A DNA tetrahedral nanostructure-containing fet biosensor
By using DNA tetrahedral nanostructures and framework nucleic acids in FET biosensors, the Debye length limitation and non-specific adsorption of graphene were solved, achieving highly sensitive and selective detection of biomolecules.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI UNIV
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-30
AI Technical Summary
In existing FET biosensors, the Debye length limitation leads to reduced detection sensitivity, and graphene materials have non-specific adsorption problems, affecting detection accuracy and selectivity.
Using a DNA tetrahedral nanostructure as the biorecognition unit, a tetrahedral framework nucleic acid is formed through complementary base pairing, which shortens the distance between the analyte molecule and the gate. Furthermore, the framework nucleic acid is modified on the graphene surface to reduce non-specific adsorption.
It effectively shortens the distance between the analyte and the gate, improves detection sensitivity and selectivity, reduces impurity interference, and enables high-precision detection of nucleic acids, proteins, exosomes, viruses, or cells.
Smart Images

Figure BDA0005740436850000081 
Figure HDA0005740436860000011 
Figure HDA0005740436860000012
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosensors, and in particular to a FET biosensor containing a DNA tetrahedral nanostructure. Background Technology
[0002] In recent years, biosensors have become a hot field. Among the various developed biosensing technologies, field-effect transistor (FET)-based biosensors stand out due to their advantages such as ultra-sensitive detection, large-scale production capabilities, and low-cost manufacturing. For example... Figure 1 The main structure of a FET typically involves modifying the gate of the FET with a biorecognition receptor. This receptor can specifically bind to biomolecules. This specific binding causes a change in the charge density on the FET gate surface. According to the working principle of FETs, changes in the gate potential regulate the channel current between the source and drain of the FET. Therefore, the change in gate potential caused by the specific binding of biomolecules to the receptor ultimately manifests as a measurable change in channel current, thereby enabling the detection of biomolecules.
[0003] The biggest challenge currently facing FET-based biosensors is the limitation of the Debye length. Current research generally considers the Debye length to define the effective distance of charge interaction in an electrolyte solution; in FET biosensors, it determines the range within which the biological receptor can effectively detect analytes. The closer the analyte is to the gate, the higher the detection sensitivity. Conventional biomolecular receptors cause analytes to move far from the gate, even falling outside the Debye length. Therefore, there is an urgent need to design a special biological receptor to shorten the distance between the analyte and the gate, ensuring that the analyte falls within the Debye length. Summary of the Invention
[0004] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a FET biosensor containing a DNA tetrahedral nanostructure to solve the problems in the prior art.
[0005] To achieve the above and other related objectives, the present invention provides the use of DNA tetrahedral nanostructures in the fabrication of field-effect transistor (FET) biosensors.
[0006] The present invention also provides a field-effect transistor biosensor, the field-effect transistor biosensor including a biorecognition part and a signal transduction part, the biorecognition part including the DNA tetrahedral nanostructure, the signal transduction part including a field-effect transistor, and the DNA tetrahedral nanostructure being disposed on the channel surface of the field-effect transistor via a connector.
[0007] The present invention also provides a biological sample detection system, which includes the field-effect transistor biosensor and the semiconductor parameter analyzer connected by signal.
[0008] The present invention also provides the use of the field-effect transistor biosensor and the biological sample detection system in the detection of biological samples for non-disease diagnostic purposes, wherein the biological sample is selected from any one of nucleic acid, protein, exosome, virus or cell.
[0009] The present invention also provides a non-disease diagnosis detection method, the detection method comprising contacting a sample to be tested with the field-effect transistor biosensor to detect the content of a target analyte in the sample to be tested.
[0010] As described above, the FET biosensor containing a DNA tetrahedral nanostructure of the present invention has the following beneficial effects:
[0011] (1) Shortening the distance between the analyte and the gate, so that the analyte falls within the Debye length: The Debye length determines the range within which a biological receptor can effectively detect analytes. Conventional biological receptors easily cause analytes to fall outside the Debye length. This patent designs a dynamic DNA tetrahedral nanostructure as a biological receptor. This structure collapses when it detects an analyte, thereby shortening the distance between the analyte and the gate, so that the analyte falls within the Debye length.
[0012] (2) Solving the problem of non-specific adsorption in graphene materials: During the detection process, substances other than the target biomolecules, such as proteins, nucleic acids, and lipids, may be non-specifically adsorbed onto the graphene surface due to electrostatic interactions or van der Waals forces. This leads to inaccurate detection results and reduced sensitivity. This patent modifies the graphene material surface with a tightly packed framework of nucleic acids, effectively solving the problem of non-specific adsorption, reducing interference from impurities, and improving the accuracy of detection results.
[0013] (3) It has good selectivity and specificity: Only molecules with higher specificity that bind to the special strand in the DNA tetrahedron can make it break away from the tetrahedron. Therefore, it can effectively eliminate the interference of impurities and has good selectivity and specificity. Attached Figure Description
[0014] Figure 1 The diagram shows the structure and detection principle of a field-effect transistor biosensor.
[0015] Figure 2 The diagram shows the binding of the DNA tetrahedral nanostructure of the present invention to the molecule to be tested.
[0016] Figure 3 The diagram shows a field-effect transistor biosensor containing a DNA tetrahedral nanostructure, according to the present invention.
[0017] Figure 4 The diagram shows the fabrication process flow of a graphene field-effect transistor.
[0018] Figure 5 The curves shown are the transfer characteristic curves of a field-effect transistor biosensor.
[0019] Figure 6 The results are shown in the atomic force microscopy characterization of the graphene field-effect transistor biosensor.
[0020] Figure 7 The image shown is a physical diagram of the biological sample detection system of the present invention.
[0021] Figure 8 The image shown is a graph of miRNA21 detection by the graphene field-effect transistor biosensor in Example 4. Detailed Implementation
[0022] This invention combines framework nucleic acid technology to design a dynamic DNA tetrahedral nanostructure as a molecular acceptor. By controlling the shape of this tetrahedron, the biomolecules to be detected can fall within the Debye length. Through high-precision molecular probe design, a framework nucleic acid graphene field-effect transistor device with high detection sensitivity and specificity has been developed. This device can effectively overcome the Debye length limitation and achieve the detection of solutions with higher ionic strength.
[0023] This invention provides the use of DNA tetrahedral nanostructures in the fabrication of field-effect transistor (FET) biosensors.
[0024] DNA tetrahedral nanostructures, also known as tetrahedral framework nucleic acids (tFNA), are formed by mixing four single-stranded DNA strands (ssDNA) in equal amounts. Conventional DNA tetrahedral nanostructure molecules are formed by the gradual folding and winding of four single-stranded DNA strands of equal length. Each single-stranded DNA strand pairs with the other three single-stranded DNA strands through base complementarity to form three double strands, each serving as an edge of each face of the tetrahedral nanostructure. This ultimately forms a DNA molecule with a tetrahedral framework structure, where each corner is formed by the intersection of three DNA double strands (e.g., ...). Figure 2 Because the side length of a tetrahedron is small, approximately less than 10 nm, it can self-assemble within seconds. This means that DNA molecules accurately combine with each other based on the principle of complementary base pairing to form a tetrahedral structure.
[0025] The high precision and programmable self-assembly properties of DNA ensure the successful construction of static DNA tetrahedral nanostructures in 3D. DNA tetrahedral nanostructures exhibit high mechanical rigidity and structural stability. More importantly, various DNA sequences with specific reactivity can be incorporated into these nanostructures without sacrificing their function. Furthermore, aminated DNA tetrahedra can be rapidly and firmly fixed to surfaces with high stability, providing biomolecular nanostructure surfaces with ordered orientation and good control.
[0026] In some embodiments of the present invention, the DNA tetrahedral nanostructure includes a sequence complementary to the molecule to be tested, such that after the sequence complementary to the molecule to be tested binds to the molecule to be tested, the DNA tetrahedral nanostructure undergoes structural collapse.
[0027] In some embodiments of the present invention, the DNA tetrahedral nanostructure is formed by self-assembly of equal amounts of a first single-stranded DNA, a second single-stranded DNA, a third single-stranded DNA, a fourth single-stranded DNA, and a nucleic acid aptamer. Each single strand includes a sequence that is complementary to the other three single strands to form one face of the DNA tetrahedral nanostructure. The third single strand also includes a sequence complementary to the nucleic acid aptamer, which is complementary to the molecule to be tested.
[0028] In some embodiments of the present invention, the first single-stranded DNA and the second single-stranded DNA are of equal length, and the third single-stranded DNA is longer than the other first single-stranded DNA and second single-stranded DNA.
[0029] In some specific embodiments of the present invention, the first single-stranded DNA and the second single-stranded DNA each include three fragments, and each fragment is complementary to the fragments in the other three single strands to form one side of a tetrahedral structure, ultimately forming one face of a DNA tetrahedral nanostructure.
[0030] In some embodiments of the present invention, the third single-stranded DNA includes five fragments: a first fragment, a second fragment, a third fragment, a fragment complementary to a nucleic acid aptamer, and a fourth fragment, wherein the first fragment and the second fragment are fragments complementary to fragments in the first single-stranded DNA or the second single-stranded DNA, and the third fragment and the fourth fragment are fragments complementary to fragments in the fourth single-stranded DNA.
[0031] When the test molecule is not present, the nucleic acid aptamer is complementary to the bases of the fragment that is complementary to the nucleic acid aptamer, and together with other single-stranded DNA, forms a DNA tetrahedral nanostructure.
[0032] The nucleic acid aptamer is completely complementary to the molecule to be tested, and is either completely complementary to the fragment that is complementary to the nucleic acid aptamer or has a base mismatch, so as to ensure that when the molecule to be tested is detected, the nucleic acid aptamer unwinds from the fragment to detach from the DNA tetrahedral nanostructure and bind to the molecule to be tested.
[0033] In some embodiments of the present invention, when the molecule to be tested is DNA or RNA, the nucleic acid aptamer has a base mismatch with a fragment complementary to the nucleic acid aptamer. In some embodiments of the present invention, the number of base mismatches is 1 to 3.
[0034] In some embodiments of the present invention, when the molecule to be tested is a protein or a small molecule, the nucleic acid aptamer will specifically bind to the target protein or small molecule.
[0035] In some embodiments of the present invention, the fourth single-stranded DNA includes four fragments: a fragment complementary to the third fragment, two fragments complementary to the first single-stranded DNA or the second single-stranded DNA, and a fragment complementary to the fourth fragment.
[0036] In some embodiments of the present invention, the fourth single-stranded DNA sequentially includes a fragment complementary to the third fragment, a fragment complementary to a fragment in the first single-stranded DNA, a fragment complementary to a fragment in the second single-stranded DNA, and a fragment complementary to the fourth fragment.
[0037] In some embodiments of the present invention, the fourth single-stranded DNA sequentially includes a fragment complementary to the third fragment, a fragment complementary to a fragment in the second single-stranded DNA, a fragment complementary to a fragment in the first single-stranded DNA, and a fragment complementary to the fourth fragment.
[0038] In some embodiments of the present invention, the number of bases in each fragment of each single-stranded DNA is an integer multiple of 10 bases.
[0039] In some embodiments of the present invention, each single strand includes 3 to 6 bases that do not pair complementaryly with any other sequence, such that the vertices of two adjacent sides of the DNA tetrahedron have a certain included angle.
[0040] In some specific embodiments of the present invention, segments within the same single strand are linked by 1-2 bases that are not complementary to any other segment.
[0041] In some embodiments of the present invention, the 5' and 3' ends of each single strand meet at the vertex of a tetrahedron or form a port on the edge. When they meet at the port, DNA ligase can be used to connect the ports, or they can be functionalized.
[0042] In some embodiments of the present invention, the DNA tetrahedral nanostructure has vertex-type modification, that is, chemical modification is performed at the vertex of the DNA tetrahedral nanostructure.
[0043] In some embodiments of the present invention, the 5' ends of the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA include chemically modified groups, wherein the chemically modified groups are selected from any one of NH2-C6 modification, thiol modification, biotin or avidin modification, or digoxigenin modification.
[0044] In some embodiments of the present invention, the nucleotide sequences of the first single-stranded DNA, the second single-stranded DNA, and the fourth single-stranded DNA are as shown in SEQ ID NO.1, 2, and 4, respectively.
[0045] In some embodiments of the present invention, the field-effect transistor biosensor includes, but is not limited to, graphene field-effect transistor biosensors, carbon nanotube field-effect transistor biosensors, silicon nanowire field-effect transistor biosensors, molybdenum disulfide field-effect transistor biosensors, silicon-based field-effect transistor biosensors, or organic material field-effect transistor biosensors.
[0046] The present invention also provides a field-effect transistor biosensor, the field-effect transistor biosensor including a biorecognition part and a signal transduction part, the biorecognition part including the DNA tetrahedral nanostructure, the signal transduction part including a field-effect transistor, and the DNA tetrahedral nanostructure being disposed on the channel surface of the field-effect transistor via a connector.
[0047] The field-effect transistor of the present invention is not specifically limited and can be selected from any field-effect transistor in the prior art.
[0048] In some embodiments of the present invention, the field-effect transistor is a graphene field-effect transistor, a carbon nanotube field-effect transistor, a silicon nanowire field-effect transistor, a molybdenum disulfide field-effect transistor, a silicon-based field-effect transistor, or an organic material field-effect transistor.
[0049] The organic material field-effect transistors (OFETs) include various types, such as 1) high molecular polymers such as alkyl-substituted polyphenene, 2) oligomers such as phenoxy oligomers and phenene oligomers, 3) small organic molecule compounds such as benzoxenes, C60, metal phthalocyanine compounds, cinnamon, styrene, charge transfer salts, etc., 4) pentaphenyl, and 5) phthalocyanine compounds.
[0050] The graphene field-effect transistor is a typical three-terminal device, such as... Figure 1 As shown, it includes electrodes (including source, drain and gate), graphene channels and substrate.
[0051] The electrode materials for the source, drain, and gate are not specifically limited, but can be gold (Au). To enhance the adhesion between the gold electrode and the channel or substrate, chromium (Cr), titanium (Ti), nickel (Ni), or other metals can be inserted as an interlayer.
[0052] The graphene field-effect transistor is selected from back-gate, top-gate, top-bottom dual-gate, side-gate, or tunneling types.
[0053] The graphene channel is located between the source and the drain.
[0054] The gate is selected from liquid gate, back gate, dual gate or floating gate.
[0055] The substrate is typically made of silicon dioxide (SiO2) to provide isolation and capacitance.
[0056] In some embodiments of the present invention, the connector is matched with the field-effect transistor, and the connector may be selected from 1-pyrenebutyrate succinimide ester (PASE), 3-aminopropyltriethoxysilane (APTES), etc., depending on the material of the field-effect transistor used.
[0057] The 1-pyrenebutyrate succinimide ester (PASE) is non-covalently functionalized onto the graphene of the graphene field-effect transistor via π-π stacking, and PASE is covalently linked to the amino-modifying groups of the DNA tetrahedral nanostructure.
[0058] The present invention also provides a sample detection system, the sample detection system comprising the field-effect transistor biosensor and the semiconductor parameter analyzer connected by signals.
[0059] The present invention also provides the use of the field-effect transistor biosensor and the sample detection system in sample detection for non-disease diagnostic purposes, wherein the sample is selected from any one of small chemical molecules, nucleic acids, proteins, exosomes, viruses or cells.
[0060] The small chemical molecules, such as ATP (adenosine triphosphate), glucose, dopamine, serotonin, etc., can reflect human physiological conditions or disease-related molecules. The present invention also provides a non-disease diagnosis detection method, which includes contacting the sample to be tested with the field-effect transistor biosensor to detect the content of the target analyte in the sample to be tested.
[0061] The sample to be tested is a biological sample or a prepared solution derived from various isolated or obtained objects. The biological sample is selected from one or more of the following: saliva, urine, amniotic fluid, blood or blood products, umbilical cord blood, chorionic villi, cerebrospinal fluid, and spinal fluid.
[0062] The detection principle of this patent is as follows: Figure 2As shown, the dynamic DNA tetrahedral framework nucleic acid designed in this invention contains one DNA segment (i.e., the nucleic acid aptamer) within one edge (i.e., the edge formed by the segment complementary to the nucleic acid aptamer in the third single-stranded DNA) of the nucleic acid aptamer. Figure 2 The protruding fragment in the left-hand tetrahedral DNA nanostructure does not cross-link with other edges. When an analyte (small molecule, nucleic acid, or protein) with a higher binding affinity to this DNA fragment is present in solution, the DNA fragment will detach from the tetrahedron and bind to the analyte. After detachment, the tetrahedral structure becomes unstable and collapses (see...). Figure 2 This will effectively shorten the distance between the molecule being tested and the gate, bringing it within the Debye length.
[0063] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0064] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[0065] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0066] Example 1: Fabrication process of GFET
[0067] The GFET fabrication process flow diagram is as follows: Figure 4 As shown.
[0068] Fabrication process of source and drain electrodes
[0069] 1. Photolithography: Using standard photolithography processes, electrode patterns with clear edges and uniform coverage are prepared;
[0070] 2. Metal sputtering: The electrode surface is a 45nm gold layer, and a 5nm chromium layer is deposited underneath to form a 5 / 45nm Cr / Au metal stack.
[0071] 3. Metal stripping: First, soak the silicon substrate thoroughly with acetone and treat it with low-frequency ultrasound for 10 minutes; then rinse the substrate surface with anhydrous ethanol, and after rinsing, add anhydrous ethanol again and treat it with ultrasound for 1 minute; finally, rinse the surface with water and anhydrous ethanol, and put it into a spin dryer to dry to complete the preparation of the surface electrode.
[0072] Transfer and patterning of graphene films
[0073] 4. Preparation of support layer: Spin-coating a layer of polymethyl methacrylate (PMMA) onto the graphene surface as a support layer.
[0074] 5. Electrochemical Exfoliation: A 0.5M potassium hydroxide solution was chosen as the electrolyte to provide ionic conductivity. A graphene-coated copper substrate with PMMA coating was used as the working electrode (cathode), and an inert electrode (platinum electrode) was inserted into the electrolyte and connected to a 3V DC power supply. On the cathode surface, water molecules undergo a reduction reaction to generate hydrogen gas, thereby forming bubbles between the graphene and the copper substrate, gradually exfoliating the graphene from the copper substrate.
[0075] 6. Transfer to Substrate: The exfoliated graphene, along with the PMMA support layer, floats on the electrolyte surface. First, the floating graphene is repeatedly washed with deionized water to remove residual electrolyte and impurities. The substrate is then immersed in water, and after contact with the graphene, it is slowly lifted to allow the graphene to adhere evenly to the target substrate surface, and then allowed to air dry.
[0076] 7. Removal of the support layer: Immerse the substrate in acetone to dissolve and remove the PMMA layer, then wash with deionized water to obtain the bare graphene.
[0077] Precise graphics
[0078] 8. Photolithography: Standard photolithography process is used for conventional photolithography.
[0079] 9. Plasma etching: The substrate surface is treated with oxygen plasma to etch away all graphene except for the target area between the source and drain electrodes.
[0080] The results are as follows Figure 5As shown. Optical microscopy observation revealed that the graphene channel film surface was smooth and the coverage position was precise. The output and transfer characteristics of the device were tested. Within the low source-drain voltage range, the device exhibited good linear ohmic characteristics, indicating low contact impedance between the metal electrode and graphene. Platinum wire, known for its good electrochemical stability, inertness, and low noise, was used as the gate electrode for transfer characteristic curve determination. The Dirac point appeared at Vg = 6.8V (Vds = 0.7V), consistent with the p-type semiconductor characteristics of graphene. During testing, the curves were smooth and reproducible, indicating high device stability.
[0081] Example 2: Preparation of Framework Nucleic Acid (FNA)
[0082] Using programmable self-assembly technology of DNA, nanostructures with uniform size and controllable morphology were obtained through precise design of nucleic acid sequences. Click chemistry was incorporated into the experiment to achieve efficient assembly and precise localization of specific functional molecules on the framework nucleic acids. The table below shows the sequence composition of the framework nucleic acids for ATP small molecule detection, where bases of the same color are complementary:
[0083]
[0084] The response sequences to miRNA21 are as follows: the sequences of the first single-stranded DNA, the second single-stranded DNA, and the fourth single-stranded DNA are shown in SEQ ID NO. 1, 2, and 4, the sequence of the third single-stranded DNA is shown in SEQ ID NO. 6, and the sequence of the nucleic acid aptamer is shown in SEQ ID NO. 7.
[0085] NH2-C6-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACTCTATAGCTTATCAGACTGATGGCTC(SEQ ID NO.6)
[0086] TCAACATCAGTCTGATAAGCTA(SEQ ID NO.7)
[0087] The response sequences to thrombin protein are as follows: the sequences of the first single-stranded DNA, the second single-stranded DNA, and the fourth single-stranded DNA are shown in SEQ ID NO. 1, 2, and 4, the sequence of the third single-stranded DNA is shown in SEQ ID NO. 8, and the sequence of the nucleic acid aptamer is shown in SEQ ID NO. 9.
[0088] NH2-C6-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACTCTAAGTCACCCCAACCTGCCCTACCACGGACTGGCTC (SEQ ID NO.8)
[0089] AGTCCGTGGTAGGGCAGGTTGGGGTGACT (SEQ ID NO. 9).
[0090] The preparation process consists of three steps: First, take 1 μl (50 μM) of each of the above primers and mix them in 45 μl of 1xTM buffer (20 mM Tris, 50 mM MgCl2, pH 8.0); next, heat the solution system to 95 °C for 2 min, and then cool it to room temperature; finally, store the obtained tetrahedral structure in 1xTM solution at 4 °C.
[0091] Example 3: Preparation of framework nucleic acid coupled with GFET
[0092] The framework nucleic acid prepared in Example 2 was coupled and immobilized on the graphene surface of the GFET prepared in Example 1 to realize the functionalization of the device sensing interface, and finally as follows: Figure 3 As shown. The specific immobilization method involves non-covalently functionalizing 1-pyrenebutyrate succinimide ester (PASE) onto a monolayer of chemically vapor-deposited graphene via π-π stacking, and covalently linking PASE to the amino groups at the bottom of the framework nucleic acid. The G-FET device was immersed in a 5 mM PASE solution in dimethylformamide at room temperature for 1.5 hours. The PASE molecule acts as a linker, connecting to the graphene via π-π interactions between the pyrene groups of PASE and the graphene. A polydimethylsiloxane (PDMS) groove was imprinted above the graphene channel to contain the solution. After thorough rinsing with ethanol and ultrapure water, 50 μl of 1×TM buffer containing 100 nM framework nucleic acid was added to the PDMS groove at room temperature for 12 hours. After this, the solution in the PDMS groove was replaced with 100 mM ethanolamine in 1×TM buffer for 1 hour to inactivate and block any remaining excess reactive groups on the graphene surface. Then, the solution in the PDMS groove was replaced with 1×TM buffer, and the device was rinsed at least 3 times. Finally, add 80 μL of buffer solution or VTM to the PDMS recess and seal it with a glass or wafer. Store the device at 4°C protected from light.
[0093] The results of characterization by atomic force microscopy after coupling are as follows: Figure 6 As shown in the figure, the results show that the graphene surface, after functionalization, contains particles that conform to the size of framework nucleic acid molecules.
[0094] Example 4: Field-Effect Transistor Biosensor for Detecting Target Substances
[0095] In applications involving the detection of relevant biomedical clinical samples (such as blood and saliva), the field-effect transistor biosensor prepared above is first connected to a semiconductor parameter analyzer (four-probe station, Keithley 4200) (e.g., Figure 7 (As shown). An appropriate amount of sample is directly dropped into the PDMS groove of the field-effect transistor biosensor. The current response of the device is observed using a semiconductor parameter analyzer. If the sample contains the target molecule, the tetrahedral structure collapse described in the aforementioned working principle will occur, causing the nucleic acid molecules on the tetrahedron to move closer to the FET surface. This leads to a change in the conductivity of the graphene channel of the FET, which is ultimately reflected in the change in the current response of the parameter analyzer. If the sample does not contain the target molecule, the above changes will not occur, and a relatively stable current reading should be observed.
[0096] The prepared sensor can effectively improve the detection limit, solve the problem of non-specific adsorption of graphene materials, and effectively eliminate the interference of impurities, exhibiting good selectivity and specificity.
[0097] Specifically, in this embodiment, a dynamic DNA tetrahedral nanostructure designed for miRNA21 is used as the biorecognition unit to construct a graphene field-effect transistor (GFET) biosensor and achieve high-sensitivity detection of the target molecule.
[0098] The framework nucleic acid sequence designed for miRNA21 in Example 2 is used, namely:
[0099] First single-stranded DNA: SEQ ID NO.1;
[0100] Second single-stranded DNA: SEQ ID NO.2;
[0101] Third single-stranded DNA: SEQ ID NO.6;
[0102] Fourth single-stranded DNA: SEQ ID NO.4;
[0103] Nucleic acid aptamer: SEQ ID NO.7.
[0104] Using the method described in Example 3, the above-mentioned framework nucleic acid was covalently coupled to the channel surface of a graphene field-effect transistor via 1-pyrene butyrate succinimide ester (PASE) to construct a functionalized GFET biosensor.
[0105] The prepared sensor was connected to a semiconductor parameter analyzer (Keithley 4200), and real-time current-time (I–T) monitoring was performed with the source-drain voltage (V~ds~) fixed at 0.1V.
[0106] First, buffer solution was added to the reaction cell. The device's source and drain currents rose rapidly and then stabilized within the range of approximately 38.6–38.7 μA. During subsequent additions and removals of buffer solution, the current curve showed minor fluctuations, but generally remained within the aforementioned range, indicating good stability during the testing process.
[0107] Based on this, 10 μL of a 1 pM miRNA21 target solution was added to the reaction chamber at predetermined time points. After the addition of the target, the current plateau of the device showed an observable shift relative to the level under buffer conditions, and formed a new stable plateau after a brief fluctuation. This plateau change was significantly different from the minor perturbations caused by buffer manipulation and can be used to identify the presence of target molecules (such as...). Figure 8 (As shown).
[0108] The test process revealed that the collapsed conformation nucleic acid tetrahedral modified GFET described in this embodiment can generate a current plateau change at a concentration of 1 pM, enabling an electrical response to low-concentration targets.
[0109] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. Application of DNA tetrahedral nanostructures in the fabrication of field-effect transistor biosensors.
2. The use according to claim 1, characterized in that, The DNA tetrahedral nanostructure includes a sequence complementary to the target molecule, such that the DNA tetrahedral nanostructure collapses after the sequence binds to the target molecule. Preferably, the DNA tetrahedral nanostructure is formed by self-assembly of equal amounts of a first single-stranded DNA, a second single-stranded DNA, a third single-stranded DNA, a fourth single-stranded DNA, and a nucleic acid aptamer. Each single strand includes a sequence complementary to the other three single strands to form one face of the DNA tetrahedral nanostructure. The third single strand includes a sequence complementary to the nucleic acid aptamer, which is complementary to the target molecule.
3. The use according to claim 2, characterized in that, It also includes one or more of the following features: 1) The first and second single-stranded DNAs each consist of three segments, and each segment is complementary to the segments in the other three single strands. 2) The third single-stranded DNA consists of five segments: the first segment, the second segment, the third segment, the segment complementary to the nucleic acid aptamer, and the fourth segment. The first and second segments are complementary to segments in the first or second single-stranded DNA, and the third and fourth segments are complementary to segments in the fourth single-stranded DNA. 3) The nucleic acid aptamer and the molecule to be tested are completely complementary, and the fragment that is complementary to the nucleic acid aptamer is completely complementary or has a base mismatch; 4) The fourth single-stranded DNA consists of four segments: a segment complementary to the third segment, two segments complementary to segments in the first or second single-stranded DNA, and a segment complementary to the fourth segment. 5) Segments within the same single strand are linked by 1-2 bases that are not complementary to any other segment.
4. The use according to claim 2, characterized in that, The DNA tetrahedral nanostructure has vertex-type modification; preferably, the 5' ends of the first single-stranded DNA, the second single-stranded DNA, and the third single-stranded DNA include chemical modification groups, which are selected from any one of NH2-C6 modification, thiol modification, biotin or avidin modification, or digoxigenin modification.
5. The use according to claim 2, characterized in that, The nucleotide sequences of the first single-stranded DNA, the second single-stranded DNA, and the fourth single-stranded DNA are shown in SEQ ID NO.1, 2, and 4, respectively.
6. The use according to claim 1, characterized in that, The field-effect transistor biosensor is a graphene field-effect transistor biosensor, a carbon nanotube field-effect transistor biosensor, a silicon nanowire field-effect transistor biosensor, a molybdenum disulfide field-effect transistor biosensor, a silicon-based field-effect transistor biosensor, or an organic material field-effect transistor biosensor.
7. A field-effect transistor biosensor, characterized in that, The field-effect transistor biosensor includes a bio-identification unit and a signal transduction unit. The bio-identification unit includes a DNA tetrahedral nanostructure as described in any of claims 1 to 6. The signal transduction unit includes a field-effect transistor. The DNA tetrahedral nanostructure is disposed on the channel surface of the field-effect transistor via a connector.
8. The field-effect transistor biosensor according to claim 7, characterized in that, The field-effect transistor is selected from graphene field-effect transistors, carbon nanotube field-effect transistors, silicon nanowire field-effect transistors, molybdenum disulfide field-effect transistors, silicon-based field-effect transistors, or organic material field-effect transistors.
9. The field-effect transistor biosensor according to claim 7, characterized in that, The connector is matched with the field-effect transistor. Preferably, the connector is selected from 1-pyrenebutyrate succinimide ester and 3-aminopropyltriethoxysilane.
10. A sample detection system, characterized in that, The sample detection system includes the field-effect transistor biosensor and semiconductor parameter analyzer as described in claim 7, wherein the field-effect transistor biosensor and semiconductor parameter analyzer are signal-connected.
11. Use of the field-effect transistor biosensor of claim 7 or the sample detection system of claim 10 in sample detection for non-disease diagnostic purposes, wherein the sample is selected from any one of small chemical molecules, nucleic acids, proteins, exosomes, viruses or cells.
12. A detection method for non-disease diagnosis, characterized in that, The detection method includes contacting the sample to be tested with the field-effect transistor biosensor of claim 7 or the sample detection system of claim 10 to detect the content of the target analyte in the sample to be tested.
13. The detection method according to claim 12, characterized in that, The sample to be tested is selected from one or more of the following: solution, saliva, urine, amniotic fluid, blood or blood products, umbilical cord blood, chorionic villus, cerebrospinal fluid, and spinal fluid.