Bionic vesicle of bcg and application thereof in preparation of tumor nano vaccine
The BBV prepared by the triple synergistic cell disruption method of reduction-chelation-enzymatic hydrolysis and high-pressure homogenization recombination solved the problems of large-scale and quality stability in BCG vesicle preparation. Furthermore, by utilizing the BCG endogenous membrane protein MmpS4 to anchor the HPV16 E7 antigen, efficient tumor antigen delivery and immune activation were achieved, significantly inhibiting the growth of cervical cancer tumors.
Patent Information
- Application Number
- CN202610810252.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-07-03
AI Technical Summary
Existing tumor vaccines have insufficient immunogenicity and are difficult to activate innate immunity. BCG live bacteria preparations have safety risks and excessive inflammatory responses. Furthermore, BCG vesicle preparation methods are difficult to scale up and maintain quality stability, and cannot efficiently display tumor antigens.
BCG biomimetic vesicles (BBVs) were prepared using a triple synergistic cell disruption method of reduction-chelation-enzymatic hydrolysis and high-pressure homogenization recombination. The tumor antigen HPV16 E7 gene was anchored to the BBV membrane surface using the BCG endogenous membrane protein MmpS4, and high-pressure homogenization technology was used to prepare BBVs with uniform particle size and intact structure.
BBV can be efficiently taken up by bone marrow-derived dendritic cells, inducing metabolic reprogramming and inflammatory factor secretion, promoting the maturation of antigen presentation function, activating acquired and trained immunity in lymph nodes, and significantly inhibiting cervical cancer tumor growth.
Smart Images

Figure CN122326503A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor vaccines, specifically relating to a BCG biomimetic vesicle and its application in the preparation of tumor nanovaccines. Background Technology
[0002] Tumor immunotherapy represents a major breakthrough in cancer treatment, and therapeutic tumor vaccines have attracted significant attention due to their ability to induce antigen-specific immune responses and form long-term immune memory. However, existing tumor vaccines generally suffer from insufficient immunogenicity and difficulty in effectively activating innate immunity, which limits their clinical translation.
[0003] Bacillus Calmette-Guérin (BCG) is a live attenuated Mycobacterium bovis vaccine that has been shown to induce training immunity, i.e., the acquisition of a "memory-like" enhanced response by innate immune cells through epigenetic and metabolic reprogramming after initial stimulation. BCG activates monocytes, macrophages, and dendritic cells (DCs) through its abundant pathogen-associated molecular patterns within its cell wall, making it the most thoroughly studied human training immune inducer. However, as a live bacterial preparation, BCG carries a risk of disseminated infection in immunocompromised individuals, and its complex composition may trigger excessive inflammatory responses, limiting its application as a training immune inducer for precise in vitro regulation of immune cells and the development of tumor nanovaccines.
[0004] To overcome the safety limitations of live BCG bacteria, researchers have attempted to prepare BCG-derived membrane vesicles. These vesicles have a nanoscale structure, retaining various immunologically active molecules from the bacteria, while lacking replication ability, significantly improving safety. However, existing methods for preparing BCG membrane vesicles mainly rely on natural bacterial secretion or simple mechanical disruption, which presents the following technical bottlenecks: First, the natural secretion method has extremely low yields and takes several weeks, making it difficult to meet the needs of large-scale production; second, traditional mechanical disruption methods cause significant damage to the vesicle structure, resulting in a wide particle size distribution, poor uniformity, and inconsistent quality between different batches; third, the BCG cell wall has a unique three-layer composite structure of mycoic acid-arabinogalactan-peptidoglycan and a disulfide bond barrier in the peptidoglycan cross-linking bridges, making it difficult for conventional cell disruption methods to efficiently lyse BCG, and even more difficult to obtain high-quality vesicles while preserving the native conformation of membrane proteins, leading to decreased immune training activity. Current technologies have not recognized the fundamental impact of the unique cell wall structure of BCG on the cell disruption process, nor have they developed a targeted, efficient, controllable, and scalable engineered preparation method.
[0005] After obtaining high-quality BCG vesicles, another key issue is how to make them specific for tumor antigens. While relying solely on non-specific immune activation from BCG vesicles can induce training immunity, it cannot generate a precise acquired immune response against specific tumor antigens. Therefore, it is necessary to efficiently display tumor antigens on the vesicle membrane surface. Currently, there are no reports on using the BCG endogenous membrane protein MmpS4 to anchor exogenous antigens to the surface of BCG vesicles.
[0006] Cervical cancer is the fourth most common malignant tumor among women worldwide, with approximately 604,000 new cases and 342,000 deaths annually. About 99% of cervical cancer cases are associated with persistent infection with high-risk human papillomavirus (HPV), with HPV16 being the most prevalent. The HPV16 E7 oncogene protein is persistently expressed in tumor cells but absent in normal tissues, making it an ideal target for tumor vaccines. However, existing vaccines based on this antigen generally suffer from low delivery efficiency and weak antigen cross-presentation, and no products have been approved to date. These strategies mostly focus on simply activating acquired immunity, making it difficult to overcome the inhibitory effects of the tumor microenvironment. Summary of the Invention
[0007] This invention provides a biomimetic vesicle (BBV) for BCG, which is prepared by a combination of a triple synergistic cell disruption process of reduction-chelation-enzymatic hydrolysis and high-pressure homogenization. Specifically, it uses a solution containing 0.05-0.15 mol / L... BCG bacterial suspension was prepared using EDTA-2Na and 0.05-0.15% β-mercaptoethanol phosphate buffer (0.1M, pH 7.4). After shaking culture, lysozyme was added, and the suspension was continued to be shaken and cultured overnight. The supernatant was removed by centrifugation at 4℃ and 3000-8000g. The bacterial precipitate was washed 2-5 times with sorbitol solution and resuspended. The bacterial suspension was placed in a high-pressure homogenizer and treated 2-5 times at 2-6℃ and a homogenization pressure of 800-1500 bar. The bacterial suspension was then centrifuged at 4℃ and 3000-8000g, and the supernatant was collected. The supernatant was purified by ultracentrifugation at 4℃ and 80000-150000g. The precipitate was collected, resuspended in sterile phosphate buffer, and filtered through a 0.45μm sterile filter membrane to obtain BCG biomimetic vesicles.
[0008] The sorbitol solution is a phosphate buffer (0.1M, pH 7.4) containing 0.5-1.5 mol / L sorbitol.
[0009] In the above method, the BCG vaccine is a BCG strain or a recombinant BCG strain. The recombinant BCG strain is obtained by fusing the BCG endogenous membrane protein MmpS4 gene with a tumor antigen gene through a flexible linker peptide to obtain a fusion gene. The fusion gene is then linked with the pMV261 vector to obtain a recombinant plasmid. The recombinant plasmid is then transformed into BCG to obtain the vaccine. The tumor antigen gene is anchored to the BBV membrane surface through the BCG endogenous membrane protein MmpS4 gene.
[0010] The nucleotide sequence of the BCG endogenous membrane protein MmpS4 gene is shown in SEQ ID NO:1; the tumor antigen gene is the HPV16 E7 gene, and its nucleotide sequence is shown in SEQ ID NO:2; the nucleotide sequence of the flexible linker peptide is shown in SEQ ID NO:3.
[0011] This invention utilizes β-mercaptoethanol to selectively reduce the disulfide bonds of the cross-linked bridges of peptidoglycan, specifically disrupting the rigid framework of the cell wall. Simultaneously, EDTA is used to efficiently chelate calcium and magnesium ions in the outer membrane, disrupting the stability of the mycobacterial acid layer and opening channels for subsequent enzymatic hydrolysis. Lysozyme is then used to precisely hydrolyze the β-1,4 glycosidic bonds of peptidoglycan, achieving gentle yet thorough cell wall lysis. Finally, under low-temperature conditions of 2-6℃, the high shear force, cavitation effect, and impaction effect of a high-pressure homogenizer cause the membrane fragments to self-assemble into BBVs with uniform particle size, intact structure, and complete preservation of the natural membrane protein conformation.
[0012] Another objective of this invention is to use the BCG-derived biomimetic vesicles (BBV) prepared with BCG strains as an immune-training inducer in the preparation of tumor nanovaccines. BBV can be efficiently taken up by bone marrow-derived dendritic cells (BMDCs), inducing metabolic reprogramming of BMDCs, including enhanced glucose 2-NBDG uptake and increased L-lactate production; inducing BMDCs to secrete inflammatory factors, including interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-alpha (TNF-α); promoting the maturation of BMDC antigen-presenting function, including upregulation of the expression of co-stimulatory molecule CD86, antigen-presenting molecules MHCI and MHCII, and inflammatory activating molecule CD40; and simultaneously, indirectly stimulating acquired immunity by promoting innate lymph node immunity, thereby inhibiting cervical cancer tumor growth.
[0013] Another objective of this invention is to apply the BCG biomimetic vesicles (rBCG-MmpS4+E7BBV) prepared using the above-mentioned BCG recombinant strain in the preparation of tumor nanovaccines. This vaccine can inhibit the growth of HPV-related subcutaneous xenografts and activate lymph node acquired immunity and training immunity-mediated innate immunity. The acquired immunity includes T helper 1 cells (Th1), cytotoxic T lymphocytes (CTL), and CD8+ T granzyme B+ (GZMB). The innate immunity includes central memory T cells (Tcm), effector memory T cells (Tem), natural killer (NK) cells, NK interferon-gamma (IFN-γ), and NK GZMB+.
[0014] Advantages and technical effects of the present invention: 1. This invention targets the unique mycolic acid barrier and peptidoglycan disulfide cross-linking structure of BCG cell walls, and establishes a triple synergistic cell wall disruption and high-pressure homogenization recombination process of "reduction-chelation-enzymatic hydrolysis". The resulting BBV particles are uniform in size and have a complete structure, retaining the conformation of natural membrane proteins. This overcomes the technical bottlenecks of low yield and long cycle of traditional natural secretion method and uneven particle size and loss of membrane protein activity of ultrasonic disruption method. 2. This invention uses BBV as a training immune inducer and establishes a standardized evaluation system for in vitro induction of BMDC training immunity. From four levels—efficient BMDC uptake, metabolic reprogramming, inflammatory factor secretion, and mature DC antigen presentation function—the training immune activity of BBV was systematically verified, and its effect is superior to that of the classic training immune inducer β-glucan (Glu). 3. This invention utilizes the BCG endogenous membrane protein MmpS4 to anchor the HPV16 E7 antigen to the BBV membrane surface, successfully constructing an engineered BBV (rBCG-MmpS4+E7 BBV) with membrane-anchored HPV16 E7 antigen. Immunoblotting confirmed that the E7 antigen is stably anchored to the BBV membrane surface, and MmpS4 is a BCG homologous protein, which has better biocompatibility and membrane integration efficiency. 4. In vivo anti-tumor experiments confirmed that the rBCG-MmpS4+E7 BBV nanovaccine synergistically activates acquired immunity (Th1, CTL, CD8) in lymph nodes. + T GZMB +Significantly elevated levels of TC-1 subcutaneous tumor cells and enhanced immune training (Tcm, Tem, and NK function) significantly inhibited the growth of TC-1 subcutaneous tumors, with effects far superior to unmodified BBV. This invention provides a novel candidate strategy for the immunotherapy of HPV-related tumors, with clear clinical application prospects and industrial value. Attached Figure Description
[0015] Figure 1 SDS-PAGE electrophoresis results of samples at each stage of BBV preparation; Figure 2 These are transmission electron microscopy results for BBV; Figure 3 Results for BBV particle size and PDI; Figure 4 Results for BBV Zeta potential; Figure 5 Results of BMDC uptake of BBV; Figure 6 The concentration of 2-NBDG in the supernatant of BMDC cells; Figure 7 The concentration of L-lactic acid in the supernatant of BMDC cells; Figure 8 The concentration of IL-6 in the supernatant of BMDC cells.
[0016] Figure 9 The concentration of IL-1β in the supernatant of BMDC cells; Figure 10 The concentration of TNF-α in the supernatant of BMDC cells; Figure 11 The result shows the proportion of DC cells in BMDC cells; Figure 12 The results show the proportion of DC CD86+ cells in BMDC cells; Figure 13 The results show the proportion of DC MHCI+ cells in BMDC cells; Figure 14 The results show the proportion of DC MHCII+ cells in BMDC cells; Figure 15 The results show the proportion of DCCD40+ cells in BMDC cells; Figure 16 The results of immunoblotting detection of BBV and rBCG-MmpS4+E7 BBV; Figure 17 For monitoring tumor growth, the tumor volume statistics are used. Figure 18 The results show the proportion of Th1 cells in lymph node lymphocytes; Figure 19The result shows the proportion of CTL cells in lymph node lymphocytes; Figure 20 The results show the proportion of CD8+T GZMB+ cells in lymph node lymphocytes; Figure 21 The result shows the proportion of Tcm cells in lymph node lymphocytes; Figure 22 The result shows the proportion of Tem cells in lymph node lymphocytes; Figure 23 The results show the proportion of NK cells in lymph node lymphocytes; Figure 24 Results showing the proportion of NK IFN-γ+ cells in lymph node lymphocytes; Figure 25 The results show the proportion of NK GZMB+ cells in lymph node lymphocytes. Detailed Implementation
[0017] The present invention will be further described below with reference to the accompanying drawings and examples. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in this embodiment shall be operated in accordance with conventional methods, and the reagents used shall be conventional reagents or reagents prepared in accordance with conventional methods unless otherwise specified.
[0018] Example 1: Preparation and characterization of BCG BBV based on synergistic cell disruption via reduction-chelation-enzymatic hydrolysis and high-pressure homogenization 1. Culture of BCG strains After reviving the BCG strain, it was inoculated into M7H9 liquid medium (containing 10% OADC enrichment broth, 0.5% glycerol, and 0.05% Tween-80) and incubated statically at 37°C and 5% CO2 for 2-3 weeks until the logarithmic growth phase (OD2). 600 =0.8-1.0) and collect the bacterial solution; 2. Synergistic cell wall disruption treatment involving reduction, chelation, and enzymatic hydrolysis. The collected BCG bacterial suspension was resuspended in a cell disruption buffer (0.1 M phosphate buffer containing 0.1 mol / L EDTA-2Na and 0.1% β-mercaptoethanol, pH 7.4) and cultured at 37°C with shaking for 2 hours. Then, 20 mg / mL lysozyme was added and cultured at 37°C with shaking overnight to further disrupt the cell wall. The bacterial suspension after cell disruption was centrifuged at 6000 g at 4°C for 20 minutes, the supernatant was removed, and the bacterial pellet was washed three times with 0.1 M phosphate buffer containing 1 mol / L sorbitol, pH 7.4, and then resuspended. 3. High-pressure homogenous extrusion treatment The bacterial suspension was placed in a high-pressure homogenizer and circulated three times at 4°C and a homogenization pressure of 1200 bar. After high-pressure homogenization, the bacterial suspension was centrifuged at 6000g and 4°C for 30 minutes, and the supernatant was collected. 4. Ultracentrifugation purification Transfer the supernatant to an ultracentrifuge tube, centrifuge at 100,000g and 4°C for 180 minutes, discard the supernatant, and resuspend the precipitate in sterile PBS (pH 7.4) by gentle pipetting. 5. Filtration, sterilization, and preservation The resuspended BBV suspension was filtered through a 0.45μm sterile filter membrane for sterilization, and then dispensed into sterile cryovials to obtain BCG biomimetic vesicles (BBV). The BBV was stored at -80℃ and thawed in an ice bath before use to avoid repeated freeze-thaw cycles.
[0019] 6. SDS-PAGE electrophoresis identification Take the products from each stage of the above preparation process and the purified BBV sample, add 5×SDS-PAGE loading buffer, and boil at 100℃ for 20 minutes. Perform SDS-PAGE electrophoresis using a 12.5% separating gel at 160V for 60 minutes. After electrophoresis, stain with Coomassie Brilliant Blue at room temperature for 2 hours, then destain with pure water until the background is clear. Record the results using a gel imaging system. The SDS-PAGE electrophoresis results are shown below. Figure 1 As can be seen from the figure, the BBV lanes show multiple protein bands with a molecular weight range of 15-235 kDa, which are similar to but relatively simplified compared to the total protein spectrum of BCG cells. This indicates that BBV effectively enriches BCG membrane-related proteins while removing cytoplasmic protein impurities.
[0020] 7. Observation using transmission electron microscopy Take 2 μL of freshly prepared BBV sample, add it to a copper grid, and let it stand at room temperature for 5 minutes. Blot away excess liquid with filter paper, add 2 μL of 2% phosphotungstic acid (pH 7.0) negative staining solution, and stain at room temperature for 2 minutes. Blot away the negative staining solution with filter paper, allow to dry at room temperature, and observe under a transmission electron microscope. Take photos of multiple randomly selected fields of view. The results are shown in the figure. Figure 2 ; Figure 2 Transmission electron microscopy (TEM) results showed that BBV exhibited a typical spherical structure with clear and complete membrane boundaries and a regular morphology. The BBV particle size was mainly distributed at 200 nm, and well-dispersed individual BBVs were visible in the field of view, with no other particulate impurities.
[0021] 8. Particle size, polydispersity index and zeta potential determination Purified BBV samples were diluted with sterile PBS to an appropriate concentration (1-10 μg / mL) and analyzed using a dynamic light scattering particle size analyzer. The parameters were set as follows: temperature 25℃, equilibration time 120 seconds. Five different batches of samples were analyzed, and the results are shown below. Figure 3-4 ; Figure 3The results showed that the average particle size of BBV was 251.9±43.76 nm and the polydispersity index (PDI) was 0.43±0.04, indicating that the particle size distribution of BBV was relatively concentrated and its monodispersity was good. Figure 4 The zeta potential measurement results showed that the surface zeta potential of BBV was -6.7±0.5 mV, indicating that the BBV suspension had good colloidal stability.
[0022] This embodiment successfully established an engineered preparation process combining reduction-chelation-enzymatic hydrolysis synergistic cell wall disruption and high-pressure homogenization recombination, targeting the mycolic acid barrier and peptidoglycan disulfide bond cross-linking structure unique to BCG cell walls. By reducing disulfide bonds with β-mercaptoethanol, chelating calcium and magnesium ions in the outer membrane with EDTA, hydrolyzing peptidoglycan with lysozyme, and combining this with high-pressure homogenization and low-temperature recombination, BBV with uniform particle size, intact structure, and preservation of the natural membrane protein conformation was successfully obtained.
[0023] Example 2: BCG BBV induces BMDC immune training and regulates its maturation in vitro. 1. Isolation and Induction of Differentiation of Mouse BMDCs Female C57BL / 6 mice aged 6-8 weeks were euthanized by cervical dislocation and then disinfected by immersion in 75% ethanol for 5 minutes. Under aseptic conditions, the femurs and tibias were separated, the epiphyses were cut, and the medullary cavity was repeatedly flushed with pre-cooled sterile PBS using a sterile syringe until the bone ends turned white. The flushing fluid was collected and filtered through a 70μm cell sieve to remove bone fragments and tissue blocks. The filtrate was centrifuged at 400g for 10 minutes, and the supernatant was discarded. The precipitate was washed once with sterile PBS and resuspended in erythrocyte lysis buffer. The erythrocytes were lysed by incubation at room temperature for 3 minutes, and an equal volume of PBS was added to terminate the lysis. The mice were centrifuged at 400g for 10 minutes, and the supernatant was discarded. The pellet was resuspended in complete culture medium (RPMI-1640 containing 10% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin, 20 ng / mL granulocyte-macrophage colony-stimulating factor (GM-CSF), and 10 ng / mL interleukin-4 (IL-4), and the cell density was adjusted to 1 × 10⁻⁶ cells / mL. 6 Cells were seeded at 10 cm² / mL in 10 cm culture dishes and cultured at 37°C in a 5% CO₂ incubator for 7 days, with fresh complete culture medium replaced every 2-3 days. On day 7, numerous semi-suspended, star-shaped or dendritic BMDCs were observed under a microscope. Cells were collected by gentle pipetting, and cell viability was counted after trypan blue staining. The cell density was then adjusted to 2 × 10⁻⁶ cells / mL. 6 cells / mL available for later use.
[0024] 2. BMDC's BBV uptake experiment BMDCs induced to differentiate on day 7 were seeded into confocal culture dishes (5 × 10⁶). 5 Cells / plate, adhered overnight. BBV was labeled with Dil fluorescent dye (excitation wavelength 549 nm, emission wavelength 565 nm) according to the instructions, incubated at 37°C in the dark for 30 minutes, and washed three times with PBS to remove free dye. Dil-labeled BBV was added to the BMDC culture system to a final concentration of 5 μg / mL and cultured for 16 hours. After culture, the supernatant was aspirated, and the cells were washed twice with PBS, then fixed with 4% paraformaldehyde at room temperature for 15 minutes. After washing three times with PBS, DAPI staining solution (1 μg / mL) was added and stained at room temperature in the dark for 10 minutes to label cell nuclei. After washing three times with PBS, the cells were observed and photographed under a confocal fluorescence microscope. The results are shown in the table below. Figure 5 ; Figure 5 Confocal microscopy revealed that Dil-labeled BBV (red fluorescence) was diffusely or dotted within BMDCs, while DAPI-labeled nuclei (blue fluorescence) had clear outlines and overlapped in position, indicating that BBV was efficiently taken up by BMDCs, providing a cellular uptake basis for subsequent BBV-induced immune training.
[0025] 3. BMDC training immune induction and restimulation experiment The isolated BMDCs were divided into three groups: PBS control group, BBV group, and Glu group (positive control). BMDCs were seeded into 24-well plates (2 × 10⁻⁶ wells). 6 Cells / well were added to PBS (equal volume, 0.1M, pH 7.4), BBV (5 μg / mL), and Glu (10 μg / mL) respectively, and stimulated in a 37℃, 5% CO2 incubator for 24 hours. After stimulation, cells were collected, centrifuged at 400g for 5 minutes, and the supernatant was discarded; the cells were washed twice with pre-warmed PBS to remove residual stimulants; the cells were resuspended in fresh complete culture medium and cultured quiescently in a 37℃, 5% CO2 incubator for 7 days, with half of the culture medium replaced every 2-3 days; after quiescence, cells from each group were collected and the density adjusted to 2×10⁶ cells / well. 6 Cells / mL were seeded into 24-well plates. Each group was further divided into two subgroups: a PBS restimulation group and an LPS restimulation group (lipopolysaccharide, LPS final concentration 25 ng / mL). Cells were cultured at 37°C in a 5% CO2 incubator for 24 hours. After culture, the supernatant was collected, centrifuged at 800g for 5 minutes to remove cell debris, aliquoted, and stored at -80°C. The cell pellet was also collected for subsequent flow cytometry analysis.
[0026] 4. Detection of metabolic reprogramming biomarkers Take cells after restimulation and adjust the density to 1×10⁻⁶. 6Cells / mL were added, and 2-NBDG was added to a final concentration of 100 μM. The cells were incubated at 37°C in the dark for 30 minutes. After washing twice with PBS, the fluorescence intensity of the FITC channel was detected by flow cytometry, and the mean fluorescence intensity (MFI) was recorded. Results are shown below. Figure 6 Cell culture supernatant was collected after restimulation, and L-lactate concentration was detected using the L-lactate oxidase method (L-lactate assay kit, microplate reader wavelength 580 nm). Results are shown below. Figure 7 ; The results showed that after LPS restimulation, BBV-pretrained BMDCs had increased 2-NBDG uptake of MFI ( Figure 6 ) and supernatant L-lactic acid concentration ( Figure 7 Both BBV and Glu (2-dose positive control group) concentrations were significantly higher than those in the PBS control group (p<0.0001, p<0.001), and there was no statistically significant difference in L-lactate concentration between the two-fold dose positive control group and Glu. These results indicate that BBV treatment alone can significantly enhance glucose uptake and glycolytic flux in BMDCs, successfully inducing metabolic reprogramming dependent on training immunity in BMDCs. Its effect is comparable to that of the classic training immunity inducer Glu, confirming the metabolic activity of BBV as a training immunity inducer.
[0027] 5. Detection of inflammatory cytokines Cell culture supernatant was collected after restimulation, and the concentrations of IL-6, IL-1β, and TNF-α were detected by ELISA. The supernatant sample was added to an ELISA plate pre-coated with capture antibody and incubated at 37°C for 2 hours; after washing, the detection antibody was added and incubated at 37°C for 1 hour; after washing, biotin-labeled horseradish peroxidase was added and incubated at 37°C for 30 minutes; after washing, the chromogenic substrate was added and the plate was developed in the dark for 15 minutes; after stopping the reaction, the absorbance was measured at 450 nm, and the concentrations of each cytokine were calculated according to the standard curve. The results are shown below. Figure 8-10 .
[0028] The results showed that after LPS restimulation, IL-6 in the supernatant of BBV-pretrained BMDCs ( Figure 8 ), IL-1β ( Figure 9 ) and TNF-α ( Figure 10 The concentrations of BBV were significantly higher than those in the PBS control group (p<0.0001) and significantly higher than those in the positive control Glu group at twice the dose. These results indicate that BBV can not only successfully induce the expression of key effector molecules for training immunity in BMDCs, but its pro-inflammatory ability is even superior to that of the classic training immunity inducer Glu, providing a stronger inflammatory microenvironment for subsequent DC maturation and highlighting the superiority of BBV in training immunity induction.
[0029] 6. Flow cytometry detection of DC maturation After restimulation, cells were washed once with PBS and their density adjusted to 1×10⁶. 7 Cells / mL, 100 μL of cell suspension was added to each tube. The corresponding fluorescently labeled antibody was added, and the tubes were incubated at 4°C in the dark for 30 minutes. After washing twice with PBS, the cells were resuspended in 200 μL of PBS. Flow cytometry was used to detect DCs (CD11c+CD11b+), DC CD86+ (CD11b+CD11c+CD86+), DC MHCI+ (CD11b+CD11c+MHCI+), DC MHCII+ (CD11b+CD11c+MHCII+), and DC CD40+ (CD11b+CD11c+CD40+). Results are shown in [Figure missing]. Figure 11-15 .
[0030] Flow cytometry analysis showed that after LPS restimulation, the total number of DCs in the BBV group ( Figure 11 ), DC CD86+ subgroup ( Figure 12 DC MHCI+ subgroup ( Figure 13 DC MHCII+ subgroup ( Figure 14 ), DC CD40+ subgroup ( Figure 15 The proportion of cells in the BBV-induced DCs was significantly higher than that in the PBS control group (p<0.01). In particular, the positivity rates of MHCI, MHCII, and CD40 induced by BBV even exceeded those in the 2-fold dose positive control Glu group. These results indicate that BBV systematically drives the functional maturation of BMDCs by triggering training immunity, significantly upregulating co-stimulatory signals, antigen-presenting molecules, and inflammatory activation markers. Its effect is superior to that of the classic inducer Glu, fully demonstrating the significant advantage of BBV as a training immunity inducer in promoting DC maturation.
[0031] This embodiment systematically establishes a standardized evaluation system for BCG BBV to induce BMDC training immunity and precisely regulate its function in vitro. From the four levels of efficient BBV uptake by BMDC, metabolic reprogramming, secretion of inflammatory factors to DC functional maturation, it progressively confirms that: the BCG BBV prepared in Example 1 can efficiently induce BMDC to establish training immune memory and systematically promote DC maturation; BBV reaches or even surpasses the level of the classic training immune inducer Glu in many indicators, fully demonstrating that BBV can serve as a highly efficient and controllable training immune inducer to precisely regulate the functional state of immune cells in vitro.
[0032] Example 3: Construction and identification of membrane-anchored HPV16 E7 antigen BBV 1. Construction of rBCG-MmpS4+E7 fusion expression vector Based on the BCG-derived MmpS4 gene sequence published in GenBank (accession number NC_008769.1), the MmpS4 gene fragment (SEQ ID NO:1, 420bp) was optimized and synthesized. MmpS4 is a membrane protein encoded by BCG itself, and its N-terminus contains a transmembrane domain, which can efficiently display exogenous antigens on the bacterial membrane surface. Simultaneously, the HPV16 E7 gene (SEQ ID NO:2, 297bp) was synthesized based on GenBank (accession number KJ152697.1). A flexible linker peptide (GGTTCGGGTGGCTCGGGTGGTGGCTCG, SEQ ID NO:3, 27bp) was used to fuse the C-terminus of MmpS4 with the N-terminus of E7 to construct the MmpS4+E7 fusion gene, with BamHI and HindIII sites introduced at both ends, for a total length of 744bp.
[0033] The fusion gene and pMV261 vector were digested with BamHI and HindIII, respectively, and incubated at 37°C for 2 hours. The recovered DNA was then ligated overnight at 16°C using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α and plated on LB agar plates containing 100 μg / mL kanamycin, and incubated at 37°C for 12–16 hours. Positive clones were selected and sequenced for verification, yielding the recombinant plasmid pMV261-MmpS4+E7.
[0034] 2. rBCG-MmpS4+E7 BBV build Preparation of BCG competent cells: BCG cells were seeded in M7H9 liquid medium (containing 10% OADC enrichment broth, 0.5% glycerol, and 0.05% Tween-80) and cultured at 37°C until the logarithmic growth phase (OD200). 600 =0.6-0.8), collect bacterial cells by centrifugation at 4℃ and 6000g for 15 minutes, wash three times with pre-cooled 10% glycerol, and finally resuspend in 10% glycerol, adjusting the concentration to approximately 1×10. 8 CFU / mL.
[0035] Take 200 μL of BCG competent cells, add 1 μg of recombinant plasmid pMV261-MmpS4+E7, mix well, and transfer to a 0.2 cm electroporation cuvette. Electroporation parameters: voltage 2.5 kV, capacitance 25 μF, resistance 1000 Ω. Immediately after electroporation, add 1 mL of M7H9 medium and incubate at 37°C for 24 hours. Spread the recovered bacterial culture onto M7H10 solid medium (containing 10% OADC enrichment broth and 0.5% glycerol) containing 25 μg / mL kanamycin, and incubate at 37°C and 5% CO2 for 3-4 weeks. Pick single colonies for expansion culture to obtain the rBCG-MmpS4+E7 recombinant strain.
[0036] Collect the logarithmic phase rBCG-MmpS4+E7 bacterial culture, centrifuge at 4℃ and 8000g for 15 minutes to collect the bacterial cells, and prepare membrane-anchored E7 antigen BBV (rBCG-MmpS4+E7 BBV) according to the method of steps 1-5 in Example 1.
[0037] 3. Immunoblotting detection of E7 protein expression rBCG-MmpS4+E7 BBV samples were subjected to SDS-PAGE (12.5% separating gel), transferred to a PVDF membrane, and blocked with 5% skim milk powder for 1 hour. The membrane was then incubated overnight at 4°C with anti-HPV16 E7 monoclonal antibody (1:1000), followed by incubation at room temperature for 1 hour with HRP-labeled secondary antibody (1:1000), and chemiluminescent imaging was performed. Simultaneously, an equal amount of unmodified BBV was used as a negative control. Results are shown in [Figure number missing]. Figure 16 ; Figure 16 Western blot analysis showed a positive band at 25 kDa for the rBCG-MmpS4+E7 BBV sample, consistent with the expected molecular weight of the MmpS4+E7 fusion protein, while the negative control showed no band. These results indicate that the E7 antigen was successfully displayed on the BBV membrane surface via the anchoring effect of the BCG endogenous membrane protein MmpS4.
[0038] This embodiment utilizes the BCG endogenous membrane protein MmpS4 as an anchoring unit to construct a recombinant BCG strain stably expressing the MmpS4+E7 fusion protein. Through a synergistic cell disruption process of reduction-chelation-enzymatic digestion and high-pressure homogenization, a membrane-anchored HPV16 E7 antigen BBV was successfully prepared. Compared to exogenous anchoring proteins, MmpS4 is a BCG homologous protein with better biocompatibility and membrane integration efficiency, providing a superior antigen delivery platform for subsequent induction of E7-specific training immune responses and anti-tumor immune responses.
[0039] Example 4: rBCG-MmpS4+E7 BBV nanovaccine inhibits tumor growth 1. Establishment and grouping of animal cervical cancer tumor models Female C57BL / 6 mice aged 6-8 weeks were subcutaneously inoculated with TC-1 cells (5 × 10⁻⁶) on their right back. 5 (cells / each) to establish a subcutaneous tumor-bearing model. Wait until the tumor volume reaches approximately 50-80 mm. 3 At that time, the mice were randomly divided into three groups (n=8 mice / group): PBS control group: 100 μL of sterile PBS was injected subcutaneously; BBV group: 5 μg of unmodified BBV (prepared in Example 1) was injected subcutaneously. rBCG-MmpS4+E7 BBV group: 5 μg rBCG-MmpS4+E7 BBV was injected subcutaneously (prepared in Example 3).
[0040] 2. Immunization regimen Each group was immunized subcutaneously on days 12, 19, and 26 after tumor inoculation, for a total of three immunizations. The injection volume for each PBS control group, BBV group, and rBCG-MmpS4+E7 BBV group was 100 μL. All mice were injected subcutaneously at the same site.
[0041] 3. Tumor growth monitoring Starting from day 12 post-inoculation, the long and short diameters of the tumor were measured every 3 days using electronic calipers, and the tumor volume was calculated using the formula: Tumor volume (mm). 3 ) = (major axis × minor axis) 2 ) / 2. Tumor growth curves were plotted on day 33, and the results are shown below. Figure 17 When the tumor volume exceeds 2000 mm 3 Mice may be euthanized if ulceration occurs.
[0042] Figure 17 Tumor growth curves showed that both the BBV group and the rBCG-MmpS4+E7 BBV group significantly inhibited tumor growth compared to the PBS control group (p<0.0001). The tumor-suppressive effect exhibited by the BBV group was mainly attributed to its induced training-mediated innate immunity, thereby indirectly stimulating an acquired immune response. Importantly, compared to the BBV group, the rBCG-MmpS4+E7 BBV group showed a further enhanced tumor growth inhibition (p<0.0001), indicating that anchoring the E7 antigen to the BBV membrane surface via MmpS4 can superimpose an antigen-specific anti-tumor immune response on top of the training immunity, thus significantly enhancing the therapeutic effect on TC-1 subcutaneous tumors.
[0043] This embodiment validated the therapeutic immunomodulatory effects of BBV and rBCG-MmpS4+E7 BBV in a TC-1 subcutaneous tumor-bearing model. The results showed that unmodified BBV produced limited non-specific inhibitory effects through training the immune mechanism; while the antigen-modified nanovaccine, at the same dose, achieved targeted antigen presentation via membrane-anchored E7 antigen, successfully inducing a highly efficient antigen-specific CTL response. This demonstrated a synergistic effect between innate and acquired immunity, providing a promising candidate vaccine for the immunotherapy of HPV-related tumors.
[0044] Example 5: rBCG-MmpS4+E7 BBV nanovaccine synergistically activates lymph node acquired and innate immunity 1. Establishment and grouping of animal cervical cancer tumor models Same as step 1 in Example 4.
[0045] 2. Immunization regimen Same as step 2 in Example 4.
[0046] 3. Sample Collection and Processing Mice were sacrificed on day 33, and inguinal lymph nodes were aseptically isolated. The lymph nodes were minced and placed in RPMI 1640 medium containing 1 mg / mL collagenase, and digested with shaking at 37°C for 30 minutes. The mixture was then filtered through a 70 μm cell sieve to prepare a single-cell suspension.
[0047] 4. Flow cytometry detection Take a single-cell suspension from lymph nodes and adjust the concentration to 1×10⁻⁶. 7 Cells / mL were added to flow cytometry tubes, and the following fluorescently labeled antibody combination was added. The cells were incubated at 4°C in the dark for 30 minutes. After washing with PBS, the proportion of each cell subset was detected by flow cytometry. Results are shown in [Figure number missing]. Figure 18-25 : Acquired immunity-related markers: Th1 (CD3+CD4+IFN-γ+), CTL (CD3+CD8+IFN-γ+), CD8+TGZMB+ (CD3+CD8+GZMB+).
[0048] Training immune-related indicators: Tcm (CD3+CD8+CD44+CD62L+), Tem (CD3+CD8+CD44+CD62L-), NK (CD3-NK1.1+), NK IFN-γ+ (CD3-NK1.1+IFN-γ+), NK GZMB+ (CD3-NK1.1+ GZMB+).
[0049] The results showed that, in terms of acquired immune response, compared with the PBS control group, the Th1 (β1) level in the lymph nodes of the BBV group and the rBCG-MmpS4+E7BBV group was significantly higher. Figure 18 ), CTL ( Figure 19 ) and CD8+T GZMB+ ( Figure 20 The proportion of T cells was significantly increased in both the BBV and rBCG-MmpS4+E7 BBV groups; and compared with the BBV group, the above indicators were further significantly increased in the rBCG-MmpS4+E7 BBV group, indicating that membrane anchoring of E7 antigen can effectively enhance antigen-specific T cell activation and killing function. Regarding training immune-mediated innate immune responses, compared with the PBS control group, the proportion of Tcm ( ) in lymph nodes in both the BBV and rBCG-MmpS4+E7 BBV groups was significantly increased. Figure 21 ), Tem ( Figure 22 ), total number of NK cells ( Figure 23 ), NKIFN-γ+ ( Figure 24 ) and NK GZMB+ ( Figure 25The proportion of cells was significantly increased, confirming that the BBV vector itself has the ability to induce training immunity, and E7 antigen anchoring did not weaken this effect. BBV exerts its inherent anti-tumor effect by systematically activating memory T cells and NK cells through this training immunity mechanism.
[0050] This embodiment demonstrates that the rBCG-MmpS4+E7 BBV nanovaccine achieves comprehensive regulation of the anti-tumor immune response in lymph nodes by synergistically activating acquired immunity (antigen-specific Th1 / CTL response) and innate immunity (enhanced memory T cell and NK cell function). Compared to unmodified BBV, rBCG-MmpS4+E7 BBV exhibits significant advantages in inducing antigen-specific T cell killing function while fully preserving its training immune induction ability, fully demonstrating its multi-level synergistic mechanism as a novel tumor nanovaccine.
Claims
1. A biomimetic vesicle for BCG vaccine, characterized in that: BCG bacterial suspension was prepared using phosphate buffer containing 0.05-0.15 mol / L EDTA-2Na and 0.05-0.15% β-mercaptoethanol. After shaking culture, lysozyme was added, and the suspension was continued to be shaken and cultured overnight. The supernatant was removed by centrifugation at 3000-8000g at 4℃. The bacterial precipitate was washed 2-5 times with sorbitol solution and resuspended. The bacterial suspension was placed in a high-pressure homogenizer and treated 2-5 times at 800-1500 bar at 2-6℃. The bacterial suspension was then centrifuged at 3000-8000g at 4℃, and the supernatant was collected. The supernatant was purified by ultracentrifugation at 80000-150000g at 4℃, and the precipitate was collected. The precipitate was resuspended in sterile phosphate buffer and filtered through a 0.45μm sterile filter membrane to obtain BCG biomimetic vesicles.
2. The BCG biomimetic vesicle according to claim 1, characterized in that: The sorbitol solution is a phosphate buffer containing 0.5-1.5 mol / L sorbitol.
3. The application of the BCG biomimetic vesicles as described in claim 1 as a training immune inducer in the preparation of tumor nanovaccines.
4. The BCG biomimetic vesicle according to claim 1, characterized in that: BCG is a recombinant strain of BCG. The recombinant strain of BCG is obtained by fusing the BCG endogenous membrane protein MmpS4 gene with the antigen gene through a flexible linker peptide to obtain a fusion gene, ligating the fusion gene with the pMV261 vector to obtain a recombinant plasmid, and transforming the recombinant plasmid into BCG to obtain a recombinant strain.
5. The BCG biomimetic vesicle according to claim 4, characterized in that: The tumor antigen gene is anchored to the surface of the BCG biomimetic vesicle by the MmpS4 gene, an endogenous membrane protein of BCG.
6. The BCG biomimetic vesicle according to claim 4, characterized in that: The nucleotide sequence of the BCG endogenous membrane protein MmpS4 gene is shown in SEQ ID NO:1; the tumor antigen gene is the HPV16 E7 gene, and its nucleotide sequence is shown in SEQ ID NO:2; the nucleotide sequence of the flexible linker peptide is shown in SEQ ID NO:
3.
7. The application of the BCG biomimetic vesicles as described in claim 4 in the preparation of tumor nanovaccines.
8. The application according to claim 3 or 7, characterized in that: Tumor nano-vaccines are vaccines for the treatment of cervical cancer.