Pigeon circovirus antigen, preparation method and application thereof
By preparing recombinant ΔCap protein as an agar diffusion antigen, the problem of detecting pigeon circovirus antibodies was solved, and a detection method suitable for agar diffusion assay was established, realizing efficient and accurate detection of pigeon circovirus antibodies, which is suitable for large-scale clinical testing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI VETERINARY RES INST
- Filing Date
- 2026-04-03
- Publication Date
- 2026-07-07
AI Technical Summary
Currently, there is a lack of effective methods for detecting pigeon circovirus antibodies, and the agar diffusion test method has not yet been applied to the detection of pigeon circovirus antibodies, resulting in insufficient control measures for pigeon circovirus.
By truncating the Cap protein of pigeon circovirus, a recombinant ΔCap protein was prepared as an agar diffusion antigen. A method for detecting pigeon circovirus antibodies using agar diffusion assay was established. The recombinant protein was induced to express and purified using IPTG and then applied to the agar diffusion assay.
It achieves efficient and accurate detection of pigeon circovirus antibodies, with the advantages of simple operation and low cost, and is suitable for large-scale clinical testing, thus overcoming the predicament of pigeon circovirus being unable to be isolated.
Smart Images

Figure CN122344237A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, specifically to a pigeon circovirus agar amplified antigen, its preparation method, and its application. Background Technology
[0002] Pigeon circovirus (PiCV) is a member of the genus Circovirus in the family Circoviridae. Other members of this genus include porcine circovirus, parrot beak feather virus, duck circovirus, and goose circovirus. Like other members of the circovirus genus, pigeon circovirus is an immunosuppressive pathogen. Infection causes severe damage to the host's immune organs (such as the bursa of Fabricius, spleen, and thymus) and induces lymphocyte apoptosis, leading to a decline in the body's immunity. This exacerbates secondary infections by other viruses, bacteria, fungi, and parasites, and in severe cases, can even lead to death and increase the overall mortality rate of the flock. Furthermore, pigeon circovirus, along with pigeon herpesvirus, pigeon adenovirus, and other pathogens, can co-infect young pigeons, causing young pigeon disease syndrome and resulting in high mortality rates among young pigeons. In 1993, pigeon circovirus was first reported in the United States and subsequently spread widely among pigeon flocks in many countries and regions around the world. In 2007, my country reported cases of pigeon circovirus infection, and the virus was subsequently detected in pigeon flocks in many provinces and cities across the country. Pigeon circovirus has now become one of the important pathogens affecting the global pigeon industry.
[0003] Pigeon circovirus (PCV) is a non-enveloped, icosahedral, single-stranded circular DNA spherical virus particle with a genome size of only about 2.0 kb. It contains two major open reading frames (ORFs), with ORF C1 encoding the capsid protein (Cap). As the main antigen of PCV, the Cap protein possesses strong immunogenicity and is a core target for serological diagnostics and subunit vaccine development. In recent years, researchers have attempted to develop serological diagnostic methods and subunit vaccines for the control of this disease. However, due to the inability to isolate PCV and the lack of key materials such as SPF pigeons and pigeon-derived positive sera (e.g., PCV, pigeon herpesvirus, pigeon adenovirus), there are currently no effective control measures for this disease. Currently, detection of this disease is mainly based on PCR, and there is no method for detecting PCV antibodies. Therefore, there is an urgent clinical need for an efficient, accurate, and rapid method for detecting PCV antibodies in pigeons, which is of great significance for the development and diagnosis of PCV vaccines. Agar diffusion assays are used to determine antibody titers and identify antigens, offering advantages such as low cost, simple operation, and suitability for large-scale clinical testing. They are widely used for detecting infections and antibodies against fowlpox virus, infectious bursal disease virus, Marek's disease virus, and equine infectious anemia virus. However, agar diffusion assays for pigeon circovirus antibodies have not yet been reported. Therefore, by using the prokaryotically expressed ΔCap protein as the agar diffusion antigen, the limitation of not being able to obtain pigeon circovirus as an antigen due to the inability to isolate the virus was overcome, thus establishing a clinically applicable agar diffusion assay method for detecting pigeon circovirus antibodies. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a pigeon circovirus agar diffusion antigen, its preparation method, and its application. By truncating the pigeon circovirus Cap protein, a recombinant ΔCap protein is obtained and used as an agar diffusion antigen to establish a method for detecting pigeon circovirus antibodies using an agar diffusion assay.
[0005] To achieve the above objectives, the technical solution provided by the present invention is as follows:
[0006] A recombinant protein, the amino acid sequence of which is shown in SEQ ID NO: 2.
[0007] Preferably, the recombinant protein is pigeon circovirus agaric antigen.
[0008] The method for preparing pigeon circovirus agar agar antigen as described above includes the following steps:
[0009] (1) Based on the nucleotide sequence shown in SEQ ID NO:3 or the amino acid sequence shown in SEQ ID NO:4, in order to delete the basic amino acid sequence from position 2 to 44, a pair of amplification primers were designed and PCR amplification was performed using recombinant plasmid pMD-GX1 as a template. The product after amplification is the truncated nucleotide sequence, as shown in SEQ ID NO:1.
[0010] (2) Insert the truncated nucleotide sequence from step (1) into the expression vector using homologous recombination to construct a recombinant expression plasmid;
[0011] (3) Transform the recombinant expression plasmid obtained in step (2) into Escherichia coli to construct the expression strain and induce expression using IPTG;
[0012] (4) The bacterial culture obtained after induction expression in step (3) is broken up and purified to obtain recombinant protein, which is pigeon circovirus agar agar antigen.
[0013] Preferably, the recombinant plasmid pMD-GX1 in step (1) is obtained by extracting viral nucleic acid from the supernatant of homogenate of infected pigeon liver, spleen, kidney and other tissues using the BeyoMag™ magnetic bead viral RNA / DNA extraction kit, and using primers F: 5'-TATGACGCCAGGCTGAAAACCTTTC-3' and R: 5'-AATCGGGACTGTGTGCCCGAATCC-3' to amplify the whole genome of pigeon circovirus using the extracted viral nucleic acid as a template. After purification and recovery of the amplification product, it is ligated into the pMD18-T vector to obtain the recombinant plasmid pMD-GX1. The amplification primers in step (1) are ΔCap-F and ΔCap-R. The sequence of ΔCap-F is shown in SEQ ID NO: 5, and the sequence of ΔCap-R is shown in SEQ ID NO: 6.
[0014] Preferably, in step (1), the truncated nucleotide sequence is obtained by deleting the nucleotide sequence corresponding to the basic amino acid-rich sequence (RRRRFRRRRAPIRRRRIRRRRTRLRRRGHRGAGRIYYFRLRRK) at positions 2 to 44 of the N-terminus of the pigeon circovirus Cap protein.
[0015] Preferably, the insertion of the expression vector in step (2) is inserted into the EcoRI position of the pET-32a vector; the induction of expression in step (3) is induced at a final IPTG concentration of 0.1~1.0 mmol / L and a temperature of 16~25 ℃ for 8~12 h.
[0016] The application of pigeon circovirus agar diffusion antigen as described above in the preparation of products for agar diffusion testing.
[0017] The application of pigeon circovirus agar diffusion antigen in the detection method of agar diffusion test, as described above.
[0018] Preferably, the agar diffusion test is used to detect antibodies produced by pigeons naturally infected with pigeon circovirus, antibodies produced by pigeons immunized with an inactivated pigeon circovirus vaccine, or antibodies produced by pigeons immunized with a genetically engineered vaccine prepared using pigeon circovirus Cap protein.
[0019] Preferably, the detection method comprises the following steps:
[0020] Prepare a 1% agarose gel using PBS buffer (0.01 mol / L, pH 7.2). After solidification, punch holes, remove the agarose from the wells, and seal the bottom of the plate by placing it over a flame. Add the pigeon circovirus agarose antigen to the central well, and then add the test sample, positive serum, and negative serum to the surrounding wells in sequence. Incubate at 37 °C for 24 h. Samples with a precipitation line are considered antibody-positive, and samples without a precipitation line are considered negative.
[0021] Preferably, the positive serum is an anti-ΔCap protein polyclonal antibody; the negative serum is serum isolated from unimmunized SPF mice.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] 1) This invention overcomes the problem that pigeon circovirus Cap protein cannot be expressed or is expressed at extremely low levels in Escherichia coli by deleting the basic amino acid sequence at positions 2-44 of the N-terminus of the Cap protein and inserting the truncated Cap protein sequence into the pET-32a expression vector. Moreover, the expressed protein contains soluble protein and has good immunogenicity, which can be applied to research on genetic engineering vaccines and serological detection methods.
[0024] 2) The method for preparing the agar-agar antigen of the present invention has the characteristics of stable production process, safety and reliability, high yield and easy large-scale production, which gets rid of the dilemma that the antigen cannot be obtained because the pigeon circovirus cannot be isolated.
[0025] 3) This invention establishes a method for detecting pigeon circovirus antibodies using ΔCap protein as the agar diffusion antigen. This detection method has the advantage of good specificity. Attached Figure Description
[0026] Figure 1 The image shows the gel electrophoresis results of the PCR amplification products of the △Cap gene; where 1 represents the △Cap gene and M is the molecular weight marker.
[0027] Figure 2The results are gel electrophoresis of PCR amplification products of colony samples transformed with the ΔCap gene; where 1-3 are PCR amplification products of colony samples transformed with the ΔCap gene, and M is the molecular weight marker.
[0028] Figure 3 The results of SDS-PAGE vertical electrophoresis of the △Cap recombinant protein are shown. Among them, 1 is the control bacteria with induced pET-32a(+) empty vector, 2 is the uninduced recombinant expression bacteria, 3 is the induced recombinant expression bacteria, 4 is the precipitate after the induced recombinant expression bacteria are broken, 5 is the supernatant after the induced recombinant expression bacteria are broken, and M is the molecular weight label.
[0029] Figure 4 The results of Western blot identification of △Cap recombinant protein are shown; where 1 represents induced recombinant expression bacteria, 2 represents uninduced recombinant expression bacteria, and M is a molecular weight marker.
[0030] Figure 5 The results of agar ...
[0031] Figure 6 Agar amplification results for determining different titers of ΔCap protein with polyclonal antibodies.
[0032] Figure 7 The results of the agar diffusion assay for the specific detection of pigeon circovirus antibodies were obtained. Among them, the ΔCap protein polyclonal antibody was positive, while the serum positive for Newcastle disease, avian influenza, pigeon pox, negative serum, and PBS were all negative.
[0033] Figure 8 The established method for detecting pigeon circovirus antibodies using an agar diffusion assay was used to test clinical pigeon serum samples; among them, 5 serum samples were antibody positive. Detailed Implementation
[0034] The following is a detailed description of specific embodiments in conjunction with the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise specified, the raw materials and reagents used in the examples are commercially available. The pMD18-T carrier is a product of Baori Biotechnology (Beijing) Co., Ltd.
[0035] Example 1
[0036] 1. Primer design
[0037] Referring to the multiple cloning site sequence of the pET-32a vector and the Cap gene sequence of the pigeon circovirus GX1 strain (GeneBank accession number: OR941416) (nucleotide sequence as shown in SEQ ID NO: 3, amino acid sequence as shown in SEQ ID NO: 4), a pair of specific homologous recombination primers were designed to delete the basic amino acid-rich sequence from positions 2 to 44:
[0038] △Cap-F:GCTGATATCGGATCCGAATTCATGGACAAGATCACATTGCCGAAAGC,
[0039] △Cap-R: TTGTCGACGGAGCTCGAATTCTTCACTTAACACGGCTGAGTCTGC, the amplification product is shown in SEQ ID NO: 1.
[0040] 2. △Cap target gene amplification
[0041] Viral nucleic acid was extracted from the supernatant of homogenates from infected pigeon liver, spleen, and kidney tissues using the BeyoMag™ magnetic bead extraction kit. Primers F: 5'-TATGACGCCAGGCTGAAAACCTTTC-3' (SEQ ID NO: 7) and R: 5'-AATCGGGACTGTGTGCCCGAATCC-3' (SEQ ID NO: 8) were used to amplify the entire genome of pigeon circovirus. The amplified product was purified and ligated into the pMD18-T vector. Sequencing yielded the complete genome sequence of GX1, which was uploaded to the GeneBank database (accession number: OR941416), thus obtaining the recombinant plasmid pMD-GX1. Using the constructed recombinant plasmid pMD-GX1 as a template, PCR amplification was performed using primers ΔCap-F and ΔCap-R with Phanta® Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The amplified product was detected by 1% agarose gel electrophoresis; the target gene size was as shown in the image. Figure 1 As shown, the target band appears at approximately 654 bp and is recovered using a gel recovery kit.
[0042] Amplification system: 2×PhantaMax Buffer 25 µL, dNTP Mix 1 µL, ΔCap-F primer 2 µL, ΔCap-R primer 2 µL, pMD-GX1 plasmid 2 µL, PhantaMax Super-Fidelity DNA Polymerase 1 µL, add ddH2O to make up to 50 µL.
[0043] Reaction conditions: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 sec, 65 °C annealing for 15 sec, 72 °C extension for 1 min; 35 cycles of amplification; 72 °C extension for 5 min.
[0044] 3. Enzyme digestion and recovery of pET-32a vector: The extracted pET-32a plasmid was digested with EcoR I restriction endonuclease. The digestion products were detected by 1% agarose gel electrophoresis and recovered using a gel recovery kit.
[0045] Enzyme digestion system: 10 µL pET-32a plasmid, 5 µL reaction buffer, 2 µL EcoRI enzyme, and ultrapure water to make up to 50 µL.
[0046] Reaction conditions: Enzyme digestion overnight at 37 ℃.
[0047] 4. Ligation: The recovered ΔCap gene fragment and pET-32a vector fragment were ligated using the ClonExpress MultiS One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.).
[0048] Ligation system: 3 µL of PCR product, 1 µL of pET-32a plasmid fragment, 2 µL of 5×CE II buffer, 1 µL of Exnase II, and ddH2O to bring the total to 10 µL.
[0049] Reaction conditions: 37 ℃ for 30 min.
[0050] 5. Transformation: Add the ligation product to 100 µL of *E. coli* DH5α competent cells, gently mix, incubate on ice for 30 min, heat shock at 42 ℃ for 90 s, then immediately place on ice for 5 min. Add 500 µL of LB liquid medium and incubate at 37 ℃ for 1 h. Concentrate the culture to 100 µL and spread it on LB solid medium containing ampicillin resistance, incubate at 37 ℃ for approximately 18 h.
[0051] 6. Colony PCR Identification and Sequencing: Single colonies from the plates were inoculated into LB liquid medium and incubated at 37 °C for 2 h. Using the resulting bacterial culture as a template, colony PCR identification was performed using ΔCap-F and ΔCap-R primers. The amplified products were detected by 1% agarose gel electrophoresis. The size of the target gene was as shown in the figure. Figure 2 As shown, samples with a band around 684 bp were positive strains. Plasmids extracted from the positive strains were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with those shown in SEQ ID NO: 1. The recombinant plasmid with the correct sequencing results was named pET-32a-△Cap.
[0052] 7. Transformation of expression strains: The recombinant plasmid pET-32a-△Cap and the empty vector pET-32a(+) were transformed into Escherichia coli BL21(DE3) competent cells. Positive strains were identified by PCR. The strains containing the pET-32a-△Cap plasmid were the constructed recombinant expression strains, and the strains containing the empty vector pET-32a(+) were the empty vector control strains.
[0053] 8. Induction of recombinant expression: The recombinant expression strain was inoculated into 10 mL LB liquid medium and cultured at 37 ℃ until the logarithmic growth phase. Then, it was transferred to 1 L LB liquid medium at a 1:100 inoculation ratio and cultured at 37 ℃ until the OD phase. 600 The value was 0.6–0.8. IPTG was added to a final concentration of 0.1–1.0 mmol / L and induced at 16–25 °C for 8–12 h. 1 mL of recombinant expression bacteria was collected before and after induction. The empty vector control bacteria were also induced under the same conditions and then the bacterial cells were collected.
[0054] 9. Recombinant Protein SDS-PAGE Detection: Collect the induced recombinant expression bacterial cells, resuspend them in an appropriate amount of PBS buffer, and sonicate them using a pressure lysing device. Centrifuge to collect the precipitate and supernatant. Add appropriate amounts of protein loading buffer to the induced empty vector control bacteria, uninduced recombinant expression bacteria, induced recombinant expression bacteria, and induced recombinant expression bacteria precipitates and supernatants, respectively. Boil for 10 min and perform vertical SDS-PAGE (polyacrylamide gel electrophoresis). After electrophoresis, immerse the gel in Coomassie Brilliant Blue staining solution for staining. After staining, pour out the staining solution, then add Coomassie Brilliant Blue destaining solution to fully cover the gel for destaining. Observe whether the protein is expressed after destaining. Figure 3As shown, the induced recombinant expression bacteria, the lysed precipitate of the induced recombinant expression bacteria, and the supernatant of the lysed precipitate contained a protein band with a molecular weight of approximately 43 kDa, which is consistent with the expected protein size. The induced empty vector control bacteria and the uninduced recombinant expression bacteria only showed a light E. coli protein band at the corresponding positions. The supernatant of the induced recombinant expression bacteria contained some soluble protein, indicating that the soluble ΔCap protein was successfully obtained.
[0055] 10. Recombinant Protein Western Blot Identification: Select the fragmented supernatant sample for Western blot identification. Transfer the SDS-PAGE electrophoresis product onto an NC (nitrocellulose) membrane, block with 5% skim milk powder for 2 h, add His Tag Mouse Monoclonal Antibody (Shanghai Beyotime Biotechnology Co., Ltd.) and incubate overnight. After rinsing, add horseradish peroxidase-labeled goat anti-mouse IgG (H+L) (Shanghai Beyotime Biotechnology Co., Ltd.) and incubate for 1 h. After rinsing, add enhanced chemiluminescent fluorescent substrate for color development and observe for the presence of the target band. For example... Figure 4 As shown, the △Cap protein was visualized at a position of approximately 43 kDa, proving that the △Cap recombinant protein was successfully expressed. The amino acid sequence of the △Cap recombinant protein is shown in SEQ ID NO: 2.
[0056] 11. Protein purification: The lysed supernatant from step 9 of this embodiment was purified using a His-tagged protein purification kit (Shanghai Beyotime Biotechnology Co., Ltd.) to obtain the recombinant protein, namely pigeon circovirus agar agar antigen (ΔCap protein). The protein was then sterilely filtered through a 0.22 μm filter membrane and stored at 4 °C.
[0057] Example 2
[0058] Establishment of an agar diffusion assay for detecting porcine circovirus antibodies
[0059] 1. Preparation of experimental serum: The ΔCap protein obtained in step 11 of Example 1 was mixed with Freund's adjuvant (purchased from BioFroxx) at a 1:1 ratio, emulsified, and then used to immunize SPF mice at a dose of 30 μg / mouse. For the first immunization, Freund's complete adjuvant was used for mixing and emulsification; for the second and third immunizations, Freund's incomplete adjuvant was used. The interval between each immunization was 2 weeks. Serum was separated 2 weeks after the last immunization to prepare anti-ΔCap protein polyclonal antibodies. Serum isolated from unimmunized SPF mice was used as negative serum. Newcastle disease positive serum, avian influenza positive serum, and pigeon pox positive serum were all obtained from pigeons immunized with the corresponding vaccines.
[0060] 2. The specific steps of this embodiment are as follows: Prepare 1% agarose gel with PBS buffer (0.01 mol / L, pH 7.2), melt it, pour it into a plate, and after solidification, punch holes. Remove excess agarose from the holes and seal the bottom of the plate by placing it above a flame. Add the agarose antigen to the central well, and add the test sample, positive serum, and negative serum to the surrounding wells in sequence. Incubate in a humidified chamber at 37°C for 24 hours and observe the precipitation line. When a precipitation line forms between the test sample and the antigen well, it is judged as antibody positive; when no precipitation line appears, it is judged as antibody negative.
[0061] 3. Determination of working concentration of positive serum: The polyclonal antibody against ΔCap protein was diluted at ratios of 1:2 to 1:64 (1:2, 1:4, 1:8, 1:16, 1:32, 1:64 in that order). ΔCap protein was added to the middle well, and the diluted antibody was added to the surrounding wells in sequence. The results are as follows: Figure 5 As shown, precipitation lines appear at concentrations of 1:2 to 1:16, while no precipitation lines appear at 1:32 and 1:64. Among these, the positive serum agar amplification titer is 1:16, and the precipitation line is clearest at a concentration of 1:4. To conserve serum, the working concentration of the positive serum was determined to be 1:4.
[0062] 4. Determination of working antigen concentration: ΔCap protein was diluted at ratios of 1:2 to 1:64 (1:2, 1:4, 1:8, 1:16, 1:32, 1:64, respectively). The polyclonal antibody against ΔCap protein was added to the middle well, and the diluted ΔCap protein was added to the surrounding wells sequentially. The results are as follows: Figure 6 As shown in the figure, precipitation lines appear at ratios of 1:2 to 1:8, while no precipitation lines appear at ratios of 1:16 to 1:64. Among these, the precipitation line is clearest at a concentration of 1:4 for the ΔCap protein agar amplification titer of 1:8. To conserve antigen, the working concentration of ΔCap protein was determined to be 1:4.
[0063] 5. Specificity Detection: ΔCap protein was added to the middle well, and polyclonal antibody against ΔCap protein, Newcastle disease positive serum, avian influenza positive serum, pigeon pox positive serum, negative serum, and PBS were added sequentially to the surrounding wells. Results are as follows: Figure 7 As shown, the polyclonal antibody against △Cap protein showed a precipitation line, while the other sera did not, indicating that the established agar diffusion assay method does not cross-react with the above sera and has good specificity.
[0064] 6. Clinical serum sample testing: Using the established pigeon circovirus antibody agar diffusion assay, 50 serum samples from the same breed of pigeons from the same pigeon farm were tested. Five samples tested positive, with a positive rate of 10%. The results are as follows: Figure 8 As shown, five serum samples containing pigeon circovirus antibodies showed precipitation lines, while the remaining serum samples did not.
[0065] The present invention provides a method for preparing pigeon circovirus agar agar antigen and its application, which provides a new diagnostic tool for serological monitoring of pigeon circovirus, development of genetically engineered vaccines, evaluation of vaccine immunization efficacy, and epidemiological surveys.
[0066] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. A recombinant protein, characterized in that: The amino acid sequence of the recombinant protein is shown in SEQ ID NO:
2.
2. The recombinant protein according to claim 1, characterized in that: The recombinant protein is pigeon circovirus agaric antigen.
3. The method for preparing pigeon circovirus agar agar antigen as described in claim 2, characterized in that, Includes the following steps: (1) Design a pair of amplification primers based on the nucleotide sequence shown in SEQ ID NO:3 or the amino acid sequence shown in SEQ ID NO:4, and perform PCR amplification using recombinant plasmid pMD-GX1 as a template. The amplified product is the truncated nucleotide sequence, as shown in SEQ ID NO:
1. (2) Insert the truncated nucleotide sequence from step (1) into the expression vector using homologous recombination to construct a recombinant expression plasmid; (3) Transform the recombinant expression plasmid obtained in step (2) into Escherichia coli to construct the expression strain and induce expression using IPTG; (4) The bacterial culture obtained after induction expression in step (3) is broken up and purified to obtain recombinant protein, which is pigeon circovirus agar agar antigen.
4. The method for preparing pigeon circovirus agar agar antigen according to claim 3, characterized in that: The recombinant plasmid pMD-GX1 mentioned in step (1) was obtained by extracting viral nucleic acid from the supernatant of homogenates of infected pigeon liver, spleen, kidney and other tissues using the BeyoMag™ magnetic bead viral RNA / DNA extraction kit, and using the extracted viral nucleic acid as a template to amplify the whole genome of pigeon circovirus using primers for amplifying the whole genome of pigeon circovirus. After purification and recovery of the amplification product, it was ligated into the pMD18-T vector to obtain the recombinant plasmid pMD-GX1. The primer sequences for amplifying the whole genome of pigeon circovirus are shown in SEQ ID NO: 7 and SEQ ID NO:
8. The amplification primers mentioned in step (1) are ΔCap-F and ΔCap-R. The ΔCap-F sequence is shown in SEQ ID NO: 5 and the ΔCap-R sequence is shown in SEQ ID NO:
6.
5. The method for preparing pigeon circovirus agar agar antigen according to claim 3, characterized in that: In step (1), the truncated nucleotide sequence is obtained by deleting the nucleotide sequence corresponding to the basic amino acid-rich sequence at positions 2 to 44 of the N-terminus of the pigeon circovirus Cap protein.
6. The method for preparing pigeon circovirus agar agar antigen according to claim 3, characterized in that: The insertion of the expression vector in step (2) is inserted into the EcoRI position of the pET-32a vector; the induction of expression in step (3) is induced at a final IPTG concentration of 0.1~1.0 mmol / L and a temperature of 16~25 ℃ for 8~12 h.
7. The application of the recombinant protein as described in claims 1-2 or the pigeon circovirus agar diffusion antigen prepared by any method of claims 3-6 in the preparation of products for agar diffusion test.
8. The application of the recombinant protein as described in claims 1-2 or the pigeon circovirus agar diffusion antigen prepared by any of the methods in claims 3-6 in the agar diffusion test detection method.
9. The application according to claims 7-8, characterized in that: The agar diffusion test is used to detect antibodies produced by pigeons naturally infected with pigeon circovirus, antibodies produced by pigeons immunized with an inactivated pigeon circovirus vaccine, or antibodies produced by pigeons immunized with a genetically engineered vaccine prepared using pigeon circovirus Cap protein.
10. The application according to claim 9, characterized in that: The detection method described herein comprises the following steps: Prepare a 1% agarose gel using PBS buffer (0.01 mol / L, pH 7.2). After solidification, punch holes, remove the agarose from the wells, and seal the bottom of the plate by placing it over a flame. Add the pigeon circovirus agarose antigen to the central well. Add the test sample, positive serum, and negative serum to the surrounding wells in sequence. Incubate at 37 °C for 24 h. Samples with a precipitation line are considered antibody-positive, and samples without a precipitation line are considered negative. The positive serum is an anti-ΔCap protein polyclonal antibody. The negative serum is serum isolated from unimmunized SPF mice.