarB.

4. The engineered bacteria according to claim 3, characterized in that: The modifications also include the following (A6): (A6) Express the following three exogenous enzymes that target the endoplasmic reticulum: β-carotene hydroxylase CrtZ, lycopene β-cyclase LCYB, and phytorepinephrine synthase CarB.

5. The engineered bacteria according to claim 4, characterized in that: The modifications also include the following (A7): (A7) Knock out the gene encoding endogenous perilipin protein LDP1.

6. The engineered bacteria according to any one of claims 1-5, characterized in that: The engineered bacteria is any one of the following: (B1) Engineered strain 1; Engineered strain 1 is a strain obtained by knocking out the encoding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB in the yeast recipient strain and introducing the following five genes: the encoding gene of β-carotene hydroxylase CrtZ from Pantotheca pineapple, the encoding gene of lycopene β-cyclase LCYB from Arabidopsis thaliana, the encoding gene of phytoene synthase CarB from Pantotheca pineapple, the encoding gene of endogenous hydroxymethylglutaryl-CoA reductase HMGR in the yeast recipient strain, and the encoding gene of endogenous geranyl-geranyl pyrophosphate synthase GGPPS in the yeast recipient strain. (B2) Engineered strain 2; the engineered strain 2 is a strain obtained by introducing the following six genes into the engineered strain 1: the encoding gene of hydroxymethylglutaryl-CoA synthase MvaS from Enterococcus faecalis, the encoding gene of mevalonate kinase MK from Methanococcus martensii, the encoding gene of isoprenyl pyrophosphate isomerase IDI from the yeast recipient strain, the fusion gene formed by fusing the encoding gene of acetyl-CoA acyltransferase ACCT from the yeast recipient strain and the encoding DNA of polypeptide tag RIDD, the fusion gene formed by fusing the encoding gene of ATP-citrate lyase ACL from the yeast recipient strain and the encoding DNA of polypeptide tag RIAD, and the fusion gene formed by fusing the encoding gene of acetyl-CoA synthase NphT7 from Streptomyces and the encoding DNA of polypeptide tag RIDD; (B3) Engineered strain 3; Engineered strain 3 is a strain obtained by introducing the following three fusion genes into engineered strain 2: Olesion-CrtZ, Olesion-LCYB, and Olesion-CarB; Olesion-CrtZ is formed by fusing the DNA encoding the lipid droplet localizing protein Oleosin with the gene encoding the β-carotene hydroxylase CrtZ from Pantotheca pineapple; Olesion-LCYB is formed by fusing the DNA encoding the lipid droplet localizing protein Oleosin with the gene encoding the lycopene β-cyclase LCYB from Arabidopsis thaliana; Olesion-CarB is formed by fusing the DNA encoding the lipid droplet localizing protein Oleosin with the gene encoding the phytoene synthase CarB from Pantotheca pineapple; (B4) Engineered strain 4; Engineered strain 4 is a strain obtained by introducing the following three fusion genes into engineered strain 3: CarB-KDEL, LCYB-KDEL, and CrtZ-KDEL; CarB-KDEL is formed by fusing the encoding gene of phytoene synthase CarB from Pantoea ananatis and the encoding DNA of the endoplasmic reticulum localized short peptide KDEL; LCYB-KDEL is formed by fusing the encoding gene of lycopene β-cyclase LCYB from Arabidopsis thaliana and the encoding DNA of the endoplasmic reticulum localized short peptide KDEL; CrtZ-KDEL is formed by fusing the encoding gene of β-carotene hydroxylase CrtZ from Pantoea ananatis and the encoding DNA of the endoplasmic reticulum localized short peptide KDEL. (B5) Engineered strain 5; the engineered strain 5 is a strain obtained by introducing the following three fusion genes into the engineered strain 3: GAPDH-CarB-KDEL, LCYB-KDEL, and ZWF1-CrtZ-KDEL; the GAPDH-CarB-KDEL is composed of the encoding gene of glyceraldehyde-3-phosphate dehydrogenase GAPDH from Clostridium perfringens, the encoding gene of phytoene synthase CarB from Pantothecin pineapple, and the endoplasmic reticulum localized short peptide KD. The LCYB-KDEL is formed by fusing the coding DNA of EL; the LCYB-KDEL is formed by fusing the coding gene of lycopene β-cyclase LCYB from Arabidopsis thaliana and the coding DNA of endoplasmic reticulum localized short peptide KDEL; the ZWF1-CrtZ-KDEL is formed by fusing the coding gene of glucose-6-phosphate dehydrogenase ZWF1 from the yeast recipient bacteria, the coding gene of β-carotene hydroxylase CrtZ from pantothenica pineapple and the coding DNA of endoplasmic reticulum localized short peptide KDEL. (B6) Engineered strain 6; the engineered strain 6 is a strain obtained by knocking out the coding gene of the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB and the coding gene of periplasmin protein LDP1 in the yeast recipient strain, and introducing the five genes in (B1), the six genes in (B2), the three fusion genes in (B3) and the three fusion genes in (B5).

7. The engineered bacteria according to any one of claims 1-6, characterized in that: The amino acid sequence of the β-carotene hydroxylase CrtZ derived from Pantotheca pineapple is shown in SEQ ID NO:1; and / or The amino acid sequence of the lycopene β-cyclase LCYB derived from Arabidopsis thaliana is shown in SEQ ID NO:2; and / or The amino acid sequence of the phytoene synthase CarB derived from Pantotheca pineapple is shown in SEQ ID NO:3; and / or The amino acid sequence of the Streptomyces-derived acetyl-CoA synthase NphT7 is shown in SEQ ID NO:4; and / or The amino acid sequence of the hydroxymethylglutaryl-CoA synthase MvaS derived from Enterococcus faecalis is shown in SEQ ID NO:5; and / or The amino acid sequence of the mevalonate kinase MK derived from *Methanococcus martensii* is shown in SEQ ID NO:6; and / or The amino acid sequence of the polypeptide tag RIDD is shown in SEQ ID NO:7; and / or The amino acid sequence of the polypeptide tag RIAD is shown in SEQ ID NO:8; The amino acid sequence of the lipid droplet localizing protein Oleosin is shown in SEQ ID NO:9; and / or The amino acid sequence of the endoplasmic reticulum localization short peptide KDEL is shown in SEQ ID NO:10; and / or The amino acid sequence of the glyceraldehyde-3-phosphate dehydrogenase GAPDH derived from Clostridium difficile is shown in SEQ ID NO:11; and / or The amino acid sequence of the endogenous hydroxymethylglutaryl-CoA reductase HMGR in the yeast recipient strain is shown in NCBI Reference Sequence: XP_016270872.1; and / or The amino acid sequence of the endogenous gerany-gerany pyrophosphate synthase (GGPPS) in the yeast recipient strain is available in GenBank: KAK4332297.1; and / or The amino acid sequence of the endogenous isoprenyl pyrophosphate isomerase IDI of the yeast recipient strain is shown in NCBI Reference Sequence: XP_016270310.1; and / or The amino acid sequence of the yeast recipient strain's endogenous acetyl-CoA acyltransferase ACCT is shown in NCBI Reference Sequence: XP_016276291.1; and / or The amino acid sequence of the endogenous ATP-citrate lyase ACL in the yeast recipient strain is available in GenBank: GEM10069.1; and / or The amino acid sequence of the endogenous glucose-6-phosphate dehydrogenase ZWF1 in the yeast recipient strain is available in GenBank:KAJ8292682.1; and / or The gene sequence encoding the β-carotene hydroxylase CrtZ derived from *Panthera pineapple* is shown in positions 1001-1525 of SEQ ID NO:13; and / or The gene sequence encoding the lycopene β-cyclase LCYB derived from Arabidopsis thaliana is shown in positions 1592-2950 of SEQ ID NO:13; and / or The encoding gene sequence of the phytoene synthase CarB derived from Pantotheca pineapple is shown at positions 3017-3946 of SEQ ID NO:13; and / or The gene sequence encoding acetyl-CoA synthase NphT7 derived from Streptomyces is shown at positions 6974-7960 of SEQ ID NO:15; and / or The gene sequence encoding the hydroxymethylglutaryl-CoA synthase MvaS derived from Enterococcus faecalis is shown in positions 1001-2149 of SEQ ID NO:14; and / or The encoding gene sequence of mevalonate kinase MK derived from *Methanococcus masculinus* is shown at positions 2213-3115 of SEQ ID NO:14; and / or The DNA encoding the polypeptide tag RIDD is shown at positions 3077-3274 of SEQ ID NO:15; and / or The DNA encoding the polypeptide tag RIAD is shown in positions 6803-6910 of SEQ ID NO:15; The DNA encoding the lipid droplet localization protein Oleosin is shown in positions 1001-1558 of SEQ ID NO:16; and / or The DNA encoding the endoplasmic reticulum localization short peptide KDEL is shown at positions 1934-1945 of SEQ ID NO:17; and / or The gene sequence encoding the glyceraldehyde-3-phosphate dehydrogenase GAPDH derived from Clostridium difficile is shown in positions 1001-2446 of SEQ ID NO:20; and / or The gene sequence encoding the endogenous hydroxymethylglutaryl-CoA reductase HMGR of the yeast recipient strain is shown in positions 1001-2554 of SEQ ID NO:12; and / or The gene sequence encoding endogenous geranylgeranyl pyrophosphate synthase (GGPPS) in the yeast recipient strain is shown at positions 2621-3700 of SEQ ID NO:12; and / or The gene sequence encoding the endogenous isoprenyl pyrophosphate isomerase IDI of the yeast recipient strain is shown at positions 3182-3940 of SEQ ID NO:14; and / or The gene sequence encoding the endogenous acetyl-CoA acyltransferase ACCT of the yeast recipient strain is shown in positions 1001-3076 of SEQ ID NO:15; and / or The gene sequence encoding the endogenous ATP-citrate lyase ACL in the yeast recipient strain is shown at positions 3332-6802 of SEQ ID NO:15; and / or The gene sequence encoding the endogenous glucose-6-phosphate dehydrogenase ZWF1 in the yeast recipient strain is shown in positions 1001-2551 of SEQ ID NO:21; and / or In (B1), the knockout of the coding gene for the bifunctional enzyme phytoene synthase / lycopene cyclase CarYB in the yeast recipient strain was achieved using CRISPR-Cas9 technology, with the target sequence being SEQ ID NO:23; and / or, when the five genes are introduced into the yeast recipient strain, the coding genes for endogenous hydroxymethylglutaryl-CoA reductase HMGR and endogenous geranyl-geranyl pyrophosphate synthase GGPPS of the yeast recipient strain are present in expression cassette 1, and the coding genes for β-carotene hydroxylase CrtZ from *Umbrella pineapple*, lycopene β-cyclase LCYB from *Arabidopsis thaliana*, and phytoene synthase CarB from *Umbrella pineapple* are present in expression cassette 2, the nucleotide sequence of expression cassette 1 is shown in SEQ ID NO:12, and the nucleotide sequence of expression cassette 2 is shown in SEQ ID NO:13; and / or In (B2), when the six genes are introduced into the engineered strain 1, the encoding genes for hydroxymethylglutaryl-CoA synthase MvaS derived from *Enterococcus faecalis*, mevalonate kinase MK derived from *Methanococcus masculinus*, and the encoding gene for isoprenyl pyrophosphate isomerase IDI endogenously from the yeast recipient strain are present in expression cassette 3; the fusion gene formed by fusing the encoding genes for acetyl-CoA acyltransferase ACCT endogenously from the yeast recipient strain and the encoding DNA of the polypeptide tag RIDD, the fusion gene formed by fusing the encoding genes for ATP-citrate lyase ACL endogenously from the yeast recipient strain and the encoding DNA of the polypeptide tag RIAD, and the fusion gene formed by fusing the encoding genes for acetyl-CoA synthase NphT7 derived from *Streptomyces* and the encoding DNA of the polypeptide tag RIDD are present in expression cassette 4; the nucleotide sequence of expression cassette 3 is shown in SEQ ID NO:14, and the nucleotide sequence of expression cassette 4 is shown in SEQ ID NO:15; and / or In (B3), when the three fusion genes are introduced into the engineered strain 2, the Olesion-CrtZ, Olesion-LCYB, and Olesion-CarB are present in expression cassette 5, the nucleotide sequence of which is shown in SEQ ID NO:16; and / or In (B4), when the three fusion genes are introduced into the engineered strain 3, CarB-KDEL is present in expression cassette 6, LCYB-KDEL is present in expression cassette 7, and CrtZ-KDEL is present in expression cassette 8. The nucleotide sequence of expression cassette 6 is shown in SEQ ID NO:17, the nucleotide sequence of expression cassette 7 is shown in SEQ ID NO:18, and the nucleotide sequence of expression cassette 8 is shown in SEQ ID NO:19; and / or In (B5), when each gene is introduced into the engineered strain 3, GAPDH-CarB-KDEL is present in expression cassette 9, LCYB-KDEL is present in expression cassette 10, and ZWF1-CrtZ-KDEL is present in expression cassette 11. The nucleotide sequence of expression cassette 9 is shown in SEQ ID NO:20, the nucleotide sequence of expression cassette 10 is shown in SEQ ID NO:18, and the nucleotide sequence of expression cassette 11 is shown in SEQ ID NO:21; and / or In (B6), the gene encoding the periplasmin-like protein LDP1 was knocked out using CRISPR-Cas9 technology, with the target sequence being SEQ ID NO:25; and / or The yeast recipient strain is red yeast; Furthermore, the red yeast is selected from any one of the following: Rhodotorula buergerianum, Rhodotorula glutinis, Rhodotorula glutinis, Rhodotorula granatum, Rhodotorula rubrum, Rhodotorula sacchariformis, Rhodotorula spheroides, Rhodotorula marinei, Rhodotorula achenes, and Rhodotorula bogorii; Furthermore, the yeast recipient strain is Rhodotorula buergerianum NP11.

8. A method for constructing the engineered bacteria according to any one of claims 1-7, comprising: The modification of the yeast recipient strain according to any one of claims 1-7, thereby obtaining the engineered strain.

9. The use of the engineered bacteria according to any one of claims 1-7 in any of the following: (C1) Production of zeaxanthin; (C2) Prepare products containing zeaxanthin; (C3) Increase the yield of maize xanthine.

10. A method for producing zeaxanthin, comprising the following steps: fermenting and culturing the engineered bacteria according to any one of claims 1-7, and obtaining zeaxanthin from the fermentation product; Furthermore, when fermenting the engineered bacteria, the carbon-to-nitrogen ratio in the culture system is (8-120):1.