A crRNA target point and crisper-cas13a system for detecting west nile virus

By designing a CRISPR-Cas13a system and specific crRNA, combined with RAA amplification primers, the problem of the inability of existing technologies to detect West Nile virus quickly, easily, and with high sensitivity was solved, achieving high sensitivity and specificity for the detection of West Nile virus nucleic acid.

CN122303494APending Publication Date: 2026-06-30ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2026-05-27
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing West Nile virus detection methods cannot maintain high sensitivity and specificity while being rapid and convenient, especially in suburban horse farms far from urban areas, where they cannot meet the need for early and rapid screening.

Method used

A CRISPR-Cas13a system was designed, comprising the Cas13a protein and specific crRNA, to detect West Nile virus by targeting its nucleic acid sequence. Combined with RAA amplification primers and reporter RNA, it enables rapid and highly sensitive detection.

Benefits of technology

It achieves highly sensitive detection of West Nile virus nucleic acid, with a sensitivity of one copy/μL, and can perform specific identification under simple conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303494A_ABST
    Figure CN122303494A_ABST
Patent Text Reader

Abstract

This invention discloses a crRNA target and a CRISPR-Cas13a system for detecting West Nile virus. The West Nile virus target sequence is shown in SEQ ID NO.1. The CRISPR-Cas13a system includes Cas13a protein and crRNA, or a complex of the two. The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the West Nile virus target sequence. The West Nile virus target sequence is shown in SEQ ID NO.1 and is located at positions 274-301 of the West Nile virus genome. Experiments demonstrate that the crRNA of this invention can achieve highly sensitive and specific detection of West Nile virus nucleic acid by activating Cas13a, with a sensitivity reaching one copy (1 copy / μL).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a crRNA target and CRISPR-Cas13a system for detecting West Nile virus. Background Technology

[0002] West Nile virus (WNV) belongs to the Flaviviridae family and Flavivirus genus. It is a widely transmitted zoonotic virus that can infect multiple hosts, including humans, birds, and horses. As a single-stranded positive-sense RNA virus, its genome encodes a polyprotein, which, after cleavage, forms three structural proteins (capsid protein C, membrane protein prM / M, and envelope protein E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). Protein E is involved in viral invasion of host cells, while protein NS5 is a key RNA polymerase for viral replication. The primary vector for West Nile virus is the Culex mosquito, with birds being its main reservoir host. The virus can be transmitted to humans and horses through mosquito bites, and in rare cases, through mother-to-child transmission and blood transfusion. Most human infections present as asymptomatically or with mild flu-like symptoms, but approximately 1% of infected individuals develop severe encephalitis or meningitis. The mortality rate is higher in high-risk groups such as the elderly. This virus has caused outbreaks in multiple regions globally and has been listed by the World Health Organization (WHO) as a vector-borne virus requiring key control. Its spread continues to expand due to factors such as climate change and the expansion of mosquito distribution, highlighting its potential for widespread epidemics. Since the beginning of the 21st century, the virus has exhibited a pattern of frequent, large-scale local outbreaks. Currently, the main detection methods for West Nile virus include PCR-based, enzyme-linked immunosorbent assay (ELISA)-based, and isothermal amplification-based methods. PCR-based methods have the advantage of high sensitivity, but are cumbersome to perform and require laboratory testing, with a single test taking several hours. ELISA-based and isothermal amplification-based methods are simpler to perform than PCR-based methods, but their sensitivity is somewhat reduced.

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and related proteins (Cas) constitute an acquired immune system, first discovered in archaea. Further research revealed that upon binding to target RNA, the Cas13a protein is activated, enabling the cleavage of non-target RNA. By attaching detectable target clusters to both ends of the non-target RNA, the target RNA can be indirectly detected by detecting these target clusters—this is the CRISPR-Cas13a detection method.

[0004] Currently, the main detection methods for West Nile virus include PCR-based, enzyme-linked immunosorbent assay (ELISA)-based, and isothermal amplification-based methods. PCR-based methods offer high sensitivity, but are cumbersome to perform and require laboratory testing, with each test taking several hours. Since West Nile virus outbreaks often occur in suburban horse farms far from urban areas, these methods are insufficient for rapid early screening. ELISA-based and isothermal amplification-based methods are simpler to perform than PCR-based methods, but their sensitivity is somewhat reduced. In summary, existing detection methods cannot simultaneously achieve rapid and convenient testing while maintaining high sensitivity. Therefore, there is an urgent need to develop a rapid, convenient, highly sensitive, and highly specific detection method for West Nile virus detection. Summary of the Invention

[0005] Based on the technical problems existing in the prior art, the present invention provides a CRISPR-Cas13a system for rapid detection of West Nile virus nucleic acid and its application.

[0006] According to a first aspect of the present invention, a crRNA target for detecting West Nile virus is provided, wherein the West Nile virus target sequence is SEQ ID NO.1.

[0007] According to a second aspect of the present invention, a CRISPR-Cas13a system for detecting West Nile virus is provided, the CRISPR-Cas13a system comprising Cas13a protein and crRNA, or a complex thereof; the crRNA comprising an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting a West Nile virus target sequence; the West Nile virus target sequence is shown in SEQ ID NO.1, and the West Nile virus target sequence is located at positions 274-301 of the West Nile virus genome (GeneID: KC736488.1).

[0008] Preferably, in the CRISPR-Cas13a system described above, the crRNA sequence is as shown in SEQ ID NO.2. Specifically, positions 1-38 of SEQ ID NO.2 are anchoring sequences for binding to the Cas13a protein; positions 39-66 of SEQ ID NO.2 are guide sequences for targeting West Nile virus target sequences.

[0009] Preferably, in the CRISPR-Cas13a system described above, the Cas13a protein is the LwCas13a protein.

[0010] According to a third aspect of the present invention, a kit for detecting West Nile virus is provided, comprising the aforementioned CRISPR-Cas13a system for detecting West Nile virus.

[0011] Preferably, in the CRISPR-Cas13a system described above, the kit further includes RAA amplification primers for specifically amplifying the West Nile virus target sequence; the RAA amplification primers consist of single-stranded DNA molecules shown in SEQ ID NO.4 and SEQ ID NO.5.

[0012] Preferably, the kit further includes other reagents for specifically amplifying the West Nile virus target sequence and other reagents for detecting the amplification products. The other reagents for specifically amplifying the West Nile virus target sequence include buffer and / or ddH2O; the other reagents for detecting the amplification products include all or some of the following: LwCas13a protein, NTP (such as NTP Mix), T7 RNA polymerase, RNase inhibitor, reporter RNA (fluorescent reporter RNA with signal reporting function or reporter RNA for test strip detection), and RNase-free water.

[0013] The kit may also include a carrier containing the following judgment criteria A or judgment criteria B: CRISPR Criterion A for the Cas13a fluorescence detection system: Set up at least 3 independent replicate experiments and compare whether the mean fluorescence values ​​at 60 minutes are significantly different among the groups (using t-test, P<0.05). If the test sample is significantly different from the negative control group (using ddH2O as a template), then the test sample contains or is a candidate for containing West Nile virus; otherwise, the test sample does not contain or is a candidate for not containing West Nile virus.

[0014] CRISPR Cas13a test strip system judgment standard B: After the reaction, the system is dropped onto the test strip for 2 seconds. The test strip is interpreted after 5 minutes. If no "T" line appears but a "C" line appears, the sample contains or is a candidate for West Nile virus. If both a "T" line and a "C" line appear, the sample does not contain or is a candidate for West Nile virus. If no "C" line appears, the test strip is invalid and needs to be replaced and the test repeated.

[0015] According to the fifth aspect of the technical solution of the present invention, any of the following substances is provided: A1) The crRNA mentioned above; A2) The Cas13a protein and crRNA mentioned above, or a complex formed by the two; A3) The primer pairs mentioned above.

[0016] According to the sixth aspect of the technical solution of the present invention, any of the following applications are provided: B1) The use of the above-described system, kit, or substance in the detection or auxiliary detection of West Nile virus or its nucleic acid; B2) The use of the above-described system, kit, or substance in the preparation of products for the detection or auxiliary detection of West Nile virus or its nucleic acid; B3) The application of the above-mentioned system, kit, or substance in detecting or assisting in the detection of whether a sample contains West Nile virus or its nucleic acid; B4) The application of the above-described system, kit, or substance in the preparation of products for detecting or assisting in the detection of whether a sample contains West Nile virus or its nucleic acid; B5) The application of the above-mentioned system, kit, or substance in screening or assisting in screening drugs for the prevention and treatment of West Nile virus. B6) The use of the above-described system, kit, or substance in the preparation of products for screening or assisting in screening West Nile virus prevention and control drugs. B7) The use of the above-mentioned substances in the preparation of the above-mentioned kit.

[0017] According to the seventh aspect of the present invention, an application for detecting the crRNA target of West Nile virus as described above is provided, wherein the application is to prepare crRNA or to prepare RAA amplification primers for specifically amplifying the target sequence of West Nile virus or to prepare a positive control for detecting West Nile virus.

[0018] According to the eighth aspect of the technical solution of the present invention, a method for detecting or assisting in the detection of West Nile virus is provided, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of single-stranded DNA molecules shown in SEQ ID NO.4 and single-stranded DNA molecules shown in SEQ ID NO.5 to obtain RAA products; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein described above, the crRNA described above, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; water is used instead of the PCR product as a negative control. C3) The CRISPR-Cas13a detection system is reacted, and the reaction products are detected to determine whether the sample to be tested contains West Nile virus.

[0019] In some embodiments, in step C1), the reaction conditions for RAA amplification are: 39°C for 30 minutes.

[0020] The CRISPR-Cas13a detection system reaction in step C3) above is a fluorescence system reaction C3). 1 or test strip system reaction C3) 2: C3) 1: The CRISPR Cas13a detection system, and CRISPR The RNA in the Cas13a detection system is a fluorescent reporter RNA. This CRISPR... The Cas13a detection system is placed in a real-time PCR instrument for reaction, and the fluorescence intensity is detected. The presence of West Nile virus in the sample is determined based on the fluorescence intensity: if the fluorescence intensity of the sample is significantly different from that of the negative control (ddH2O) within the same detection time, the sample contains or is a candidate for containing West Nile virus; otherwise, the sample does not contain or is a candidate for not containing West Nile virus. (Step C3 above) In step 1, the reaction conditions are: 37℃, fluorescence intensity value is read every 2 minutes, for a total of 30 readings.

[0021] C3) 2: The CRISPR The Cas13a detection system reacts, and CRISPR... The RNA in the Cas13a detection system is the reporter RNA detected by the test strip. The reaction product is detected using the test strip, and the presence of West Nile virus in the sample is determined by whether the "T" line disappears and the "C" line appears: if the "T" line disappears and the "C" line appears within the same detection time, the sample contains or is a candidate for containing West Nile virus; otherwise, the sample does not contain or is a candidate for not containing West Nile virus. (Step C3 above) In step 2, the reaction conditions are: 37℃, reaction time 30 min.

[0022] In some embodiments, the application is for non-diagnostic purposes.

[0023] Compared with the prior art, the above-mentioned technical solution of the present invention has at least the following beneficial effects: This invention is based on CRISPR The Cas13a nucleic acid detection technology, through design, construction, and screening, ultimately provides a target sequence for West Nile virus detection and a specific crRNA that can target this sequence. This crRNA can activate Cas13a to achieve highly sensitive and specific detection of West Nile virus nucleic acid, with a sensitivity of one copy (1 copy / μL). Attached Figure Description

[0024] Figure 1Results of plasmid PCR+CRISPR fluorescence screening for crRNA.

[0025] Figure 2 For use of 10 3 Results of screening RAA primer combinations using plasmids of copies / µL and preliminarily screened crRNA.

[0026] Figure 3 For use of 10 1 A curve of crRNA screening using plasmids of copies / µL and preliminary RAA primer combinations.

[0027] Figure 4 For use of 10 1 Results of crRNA screening using plasmid copies / µL and preliminary RAA primer combinations (60 min).

[0028] Figure 5 For use of 10 0 Results of screening for RAA primer combinations with plasmids of copies / µL and optimal crRNA.

[0029] Figure 6 CRISPR for the optimal RAA primer combination and the optimal crRNA Cas13a detection curves for different concentrations of WNV nucleic acid.

[0030] Figure 7 CRISPR for the optimal RAA primer combination and the optimal crRNA Results of Cas13a detection of different concentrations of WNV nucleic acid (60 min).

[0031] Figure 8 CRISPR for the optimal RAA primer combination and the optimal crRNA Images of Cas13a test strips for detecting different concentrations of WNV nucleic acid.

[0032] Figure 9 CRISPR for the optimal RAA primer combination and the optimal crRNA Grayscale images of the T-line of the Cas13a test strip for detecting different concentrations of WNV nucleic acid.

[0033] Figure 10 CRISPR targeting WNV nucleic acids Cas13a did not show cross-reactivity when detecting other pathogens (test strip image).

[0034] Figure 11 CRISPR targeting WNV nucleic acids Cas13a did not show cross-reactivity when detecting other pathogens (test strip T-line grayscale image). Detailed Implementation

[0035] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0037] RNA Isothermal Rapid Amplification Kit (Basic Type) II (Amp Future, 25110810C), NTP Mix (Beyotime, B600057), RNase inhibitor (Murine RNase inhibitor, Novizan, R301-03), 2× Taq MasterMix (Novizan, P111-01), T7 RNA Polymerase (NEB, 10267234), T7 Transcription Kit (T7 QuickHigh Yield RNA Synthesis kit, NEB, E2050S), Fluorescent Reporter RNA (Tulugang, 25702810), MgCl2 (Thermo Fisher Scientific, AM9530G), HEPES (Solepro, 15630-080), LwaCas13a protein (GenScript, Z03486), 2× Super PfxMasterMix (CWBIO, 07984 / 15624), anhydrous ethanol (Sinopharm Shanghai Laboratory, 20210809), chloroform (Sinopharm Shanghai Laboratory, 20200908), RNA Clean XP kit (BECKMAN COULTER, A63987), Tris balanced phenol (Sollarbio, T0250), RNase-free ddH2O (Biosharp, 01625099AG), test strip report RNA (Tianyi Huiyuan, 203130347), CRISPR test strip (Hangzhou Zhongce, 211108004).

[0038] Nucleic acid was extracted from eight viruses: CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (tick encephalitis virus), YFV (yellow fever virus), DENV (dengue virus), ZIKV (Zika virus), IBV (influenza B virus), and MERS-CoV (Middle East Respiratory Syndrome Coronavirus).

[0039] Example 1: West Nile virus nucleic acid detection kit and detection method based on CRISPR-Cas13a system (I) West Nile Virus Nucleic Acid Detection Kit Based on CRISPR-Cas13a System I. Preparation of crRNA Four crRNAs were designed from the conserved WNV sequence (SEQ ID NO.3) of West Nile virus: WNV-crRNA1, WNV-crRNA2, WNV-crRNA3, and WNV-crRNA4. The target sequences corresponding to each WNV-crRNA sequence are as follows: The target sequences for WNV-crRNA1 are as follows: AATACGATTGTGTTGGCTCTCTTGGCG, located at positions 225-252 of the WNV genome (GeneID: KC736488.1); the target sequences for WNV-crRNA2 are as follows: TGGCTCTCTTGGCGTTCTTCAGGTTCAC, located at positions 239-266 of the WNV genome (GeneID: KC736488.1); the target sequences for WNV-crRNA3 are as follows: CTCTCTTGGCGTTCTTCAGGTTCACAGC, located at positions 242-269 of the WNV genome (GeneID: KC736488.1); and the target sequences for WNV-crRNA4 are as follows: GCTCCGACCCGAGCAGTGCTGGATCGAT (SEQ ID NO.1), located at positions 274-301 of the WNV genome (GeneID: KC736488.1). The synthesis method of the above crRNA is as follows: 1. Primer sequence synthesis Synthesize the sequences in Table 1.

[0040] Table 1. Primer sequences

[0041] 2. PCR amplification The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O to prepare the PCR reaction system. The PCR reaction system is shown in Table 2.

[0042] Table 2. PCR amplification system

[0043] PCR reaction conditions: 95℃ for 5 min heat denaturation; 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min; automatic extension at 72℃ for 10 min; storage of PCR products at 4℃. Four PCR products were obtained by amplification using the WNV-gRNA primer pairs shown in Table 1.

[0044] 3. Purification of PCR products The four PCR products obtained in step 2 were purified using Tris-balanced phenol. The specific steps are as follows: 700 μL of Tris-balanced phenol was added to an equal volume of chloroform, vortexed, and briefly centrifuged, discarding the supernatant. 600 μL of the phenol-chloroform mixture was added to 200 μL of the PCR product, mixed, and centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a new 1.5 mL centrifuge tube, and anhydrous ethanol was added to make a supernatant-to-ethanol ratio of 3:7. The tube was centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded. 200 μL of 75% ethanol was added, and the tube was centrifuged at 12,000 rpm for 10 min, discarding the supernatant (this step was repeated three times). The resulting precipitate was air-dried at room temperature (approximately 10 min) to obtain the four purified PCR products.

[0045] The above four purified PCR products were added to 40 μL of RNase-free water, and the concentration was detected by an ultra-micro spectrophotometer. They were then stored at -80℃.

[0046] 4. Transcription Take 1 μg of the four purified PCR product aqueous solutions obtained in step 3, and use the T7 transcription kit (NEB) to transcribe crRNA. The crRNA transcription system is shown in Table 3.

[0047] Table 3. crRNA transcription system

[0048] After mixing the above crRNA transcription system, transcribe overnight at 37°C.

[0049] The transcribed crRNA sequences were named WNV-crRNA1, WNV-crRNA2, WNV-crRNA3, and WNV-crRNA4, with the WNV-crRNA4 sequence as follows: GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACATCGATCCAGCACTGCTCGGGTCGGAGC (SEQ ID NO.2), where positions 1-38 of SEQ ID NO.2 are anchoring sequences for binding to the Cas13a protein; and positions 39-66 of SEQ ID NO.2 are guide sequences for targeting the WNV target sequence.

[0050] The target sequence of WNV-crRNA4 is as follows: GCTCCGACCCGAGCAGTGCTGGATCGAT (SEQ ID NO.1), located at positions 274-301 of the WNV genome (GeneID: KC736488.1). The prepared WNV-crRNA4 was used for subsequent CRISPR-Cas13a detection.

[0051] 5. crRNA purification The specific steps are as follows: Vortex the magnetic beads (RNA Clean XP) to mix. Add 36 μL of magnetic beads and 100 μL of isopropanol to 20 μL of transcription product. Mix the magnetic beads and transcription system by pipetting 10 times and incubate at room temperature for 10 min. Place the reaction system on a magnetic rack and incubate for 10 min to separate the magnetic beads. Gently aspirate the liquid from the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free ddH2O water) to the magnetic beads and incubate at room temperature for 30 s. Aspirate the ethanol. Repeat this process to wash the magnetic beads, for a total of 3 times. Air dry the system at room temperature to remove the ethanol, approximately 10 min. Add 30 μL of RNase-free ddH2O water, pipette and vortex 10 times, let stand for 5 min, then place on a magnetic rack until the system is clear. Aspirate the supernatant and transfer it to a 1.5 mL centrifuge tube. Measure the concentration of the purified crRNA using a micro spectrophotometer. Dilute to 100 ng / μL and aliquot at -80℃ for use.

[0052] The above crRNA sequence was used for the following CRISPR-Cas13a detection of West Nile virus.

[0053] II. Preparation of plasmid standards 1. Plasmid sequence Plasmid-WNV is a recombinant plasmid obtained by inserting the following sequence from the West Nile virus genome: ATGTCTAAGAAACCAGGAGGGCCCGGCAAGAGCCGGGCTGTCAATATGCTAAAACGCGGAATGCCCCGCGTGTTGTCCTTGATTGGACTGAAGAGGGCTATGTTGAGCCTGATCGACGGCAAGGGGCCAATACGATTTGTGTTGGCTCTCTTGGCGTTCTTCAGGTTCACAGCAATTGCTCCGACCCGAGCAGTGCTGGATCGATGGAGAGGTGTGAACAAACAAACAGCGATGAAACACCTTCTGAGTTTTAAGAAGGAACTAGGGACCTTGACCAGTGCTATCAATCGGCGGAGCTCAAAACAAAAGAAAAGAGGAGGAA (SEQ ID NO. 3) into the pUC57 vector (Beijing Tianyi Huiyuan Company).

[0054] Beijing Tianyi Huiyuan Company extracted 5 μg of recombinant plasmid.

[0055] According to the formula: copies / μL = 6.02 × 10 23 × (ng / μL) ×10 9 / (DNA Length × 660), the above 5 μg of recombinant plasmid was diluted with 20 μL of water to obtain a copy number of 1.68 × 10. 11 Plasmid copies / μL WNV.

[0056] 2. Dilution The above plasmids were serially diluted 10-fold to obtain plasmid standards of different concentrations.

[0057] III. Design of RAA Amplification Primers and Obtaining RAA Amplification Products 1. Design of RAA amplification primers Based on the RPA primers designed in reference (PMID: 27246147), WNV-specific RAA primers were designed for CRISPR detection. These primers have a T7 transcription sequence at the 5' end, allowing the double-stranded DNA (dsDNA) obtained from RAA amplification to be recognized and transcribed by T7 RNA polymerase. The primer sequences are shown in Table 4 and were synthesized by Beijing Tianyi Huiyuan Co., Ltd.

[0058] Table 4, WNV RAA amplification primers

[0059] 2. Obtaining RAA amplification products Using plasmid standards as templates, RAA amplification was performed using primers designed in step 1 to obtain RAA amplification products. The RAA amplification system is shown in Table 5.

[0060] Table 5. RAA amplification system

[0061] Add 47.5 μL of the mixed solution to the basic reaction unit containing the lyophilized powder, and allow the lyophilized powder to fully reconstitute. Add 2.5 μL of B Buffer (a component of the RAA amplification kit) to the cap of each reaction tube, close the cap, briefly collect, and mix thoroughly. Incubate the reaction tubes at 39°C for 30 minutes to obtain the RAA amplification product.

[0062] (II) A method for detecting West Nile virus nucleic acid based on the CRISPR-Cas13a system I. Preparation of plasmid PCR + CRISPR-Cas13a fluorescence detection system 1. Based on the principles of PCR primer design and reference (PMID: 32160714), upstream and downstream primers for plasmid PCR were designed. A T7 promoter sequence was introduced at the 5′ end of the upstream primer to facilitate subsequent transcription. Upstream primer: WNV-PCR-F sequence is aattctaatacgactcactatagggCTAAGAAACCAGGAGGGCCC (where 1-25 are the T7 promoter sequence). Downstream primer: WNV-PCR-R sequence is TTTTGTTTTGAGCTCCGCCG. Both upstream and downstream primers were synthesized by Beijing Tianyi Huiyuan Company.

[0063] 2. Obtaining plasmid PCR products The sequence synthesized in step 1 above was diluted to 10 μM with ddH2O, and the plasmid PCR reaction system was prepared according to Table 6. Table 6. Plasmid PCR System

[0064] Plasmid PCR reaction conditions: 95℃ for 5 min heat denaturation; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 12 s, for a total of 35 cycles; 72℃ for automatic extension for 5 min; PCR products stored at 4℃.

[0065] 3. Take 5 μL of the plasmid PCR amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0066] Table 7 CRISPR-Cas13a fluorescence detection system

[0067] PCR tubes containing the reaction system shown in Table 7 above were placed in a real-time PCR instrument. The excitation wavelength of the channel was set to 490 nm, the emission wavelength to 520 nm, and the temperature to 37 °C. The values ​​were read every 2 minutes for a total of 30 readings over 60 minutes to detect changes in fluorescence intensity in the system.

[0068] Result determination: If, within the same detection time, the mean fluorescence intensity value of the test sample detection system is significantly different from the mean fluorescence intensity value of the negative control (ddH2O), then the test sample contains or is a candidate for containing West Nile virus; otherwise, the test sample does not contain or is a candidate for not containing West Nile virus. II. Preparation of the RAA+CRISPR-Cas13a fluorescence detection system Using primers WNV-RAA-F1 and WNV-RAA-R2 from section 3.1 of (I) above, the nucleic acid of the sample to be tested was amplified using RAA to obtain the RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 8 below.

[0069] The negative control is to replace the RAA product in Table 8 with ddH2O while keeping other reagent components unchanged.

[0070] Table 8. CRISPR-Cas13a fluorescence detection system

[0071] PCR tubes containing the reaction systems shown in Table 8 above were placed in a real-time PCR instrument. The excitation wavelength of the channel was set to 490 nm, the emission wavelength to 520 nm, and the temperature to 37 °C. The values ​​were read every 2 minutes for a total of 30 readings over 60 minutes to detect changes in fluorescence intensity in the system.

[0072] Result determination: If, within the same detection time, the mean fluorescence intensity value of the test sample detection system is significantly different from the mean fluorescence intensity value of the negative control (ddH2O), then the test sample contains or is a candidate for containing West Nile virus; otherwise, the test sample does not contain or is a candidate for not containing West Nile virus. III. Preparation of the CRISPR-Cas13a test strip detection system Using primers WNV-RAA-F1 and WNV-RAA-R2 from section 3.1 of (I) above, the nucleic acid of the sample to be tested was amplified using RAA to obtain the RAA amplification product; Take 5 μL of the RAA amplification product obtained above as a template and prepare CRISPR according to Table 7 below. Cas13a detection system.

[0073] The negative control is to replace the RAA product in Table 9 with ddH2O while keeping other reagent components unchanged.

[0074] Table 9, CRISPR Cas13a test strip detection system

[0075] Cover the reaction tube containing the reaction system shown in Table 9 and invert it 5 times. Mix 6 times and centrifuge at low speed for 10 seconds each time. Place the reaction tube at 37°C for 30 minutes. After the reaction is complete, add the entire reaction system (50 μL) to the sample well of the CRISPR test paper.

[0076] Result determination: After the reaction system is dropped onto the test paper, 2... The test strip is interpreted after 5 minutes. If no "T" line appears but a "C" line appears, the sample contains or is a candidate for West Nile virus. If both a "T" line and a "C" line appear, the sample does not contain or is a candidate for West Nile virus. If no "C" line appears, the test strip is invalid and needs to be replaced and the test repeated.

[0077] (III) Based on CRISPR Optimization of the conditions for detecting West Nile virus nucleic acid using the Cas13a system I. Screening of Optimal RAA Primers and Optimal crRNA 1. The diluted concentration prepared using (I) is 10. 2 Using a plasmid standard of copies / μL as a template, plasmid PCR amplification was performed using the method described in Table 6 of Section I in (II) above to obtain the plasmid PCR amplification product.

[0078] Take 5 μL of the PCR amplification product of the above plasmid, and perform fluorescence detection using the method in Table 7 of Section 1 of (II) and the four types of crRNA prepared in Section 1 of (I). The results are as follows. Figure 1 As shown.

[0079] Figure 1The results showed that after 60 minutes, all four crRNA groups were significantly different from their respective negative control groups. Among them, the fluorescence value of crRNA4 was (18315±503) RFU, which was better than that of crRNA1 (6079±262) RFU, crRNA2 (4843±18) RFU, and crRNA3 (7319±568) RFU. Therefore, crRNA4 was selected as the crRNA for initial screening and further experiments were conducted.

[0080] 2. The diluted concentration prepared using (I) is 10. 3 Using a plasmid standard of copies / μL as a template, the upstream and downstream primers of RAA were combined in pairs (F1&R1, F1&R2, F1&R3, F2&R1, F2&R2, F2&R3, F3&R1, F3&R2, F3&R3) and amplified according to the method in Table 5 of Section 3 in (I).

[0081] Take 5 μL of the amplified product and perform fluorescence detection according to the method in Table 8 of section (II). The crRNA is WNV-crRNA4. The results are as follows. Figure 2 As shown.

[0082] Figure 2 As shown: In the three repeated experiments, the fluorescence values ​​of F1R2 and F2R2 were high in the first experiment, high in the second experiment, and high in the third experiment. Based on the results of the three experiments, F1R2 was selected as the RAA primer for initial screening and further experiments were carried out.

[0083] 3. The diluted concentration prepared using (I) is 10. 1 Using a plasmid standard of copies / μL as a template, amplification was performed using the RAA primer F1R2 selected from the initial screening, following the method in Table 5 of Section 3 of Part (I).

[0084] Take 5 μL of the amplified product and the four crRNAs prepared in (I) 1, and perform fluorescence detection according to the method in Table 8 of (II). The results are as follows. Figure 3 , 4 As shown.

[0085] Figure 3 Indicate: Use 10 1 A curve of crRNA screening using plasmids of copies / µL and preliminary RAA primer combinations.

[0086] Figure 4As shown: Comparing the fluorescence values ​​at 60 min, the fluorescence values ​​of crRNA1 (9135±510) RFU, crRNA2 (3446±72) RFU, crRNA3 (5931±176) RFU, and crRNA4 (13959±3025) RFU were all higher than those of the other three crRNA groups and the negative control group, and the difference was significant. Therefore, crRNA4 (the optimal crRNA) was selected for the next step of the experiment.

[0087] 4. The diluted concentration prepared using (I) is 10. 0 Using a plasmid standard of copies / μL as a template, the upstream and downstream primers of RAA were combined in pairs (F1&R1, F2&R1, F3&R1, F1&R2, F2&R2, F3&R2, F1&R3, F2&R3, F3&R3) and amplified according to the method in Table 5 of Section 3 in (I).

[0088] Take 5 μL of the amplified product and perform fluorescence detection according to the method in Table 8 of section (II). The crRNA is WNV-crRNA4 (optimal crRNA). The results are as follows. Figure 5 As shown.

[0089] Figure 5 As shown: In the three repeated experiments, the fluorescence value of F1R2 was high in the first, second and third experiments. Based on the results of the three experiments, F1R2 (i.e. WNV-RAA-F1, WNV-RAA-R2) was selected as the optimal RAA primer combination.

[0090] Example 2: Sensitivity detection of West Nile virus nucleic acid based on CRISPR-Cas13a system.

[0091] Using serially diluted plasmid standards as templates, plasmids containing different concentrations of the WNV gene fragment were detected according to the method in Example 1 to test the sensitivity of the method of the present invention. The specific steps are as follows: 1. The plasmid standard obtained in step (a) of Example 1 was serially diluted with water to obtain plasmid solutions containing different concentrations of the WNV gene fragment: 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.

[0092] 2. Perform RAA amplification according to the method in step (I) of Example 1, using primers WNV-RAA-F1 and WNV-RAA-R2 (optimal primers) to obtain RAA amplification products.

[0093] 3. CRISPR fluorescence detection: Take 5 μL of LRAA amplification product and detect West Nile virus nucleic acid using the CRISPR-Cas13a fluorescence system according to the method in step (II) of Example 1. Simultaneously, use water as a template for the amplification product as a negative control. The crRNA is WNV-crRNA4 (optimal crRNA).

[0094] CRISPR-Cas13a detection results are as follows: Figure 6 and Figure 7 As shown.

[0095] Figure 6 Showing: Optimal RAA primer combination and optimal crRNA CRISPR Cas13a detection curves for different concentrations of WNV nucleic acid.

[0096] Figure 7 Indicated: Compare fluorescence values ​​at 60 minutes, 10 2 -10 0 Compared with the negative control, the fluorescence intensity of copies / μL showed a significant statistical difference, indicating that the CRISPR involved in this invention... The Cas13a detection system has a sensitivity of one copy (1 copy / μL) for detecting WNV nucleic acid.

[0097] 4. CRISPR test strip detection The plasmid standard obtained in step (a) of Example 1 was serially diluted with water to obtain plasmid solutions containing different concentrations of the WNV gene fragment: 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.

[0098] RAA amplification was performed according to the method in step (I) of Example 1, using primers WNV-RAA-F1 and WNV-RAA-R2 (optimal primers), to obtain RAA amplification products.

[0099] Take 5 μL of RAA amplification product and detect WNV nucleic acid using the method in step (II) of Example 1 via the CRISPR-Cas13a system. Simultaneously, use the amplification product with ddH2O as a template as a negative control. crRNA represents WNV nucleic acid. crRNA4.

[0100] RAA CRISPR test strip results are as follows: Figure 8 , 9 As shown.

[0101] Figure 8 Instructions: Using WNV When detecting WNV nucleic acid with crRNA4, at 10 2 10 0 The "T" line disappears and the "C" line appears in the copies / μL group, 10 -1 Both copies / μL and the T and C lines were visible in the negative control group, therefore, 10 were determined to be positive. 2 10 0 The copies / μL group was positive, 10 -1 The copies / μL group and the negative control group were negative.

[0102] Figure 9 Show: 10 2 10 0 In the three repeated experiments of the copies / μL group, the gray value of the T line was 0 and 10 in all cases. -1 The experiment was repeated three times with copies / μL and a negative control group, and the gray value of the T line was greater than 0 in all cases.

[0103] comprehensive Figure 8 and Figure 9 As a result, RAA The CRISPR test strip has a sensitivity of up to one copy (1 copy / μL) for detecting WNV nucleic acid.

[0104] Example 3: Based on CRISPR Specific detection of West Nile virus nucleic acid using the Cas13a system Eight viruses—CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (tick-borne encephalitis virus), YFV (yellow fever virus), DENV (dengue virus), ZIKV (Zika virus), IBV (influenza B virus), and MERS-CoV (Middle East Respiratory Syndrome Coronavirus)—were tested for their nucleic acids according to the method described in Example 1 (II) to verify the specificity of the method of the present invention. The specific steps are as follows: 1. Each in 10 3 Nucleic acid samples from 8 viruses (CHIKV, JEV, TBEV, YFV, DENV, ZIKV, IBV, and MERS-CoV) and 10 copies / μL were collected. 3Using WNV plasmid copies / μL as a detection template, RAA amplification was performed according to the method in step (I) of Example 1 to obtain RAA amplification products. Primers WNV-RAA-F1 and WNV-RAA-R2 were used.

[0105] 2. Take 5 μL of RAA amplification product and detect WNV nucleic acid using the method in step (II) of Example 1 based on the CRISPR-Cas13a system. Simultaneously, use the amplification product with ddH2O as a template as a negative control. crRNA represents WNV nucleic acid. crRNA4.

[0106] CRISPR Cas13a test results are as follows Figure 10 and Figure 11 show Figure 10 Instructions: Using WNV When crRNA4 was used to detect different viral nucleic acids, only the WNV group showed a disappearance of the "T" line and the appearance of the "C" line, while the other groups and the negative control group showed both the "T" line and the "C" line.

[0107] Three repeated experiments were conducted. The gray value of the T line in the WNV group was 0, while the gray value of the T line in all other groups and the negative control group was greater than 0.

[0108] comprehensive Figure 10 and Figure 11 As a result, the present invention is based on CRISPR The Cas13a system's method for detecting West Nile virus sites has high specificity, and there is no cross-reactivity during the detection process.

[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0110] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A crRNA target for detecting West Nile virus, characterized in that, The target sequence of the West Nile virus is SEQ ID NO.

1.

2. A CRISPR-Cas13a system for detecting West Nile virus, characterized in that, The CRISPR-Cas13a system comprises the Cas13a protein and crRNA, or a complex of the two. The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting a West Nile virus target sequence, as shown in SEQ ID NO.

1.

3. The CRISPR-Cas13a system according to claim 2, characterized in that: The crRNA sequence is shown in SEQ ID NO.

2.

4. The CRISPR-Cas13a system according to claim 2 or 3, characterized in that: The Cas13a protein is the LwCas13a protein.

5. A kit for detecting West Nile virus, comprising the CRISPR-Cas13a system for detecting West Nile virus as described in any one of claims 2-4.

6. The reagent kit according to claim 5, characterized in that: The kit also includes RAA amplification primers for specifically amplifying West Nile virus target sequences; the RAA amplification primers consist of single-stranded DNA molecules shown in SEQ ID NO.4 and SEQ ID NO.

5.

7. Any of the following substances: A1) The crRNA as described in any one of claims 2-4; A2) The Cas13a protein and crRNA as described in any one of claims 2-4, or a complex thereof; A3) The primer pair as described in claim 6.

8. Any of the following applications: B1) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in the detection or auxiliary detection of West Nile virus or its nucleic acid; B2) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in the preparation of products for detecting or assisting in the detection of West Nile virus or its nucleic acid; B3) The use of the CRISPR-Cas13a system of any one of claims 2-4, the kit of claim 5 or 6, or the substance of claim 7 in detecting or assisting in the detection of whether a sample to be tested contains West Nile virus or its nucleic acid; B4) The use of the CRISPR-Cas13a system of any one of claims 2-4, the kit of claim 5 or 6, or the substance of claim 7 in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains West Nile virus or its nucleic acid; B5) The use of the CRISPR-Cas13a system according to any one of claims 2-4, the kit according to claim 5 or 6, or the substance according to claim 7 in screening or assisting in screening drugs for the prevention and treatment of West Nile virus; B6) The use of the CRISPR-Cas13a system of any one of claims 2-4, the kit of claim 5 or 6, or the substance of claim 7 in the preparation of products for screening or assisting in screening for West Nile virus prevention and treatment drugs; B7) Use of the substance of claim 7 in the preparation of the kit of claim 5 or 6.

9. A method for detecting or assisting in the detection of West Nile virus, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of single-stranded DNA molecules shown in SEQ ID NO.4 and single-stranded DNA molecules shown in SEQ ID NO.5 to obtain RAA products; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein as described in any one of claims 2-4, the crRNA as described in any one of claims 2-4, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; water is used instead of the PCR product as a negative control. C3) The CRISPR-Cas13a detection system is reacted, and the reaction products are detected to determine whether the sample to be tested contains West Nile virus.

10. The method according to claim 9, characterized in that: In step C1), the reaction conditions for RAA amplification are: reaction at 39°C for 30 minutes.