Application of heterologous overexpression of FpPbH1 gene in improving resistance of wheat and rice to multiple pathogens
By heterologously overexpressing the FpPbH1 gene in wheat and rice, the problem of limited disease resistance gene resources in existing technologies has been solved, achieving broad-spectrum resistance to multiple pathogens and the effects of increased yield and reduced pesticide use.
Patent Information
- Application Number
- CN202610786441.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-02
- Publication Date
- 2026-06-30
AI Technical Summary
Existing methods for breeding disease-resistant wheat and rice rely on limited natural disease-resistant gene resources. Single disease-resistant genes are prone to losing their resistance and are difficult to produce broad-spectrum resistance to multiple pathogens.
Heterologous overexpression of the *Fusarium graminearum* FpPbH1 gene in wheat and rice, and improvement of plant resistance to multiple pathogens by transduction of the overexpression vector via *Agrobacterium tumefaciens*.
It significantly enhances the resistance of transgenic wheat to wheat stem rot and rice to rice blast and sheath blight, without affecting agronomic traits, thus achieving the effect of increasing yield and reducing pesticide use.
Smart Images

Figure CN122303312A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural biotechnology, specifically, it relates to heterologous overexpression. FpPbH1 Application of genes in improving the resistance of wheat and rice to a variety of pathogens. Background Technology
[0002] Wheat stem rot is a soil-borne disease caused by a combination of pathogens, including *Fusarium graminearum*, *Fusarium graminearum*, and *Fusarium asiaticum*, with *Fusarium graminearum* being the dominant pathogen. This disease primarily affects the base of the wheat stem and roots, leading to premature aging and lodging of the plant. In severe cases, it can cause large-scale yield reduction or even total crop failure. With changes in cropping systems, the widespread adoption of straw return to the field, and continuous cropping, the incidence of wheat stem rot has been expanding, occurring to varying degrees in all major wheat-growing areas of China. Furthermore, the pathogens can survive in the soil for extended periods, increasing the difficulty of control. This disease not only directly affects wheat yield and quality but also poses a potential threat to agricultural production safety; therefore, strengthening research and control of wheat stem rot is of great significance.
[0003] Traditional methods for breeding disease resistance in wheat and rice primarily rely on naturally occurring disease-resistant gene resources, introducing these genes into superior wheat and rice varieties through hybridization and selection. However, naturally occurring disease-resistant gene resources are limited, and single disease-resistant genes often only provide resistance to specific physiological races of pathogens, easily losing their resistance due to variations in these physiological races. Therefore, discovering new disease-resistant gene resources and cultivating wheat and rice varieties with broad-spectrum disease resistance is a key issue in current wheat and rice disease resistance breeding.
[0004] Targeted modification of wheat and rice genomes through biobreeding techniques holds promise for obtaining wheat and rice germplasm resources with unique disease resistance mechanisms. The development of modern biotechnology has provided new approaches for the control of stem base rot using gene technology. CN202011509914.2 discloses a wheat stem base rot gene sequence, TaDIR-B1, and utilizes this gene to construct a gene silencing vector, which can be used for breeding wheat varieties resistant to stem base rot or for the control of wheat stem base rot. CN202310977744.8 discloses a gene fragment for the control of wheat stem base rot. Fp487 The dsRNA synthesized by the gene targeting this gene fragment can effectively reduce the infectivity of pathogens, thereby controlling wheat stem base rot. CN202510702208.6 discloses a gene regulating wheat stem base rot. TaTrx-m The positive regulatory role of this technology in wheat stem base rot has been clarified, and it can be applied to the development of disease resistance molecular markers, gene editing and transgenic breeding, providing core genetic resources for the breeding of disease-resistant varieties, and has both theoretical and practical value. Summary of the Invention
[0005] The purpose of this invention is to provide more gene resources for disease resistance in wheat and rice. Through extensive research and screening, this invention has discovered a heterologous overexpression of *Fusarium graminearum* in wheat and rice. FpPbH1 The present invention is achieved through a gene-based strategy. Specifically, the technical solution of the present invention is as follows: In one aspect, the present invention provides *Fusarium pseudograssii*. FpPbH1 The application of gene therapy in enhancing crop disease resistance, the aforementioned FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0006] In some embodiments, the crop is selected from wheat and rice.
[0007] In some embodiments, the *Fusarium graminearum* FpPbH1 Genes can enhance crop resistance to diseases caused by fungal infection. Preferably, the fungi are selected from Fusarium graminearum, rice blast fungus, and Rhizoctonia solani.
[0008] In one aspect, the present invention provides a product containing... FpPbH1 The application of gene sequence overexpression vectors in enhancing crop disease resistance, the FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0009] In one aspect, the present invention discloses a method for preparing an antifungal wheat or rice variety, the method comprising: [the method involves] exceeding the permitted levels of certain fungi in wheat or rice. FpPbH1 Genes, the ones mentioned FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0010] In some embodiments, overexpression is achieved via Agrobacterium tumefaciens transduction. FpPbH1 Gene vectors are introduced into wheat or rice to obtain the antifungal wheat or rice varieties.
[0011] This invention discovers that heterologous overexpression in wheat and rice... FpPbH1 Genes do not affect agronomic traits in wheat and rice seeds; this invention relates to the cloning and identification of Fusarium pseudograminearum. FpPbH1 The gene's DNA fragment, which, when heterologously overexpressed, can enhance plant resistance to various pathogens, is shown in SEQ ID NO.1; FpPbH1 After the gene is transferred into wheat and rice, disease-resistant varieties can be obtained and then applied to production. Beneficial effects
[0012] This invention discovered Fusarium pseudograss FpPbH1After the gene was transferred into wheat or rice, the resulting transgenic wheat showed significantly enhanced resistance to wheat stem rot, and the transgenic rice showed significantly enhanced resistance to rice blast and sheath blight, without affecting agronomic traits, thus achieving the goal of increasing yield and reducing pesticide use. This transgenic material has great application potential. Attached Figure Description
[0013] Figure 1 : FpPbH1 Statistical analysis of growth and development phenotypes in wheat and rice with heterologous overexpression of the gene. Among them, (AB) wheat plants were used as control (EV) transgenic plants and transgenic wheat plants were used as control (EV) transgenic plants. FpPbH1 Images and statistical data on grain length, grain width, and thousand-grain weight of heterologous overexpression wheat plants (HE-2 and HE-3). Rice plants transgenic with empty vector (EV) and transgenic... FpPbH1 Images and statistical data on grain length, grain width, and thousand-grain weight of heterologous overexpression rice plants (HE-16 and HE-20).
[0014] Figure 2 : FpPbH1 Disease resistance analysis of wheat and rice with heterologous overexpression of genes. (A) Control (EV) and FpPbH1 Analysis of resistance to Fusarium graminearum in heterologous overexpression wheat plants (HE-2 and HE-3). (B) Control (EV) and FpPbH1 Analysis of resistance to rice blast in heterologous overexpression rice plants (HE-16 and HE-20). (C) Control (EV) and FpPbH1 Analysis of resistance to sheath blight in rice plants (HE-16 and HE-20) expressing heterologous overexpression. **** indicates statistical analysis. P <0.00001. Detailed Implementation
[0015] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention. Example 1 1.1 Preservation and culture of test strains and test plants
[0016] (1) The wild-type strains of Fusarium pseudograss Fp-1, rice blast fungus strain Guy11, and sheath blight strain HG84 (Rhizoctonia solani) tested are wild-type strains used in the identification of disease resistance in wheat and rice in this invention.
[0017] (2) The wheat tested was Fielder and the rice was Zhonghua 11 (ZH11), which were the background plants for the genetic transformation of wheat and rice in this invention.
[0018] (3) Escherichia coli ( Escherichia coli Top 10 strains of Agrobacterium ( ) Agrobacterium tumefaciens The strain EHA105 was purchased from Beijing TransGen Biotechnology Co., Ltd.
[0019] 1.2 Fusarium pseudomonas FpPbH1 Construction of gene overexpression vectors and rice transformation Using wild-type cDNA of Fusarium graminearum as a template, primers were used. FpPbH1 -F / R is used for amplification. FpPbH1 Gene coding sequence (SEQ ID NO.1), in which FpPbH1 -F:GACAAGCTTGGTACCTCTAGAATGTTCCGTCTCTCTTCGATCATC (SEQ ID NO.2); FpPbH1 -R: gtctttgtagtccatactagtTCAGCAGACGTTCTTCTTAGCG (SEQ ID NO. 3). The sequence was ligated into the pEXT06f vector using a One Step Cloning Kit to obtain the overexpression vector pEXT06f- FpPbH1 The empty vector pEXT06f and the overexpression vector pEXT06f- FpPbH1 Plasmid electroporation was used to transform Agrobacterium tumefaciens EHA105, and the transformation was carried out in wheat and rice using the Agrobacterium tumefaciens-mediated genetic transformation system (ATMT). The transformation of wheat and rice was carried out by Wuhan Boyuan Biotechnology Co., Ltd.
[0020] 1.3 FpPbH1 Statistical analysis of agronomic traits in seeds of plants with heterologous overexpression of genes right FpPbH1 Phenotypic analysis was performed on heterologous overexpression transgenic wheat and rice seeds. FpPbH1 Heterologous overexpression transgenic wheat, rice, and empty vector transgenic lines were planted in wheat and rice fields. After harvesting, the growth phenotypes such as thousand-grain weight and grain size were recorded.
[0021] Results: Wheat and wheat samples from the empty vector control group... FpPbH1 Wheat plants that underwent heterologous overexpression showed no significant differences in seed length, width, and thousand-seed weight, indicating... FpPbH1 It does not affect the agronomic traits of wheat seeds; rice and wheat seed control group transformed with empty vectors FpPbH1 Rice plants that underwent heterologous overexpression showed no significant differences in seed length, width, and thousand-grain weight, indicating... FpPbH1It does not affect the agronomic traits of rice seeds; 1.4 FpPbH1 Disease resistance assay of plants with heterologous gene overexpression Resistance analysis against *Fusarium graminearum*: Spores of *Fusarium graminearum* were collected from the CMC culture filtrate after 3 days of culture, and the spore concentration was adjusted to a uniform 1×10⁻⁶. 6 Spores were added dropwise to the tip of wheat coleoptiles at a concentration of 1 / mL. After 24 hours of incubation at 25°C in the dark, the spores were transferred to a greenhouse for alternating light and dark treatment for 5-7 days. The length of lesions at the base of the wheat stem was measured and photographed. The experiment was repeated three times. Wheat stem base tissue infected with *Fusarium graminearum* was cut and flash-frozen in liquid nitrogen. RNA was extracted by grinding and reverse transcribed into cDNA. Then, wheat... Tubulin Genes used as internal reference genes in Fusarium pseudobulb Actin The gene was used as a detection gene for qRT-PCR analysis to detect the relative amount of Fusarium graminearum in the infected plants.
[0022] Rice blast resistance analysis: Rice leaves at four weeks of age were selected for inoculation with *Bacillus oryzae*. Wounds were made on the leaves using an inoculation needle, and a suspension of conidia of *Bacillus oryzae* strain Guy11 was dripped onto the wounds. The inoculated rice was placed in a 28℃ artificial climate incubator for humidified culture. Initially, the rice was cultured in the dark for 24 hours, followed by full-light culture. Disease incidence was observed and lesion length was recorded 7 days after inoculation.
[0023] Sheath blight resistance analysis: Rice leaves at four weeks of age were selected for inoculation with sheath blight pathogens. The fungal cake of strain HG84 was inoculated onto the rice leaves. The inoculated rice was placed in a 28℃ artificial climate incubator for moist cultivation. Initially, the rice was cultured in the dark for 24 hours, followed by full-light cultivation. Disease incidence was observed and the area of lesions was recorded 1-2 days after inoculation.
[0024] Results: After infection with Fusarium graminearum, compared with the empty vector control EV plants, FpPbH1 The length of lesions and the biomass of pathogens in wheat plants with heterologous overexpression were significantly reduced; after infection with rice blast fungus, compared with the empty vector control EV plants, FpPbH1 The length of lesions in heterologous overexpression rice plants was significantly reduced; after infection with *Rhizoctonia solani*, compared with the empty vector control EV plants, FpPbH1 The lesion area of heterologous overexpression rice plants was significantly reduced; these results indicate that... FpPbH1 Genetically modified wheat exhibits significantly enhanced resistance to wheat stem rot. FpPbH1 Genetically modified rice exhibits significantly enhanced resistance to rice blast and sheath blight.
[0025] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.
Claims
1. Fusarium pseudobulb FpPbH1 The application of gene therapy in enhancing crop disease resistance is characterized by, The FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The crops are selected from wheat and rice.
3. The application according to claim 1, characterized in that, The pseudofusarium FpPbH1 Genes can enhance crops' resistance to diseases caused by fungal infections.
4. The application according to claim 1, characterized in that, The fungi were selected from Fusarium pseudograss, rice blast fungus, and Rhizoctonia solani.
5. Including FpPbH1 The application of gene sequence overexpression vectors in enhancing crop disease resistance is characterized by, The FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.
1.
6. A method for preparing a wheat or rice variety resistant to fungal infection, characterized in that, The method involves overexpression in wheat or rice. FpPbH1 Genes, the ones mentioned FpPbH1 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.
1.
7. The method according to claim 6, characterized in that, Overexpression via Agrobacterium tumefaciens transduction FpPbH1 Gene vectors are introduced into wheat or rice to obtain the antifungal wheat or rice varieties.
Citation Information
Patent Citations
Wheat stem rot related gene TaDIR-B1 and application thereof
CN112852829A
Gene fragments for preventing and controlling wheat stem rot and their application
CN116970623B
Wheat stem rot regulatory gene Tatrx-m, encoding protein thereof, recombinant vector and application of wheat stem rot regulatory gene Tatrx-m
CN120758513A