A rapid detection method of nucleic acid of anopheles lesteri
By combining enzymatic recombination isothermal amplification technology with specific primers and probes, the problem of rapid and accurate detection of Anopheles hukanense in primary healthcare institutions has been solved, enabling efficient and rapid detection in resource-scarce environments, and is suitable for early warning and prevention of epidemics.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE NAVAL MEDICAL UNIV OF PLA
- Filing Date
- 2026-05-11
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate identification and detection of Anopheles hucansis in primary healthcare institutions, especially in resource-scarce environments, where traditional methods suffer from misjudgment and operational complexity.
Enzymatic recombination isothermal amplification (ERA) combined with specific primers and probes was used to achieve rapid nucleic acid detection of Anopheles hucansis. The simple operation process enables high-sensitivity and high-specificity detection in a short time.
The detection of Anopheles hucanis mosquitoes can be completed in minutes, improving the accuracy and sensitivity of the test. It is suitable for rapid on-site screening, especially in the event of a large-scale outbreak, where it can quickly process a large number of samples and reduce the impact of the outbreak.
Smart Images

Figure CN122279053A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, and relates to the detection of Anopheles hucanis, specifically to a rapid nucleic acid detection method for Anopheles hucanis. Background Technology
[0002] *Anopheles hukanense* belongs to the genus *Anopheles* in the family Culicidae. It is the core representative species of the *Anopheles hukanense* species group (which consists of several morphologically closely related species, mainly including the nominate subspecies of *Anopheles hukanense*, *Anopheles barbaculata*, and *Anopheles sinensis*). *Anopheles hukanense* is widely distributed in parts of Northeast, North, Northwest, and Southwest my country, and is one of the most common Anopheles mosquito species in northern and southwestern my country. It is also the most common representative species of the *Anopheles hukanense* species group in the natural environment. Its larvae mainly breed in still or slow-flowing shallow waters such as rice paddies, swamps, irrigation ditches, and puddles, showing strong adaptability to breeding grounds and moderate tolerance to pollution. Its adult hosts are wide-ranging, biting humans, cattle, sheep, and other mammals. Most populations show a strong preference for animal blood, while only a few populations have a weak preference for human blood. Adults are mostly light brown or grayish-brown, with alternating light and dark markings on their wing veins (a typical morphological feature of Anopheles mosquitoes). The females have slender, toothless proboscis. Compared to other mosquito species in the same swarm, such as Anopheles sinensis, there are subtle morphological differences, mainly concentrated in the details of wing markings, leg segment markings, and the structure of the female's cerci. These differences can easily lead to confusion with the naked eye, which is a key point for distinguishing different mosquito species in the classification of Anopheles hucanensis swarms. Adult activity exhibits a clear seasonality, typically being more active from late spring to autumn. Their nocturnal blood-sucking activity is mainly concentrated from dusk to dawn, and their activity range is significantly influenced by the distribution of their breeding grounds, generally remaining within a 500-meter radius of the breeding grounds. Some populations can carry Plasmodium parasites and participate in malaria transmission under certain conditions, thus possessing important research value and control significance in vector control work. Due to their wide distribution and activity range highly overlapping with areas of field training and border patrols, they easily come into contact with military personnel, posing a potential risk of malaria transmission, and require close attention in military health control.
[0003] Currently, the identification methods for Anopheles hucanis mainly include morphological identification and molecular biological identification. Morphological identification is simple to operate, requiring only a microscope for preliminary screening, and is suitable for rapid classification in the field. However, its accuracy is highly dependent on the professional level and practical experience of the testing personnel. Due to the extremely high morphological similarity among closely related species within the Anopheles hucanis species cluster, subtle distinguishing features are difficult to control, leading to missed or incorrect identifications and an inability to accurately distinguish groups with different malaria transmission capabilities. Molecular biological identification methods (such as PCR technology and DNA barcoding technology) are highly specific and accurate, capable of accurately distinguishing different closely related species within the Anopheles hucanis species cluster, clarifying their species composition and malaria transmission potential, and providing precise vector information for malaria control. However, this method requires sophisticated testing equipment and reagents, has a cumbersome and time-consuming operation process, and requires professional technicians for operation and result analysis, making it difficult for primary healthcare institutions to implement independently.
[0004] The ERA (Enzymatic Recombinase Amplification) technology in this invention features short detection time (generally within 20 minutes), high sensitivity, and strong specificity. It does not require sophisticated or complex instruments and can be used for rapid detection in ordinary field environments or harsh environments such as high temperature, high humidity, and high salinity. Furthermore, the technology is simple to operate; it can be mastered with minimal training, making it highly suitable for rapid detection or screening of Anopheles sinensis in grassroots settings or resource-constrained laboratories. Summary of the Invention
[0005] The purpose of this invention is to provide a rapid nucleic acid detection method for Anopheles hucanis, which utilizes enzymatic recombination isothermal amplification technology and specific primer and probe combinations to efficiently and rapidly amplify trace amounts of Anopheles hucanis DNA-specific fragments in a short time, thereby achieving rapid detection and differentiation of Anopheles hucanis.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] This invention provides a specific primer-probe set for detecting Anopheles hucansis, the primer-probe set comprising a forward primer, a reverse primer, and a probe.
[0008] The sequence of the forward primer is shown in SEQ ID NO: 1: AAATTTGGGTTTACAAGATAGTTCTTCACC;
[0009] The sequence of the reverse primer is shown in SEQ ID NO: 2: CCAACAGACTTTAGTGTAATTGAAGGTCTA;
[0010] The probe sequence is as shown in SEQ ID NO: 3: CAAACAATTGAAATTATTTGAACTGTTTACGCAATTATTTTA.
[0011] The present invention also provides a kit for detecting Anopheles hucansis, the kit comprising the primer and probe kit described above.
[0012] The present invention also provides a method for detecting Anopheles hucansis, the method specifically including the following steps:
[0013] S1. Extract sample DNA, and perform enzymatic recombination isothermal amplification experiment on the sample DNA using the specific primer and probe set described in claim 1;
[0014] S2. Result determination: A fluorescence value greater than 2000 is considered positive.
[0015] The present invention also provides a method for screening specific primer-probe sets as described above. The method specifically includes: designing nine sets of primers for Anopheles hucansis and one set of probes to perform enzymatic recombination isothermal amplification, and selecting the primer set with the highest fluorescence value as the specific primer-probe set.
[0016] Preferably, the nine sets of primers include a random combination of forward primers F1 / F2 / F3 and reverse primers R1 / R2 / R3, and the sequences of the forward primers F1 / F2 / F3 and the reverse primers R1 / R2 / R3 are as follows:
[0017] F1 is SEQ ID NO: 1 AAATTTGGGTTTACAAGATAGTTCTTCACC,
[0018] F2 is SEQ ID NO: 4: AATCAATTTACTAATCGTTATTTATTACACGG,
[0019] F3 is SEQ ID NO: 5: AGATAGTTCTTCACCTTTAATAGAACAATT,
[0020] R1 is SEQ ID NO: 6: ATAGTAAGCGTAAAGATGGAAATGCAATGA,
[0021] R2 is SEQ ID NO: 7: AAATTAAGTTGATTTAATCGTCCTGGTGTA,
[0022] R3 is SEQ ID NO: 2: CCAACAGACTTTAGTGTAATTGAAGGTCTA.
[0023] The beneficial effects of this invention are:
[0024] The enzymatic recombination isothermal amplification technology used in this invention can complete the detection of Anopheles hecanis in a few minutes. Compared with the traditional PCR detection method, the detection time is shortened by at least 0.5 hours. This significant time advantage enables this method to respond quickly in emergency situations and win valuable time for the control of mosquito-borne disease outbreaks.
[0025] The specific primers and probes designed in this invention can anchor different sequence regions between Anopheles hucanensis and other closely related mosquito species in the same phylum, thereby achieving specific detection of Anopheles hucanensis and improving the accuracy of detection.
[0026] This invention does not require large instruments and equipment and can be used for rapid on-site screening, which is particularly important for early warning and prevention of epidemics. At the same time, the method has good sensitivity and can detect even when the initial pathogen concentration is diluted by one million times, which means that even when the number of mosquito gene copies is low, Anopheles henryi can be accurately detected.
[0027] This invention is highly suitable for the detection and classification of large-scale samples and is of great significance for the diagnosis and screening of diseases transmitted by Anopheles hucanis. Especially during large-scale outbreaks, it can quickly process a large number of samples, rapidly identify mosquito species that transmit diseases, provide key information for epidemic control and treatment, facilitate early identification and rapid response to outbreaks, reduce the impact of outbreaks, and improve overall detection efficiency. Attached Figure Description
[0028] Figure 1 This is a sequence diagram of the Anopheles hucanis primer and probe in this invention (the red part is the upper and lower primer pairs, the blue part is the probe, and the boxed part is the mutation point).
[0029] Figure 2 This is a flowchart illustrating the detection method in this invention;
[0030] Figure 3 This is a diagram showing the optimal primer selection results for Anopheles hucanis based on the enzyme-catalyzed recombination isothermal amplification technique in an embodiment of the present invention (NC is the negative control).
[0031] Figure 4 This is a specific detection result in an application example of the present invention (NC is a negative control);
[0032] Figure 5 This is the sensitivity detection result in an application example of the present invention (NC is the negative control). Detailed Implementation
[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0034] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0036] Example Primer Screening
[0037] This embodiment uses literature review and database searches (NCBI, GAISD) to retrieve the Anopheles hyrcanus species cluster sequence, anchoring the sequence regions that differ between Anopheles hyrcanus and 14 other closely related mosquito species (Anopheles nigerrimus; Anopheles lessinensis; Anopheles argyropus; Anopheles nitidus; Anopheles sineroides; Anophelesskleini; Anopheles pullus; Anopheles peditaeniatus; Anopheles belenrae; Anophelespursati; Anopheles vagus; Anopheles kochi; Subgenus pseudowillmori; Anopheles minimus). Species-specific primers and probes are designed to enable rapid identification of Anopheles hyrcanus from the Anopheles hyrcanus species cluster.
[0038] The experimental materials used in this embodiment were as follows: DNA was extracted from adult Anopheles hucanis using a kit and the concentration was determined (14.2 ng / μL). Detection was performed using the enzymatic recombination isothermal amplification (ERA) method: 21.2 μL of water, 20 μL of dissolving buffer, 2.1 μL of forward primer, 2.1 μL of reverse primer, 0.6 μL of probe, and 2 μL of activator were added to each test tube. The primers and probe were first diluted to 100 pmol / μL. For subsequent use, 5 μL of primers and probe were taken, and 45 μL of water was added to dilute it to a working solution concentration of 10 pmol / μL. Finally, 2 μL of the DNA sample to be tested was added.
[0039] After mixing the above reagents thoroughly, add them to the isothermal amplification instrument, observe the changes in fluorescence value, and copy the data to the computer for analysis after the detection is completed.
[0040] This embodiment designed three forward primers (F1, F2, F3) and three reverse primers (R1, R2, R3) specifically for the amplification of Anopheles hucansis, resulting in a total of 3 × 3 = 9 possible combinations of forward and reverse primer pairs, as shown in Table 1:
[0041] Table 1 Primer and probe list for Anopheles hucansis species clusters
[0042]
[0043] In this embodiment, the amplification template (positive plasmid, 1.71 × 10⁻⁶) is added to the first four tubes of each eight-tube bundle. -2 Add one forward primer and one of three reverse primers to each tube (ng / μL). Add the same primer pair combination and negative control to the last five tubes. Compare and analyze the detection results (fluorescence intensity, detection time).
[0044] The test results showed that the combination of forward primers F2 and F3 with the three reverse primers had no significant amplification effect. Figure 2 It can be seen that among the three primer pairs of F1 and the three reverse primers, only one primer pair has the best amplification effect, the shortest detection time, and the highest fluorescence value. The final primer pair combination is determined to be F1R3, where:
[0045] The specific sequence for F1 is:
[0046] AAATTTGGGTTTACAAGATAGTTCTTCACC;
[0047] The specific sequence of R3 is as follows:
[0048] CCAACAGACTTTAGTGTAATTGAAGGTCTA;
[0049] The probe sequence is as follows:
[0050] CAAACAATTGAAATTATTTGAACTGTTTACGCAATTATTTTA.
[0051] Anopheles hucansis sequence, primer sequence, probe sequence, and mutation points are as follows: Figure 1 As shown.
[0052] Application example: Identification of Anopheles mosquitoes
[0053] The primers and probes selected in the examples were used to detect 15 species of Anopheles mosquitoes to determine the specificity and sensitivity of the enzyme recombination isothermal amplification (ERA) method.
[0054] The testing process is as follows Figure 3As shown. DNA was extracted from 15 Anopheles mosquito species, and amplification was performed using the primer and probe combinations screened in the examples. Fluorescence values were then detected. The results showed... Figure 4 Anopheles hyrcanii (Hyr) was specifically detected in 15 Anopheles mosquito species. The DNA of Anopheles hyrcanii was diluted to a concentration of 10... 1 -10 7 The fluorescence values were found to be greater than 2000, indicating a positive result. Figure 5 This indicates that when using the amplification primer and probe combination in the example to detect Anopheles hucanis in this application example, the detection limit is extremely low and the sensitivity is high.
[0055] In summary, the specific primer and probe set provided by this invention (SEQ ID NO: 1: AGATAGTTCTTCACCTTTAATAGAACAATT; SEQ ID NO: 2: ATAGTAAGCGTAAAGATGGAAATGCAATGA; SEQ ID NO: 3: CAAACAATTGAAATTATTTGAACTGTTTACGCAATTATTTTA) can be used for the rapid detection of Anopheles hucanis, and a fluorescence value greater than 2000 is considered positive.
[0056] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.
Claims
1. A specific primer and probe set for detecting Anopheles hucansis, characterized in that, The primer-probe set includes a forward primer, a reverse primer, and a probe. The sequence of the forward primer is shown in SEQ ID NO: 1: AAATTTGGGTTTACAAGATAGTTCTTCACC; The sequence of the reverse primer is shown in SEQ ID NO: 2: CCAACAGACTTTAGTGTAATTGAAGGTCTA; The probe sequence is as shown in SEQ ID NO: 3: CAAACAATTGAAATTATTTGAACTGTTTACGCAATTATTTTA.
2. A kit for detecting Anopheles hucanense (an important mosquito species in the Anopheles hucanense subspecies), characterized in that, The kit includes the primer and probe set reagent as described in claim 1.
3. A method for detecting Anopheles henryi mosquitoes, characterized in that, The detection method specifically includes the following steps: S1. Extract sample DNA, and perform enzymatic recombination isothermal amplification experiment on the sample DNA using the specific primer and probe set described in claim 1; S2. Result determination: A fluorescence value greater than 2000 is considered positive.
4. The method for screening specific primer-probe sets as described in claim 1, characterized in that, The method specifically includes: designing 9 sets of primers and 1 set of probes for enzymatic recombination isothermal amplification, and selecting the primer set with the highest fluorescence value as the specific primer-probe set.
5. The screening method according to claim 4, characterized in that, The nine sets of primers include a random combination of forward primers F1 / F2 / F3 and reverse primers R1 / R2 / R3, and the sequences of the forward primers F1 / F2 / F3 and the reverse primers R1 / R2 / R3 are as follows: F1 is SEQ ID NO: 1 AAATTTGGGTTTACAAGATAGTTCTTCACC, F2 is SEQ ID NO: 4: AATCAATTTACTAATCGTTATTTATTACACGG, F3 is SEQ ID NO: 5: AGATAGTTCTTCACCTTTAATAGAACAATT, R1 is SEQ ID NO: 6: ATAGTAAGCGTAAAGATGGAAATGCAATGA, R2 is SEQ ID NO: 7: AAATTAAGTTGATTTAATCGTCCTGGTGTA, R3 is SEQ ID NO: 2: CCAACAGACTTTAGTGTAATTGAAGGTCTA.