An antisense oligonucleotide targeting the RdRp gene and uses thereof

Abstract

This invention discloses an antisense oligonucleotide targeting and inhibiting the RdRp gene and its applications. This study designed and screened a series of antisense oligonucleotides (ASOs) targeting the highly conserved SARS-CoV-2 RNA-dependent RNA polymerase (RdRp), and systematically evaluated their antiviral effects against various SARS-CoV-2 variants. Experimental results show that the designed ASO molecules, especially RDRP-5, exhibit significant viral inhibitory activity at multiple experimental levels (including reporter gene systems, viral replicon models, and true viral infection experiments).

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to an antisense oligonucleotide that targets and inhibits the RdRp gene and its applications. Background Technology

[0002] Antisense oligonucleotides (ASOs) are short-chain nucleic acid molecules synthesized artificially. Their core technology lies in the principle of "sequence-specific pairing." ASOs are designed to be perfectly complementary to specific target messenger RNA (mRNA) sequences and bind precisely to them through classic base pairing principles. This binding primarily triggers two different mechanisms to prevent the production of harmful proteins: first, a steric hindrance mechanism—the bound ASO physically hinders the cleavage of mRNA, thus directly preventing the formation of mature mRNA; second, an RNase H1-mediated degradation mechanism—after forming a DNA-RNA hybrid double helix with mRNA, the ASO recruits the cell's endogenous RNase H1 enzyme. This enzyme specifically cleaves the RNA portion of the hybrid strand, leading to mRNA degradation and achieving gene silencing at a higher upstream level.

[0003] The key breakthrough of this technology lies in the extensive chemical modification of its phosphate backbone, ribose and other parts, which greatly enhances the stability of oligonucleotides in vivo, their affinity for targets and delivery efficiency, enabling them to move from laboratory concepts to clinical applications.

[0004] In the field of antiviral research, antisense oligonucleotides have demonstrated unique advantages. The RNA-dependent RNA polymerase (RdRp), responsible for viral replication during the SARS-CoV-2 lifecycle, is highly conserved, providing a clear target for designing highly specific antisense drugs. Their mechanism of action is direct and efficient: by entering infected cells and binding to mRNA or genomic RNA essential for viral replication, they block the synthesis of key viral proteins (such as polymerases and capsid proteins) or directly disrupt the viral genome, fundamentally inhibiting viral replication and amplification. For example, antisense drugs targeting Ebola virus, influenza virus, and hepatitis B virus have shown potential in preclinical or clinical studies, demonstrating their possibility as a broad-spectrum antiviral strategy.

[0005] Despite its promising prospects, this technology still faces challenges such as delivery efficiency, potential off-target effects, and long-term safety. However, with continuous advancements in delivery technologies and chemical modification platforms, antisense oligonucleotides have become a highly attractive precision tool for combating emerging and re-emerging viral infectious diseases. Since they do not rely on the live replication process of the virus, they hold significant strategic value in combating drug-resistant strains or viruses lacking effective treatments, opening a new pathway for antiviral drug development. Summary of the Invention

[0006] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of this invention is to provide an antisense oligonucleotide that targets and inhibits the RdRp gene.

[0007] Another object of the present invention is to provide the application of the above-mentioned antisense oligonucleotides that target and inhibit the RdRp gene.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] An antisense oligonucleotide that targets and inhibits the RdRp gene, comprising at least one of the following:

[0010] RDRP-1, its nucleotide sequence is as follows:

[0011] G*T*A*A*G*G*T*C*A*G*T*C*T*C*A*G*T*C*C*A*;

[0012] RDRP-2, its nucleotide sequence is as follows:

[0013] T*T*C*G*T*C*C*T*T*T*T*C*T*T*G*G*A*A*G*C*;

[0014] RDRP-3, its nucleotide sequence is as follows:

[0015] G*G*T*T*C*C*C*A*A*T*A*C*C*T*T*G*A*A*G*T*;

[0016] RDRP-4, its nucleotide sequence is as follows:

[0017] T*G*G*C*C*G*T*G*A*C*A*G*C*T*T*G*A*C*A*A*;

[0018] RDRP-5, its nucleotide sequence is as follows:

[0019] G*G*T*G*G*T*A*T*G*T*C*T*G*A*T*C*C*C*A*A*;

[0020] In the above nucleotide sequences, nucleotides with an asterisk (*) at the end represent nucleotides modified by thiophosphorylation.

[0021] Or RDRP-1, RDRP-2, RDRP-3, RDRP-4, RDRP-5 analogs that still have the function of inhibiting RdRp gene expression, obtained through base insertion, deletion, or substitution.

[0022] The antisense oligonucleotides that target and inhibit the RdRp gene, after being transfected into cells using a transfection reagent, can suppress the expression level of the RdRp gene.

[0023] A reagent for targeting and inhibiting the expression of the RdRp gene, comprising the aforementioned antisense oligonucleotides that target and inhibit the RdRp gene.

[0024] The reagents described for targeting and inhibiting RdRp gene expression also include transfection reagents for transferring antisense oligonucleotides into cells.

[0025] The application of the aforementioned antisense oligonucleotides that target and inhibit the RdRp gene and / or reagents that target and inhibit the expression of the RdRp gene in the preparation of anti-COVID-19 drugs.

[0026] The novel coronavirus mentioned includes at least one of SARS-CoV-2 Wuhan-Hu-1 (original strain), SARS-CoV-2 Delta, SARS-CoV-2 Omicron BA.1, and SARS-CoV-2 XBB.1.1.6.

[0027] The present invention has the following advantages and effects compared with the prior art:

[0028] This study designed and screened a series of antisense oligonucleotides (ASOs) targeting the highly conserved SARS-CoV-2 RNA-dependent RNA polymerase (RdRp), and systematically evaluated their antiviral effects against various SARS-CoV-2 variants. Experimental results showed that the designed ASO molecules, especially RDRP-5, exhibited significant viral inhibition at multiple experimental levels, including reporter gene systems, viral replicon models, and live virus infection experiments.

[0029] First, rational ASO design using RNA structure v6.3 software combined with OligoWalk function successfully screened several potentially effective sequences. Real-time PCR results showed that RDRP-5 significantly reduced intracellular RdRpmRNA levels, indicating its good targeted silencing efficiency. Further experiments in the secNluciferase reporter virus replication system confirmed that RDRP-5 treatment could significantly inhibit viral transcriptional activity, further supporting its antiviral potential.

[0030] In live virus experiments, RDRP-5 exhibited broad-spectrum inhibitory effects against various variants of interest, including the original strain, Delta, Omicron, and XBB.1.1.6. Notably, this ASO significantly reduced viral load and viral titer in the early to mid-stages of XBB.1.1.6 variant infection (24–72 hours), reaching its peak inhibitory effect around 72 hours, suggesting that its action may be related to the progression of the viral replication cycle. However, the inhibitory effect generally weakened after 96 hours, suggesting that the stability or intracellular persistence of the ASO may still need optimization. Attached Figure Description

[0031] Figure 1 This is a plasmid map of the pXJ2-scv2-NSP12-GFP plasmid.

[0032] Figure 2 This is the experimental result of the 293T cell expression inhibition experiment in Example 2.

[0033] Figure 3 This is a schematic diagram of the vector construction in Example 3; where A is the structure of the SARS-CoV-2 genome. B is the structure of the SARS-CoV-2 viral replicon.

[0034] Figure 4 This is the experimental result of the determination of secNanoLuci activity in Example 3.

[0035] Figure 5 This is the experimental result of nucleic acid drug against the original SARS-CoV-2 virus in Example 4.

[0036] Figure 6 This is the experimental result of nucleic acid drug against SARS-CoV-2 delta virus in Example 4.

[0037] Figure 7 This is the experimental result of nucleic acid drug against SARS-CoV-2 Omecron virus in Example 4.

[0038] Figure 8 These are the experimental results of the nucleic acid drug against XBB.1.1.6 virus at different time periods in Example 4. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0040] Human embryonic kidney cells (HEK293T) and human liver cancer cells (HuH-7) were purchased and preserved by our laboratory.

[0041] DMEM medium, fetal bovine serum, and Opiti-MEM medium were all purchased from GIBCO, USA; Lipofectamine 3000 was purchased from Thermo Fisher Scientific; Trizol was purchased from Invitrogen, USA; and 2x SYBR Green qPCR Master Mix was purchased from Biosharp.

[0042] The Military Veterinary Research Institute of the Academy of Military Medical Sciences provided the original Wuhan strain (SARS-CoV-2 Wuhan-Hu-1), Delta virus strain, Omicron BA.1, and SARS-CoV-2 XBB.1.1.6 virus strain, and conducted real virus experiments in the Biosafety Level 3 (P3) laboratory of the Military Veterinary Research Institute of the Academy of Military Medical Sciences.

[0043] Data are expressed as mean ± SD of at least three biological replicates. Statistical analysis was performed using GraphPad Prism version 8.0 (Systat Software, San Jose, CA, USA). The Student's two-tailed unpaired t-test was used to analyze the significance of differences between groups, and a p-value < 0.05 was considered statistically significant.

[0044] Example 1: Design and Synthesis of Antisense Oligonucleotides

[0045] To design an efficient antisense oligonucleotide (ASO) targeting and inhibiting the RdRp gene of SARS-CoV-2, the RdRp mRNA sequence was obtained from NCBI (National Center for Biotechnology Information). Secondary structure simulations of this sequence fragment were performed using RNAstructure v6.3 software, and the simulation results were analyzed using the OligoWalk function. By calculating the Gibbs free energy of ASO binding at all different positions, the optimal design scheme, i.e., the most stable binding site of the antisense oligonucleotide, was determined.

[0046] Log in to NCBI, obtain the RdRp sequence (MN908947), import the sequence into RNA structure v6.3 software, perform secondary structure simulation on the sequence fragment, and use the OligoWalk function in the software to analyze the simulation results. By calculating the Gibbs free energy of antisense oligonucleotide binding at all different positions, the optimal design scheme, i.e. the most stable binding site of antisense oligonucleotide, is given.

[0047] Based on potential binding sites, five antisense oligonucleotides were designed. A biotechnology company was commissioned to synthesize all candidate sequences, and each sequence underwent full-thiophosphorylation backbone modification. The specific sequences are as follows:

[0048] SCR:C*A*T*T*A*A*T*G*T*C*G*G*A*C*A*A*C*T*C*A*A*T*;

[0049] RDRP-1: G*T*A*A*G*G*T*C*A*G*T*C*T*C*A*G*T*C*C*A*;

[0050] RDRP-2: T*T*C*G*T*C*C*T*T*T*T*C*T*T*G*G*A*A*G*C*;

[0051] RDRP-3: G*G*T*T*C*C*C*A*A*T*A*C*C*T*T*G*A*A*G*T*;

[0052] RDRP-4 :T*G*G*C*C*G*T*G*A*C*A*G*C*T*T*G*A*C*A*A*;

[0053] RDRP-5 :G*G*T*G*G*T*A*T*G*T*C*T*G*A*T*C*C*C*A*A*.

[0054] Note: Nucleotides with an asterisk (*) at the end represent thiophosphorylation modification.

[0055] Example 2: 293T cell expression inhibition experiment

[0056] 2.1 Passaging of 293T cells

[0057] 293T cells were cultured in DMEM medium containing 10% FBS and 1% penicillin-dextrose antibodies. The culture environment was a cell culture incubator with constant temperature (37℃), constant humidity (70%), and constant carbon dioxide (5%). Cells were passaged every 2-3 days, depending on their growth status. During passage, the culture medium was discarded, the cells were washed twice with PBS buffer, and an appropriate amount of 0.25% trypsin-EDTA was added. The culture flask was then placed in a cell culture incubator for 1-2 minutes to digest the cells. Complete culture medium was then added to the flask to stop the digestion, and the resulting cell suspension was passaged into individual flasks, typically three times per flask.

[0058] 2.2 Plasmid Design and Construction

[0059] (1) Design and synthesize gene fragments

[0060] The NSP12 gene of the novel coronavirus was codon optimized for mammalian cells, and a GFP tag sequence was fused to its end. The DNA fragment was then obtained through whole-genome synthesis.

[0061] (2) PCR amplification of the target fragment

[0062] Using the synthesized gene as a template, PCR amplification was performed using high-fidelity DNA polymerase; the 5' end of the primer was fitted with restriction enzyme sites (such as Cla I / Kpn I) and protective bases that matched the pXJ2 vector.

[0063] (3) Double enzyme digestion of linearized pXJ2 vector

[0064] Extract pXJ2 plasmid DNA and perform double digestion with the same pair of restriction endonucleases as in step (2) to linearize the vector; after separation by agarose gel electrophoresis, the linearized vector is recovered by gel cutting.

[0065] (4) Connect the target fragment to the carrier

[0066] The recovered NSP12-GFP fragment was mixed with the linearized pXJ2 vector at a molar ratio of 3:1 to 10:1, and T4 DNA ligase was added. The mixture was then ligated overnight at 16°C.

[0067] (5) Transformation of Escherichia coli

[0068] The ligation product was transformed into DH5α competent cells, and after heat shock (42°C for 45-60 seconds), it was spread on LB agar plates containing ampicillin and incubated upside down at 37°C overnight.

[0069] (6) Screening for positive clones

[0070] Single colonies were selected for initial screening using colony PCR. Positive clones were then subjected to plasmid extraction in small quantities, and the fragment size was verified by double enzyme digestion.

[0071] (7) Sequencing verification

[0072] The plasmid that was correctly identified by enzyme digestion was subjected to Sanger sequencing to confirm that the NSP12-GFP sequence was free of mutations and that the reading frame was correct. Finally, the successfully constructed pXJ2-scv2-NSP12-GFP plasmid (SEQ ID NO.10) was obtained.

[0073] 2.3 Transfection and Grouping

[0074] Cells were divided into SCR and ASO groups. The SCR group consisted of cells transfected with random oligonucleotide sequences, while the ASO group consisted of cells transfected with candidate antisense oligonucleotide sequences. The final concentration for both SCR and ASO groups was set at 0.5 μmol / L. Transfection was performed using cationic liposome Lipofectamine 3000, and the transfection steps are as follows:

[0075] (1) Take cells in the logarithmic growth phase and adjust the cell suspension concentration to 3×10⁻⁶ using DMEM medium containing serum and antibiotics. 5 1 mL / mL was seeded into each well of a 6-well plate. The culture plate was placed at 37 ℃ with 5% CO2, and transfection was performed when the cells reached 60-80% confluency.

[0076] (2) Before transfection, remove the original culture medium from the 6-well plate. Add 1.5 mL of DMEM medium without serum and antibiotics and starve the plate.

[0077] (3) Prepare antisense oligonucleotide-Lipo3000 mixture.

[0078] a. Dilute the transfection reagent lipofectamine 3000; before use, gently shake the lipo3000 transfection reagent, then take 5 μL and dilute it with 250 μL of serum-free optimized medium (Opti-MEM), mix gently, and incubate at room temperature for 5 min;

[0079] b. Dilute the antisense oligonucleotide: Dilute 10 μL of antisense oligonucleotide and 1 μg of plasmid with 250 μL of serum-free optimized medium (Opti-MEM) and mix gently;

[0080] c. After incubating the diluted lipo3000 for 5 min, gently mix it with the antisense oligonucleotides and plasmids diluted in (b) above, and incubate at room temperature for 20 min;

[0081] (4) Add the above mixture to the cell culture plate containing cells and culture medium, and gently shake to mix them;

[0082] (5) After incubation at 37°C for 6 h, remove the culture medium containing the liposome mixture from the wells and replace it with complete culture medium (containing serum and antibiotics).

[0083] (6) After culturing the culture plate in a 37°C, 5% CO2 incubator for 48 h, RNA was extracted.

[0084] 2.4 Real-time PCR detection of the degradation ability of antisense oligonucleotides on target mRNA

[0085] To investigate the degradation ability of different antisense oligonucleotides (ASOs) on their target mRNAs after transfection into cells, real-time PCR was used to detect changes in target mRNA expression levels before and after transfection, aiming to identify the most effective ASO. The main steps were as follows:

[0086] After extracting total RNA from cells in step 2.3, cDNA was reverse transcribed and the relative expression level of mRNA was detected by qPCR, using GAPDH or β-actin as internal controls. The Ct values ​​of the target gene and the internal controls were calculated using a 2-1T ratio. -△△Ct Calculate the relative level changes of the target gene.

[0087] GAPDH-Forward:CAATGACCCCTTCATTGACC;

[0088] GAPDH-Reverse:GACAAGCTTCCCGTTCTCAG;

[0089] RdRp- Forward:GTGARATGGTCATGTGTGGCGG;

[0090] RdRp- Reverse:CARATGTTAAASACACTATTAGCATA.

[0091] 2.5 Experimental Results

[0092] To verify whether our designed RDRP-targeting ASO degrades RdRp mRNA, we co-transfected 0.5 μM ASO and 1 μg pXJ2-scv2-NSP12-GFP plasmid into 293T cells using a Lipo3000. After culturing for 48 h, total RNA was extracted from the cells. Real-time quantitative PCR was used to detect the relative expression levels of RdRp mRNA in different experimental groups. The experimental results are as follows: Figure 2 As shown, the antisense oligonucleotides RDRP-1 and RDRP-5 have different degrees of significant inhibition on RdRp expression, with RDRP-5 showing the best inhibitory effect.

[0093] Example 3: Determination of secNanoLuci activity

[0094] 3.1 Construction of SARS-CoV-2 virus replicons

[0095] (1) Design of replicon genome structure

[0096] The preserved sequences were determined as follows: the 5′ UTR, ORF1a, ORF1b, N protein genes and 3′ UTR of the SARS-CoV-2 genome were preserved.

[0097] The replacement strategy was determined as follows: the complete open reading frames of the S and E protein genes were deleted, and the secNluciferase-P2A-GFP expression cassette (P2A being the self-cleaving peptide) was inserted at the corresponding positions.

[0098] (2) Obtaining genome fragments

[0099] Chemical synthesis: segmented synthesis, including:

[0100] The 5′ end UTR to the ORF1a / b section (approximately 15-20 kb, which can be synthesized in multiple segments);

[0101] secNluciferase-P2A-GFP expression cassette (approximately 2 kb);

[0102] N protein gene and 3′ UTR (approximately 1.5 kb).

[0103] (3) Overlap extension PCR: The fragments are spliced ​​together into a complete replicon cDNA sequence (total length approximately 22-25 kb) by overlap extension PCR.

[0104] (4) Cloning into the BAC vector

[0105] BAC vector preparation: Select pBeloBAC11 or a similar low-copy BAC vector and linearize it with an appropriate restriction endonuclease (such as EcoRI / BamHI).

[0106] (5) Homologous recombination

[0107] The spliced ​​replicon cDNA and linearized BAC vector were co-electroporated into recombinant engineered bacteria such as SW102, and cloned using the Red / ET recombination system.

[0108] (6) Screening positive clones: LB plates containing chloramphenicol (BAC vector resistance) are used for screening, and single colonies are picked.

[0109] (7) Verify viral replicons

[0110] PCR identification: Primers were designed targeting the reporter gene (secNluciferase, GFP) and the deletion region (S / E deletion) to confirm correct integration.

[0111] Sequencing validation: Sanger sequencing was performed on key regions (UTR, ORF1a / b junction, reporter gene insertion site).

[0112] 3.2 Transfection and Detection

[0113] (1) Cell treatment and transfection: Huh7 cells were seeded in 96-well plates and antisense oligonucleotides (ASO) were transfected into the cells using liposome transfection reagent (e.g., Lipo3000). 24 hours after transfection, SARS-CoV-2 replicon plasmid DNA was added to each well. A negative control group (SCR) was also set up.

[0114] (2) Sample collection and equilibration: Incubate the cells at 37°C and 5% CO2 for 48 hours. Before detecting cell viability, remove the cell culture plate from the incubator and transfer the supernatant to a new EP tube. Equilibrate the collected supernatant and Nano-Glo® luciferase assay reagent to room temperature (approximately 5-10 minutes).

[0115] (3) Sample addition and detection: Add 50 μL of cell culture supernatant to a white 96-well plate, then add an equal volume (50 μL) of Nano-Glo® luciferase detection reagent (a mixture of substrate and buffer), and mix gently.

[0116] (4) Incubation and reading: Incubate at room temperature for 3 minutes (to stabilize the signal), then read the luminescence intensity value using a chemiluminescence detector (ELISA reader). Note: The signal half-life is approximately 120 minutes; stable results can be obtained within 30 minutes. The luminescence intensity is directly proportional to the secNluc activity, i.e., positively correlated with the viral replication level.

[0117] 3.3 Experimental Results

[0118] To verify the inhibitory effect of ASO on viral replication, we constructed a SARS-CoV-2 replication subsystem (S / E protein secNluciferase reporter gene substitution). The inhibitory effect of ASO on viral transcription was assessed by detecting secNluciferase activity. Experimental results are shown below. Figure 4 As shown, huh7 cells were transfected with the antisense nucleic acid RDRP-5. The qPCR results showed that RDRP-1 and RDRP-5 could effectively inhibit the expression of RDRP mRNA.

[0119] Example 4: Detection of the anti-SARS-CoV-2 efficacy of ASO nucleic acid drugs

[0120] 4.1 Cell Culture

[0121] Revive and culture Vero-E6 cells to the logarithmic growth phase. Seed cells into 24-well plates (density optimized according to experimental needs), adding 1 × 10⁶ cells per well. 5 Individual cells were cultured at 37°C and 5% CO2 for 24 hours to achieve a cell confluence of 80-90%.

[0122] ASO drug: Dilute the RDRP-targeting ASO to the working concentration (0.5 μM) with sterile nuclease-free water.

[0123] Virus strains: Wuhan original strain (SARS-CoV-2 Wuhan-Hu-1), Delta virus strain, Omicron BA.1 (aliped and stored at -80℃), thawed on ice before use.

[0124] 4.2 ASO transfection

[0125] Prepare the complex according to the transfection reagent instructions: Add 0.5 μM ASO and transfection reagent to each well and incubate for 20 minutes. Aspirate the cell culture medium, add serum-free medium containing the ASO-transfection complex, and incubate at 37°C for 4-6 hours.

[0126] 4.3 Virus inoculation

[0127] Aspirate the transfection solution and gently wash the cells twice with PBS. Dilute the virus solution to an MOI of 0.01, adding 200 μL of the virus dilution to each well, and incubate at 37°C for 1 hour. Aspirate the virus solution and add maintenance medium containing 2% FBS.

[0128] 4.4 qPCR detection of viral load

[0129] Twelve hours after infection, 100 μL of cell supernatant was collected, and viral RNA was extracted to detect viral load. The specific steps are as follows:

[0130] (1) Prepare 560 μL of lysis buffer containing carrier RNA per sample, and use immediately after preparation;

[0131] (2) Take 100 μL of cell supernatant after infection, add it to the lysis buffer, vortex to mix, and then let it stand at room temperature for 10 minutes; then add 560 μL of anhydrous ethanol and mix again.

[0132] (3) The lysate was centrifuged twice (8000 rpm, 1 min) to remove the added anhydrous ethanol, and the filtrate was discarded.

[0133] (4) Take 500 μL of the prepared GD buffer, filter it once through a filter column, centrifuge at 8000 rpm for 1 minute, and discard the filtrate.

[0134] (5) Take 500 μL of the prepared PW buffer, filter it twice through a filter column, centrifuge at 8000 rpm for 1 minute, and discard the filtrate.

[0135] (6) Centrifuge the filter column at 12,000 rpm for 3 minutes. Then, add 50 μL of RNase-free deionized water to the center of the filter column. Centrifuge again at 12,000 rpm for 2 minutes. The filtrate collected in this way is the extract of the target viral RNA.

[0136] Absolute quantification of the SARS-CoV-2 N gene in the extracted viral RNA was performed using the Novizan qRT-PCR kit. The reaction system was prepared according to the kit instructions, and the viral RNA copy number (copies / mL) was calculated using a standard curve. After rapid centrifugation, the prepared reaction system was analyzed using a BioRad CFX96 real-time quantitative PCR instrument. 20 μL of reaction solution containing SYBR Green Mix, cDNA, and specific primers was prepared on ice, with three replicates. The reaction was pre-denatured at 95℃ for 30 s, followed by 40 cycles of 95℃ for 15 s, 55℃ for 30 s, and 72℃ for 30 s, and melting curves were collected. GAPDH or β-actin was used as an internal control, and a 2... ^-ΔΔCt The relative expression level of the target mRNA was calculated using this method.

[0137] 4.5 Virus titer detection (TCID) 50 )

[0138] Cell culture supernatant was collected 48 hours after ASO treatment or control treatment and infected with SARS-CoV-2 virus; this was the viral supernatant to be tested. The viral supernatant was then serially diluted 10-fold (10⁻¹ to 10⁻¹) with maintenance medium. 8 Each dilution was seeded into 96-well plates pre-coated with Vero-E6 cells, with 8 replicates per dilution and 100 μL seeded per well. Control wells without virus were also included. Cells were incubated at 37°C with 5% CO2 for 5 days, and cytopathic effect (CPE) was observed daily. TCID was calculated for each group using the Reed-Muench method. 50 / mL, to assess viral titer.

[0139] 4.6 Experimental Results

[0140] To verify whether targeting the highly conserved RdRp catalytic core region effectively circumvents immune escape and drug resistance issues caused by spike protein mutations, and to provide strategic support for addressing potential new variants in the future, we subsequently selected three viruses—wild-type, delta, and omeprón—for validation. Viral load and viral titer in cell supernatants were measured 72 hours post-infection with each of the three viral strains. Experimental results are as follows: Figures 5-7 As shown in the figure, experimental data indicate that RDRP-5 can significantly reduce viral load and viral titer.

[0141] To further examine the effect of ASO on SARS-CoV-2 XBB.1.1.6 replication, SCR and RDRP-5 were transfected at a final concentration of 0.5 μM. Thirty-six hours after transfection, cells were infected with SARS-CoV-2 XBB.1.1.6 at a MOI of 0.01. Viral load in the cell supernatant was measured at 24 h, 36 h, 72 h, and 96 h post-infection. The experimental results are as follows: Figure 8 As shown, the data indicate that RDRP-5 significantly reduced viral load at 4h, 36h, 72h, and 96h after viral invasion. The inhibitory effect was strongest at 72h, followed by 48h, 24h, and 96h. RDRP-5 significantly reduced the viral titer of SARS-CoV-2 XBB.1.1.6 at 24h, 48h, and 72h after viral invasion, with the most significant inhibitory effect at 72h.

[0142] These results demonstrate that the ASO drug RDRP-5, targeting the highly conserved RdRp catalytic core region, exhibits significant viral inhibition in both Delta and Omeprone variant infection models. This demonstrates that antiviral strategies designed targeting the core elements of viral replication can effectively circumvent immune escape and drug resistance issues caused by spike protein mutations, providing experimental evidence for addressing potential new variants in the future.

[0143] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An antisense oligonucleotide that targets and inhibits the RdRp gene, characterized in that... It is at least one of the following: RDRP-1, its nucleotide sequence is as follows: G*T*A*A*G*G*T*C*A*G*T*C*T*C*A*G*T*C*C*A*; RDRP-2, its nucleotide sequence is as follows: T*T*C*G*T*C*C*T*T*T*T*C*T*T*G*G*A*A*G*C*; RDRP-3, its nucleotide sequence is as follows: G*G*T*T*C*C*C*A*A*T*A*C*C*T*T*G*A*A*G*T*; RDRP-4, its nucleotide sequence is as follows: T*G*G*C*C*G*T*G*A*C*A*G*C*T*T*G*A*C*A*A*; RDRP-5, its nucleotide sequence is as follows: G*G*T*G*G*T*A*T*G*T*C*T*G*A*T*C*C*C*A*A*; In the above nucleotide sequences, nucleotides with an asterisk (*) represent nucleotides modified by thiophosphorylation. Or RDRP-1, RDRP-2, RDRP-3, RDRP-4, RDRP-5 analogs that still have the function of inhibiting RdRp gene expression, obtained through base insertion, deletion, or substitution.

2. The antisense oligonucleotide targeting and inhibiting the RdRp gene according to claim 1, characterized in that: The antisense oligonucleotides that target and inhibit the RdRp gene, after being transfected into cells using a transfection reagent, can suppress the expression level of the RdRp gene.

3. A reagent for targeting and inhibiting the expression of the RdRp gene, characterized in that: Includes the antisense oligonucleotides that target and inhibit the RdRp gene as described in any one of claims 1 to 2.

4. The reagent for targeting and inhibiting RdRp gene expression according to claim 3, characterized in that: It also includes transfection reagents for transferring antisense oligonucleotides into cells.

5. The use of the antisense oligonucleotide targeting and inhibiting the RdRp gene as described in any one of claims 1 to 2 and / or the reagent targeting and inhibiting the expression of the RdRp gene as described in any one of claims 3 to 4 in the preparation of anti-COVID-19 drugs.

6. The application according to claim 5, characterized in that: The novel coronavirus mentioned includes at least one of SARS-CoV-2 Wuhan-Hu-1, SARS-CoV-2 Delta, SARS-CoV-2Omicron BA.1, and SARS-CoV-2 XBB.1.1.6.

Images