An OsMPS knockout line associated with rice resistance to sheath blight and its application

Abstract

This invention discloses an OsMPS gene knockout line related to rice resistance to sheath blight and its application. The CDS sequence of the OsMPS gene is shown in SEQ ID NO.1, and the full-length sequence is shown in SEQ ID NO.2. Through tissue-specific expression data, this invention reveals that OsMPS is mainly expressed in roots. The OsMPS gene knockout line in this invention significantly enhances rice resistance to sheath blight. The rice gene OsMPS of this invention has a significant impact on rice resistance to sheath blight and can be applied in rice breeding for resistance to sheath blight, which is of great significance for promoting the process of rice disease resistance breeding and improving food security.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an OsMPS gene knockout line related to rice resistance to sheath blight and its application. Background Technology

[0002] Rice sheath blight is a global rice disease caused by *Rhizoctonia solani*. The pathogen infects the leaf sheaths and stems, causing tissue necrosis, leading to lodging and hindered grain filling, ultimately affecting yield. Statistics show that under normal conditions, this disease can cause a 30%-50% reduction in rice yield, and in severe cases, a 50% reduction, seriously threatening food security. Currently, control of this disease mainly relies on chemical control, such as the application of pesticides like difenoconazole and thifluzamide. However, long-term use of chemical fungicides not only exacerbates pathogen resistance but also threatens farmland ecological security and rice quality, such as causing a decline in aquatic biodiversity in paddy fields and excessive pesticide residues in rice. Furthermore, the lack of high-level resistance sources and major or high-effect resistance genes has resulted in slow progress in cloning sheath blight resistance genes, severely hindering the progress of sheath blight resistance breeding. This has also led to the vast majority of currently promoted varieties being susceptible to sheath blight. Therefore, exploring sheath blight resistance gene resources is of great significance.

[0003] Rice resistance to sheath blight is a typical quantitative trait, regulated by multiple genes or quantitative trait loci (QTLs). Although researchers have identified several QTLs associated with resistance, the stability and reliability of most reported QTLs still need further validation under different genetic backgrounds and environmental conditions because sheath blight resistance is highly susceptible to interference from field environment, cultivation practices, and the plant's own agronomic traits (such as plant height and tiller number).

[0004] Against this backdrop, genome-wide association studies (GWAS) have demonstrated unique advantages. This technology can perform genome-wide genetic variation scanning on natural germplasm populations, directly screening for genetic markers significantly associated with target traits from the population by performing large-scale statistical association between genotype data and phenotypic data, thereby rapidly identifying candidate genes. In recent years, with the rapid development and cost reduction of high-throughput sequencing and microarray genotyping technologies, GWAS based on diverse natural populations has been widely applied to the genetic analysis of complex traits in rice.

[0005] Compared to traditional gene screening methods, the core advantage of GWAS lies in its ability to quickly and efficiently identify molecular markers and potential dominant alleles associated with phenotypes in large quantities, without requiring the time-consuming construction of specialized populations. In the field of sheath blight resistance research, scholars both domestically and internationally have utilized GWAS in numerous studies, successfully identifying a series of new associated loci and providing valuable clues for discovering sheath blight resistance genes. Summary of the Invention

[0006] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a gene OsMPS related to rice resistance to sheath blight. By using CRISPR / Cas9 editing to knock out this gene, the resistance of rice to sheath blight can be effectively improved, which can effectively solve the problem of difficult control of sheath blight in actual rice production and promote the process of breeding rice with resistance to sheath blight.

[0007] Technical solution: In order to achieve the above objectives, the present invention provides a CDS sequence of the gene OsMPS related to rice resistance to sheath blight, the CDS sequence being shown in SEQ ID NO.1.

[0008] The full-length sequence of the gene OsMPS, which is related to rice resistance to sheath blight, is shown in SEQ ID NO.2.

[0009] Among them, the gene knockout vector pCXUN-Cas9-OsMPS that regulates the rice sheath blight resistance gene OsMPS.

[0010] Furthermore, the gene knockout vector construction method involves designing and synthesizing the sgRNA of the target site: AGCGCAGGAAGACAAGCTGCTGG, digesting it with enzymes and ligating it into the pCXUN-Cas9 vector, transforming it with E. coli, extracting the plasmid, and finally obtaining the gene knockout vector pCXUN-Cas9-OsMPS.

[0011] Furthermore, CRISPR / Cas9 editing of the OsMPS gene resulted in knockout transgenic rice that effectively improved rice resistance to sheath blight.

[0012] The application of the CDS sequence of the OsMPS gene, the full-length sequence of the OsMPS gene, or the gene knockout vector described in this invention in the cultivation of rice germplasm resistant to sheath blight.

[0013] Among them, the application of the knockout gene OsMPS described in this invention in the breeding of transgenic rice resistant to sheath blight.

[0014] Furthermore, the application of the knockout gene OsMPS described in this invention in rice sheath blight resistance breeding.

[0015] The application of the OsMPS gene knockout rice described in this invention in any of the following:

[0016] (1) Regulating plant resistance to sheath blight;

[0017] (2) Gene knockout transgenic rice seedlings were obtained by gene CRISPR / Cas9 editing.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0019] This invention screened for the gene OsMPS, which is associated with resistance to rice sheath blight, through genome-wide association analysis (GWAS). Knocking out this gene significantly enhanced rice resistance to sheath blight. This indicates that the knockout line of this gene can be used for genetic improvement of rice resistance to sheath blight, promoting the process of disease-resistant breeding and possessing significant application value in cultivating sheath blight-resistant varieties. Attached Figure Description

[0020] Figure 1 Genome-wide association analysis of disease indicators of rice sheath blight in Taihu rice population in 2024;

[0021] Figure 2 This illustrates the expression patterns of this gene in different tissues of rice.

[0022] Figure 3 The expression characteristics of the OsMPS gene in wild-type plants after inoculation with *Rhizoctonia solani* at different time points;

[0023] Figure 4 A schematic diagram of two knockout lines of the OsMPS gene;

[0024] Figure 5 The results show the identification of in vitro sheath blight resistance in OsMPS knockout lines and wild-type lines, where A represents the phenotype of in vitro sheath blight resistance identification in OsMPS knockout lines and wild-type lines, and B represents the bar chart of lesion length identification in in vitro sheath blight resistance identification in OsMPS knockout lines and wild-type lines. This indicates the result of the T-test at the P<0.0001 level. Detailed Implementation

[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0026] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] Experimental methods not specified in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0028] The rice genetic transformation material used in this invention is the japonica rice variety Nipponbare (NIP), provided by the Rice Germplasm Resource Bank of Yangzhou University.

[0029] Example 1

[0030] Identification and cloning of the OsMPS gene

[0031] To investigate rice resistance to sheath blight and screen for potential resistance genes, we resequencing and in vitro sheath blight resistance identification were performed on 296 rice varieties from Taihu rice germplasm resources previously collected and organized by our laboratory. Genome-wide association analysis (GWAS) was conducted on the sheath blight phenotype and genotype of the rice population, identifying a significantly associated region on chromosome 2 (physical location 24.324-24.703 Mb) with sheath blight resistance. Combining this with transcriptome data from seven rice varieties constructed by our laboratory before and after sheath blight infection, all semantic genes within this region were analyzed, ultimately identifying the gene OsMPS (…) which is significantly associated with sheath blight resistance. Figure 1 The gene exhibited a sustained upregulation of expression after infection with *Rhizoctonia solani*, prompting further investigation into its knockout. Primers were designed: F: 5'-ATGGAAGGGCAGCAGTTCGC-3', R: 5'-GTAGAAAGCGAGGCCTTTAT-3'. Using cDNA from NIP seedling leaves as a template, the CDS sequence of the rice OsMPS gene was amplified as shown in SEQ ID NO.1, and the full length of the OsMPS gene is shown in SEQ ID NO.2.

[0032] Example 2

[0033] OsMPS gene expression characterization analysis

[0034] Root, stem, leaf, leaf sheath, and panicle tissues from the booting stage of the susceptible rice variety NIP were selected as materials, and RNA was extracted from each tissue. RNA extraction was performed using Invitrogen's Trizol reagent according to its manufacturer's instructions. Genomic DNA contamination was then removed using Promega's RNase-free DNase I, following the kit's instructions. Subsequently, the first strand of cDNA was synthesized using TaKaRa's PrimeScript RT reagent Kit With gDNA Eraser, following the manufacturer's instructions. The reaction conditions were: 37°C for 30 min, 85°C for 5 sec, and storage at 4°C. Using cDNA from various tissues as templates and the rice Actin gene as an internal reference gene (amplification primer sequences: forward primer F: 5'-TGTATGCCAGTGGTCGTACCA-3', reverse primer R: 5'-CCAGCAAGGTCGAGACGAA-3'), real-time quantitative PCR was performed with OsMPS gene-specific quantitative primers (OsMPS: 5'-CCTGGCAGGACGGACAAC-3'; OsMPS: 5'-AAGGTTGTCGTCCACCACC-3') to detect the expression specificity of the OsMPS gene in different rice tissues. The real-time quantitative PCR reaction conditions were: 95℃ pre-denaturation for 2 min; followed by 40 cycles of amplification with cycling parameters of 95℃ for 15 sec, 60℃ for 10 sec, and 72℃ for 10 sec. The qPCR results showed that the OsMPS gene was mainly expressed at high levels in roots, leaves, and leaf sheaths, with the highest expression level observed in roots. Figure 2 ).

[0035] NIPs were cultured under normal field conditions until the late tillering stage and then inoculated with *Rhizoctonia solani* YN-7. The inoculation method was used (Pan Xuebiao, *Journal of Jiangsu Agricultural College*, 1997, (03): 28-33). A 1cm long and 2mm wide piece of wood covered with *Rhizoctonia solani* YN-7 hyphae (enough to be fully coated with hyphae) was carefully embedded into the leaf sheath 1-2 cm below the second leaf from the top of the rice plant. Leaf sheath tissues of 1cm above and below the inoculation were harvested before inoculation (0h) and 8h and 16h after inoculation, and then frozen in liquid nitrogen. The experimental procedures for RNA extraction, reverse transcription, and qRT-PCR were the same as those for determining the expression levels in rice tissues. Figure 3 As shown, the OsMPS gene exhibits a characteristic of continuous upregulation after infection with Sheath blight pathogen.

[0036] Example 3

[0037] Vector construction, genetic transformation and detection

[0038] 1. Steps for constructing a CRISPR / Cas9 knockout vector using the rice OsMPS gene:

[0039] (1) Select a high-efficiency knockout target site; design and synthesize an sgRNA that recognizes the target site, with the sequence sgRNA: 5'-AGGCGCAGGAAGACAAGCTGCTGG-3'.

[0040] (2) Linearize the pCXUN-Cas9 vector by single digestion with restriction endonuclease KpnI at specific restriction sites. (Refer to Chinese Invention Patent CN108949805A)

[0041] (3) The linearized vector was combined with sgRNA. The reaction system was as follows: sgRNA 4µL; linearized vector template after enzyme digestion 3µL; recombinase (Exnase II from Novizan Biosciences) 1µL; recombinant buffer (5×CEⅡBuffer from Novizan Biosciences) 2µL; H2O 4µL. The PCR instrument was run at 37℃ for 30 min and then stored on ice.

[0042] (4) In a clean bench, the recombinant plasmid was aspirated into competent E. coli (DH5α) cells and placed on ice for 30-45 minutes. Then, the cells were heat-shocked at 42°C for 60-90 minutes and then quickly placed on ice for 3-4 minutes. 600 μL of non-resistant LB medium was added to the clean bench, aspirated and mixed, and then placed on a shaker at 37°C for 45 minutes-1 hour. The cells were then centrifuged at 3000g for 2-3 minutes. 400 μL of supernatant was discarded, and the remaining bacterial culture was resuspended. Finally, the remaining liquid was evenly spread on LB medium with kanamycin resistance using a pipette and incubated overnight at 37°C with the medium inverted.

[0043] (5) Randomly select 8 single clones from the plate and place them into 2 mL sterile EP centrifuge tubes. Add 600 µL of LB liquid containing kanamycin beforehand, and shake until the tube becomes turbid. Take 5 µL of bacterial solution from each sample for PCR reaction, select positive clones and sequence them for verification. The primer sequences for the PCR reaction are as follows:

[0044] OsMPS-ko-F: 5'-ACTCGCTAGCTCATCACTGC-3',

[0045] OsMPS-ko-R: 5'-TGGCGACAGAATTCCACCTC-3';

[0046] The constructed knockout vector plasmid was sent to Weimi Biotechnology Co., Ltd. for rice genetic transformation. The recipient rice variety was NIP (Nipponbare).

[0047] The genetic transformation of the transgenes in this invention was obtained by Weimi Biotechnology Co., Ltd. using conventional transgenic technology experiments, resulting in two transgene knockout lines, named OsMPS-ko1 and OsMPS-ko2, respectively. Through testing, as... Figure 4 As shown, there are two types of mutations in the transgenic knockout lines: OsMPSko-1 has an A base inserted, and OsMPSko-2 has a T base inserted.

[0048] Example 4

[0049] Identification of resistance to sheath blight in in vitro stems of transgenic rice plants

[0050] Using the wild-type rice variety NIP as a control group, the resistance of the control group and the knockout lines (OsMPS-ko1 and OsMPS-ko2) to rice detached stem blight was identified.

[0051] The method for identifying resistance to in vitro sheath blight is as follows:

[0052] For inoculation with detached stem materials, detached stem samples were taken from rice plants at the early panicle initiation stage. Stems from each plant, as well as wild-type plants, were cut off, leaving only the flag leaf and the second leaf from the top. These were then placed in water overnight to allow the rice to acclimatize to the climatology chamber environment and prevent water loss. The next day, the same embedding method was used for inoculation. A piece of wood bark (1.0 cm long and 2 mm wide, fully coated with mycelium of *Rhizoctonia solani* RH-9) was carefully placed 1 cm below the leaf sheath of the second leaf from the top. After inoculation, the stems were inserted into test tubes containing floral foam and then transferred to a nutrient solution. The plants were then placed in an environment with 14 hours of light (30℃), 10 hours of darkness (26℃), and 90% humidity. Eight to ten detached stems were collected from each line, and the length of lesions was assessed seven days after inoculation.

[0053] When using in vitro inoculation, such as Figure 5 As shown, the average lesion length of the knockout lines (OsMPS-ko1 and OsMPS-ko2) was significantly lower than that of the wild-type plants. These results indicate that the OsMPS gene negatively regulates rice sheath blight resistance, and knocking out this gene can significantly improve rice sheath blight resistance.

Claims

1. A CDS sequence of a gene OsMPS related to rice sheath blight resistance, characterized in that, The CDS sequence is shown in SEQ ID NO.

1.

2. The full-length sequence of the gene OsMPS associated with rice sheath blight resistance according to claim 1, wherein, The full-length sequence of the gene OsMPS is shown in SEQ ID NO.

2. ​ 3. A gene knockout vector pCXUN-Cas9-OsMPS based on the rice sheath blight resistance gene OsMPS as described in claim 1. 4.The gene knockout vector pCXUN-Cas9-OsMPS of claim 3, wherein, The gene knockout vector construction method involves designing and synthesizing sgRNA targeting the target site, digesting it with enzymes and ligating it into the pCXUN-Cas9 vector, and then transforming it with E. coli and Agrobacterium to finally obtain the gene knockout vector pCXUN-Cas9-OsMPS.

5. The gene knockout vector pCXUN-Cas9-OsMPS according to claim 4, characterized in that, The sgRNA is AGCGCAGGAAGACAAGCTGCTGG.

6. The application of a CDS sequence of the gene OsMPS according to claim 1, the full-length sequence of the gene OsMPS according to claim 2, or the gene knockout vector according to claim 3 in regulating rice sheath blight resistance.

7. The application according to claim 6, characterized in that, CRISPR / Cas9 was used to edit the OsMPS gene in rice to improve its resistance to sheath blight.

8. The application of a CDS sequence of the gene OsMPS according to claim 1, the full-length sequence of the gene OsMPS according to claim 2, or the gene knockout vector according to claim 3 in the cultivation of rice germplasm resistant to sheath blight.

Images