Application of OsECT3 gene in changing cold tolerance of rice
By regulating the expression of the OsECT3 gene, rice varieties with different cold tolerance were bred, solving the problem of rice's sensitivity to low temperatures and achieving a significant increase or decrease in cold tolerance, thus providing a new method for rice breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2026-04-29
- Publication Date
- 2026-06-30
AI Technical Summary
In existing technologies, rice is sensitive to low temperatures, which can lead to slow growth, yellowing, poor development, wilting, and even death of rice seedlings, affecting yield and quality. Furthermore, there are no reports on the role of OsECT3 in regulating low-temperature stress in rice.
By regulating the expression of the OsECT3 gene through hybridization or genetic engineering, its activity in rice plants can be enhanced or weakened, thereby cultivating rice varieties with different cold tolerance. Furthermore, by screening and detecting the expression status of the OsECT3 gene, OsECT3 knockout and complementary materials can be constructed to verify their cold tolerance effects.
Significantly improving or decreasing the cold tolerance of rice provides a molecular basis for cultivating high-quality rice resources and offers new methods for future breeding. The OsECT3 mutant exhibits decreased cold tolerance while the complementary material exhibits increased cold tolerance.
Smart Images

Figure CN122303303A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of rice molecular breeding, specifically involving... OsECT3 The application of genes in altering cold tolerance in rice, and a rice breeding method for altering cold tolerance in rice. Background Technology
[0002] Rice ( Oryza sativa As the staple food of more than half the world's population, rice production faces severe challenges, especially in recent years due to increasingly frequent cold weather events, leading to a significant decline in the yield and quality of rice originating from tropical or subtropical regions. Rice is a crop sensitive to low temperatures; when rice seedlings encounter low temperatures, they suffer from stunted growth, yellowing, poor development, wilting, and even death. Low temperatures during the reproductive growth stage of rice directly affect the yield and quality of the grains. Therefore, developing cold-resistant rice varieties is an urgent problem to be solved.
[0003] OsECT3 (Evolutionarily Conserved C-Terminal region 3) encodes an mRNA adenine methylation modification (m6A) binding protein containing a conserved YTH (YT521-B homology) domain.
[0004] Currently, there are no reports on whether OsECT3 regulates low-temperature stress in rice. Summary of the Invention
[0005] This invention provides OsECT3 Application of genes in altering cold tolerance in rice.
[0006] This invention also provides a rice breeding method for modifying the cold tolerance of rice. On the one hand, we can make rice varieties that do not express active... OsECT3 The gene originates from active expression in rice plants. OsECT3 Genes were used to cultivate rice varieties with higher cold resistance.
[0007] On the other hand, we can also make the expression active. OsECT3 The gene that originates in rice plants is not expressed and is not active. OsECT3 Genes are used to breed rice varieties with lower cold tolerance. Although lower cold tolerance may seem like a detrimental trait in the final rice variety, it can be useful for specific purposes, such as using lower cold-tolerant rice varieties as intermediate varieties for hybridization or genetic manipulation to facilitate further breeding.
[0008] In one specific implementation scheme, the active [products] are obtained through hybridization. OsECT3 Genes were introduced into the non-expressing, inactive cells.OsECT3 The gene originates in the rice plant and is then expressed in an active manner. OsECT3 Genes; or Using genetic engineering methods to OsECT3 Gene expression cassettes are introduced into the non-expressing, inactive cells. OsECT3 The gene originates in the rice plant and is then expressed in an active manner. OsECT3 Gene.
[0009] In one specific implementation, the expression is made active through hybridization. OsECT3 The gene that originates in rice plants is not expressed and is not active. OsECT3 Genes; or The expressed active gene was knocked out using genetic engineering methods. OsECT3 Gene origin in rice plants OsECT3 Genes, or the genes that make the stated OsECT3 Gene mutation into inactive; or The expression is made active by physical or chemical mutagenesis. OsECT3 Gene origin in rice plants OsECT3 The gene mutates into an inactive form.
[0010] This invention also provides a method for screening the cold tolerance of rice, including detecting whether active [expression of [organism / symbol] is expressed in the target rice plant. OsECT3 The steps of gene generation.
[0011] In one specific implementation scheme, the OsECT3 The amino acid sequence encoded by the gene is shown in SEQ ID NO:2.
[0012] In one specific implementation scheme, the OsECT3 The nucleic acid sequence of the gene is shown in SEQ ID NO:2.
[0013] This invention has unearthed OsECT3 In regulating the response of rice to low-temperature stress, by constructing OsECT3 The knockout materials and complementary materials verified OsECT3 The mutant rice plants exhibited significantly reduced cold tolerance, while the complementary materials showed a marked increase in cold tolerance. This provides a new perspective for creating high-quality rice resources and offers a molecular basis for future breeding of rice varieties with cold tolerance or other superior traits. Attached Figure Description
[0014] Figure 1 for OsECT3 A schematic diagram of the gene structure and the CRISPR editing method. The upper part of the diagram shows... OsECT3 The diagram shows the gene structure and the method of editing its sequence using CRISPR knockout technology.
[0015] Figure 2 for OsECT3 Identification of positive families with complementary materials. Among them, AB represents... OsECT3 Identification of positive families for complementary material (COM-E3); CD indicates loss of m6A binding ability. OsECT3 Complementary materials (COM-E3) 3WA Identification of positive family pedigrees.
[0016] Figure 3 for OsECT3 Positive regulation of rice response to low temperature stress. WT (ZH11) osect3 Representative images and survival rate statistics of mutants before and after treatment and recovery.
[0017] Figure 4 For WT, osect3 Mutant materials and complementary materials (COM-E3) and complementary materials lacking the m6A domain (COM-E3) 3WA Phenotypic analysis and survival rate statistics after low-temperature treatment.
[0018] Figure 5 For WT, osect3 Mutant materials and complementary materials (COM-E3) and complementary materials lacking the m6A domain (COM-E3) 3WA Conductivity statistics before and after low-temperature treatment. Detailed Implementation
[0019] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.
[0020] 1. OsECT3 gene knockout Obtaining rice OsECT3 The sequence of the gene is shown in SEQ ID NO:1; the encoded amino acid sequence is shown in SEQ ID NO:2.
[0021] according to OsECT3 Gene sequence, select two knockout target sites: OsECT3 -target 1: 5'-GCGTGGCGATTCCTCCTGAG-3' (SEQ ID NO: 3); OsECT3 -target 2: 5'-GAAGGAACTCCACCTAGCAA-3' (SEQ ID NO: 4).
[0022] The target site was fused into the promoter sequence of TKC via homologous recombination and amplified to obtain a promoter sequence containing the target site. The amplified fragment was then cleaved with the corresponding restriction endonucleases in the knockout vector TKC. The resulting fragment was then ligated with homologous recombinase and heat-shocked into competent Trnas5α cells to obtain the transformation vector. TKC- OsECT3 The vectors were introduced into the rice receptor Zhonghua11 (ZH11) using Agrobacterium-mediated transgenic method to obtain the corresponding transformed plants.
[0023] The results are as follows Figure 1 As shown, the mutant yielded two homozygous families. The first family's mutation type is... OsECT3 The mutations in the first family were of two types: insertion of one base and deletion of five bases in the exon, causing premature termination of the coding sequence. The second family exhibited the following mutation type: OsECT3 There are two types of premature termination of encoding: insertion of one base and deletion of four bases in the exon.
[0024] 2. Complementation of knockout mutants according to OsECT3 Gene sequence, design OsECT3 Complementary vector primers, primer sequences are as follows: PFA2300-promoter-F: CCGCATGCGTCGACTCTAGACTTCCATATCACAATAAACC (SEQ IDNO:5); Promoter-R-2: GGCCATGGCTTTGGCTCACGAGATAG (SEQ ID NO: 6); CDS-F: TATCTCGTGAGCCAAAGCCATGGCCGCCGTCGCGCCG (SEQ ID NO:7); PFA2300-E3-CDS-R: CCCCCGGGCTGCAGTCTAGAACTAGCTTTGACGGTGCCGT (SEQ ID NO: 8).
[0025] The target sequence was amplified using the primers described above. The amplified fragment was then cut into the knockout vector using the corresponding restriction endonucleases. The vector was then ligated with homologous recombinases and heat-shocked into competent Trnas5α cells. The transformation vector Pfa2300-OsECT3 was obtained; this vector was then introduced into rice recipients using Agrobacterium-mediated transgenic methods. osect3 In the process, corresponding positive transformation plants were obtained.
[0026] The results are as follows Figure 2As shown, positive complementary strains were obtained after detecting gene expression levels and protein levels, respectively.
[0027] 3. OsECT3 Impact on plant survival rate Select ZH11 wild-type (WT) with consistent growth. 、OsECT3 The mutant and complementary seedlings were grown under normal hydroponic conditions for 2 weeks, and then placed in a 4℃ incubator for low-temperature treatment for 3 days; after 14 days, the survival rate of each material was counted.
[0028] The results are as follows Figure 3 and 4 As shown, after low-temperature stress treatment, compared to the wild type, osect3 The mutants exhibited a significantly reduced survival rate. The results are as follows: Figure 4 As shown, after low-temperature stress treatment, the COM-E3 complementary material can improve the survival rate of mutants. 3WA Plants (that have lost the ability to bind m6A) OsECT3 Survival rate of complementary materials osect3 There were no significant differences between the mutants.
[0029] 4. OsECT3 Effect on the conductivity of plant tissues Take WT with consistent growth, OsECT3 Mutant, COM-E3, COM-E3 3WA Complementary seedlings were grown under normal hydroponic conditions for 2 weeks, and then subjected to low-temperature treatment for 3 days for conductivity testing.
[0030] The results are as follows Figure 5 As shown, OsECT3 Mutants and COM-E3 3WA The plant exhibited high conductivity, while the COM-E3 complementary material showed no significant change.
[0031] Although only specific methods are listed in the embodiments of the present invention for making wild-type rice and OsECT3 Mutants, as demonstrated by the experiments of this invention, have in fact proven... OsECT3 The mutation makes rice sensitive to cold stress. OsECT3 The compensating material partially compensates for the mutant phenotype. This is readily understood by those skilled in the art after reading this invention; it only requires the use of appropriate methods to... OsECT3 The cold tolerance of rice can be improved by filling in the mutant mutation. Therefore, the means to achieve the above objective should not be used to limit the scope of protection of this invention; all means that can achieve the above objective should be included within the scope of protection of this invention.
[0032] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. OsECT3 Application of genes in altering cold tolerance in rice.
2. A rice breeding method for modifying the cold tolerance of rice, characterized in that, Including making non-expressing active substances OsECT3 The gene originates from active expression in rice plants. OsECT3 The steps of gene generation; or, To make expression active OsECT3 The gene that originates in rice plants is not expressed and is not active. OsECT3 The steps of gene generation.
3. The method according to claim 2, characterized in that, By hybridization, active OsECT3 Genes were introduced into the non-expressing, inactive cells. OsECT3 The gene originates in the rice plant and is then expressed in an active manner. OsECT3 Gene; or Using genetic engineering methods to OsECT3 Gene expression cassettes are introduced into the non-expressing, inactive cells. OsECT3 The gene originates in the rice plant and is then expressed in an active manner. OsECT3 Gene.
4. The method according to claim 2, characterized in that, The expression was made active through hybridization. OsECT3 The gene that originates in rice plants is not expressed and is not active. OsECT3 Gene; or The expressed active gene was knocked out using genetic engineering methods. OsECT3 Gene origin in rice plants OsECT3 Genes, or the genes that make the stated OsECT3 Gene mutation results in inactivity; or The expression is made active by physical or chemical mutagenesis. OsECT3 Gene origin in rice plants OsECT3 The gene mutates into an inactive form.
5. A method for screening the cold tolerance of rice, characterized in that, This includes detecting whether the target rice plant expresses active [the substance / form]. OsECT3 The steps of gene generation.
6. The application according to claim 1 or the method according to any one of claims 2-5, characterized in that, The active OsECT3 The amino acid sequence encoded by the gene is shown in SEQ ID NO:
2.
7. The application or method according to claim 6, characterized in that, The active OsECT3 The nucleic acid sequence of the gene is shown in SEQ ID NO:2.