Specific primer, Taqman probe and application for detecting bacillus velezensis strain HMB26553
By designing specific primers and Taqman probes, and combining them with real-time PCR technology, the problem of rapid and accurate detection of Bacillus belysus HMB26553 strain was solved, achieving high sensitivity and high efficiency in quantitative monitoring.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2022-09-07
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate identification and quantitative monitoring of Bacillus belyssus strain HMB26553, especially during large-scale liquid fermentation and application to the cotton rhizosphere, where efficient detection methods are lacking.
We designed specific primers and Taqman probes to achieve specific detection of Bacillus belyssus HMB26553 strain using real-time PCR technology. By accumulating fluorescence signals to synchronize PCR product formation, we provide a detection method with high sensitivity and high specificity.
It achieves specific detection of Bacillus belysus strain HMB26553, with high sensitivity, low false positive rate and high efficiency. It can linearly detect within the range of 10 copies, accurately monitor the number of strains, and improve the accuracy and efficiency of detection.
Smart Images

Figure CN116769936B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection technology, specifically involving specific primers, Taqman probes, and applications for detecting Bacillus belyssus HMB26553 strain. Background Technology
[0002] Bacillus belyes is a species of Bacillus characterized by rapid growth and reproduction, and the formation of stress- and heat-resistant spores. By successfully colonizing the rhizosphere, surface, or interior of plants, Bacillus belyes competes with pathogens for nutrients. During its growth, it synthesizes and secretes active substances such as lipopeptides, thiabendazole, dipeptides, siderophores, and polyketides. These active substances have significant inhibitory effects on plant pathogens, and some can even induce systemic resistance in plants. Therefore, Bacillus belyes has become an important resource for developing microbial fungicides and is receiving increasing attention from scientists.
[0003] Chinese patent document CN106939290A (application number 201710157385.6) discloses a method for controlling cotton damping-off and its microbial agent. It discloses that the Bacillus belyes strain HMB26553 can effectively control cotton damping-off, and it is reclassified and identified as Bacillus belyes based on the whole genome sequence.
[0004] To enhance the protection of Bacillus belysus strain HMB26553, rapidly identify the strain, and quantitatively monitor bacterial counts during large-scale liquid fermentation and application of the inoculant to the cotton rhizosphere, it is crucial to establish a specific detection technology for Bacillus belysus strain HMB26553. Summary of the Invention
[0005] The purpose of this invention is to provide specific primers and probes for detecting Bacillus belyssus strain HMB26553.
[0006] Another object of the present invention is to provide applications of the above-mentioned primers and probes.
[0007] The specific primers and probes for detecting Bacillus belyssus HMB26553 strain according to a specific embodiment of the present invention, and the internal reference primers and probes, wherein the nucleotide sequence of the specific primers is as follows:
[0008] SEQ ID NO.1: 5'-CCGCGGAAGACTTCTATTCTATC-3',
[0009] SEQ ID NO.2: 5'-AACCACGGGAACTGTCAATAA-3';
[0010] The nucleotide sequence of the specific probe is as follows:
[0011] SEQ ID NO. 5: 5'-AGAGTCATGCCCGAGACACAACC-3'.
[0012] The primers and probes of this invention were designed to target the unique gene sequence of Bacillus belyssus strain HMB26553, and the nucleotide sequence of the unique gene of Bacillus belyssus strain HMB26553 is shown in SEQ ID NO: 7:
[0013] 5'-ATGAACCACGGGAACTGTCAATAATAAAAAATCCCGCCGGATATTTTTCCAGCGGGTTGTGTCTCGGGCATGACTCTATTGTTACAGATAGAATAGAAGTCTTCCGCGGCTCCTATTCTACTTAA-3'.
[0014] According to a specific embodiment of the present invention, specific primers and probes for Bacillus belyssus HMB26553 strain are provided, wherein the 5' end of the probe is labeled with a fluorescent group and the 3' end of the probe is labeled with a quenching group. The fluorescent group may be selected from FAM, HEX, TET, etc., and the quenching group may be selected from TAMRA, BHQ, MGB, etc.
[0015] TaqMan fluorescent probes are oligonucleotide probes with a fluorescent group attached to the 5' end and a quencher at the 3' end. During PCR amplification, a specific fluorescent probe is added along with a pair of primers. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the 5'-3' exonuclease activity of Taq polymerase cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. This allows the fluorescence monitoring system to receive the fluorescent signal. In other words, one fluorescent molecule is formed for each DNA strand amplified, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product.
[0016] According to a specific embodiment of the present invention, specific primers and probes for Bacillus belyssus strain HMB26553 are provided, wherein the 5' end of the probe is labeled with FAM fluorescent dye and the 3' end of the probe is labeled with the quencher group TamerMGB.
[0017] This invention also provides the application of specific primers and probes for Bacillus vesiculosus HMB26553 strain, specifically applicable to the quantitative detection of Bacillus vesiculosus HMB26553 strain, such as detection kits for Bacillus vesiculosus HMB26553 strain, or methods for real-time fluorescence quantitative detection of Bacillus vesiculosus HMB26553 strain.
[0018] The detection kit for Bacillus belyssus HMB26553 includes the aforementioned specific primers and probes, as well as DNA lysis buffer, amplification reaction solution, primer mixture, and positive control solution, and an MGB-labeled 26553-Taqman probe.
[0019] The detection kit for Bacillus belyssus strain HMB26553 also includes internal reference gene primers and probes, among which...
[0020] The nucleotide sequence of the internal reference gene primer is as follows:
[0021] SEQ ID NO.3: 5'-AGGGCTGACTGCCATTATTT-3',
[0022] SEQ ID NO.4: 5'-GATCGTTCTCGCTTCAGAGTT-3';
[0023] The nucleotide sequence of the internal reference gene probe is as follows:
[0024] SEQ ID NO. 6: 5'-TAAGCACCCTGATCCGCAATTCGA-3'.
[0025] The DNA lysis buffer includes 100 mM NaCl, 10 mM Tris-Cl at pH 8.0, 25 mM EDTA at pH 8.0, 1% w / v sodium dodecyl sulfate, 1.7 μg / μL proteinase K, and 2 mg / mL lysozyme; the amplification reaction solution includes full-gold PCR buffer, 25 mM MgCl2 solution, 2.0 mM deoxyribonucleotide solution, and Taqman MGB probe.
[0026] The real-time PCR of the present invention can be performed using a full-gold reagent kit. The reaction conditions were optimized, and the 20 μL reaction system was determined as follows: 10 μL Probe qPCR Mix, 1.0 μL each of 10 μm / L primers, 1.0 μL of 5 μm / L probe, 1 μL template, and sterile ddH2O to make up to 20 μL.
[0027] The PCR amplification reaction program was: 94℃ for 30s, 58℃ for 45s, for 40 cycles, with fluorescence signals collected at the end of each extension.
[0028] The beneficial effects of this invention are:
[0029] This invention designs primers and probes targeting a unique gene fragment of Bacillus belyssus HMB26553, and amplifies the single target fragment, which does not show amplification signals in other bacteria. Thus, this invention utilizes the primers and probes to achieve specific detection of Bacillus belyssus HMB26553.
[0030] This invention can detect 10 copies of sample DNA in a recombinant plasmid of 1×10-1 1 ~1×10 7 The novel method exhibits good linearity within the copy number range, enabling specific quantitative detection of Bacillus belyssus HMB26553 strain and accurately predicting the quantity of Bacillus subtilis HMB26553. Furthermore, this invention utilizes the aforementioned primers and probes to periodically monitor the colonization of HMB26553 in the cotton rhizosphere. Compared to conventional plate coating, this method offers high specificity, high detection efficiency, low false positive rate, and high sensitivity, providing an accurate and efficient detection method for quantitative monitoring of bacterial counts during large-scale liquid fermentation and application of the inoculant to the cotton rhizosphere. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0032] Figure 1 These are the specific detection results of the primers and probes of this invention;
[0033] Figure 2 The results show the sensitivity detection of the primers and probes of pB-0026 of the present invention;
[0034] Figure 3 This shows the sensitivity detection results of the primers and probes for the internal reference gene gyrB.
[0035] Figure 4 This paper presents a comparison between the Taqman detection method of the present invention and the conventional plate counting method. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0037] Example 1: Design of Specific Primers
[0038] This invention selects the gene pB-0026 from strain HMB26553 as the target gene. This gene is of unknown function and is located on plasmid B. Since the copy number of this plasmid within the genome is unknown, it is necessary to determine the copy number of plasmid B, and thus clarify the quantitative relationship between the unique gene on plasmid B and the genome. No homologous genes of this unique gene are found in the existing NCBI database.
[0039] The nucleotide sequence of the unique gene pB-0026 of strain HMB26553 is shown in SEQ ID NO.7:
[0040] 5'-CATGAACCACGGGAACTGTCAATAATAAAAAATCCCGCCGGATATTTTTCCAGCGGGTTGTGTCTCGGGCATGACTCTATTGTTACAGATAGAATAGAAGTCTTCCGCGGCTCCTATTCTACTTAA-3'.
[0041] Based on this gene fragment in strain HMB26553, specific primers and probes targeting strain HMB26553 were designed. The primers were designed in-house, and after comparison, the primer sequences selected are as follows:
[0042] 26553-F: 5'-CCGCGGAAGACTTCTATTCTATC-3';
[0043] 26553-R: 5'-AACCACGGGAACTGTCAATAA-3'.
[0044] The probe sequence for 26553-P is: 5'-AGAGTCATGCCCGAGACACAACC -3'.
[0045] In this invention, the gene gyrB from strain HMB26553 was selected as an internal reference gene, and its nucleotide sequence is shown in SEQ ID NO.8:
[0046]
[0047] Internal reference primers and probes targeting Bacillus vesiculosus HMB26553 strain were designed based on the internal reference gene fragment in Bacillus vesiculosus strain HMB26553. The primers were designed independently, and the selected primer sequences are as follows:
[0048] 26553gyrB-F: 5'-AGGGCTGACTGCCATTATTT -3';
[0049] 26553gyrB-R: 5'-GATCGTTCTCGCTTCAGAGTT-3'.
[0050] The probe sequence for 26553gyrB-P is: 5'-TAAGCACCCTGATCCGCAATTCGA -3'.
[0051] Example 2: Investigating the specificity of unique gene primers
[0052] The genomes of Bacillus belyssus HMB26553, cotton, soil, and Bacillus species were extracted and detected using primers 26553-F / 26553-R and probe 26553-P.
[0053] The real-time PCR was performed using the AQ221 All-Gold Reagent Kit. The reaction conditions were optimized, and the optimal reaction system was determined to be 20 μL: 10 μL Probe qPCR Mix, 1.0 μL each of 26553-F / R primers (10 μm / L), 1.0 μL of 26553-Taqman probe (5 μm / L), 1 μL template, and sterile ddH2O to a final volume of 20 μL.
[0054] The amplification program was 94℃ for 30 s, 58℃ for 45 s, for 40 cycles, with fluorescence signals collected at the end of each extension.
[0055] The specificity test results are shown in Table 1:
[0056] Table 1. Probe specificity detection results
[0057]
[0058] As shown in Table 1, the primers and probes of this invention only showed amplification curves for Bacillus subtilis HMB26553, and no amplification curves for cotton leaf genome and soil, indicating that cotton and soil do not interfere with the detection system, and other strains do not interfere.
[0059] The results are as follows Figure 1As shown, the specific primers and probes of this invention only showed amplification curves for Bacillus belyssus HMB26553, and no amplification curves for cotton and soil genomes alone, indicating that cotton and soil do not interfere with the detection system, and other strains do not interfere.
[0060] Example 3: Establishing standard curves for target gene and internal reference gene
[0061] Using the genome of Bacillus belye strain HMB26553 as a template, amplification was performed using the unique gene primers 26553-F / 26553-R and the internal reference gene primers 26553gyrB-F / 26553gyrB-R. The amplified products were purified and cloned into the vector pMD19-T, and then transformed into competent Escherichia coli DH5a spores for propagation by heat shock transformation.
[0062] Colonies containing recombinant plasmids were screened on LB broth plates containing ampicillin antibiotics using PCR to obtain recombinant plasmids containing unique and internal reference gene sequences. The recombinant plasmids were extracted using a plasmid extraction kit, and the extracted plasmids were verified by digestion with the restriction enzyme EcoRI. Recombinant vectors with correct digestion verification were then sequenced.
[0063] The correctly sequenced recombinant vector was digested with enzymes, and the product was subjected to agarose gel electrophoresis. The corresponding fragments were then recovered by gel excision and fragment recovery using the Promega Gel Extraction Kit. The DNA concentration of the linearized recombinant plasmid was determined using a spectrophotometer, and the copy number of the recombinant plasmid DNA was calculated according to the formula.
[0064] The above plasmid vector was diluted to 1×10⁻⁶ using ddH₂O. 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 Copy / μL dilution.
[0065] Using the serially diluted DNA as templates, and with 26553-F / 26553-R as primers and 26553-P as probe, real-time quantitative PCR was performed using the TaqMan fluorescent probe method to establish a standard curve of copy number and Ct value of plasmid containing the unique gene. Similarly, using 26553gyrB-F / 26553gyrB-R as primers and 26553gyrB-P as probe, real-time quantitative PCR was performed using the TaqMan fluorescent probe method to establish a standard curve of copy number and Ct value of plasmid containing the internal reference gene.
[0066] Target gene results as follows Figure 2 As shown, the standard curve is y = -3.4254x + 35.593 (R²). 2 =0.9995), the amplification efficiency was 95.86%, where x represents the logarithm of the copy number and y represents the Ct value; the primers of this invention were used in recombinant plasmid 1×10 1 ~1×10 7 The primers exhibit good linearity within the copy number range, enabling accurate detection of *Bacillus belyssus* HMB26553. When the recombinant plasmid has 10 copies, a Ct value of 32 can be obtained. Therefore, the primers of this invention can detect *Bacillus belyssus* HMB26553 strain at a minimum copy number of 10, demonstrating high sensitivity for *Bacillus belyssus* HMB26553 strain.
[0067] Internal reference gene results as follows Figure 3 As shown, the standard curve is y = -3.2709x + 36.861 (R²). 2 =0.9944), the amplification efficiency was 102.17%, where x represents the logarithm of the copy number and y represents the Ct value; the primers of this invention were used in recombinant plasmid 1×10 1 ~1×10 7 The linear relationship is good within the copy number range, and the copy number of plasmid B can be accurately quantified.
[0068] Example 4: Determination of the copy number of plasmid B in the strain
[0069] The total genome of Bacillus belyssus HMB26553 was extracted, which contains both plasmid B and chromosome. PCR was performed on the same total genome template using the two sets of primers and probes from Example 1. Substituting the values into the standard curve, it was found that the copy number of plasmid B in the HMB26553 strain was 2, meaning that the two unique genes correspond to one bacterium.
[0070] Example 5: Application of the primers of the present invention
[0071] Detection of Bacillus belyssus strain HMB26553:
[0072] (S1) Sow cotton seeds into sterilized soil, and simultaneously irrigate each gram of soil with 10 ml of water. 8 HMB26553 bacterial culture at CFU / mL was used to collect rhizosphere soil at 0, 2, 4, 6, and 8 days. The rhizosphere soil was divided into two parts. One part was serially diluted and plated on LB plates, and the other part was used to extract genomic DNA.
[0073] (S2) Real-time quantitative PCR amplification: Using genomic DNA as a template, the 26553-P probe was added, and real-time quantitative PCR amplification was performed using 26553-F and 26553-R primers:
[0074] 20 μL reaction system: 10 μL Probe qPCR Mix, 1.0 μL each of 26553-F / 26553-R primers (10 μm / L), 1.0 μL 26553-P probe (5 μm / L), 1 μL template, and bring the total volume to 20 μL with sterile ddH2O;
[0075] The amplification program was 94℃ for 30 seconds, 58℃ for 45 seconds, for 40 cycles, with fluorescence signals collected at the end of each extension.
[0076] (S3) Based on the amplification results, the strain of Bacillus belysium HMB26553 was quantified.
[0077] Meanwhile, the CFU conventional plate counting method was used to quantify the strain of Bacillus belyi HMB26553.
[0078] The results are as follows Figure 4 As shown, the overall number of HMB26553 detected by the traditional CFU plate count method is less than that of the Taqman method, by two orders of magnitude. Furthermore, the CFU method cannot distinguish whether there are contaminating environmental Bacillus in the HMB26553 in the sample. Therefore, the traditional CFU plate count method cannot accurately reflect the colonization quantity of HMB26553 in the cotton rhizosphere soil. In contrast, the number of HMB26553 detected by the Taqman method changes less over time, has a smaller error, and better repeatability.
[0079] Therefore, the method for detecting Bacillus belyssus HMB26553 based on the Taqman-MGB probe established in this invention has high accuracy.
[0080] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A detection kit for Bacillus bereaves strain HMB26553, characterized in that, The detection kit includes specific primers and probes for Bacillus belyssus HMB26553 strain. The nucleotide sequence of the specific primers is as follows: SEQ ID NO.1: 5'-CCGCGGAAGACTTCTATTCTATC-3', SEQ ID NO.2: 5'-AACCACGGGAACTGTCAATAA-3'; The nucleotide sequence of the probe is as follows: SEQ ID NO.5: 5'-AGAGTCATGCCCGAGACACAACC-3'; The detection kit also includes internal reference gene primers and probes. The nucleotide sequence of the internal reference gene primer is as follows: SEQ ID NO.3: 5'-AGGGCTGACTGCCATTATTT-3', SEQ ID NO.4: 5'-GATCGTTCTCGCTTCAGAGTT-3'; The nucleotide sequence of the internal reference gene probe is as follows: SEQ ID NO. 6: 5'-TAAGCACCCTGATCCGCAATTCGA-3.
2. A method for detecting Bacillus belyssus strain HMB26553, characterized in that, The method includes the step of PCR amplification using the detection kit for Bacillus belyssus strain HMB26553 as described in claim 1.
3. The method for detecting Bacillus belyssus HMB26553 strain according to claim 2, characterized in that, The PCR amplification reaction system was as follows: 10 μL Probe qPCR Mix, 1.0 μL each of 10 μm / L primers, 1.0 μL of 5 μm / L probe, 1 μL template, and 20 μL made up with sterile ddH2O.
4. The method for detecting Bacillus belyssus HMB26553 strain according to claim 3, characterized in that, The PCR amplification reaction program was: 94℃ for 30 seconds, 58℃ for 45 seconds, for 40 cycles.