A standard probe and its application in reducing signal space effect of gene chip detection

Abstract

The application discloses a standard probe and application thereof in reducing space effect of a gene chip detection signal, and belongs to the technical field of gene chip detection. In the application, the standard probe is reasonably arranged on the gene chip, polynomial modeling is carried out based on a signal value of the standard probe, a space trend surface is obtained by fitting the signal value, and the signal value of each detection probe is further corrected, so that the space effect is reduced.

Description

[0001] Related patents This application is a divisional application of Chinese Patent Application No. 2025120148476, filed on December 30, 2025, entitled "Standard probe, method, system and medium for reducing spatial effects of gene chip detection signals". Technical Field

[0002] This application relates to the field of gene chip detection technology, and in particular to a standard probe and its application in reducing the spatial effect of gene chip detection signals. Background Technology

[0003] Gene chip technology is a high-throughput, high-sensitivity nucleic acid detection technique. Its basic principle involves immobilizing a large number of specific nucleic acid probes on a tiny solid surface. These probes hybridize with target nucleic acid sequences in the sample to detect and analyze genetic information. Gene chip technology can simultaneously detect hundreds to thousands of genes in a single experiment, demonstrating enormous application potential in areas such as environmental microbiology detection. By designing specific probes, rapid and accurate detection of target genes can be achieved.

[0004] However, due to factors such as uneven probe spotting and inconsistent local microenvironments during hybridization, gene chip signals often exhibit spatial effects. Ideally, each probe spot within the microarray should have the same hybridization environment (uniform local temperature, local microenvironment of the hybridization working solution, etc.). If identical standard probes are placed at multiple points within the microarray, the standard probes should detect similar signal intensities after hybridization. However, in reality, while the signal values ​​detected by the standard probes at different locations are within a certain range, they always exhibit a certain spatial trend. This indicates that there is a spatial effect in the local microenvironment within the microarray during hybridization. Moreover, this spatial trend is not reproducible and varies for different microarrays (the direction and edges of the spatial trend), making it impossible to uniformly assess its impact.

[0005] Therefore, there is an urgent need in this field for a method to remove spatial trends in signals. Summary of the Invention

[0006] To solve at least one of the above-mentioned technical problems, the technical solution adopted in this application is as follows.

[0007] The first aspect of this application provides a method for designing a standard probe to reduce spatial effects on gene chip detection signals, comprising the following steps: Generate a candidate sequence set consisting of random bases; Sequences that meet the following conditions are selected from the candidate sequence set: (1) 0.35 < GC content < 0.65, ensuring that the GC content of all probes is generally consistent to guarantee the stability of hybridization. (2) 75°C < Tm value < 95°C, ensuring that the Tm values of all probes are generally consistent to guarantee the stability of hybridization. An appropriate Tm value helps to improve the success rate of hybridization. (3) Binding free energy > -30 kcal / mol. (4) The number of consecutive identical bases ≤ 5 to ensure that the complexity is not too low. (5) Does not contain palindromic sequences to avoid forming stable secondary structures, thus affecting the hybridization efficiency with the target sequence. (6) Does not bind to any non-target DNA sequences. In this application, the standard probe should have a sequence length consistent with or similar to that of other detection probes to ensure that they have similar thermodynamic properties. Usually, the probe sequence length is set at 50 mer.

[0008] The "spatial effect" of a gene chip, also known as spatial deviation or position effect, refers to the fact that for probe sites at different physical positions on the gene chip, even if they detect the same gene, the fluorescence signal intensity (signal value) will be systematically affected by the position coordinates of the site on the chip.

[0009] Distributing the standard probes designed by the above method on the gene chip, affected by the spatial effect, the signal values of the standard probes at different sites will be different, showing a certain spatial trend. Combining common data methods in the art or the innovative methods proposed later in this application, it is possible to correct (or calibrate) the signal values of each probe on the gene chip based on the signal values of all standard probes, thereby reducing or even eliminating the spatial effect.

[0010] The second aspect of this application provides a standard probe, which is designed by using the design method described in the first aspect of this application.

[0011] In some embodiments of this application, the nucleotide sequence of the standard probe is as shown in SEQ ID No. 1.

[0012] The third aspect of this application provides a gene chip, including the standard probe described in the second aspect of this application and also including detection probes.

[0013] In some embodiments of this application, the number of standard probes is set to 2% - 3% of the total number of probes on the gene chip.

[0014] In some embodiments of this application, standard probes are set at equal intervals to construct a two-dimensional dot matrix basis for three-dimensional spatial signal data. The detection probes are then set up after the standard probes are configured.

[0015] In some embodiments of this application, the gene chip further includes a control probe. If the site of the standard probe coincides with the site of the control probe, the standard probe is placed at a site adjacent to the control probe.

[0016] The fourth aspect of this application provides a method for reducing spatial effects in gene chip detection signals, comprising the following steps: Obtain fluorescently labeled standard DNA that is inversely complementary to the standard probe described in the second aspect of this application; The standard DNA and the fluorescently labeled DNA to be tested are hybridized with any of the gene chips described in the third aspect of this application, and the fluorescence image is scanned and digitized to obtain a microarray data file; Based on the microarray data file, a spatial dataset is constructed, containing two-dimensional coordinate information and signal values; Trend surface construction and signal value correction: The spatial dataset is modeled using a polynomial model, and the signal values ​​are fitted to obtain a trend surface. The correction coefficient of each probe site is calculated using the fitted value of each probe site on the trend surface, and the original signal values ​​are corrected.

[0017] In some embodiments of this application, after obtaining the sample to be tested, the total DNA in the sample is first extracted. There are various methods for DNA extraction, among which the phenol-chloroform method and magnetic bead-based DNA purification methods are commonly used. Those skilled in the art can choose different DNA extraction methods according to different experimental needs. The DNA sample is then tested; if the total amount and purity meet the requirements, subsequent experiments are performed. If the test results do not meet the requirements, nucleic acid re-extraction or magnetic bead purification of the existing nucleic acid is necessary. These processing steps can effectively improve the purity and quality of nucleic acids, thereby ensuring the accuracy of subsequent experiments.

[0018] In some embodiments of this application, the steps for trend surface construction and signal value correction are as follows: For each probe site on the gene chip, local weighted regression is performed using the following steps to obtain the signal trend surface of the entire gene chip: (1) Based on the coordinates of the target site, the k nearest standard probe sites are obtained using the k-nearest neighbor algorithm, thus obtaining the neighborhood point set; (2) For each point in the neighborhood point set, calculate its distance to the target point, and use the weight function to calculate the weight to obtain the weight matrix; (3) Use a polynomial feature converter to convert the coordinates of each point in the neighborhood point set into a polynomial feature matrix. Use the weight matrix to weight the polynomial feature matrix and the signal value vector. Use the least squares method to solve the weighted linear equation system to obtain the coefficients of the local polynomial model. Use the following steps to correct the signal value: (1) Calculate the mean of the fitted values ​​of all standard probes. For each probe site, calculate the correction coefficient: , in, It is the first i Fitted values ​​for each probe point; (2) Multiply the original signal value of each probe site by the corresponding correction coefficient to obtain the corrected signal value: Corrected signal value = original signal value × correction coefficient.

[0019] In some embodiments of this application, the weighting function is as follows: , Where u is the standardized distance, which represents the distance from the target site to a point in the neighborhood point set divided by the distance from the target site to its k-th nearest neighbor.

[0020] A fifth aspect of this application provides an electronic device, comprising: at least one processor; and a memory communicatively connected to said at least one processor; wherein... The memory stores instructions executable by the at least one processor, which, when executed by the at least one processor, enables the at least one processor to perform any of the methods described in the fourth aspect of this application.

[0021] A sixth aspect of this application provides a non-transitory computer-readable storage medium storing computer instructions for causing the computer to perform any of the methods described in the fourth aspect of this application.

[0022] Compared with the prior art, this application has the following advantages: This application screens standard probes by determining probe design criteria and evaluates the specificity of the standard probes, thereby reducing non-specific hybridization of the standard probes and making the signal data of the standard probes more reliable.

[0023] This application reduces spatial effects by rationally setting standard probes on a gene chip, performing polynomial modeling based on the signal values ​​of the detection probe and the standard probe, and fitting a spatial trend surface to the signal values. Further correction is then applied to the signal values ​​at each probe site. Using the method, system, and medium of this application, spatial effects in gene chip detection results can be effectively removed.

[0024] It should be understood that the description in this section is not intended to identify key or essential features of the embodiments of this application, nor is it intended to limit the scope of this application. Other features of this application will become readily apparent from the following description. Attached Figure Description

[0025] The above and other objects, features, and advantages of exemplary embodiments of this application will become readily apparent from the following detailed description taken in conjunction with the accompanying drawings. Several embodiments of this application are illustrated in the drawings by way of example and not limitation, in which: Figure 1 A partial schematic diagram of the probe layout of the gene chip in Embodiment 1 of this application is shown; Figure 2 This paper illustrates the application and data processing flow of the gene chip containing standard probes according to Embodiment 2 of this application. Figure 3 The distribution of standard probe signal values ​​before (left) and after (right) the reduction of spatial effects is shown in Embodiment 2 of this application; Figure 4 This illustrates the effect of the proportion of standard probes on the fitted trend surface in Embodiment 3 of this application; Figure 5 This illustrates the effect of the neighborhood point set size on the fitted trend surface in Embodiment 4 of this application; Figure 6 The effect of the polynomial order on the fitted trend surface is shown in Embodiment 5 of this application. Detailed Implementation

[0026] Unless otherwise stated, implied from the context, or as is customary in the art, all parts and percentages in this application are based on weight, and all testing and characterization methods used are concurrent with the filing date of this application. Where applicable, any patent, patent application, or disclosure relating to this application is incorporated herein by reference in its entirety, and its equivalent patent families are also incorporated herein by reference, particularly the definitions of relevant terms in the art disclosed in such documents. If any definition of a specific term disclosed in the prior art is inconsistent with any definition provided in this application, the definition provided in this application shall prevail.

[0027] To make the technical problems, technical solutions and beneficial effects solved by this application clearer, the following detailed description is provided in conjunction with embodiments.

[0028] The following examples are used to illustrate preferred embodiments of this application. Those skilled in the art will understand that the techniques disclosed in the examples represent technologies discovered by the inventors that can be used to implement this application, and therefore can be considered preferred embodiments of this application. However, those skilled in the art should understand from this specification that many modifications can be made to the specific embodiments disclosed herein, still yielding the same or similar results, without departing from the spirit or scope of this application.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains, and all materials cited herein and referenced by them are incorporated herein by reference.

[0030] Those skilled in the art will recognize, or can learn through routine experimentation, many equivalents of the specific embodiments of the invention described herein. These equivalents will be included in the claims.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0032] Example 1: Design and layout of standard probes for reducing space effects 1. Probe Synthesis To eliminate the spatial effects of gene chips, this embodiment provides a standard probe, the design criteria of which are as follows: Probe length: 50 mer; GC content: 0.35~0.65; Tm value: 75℃~95℃; Binding free energy: greater than -30; Complexity: No more than 5 consecutive identical bases; Second-order structure: does not contain palindromic sequences that can form stable second-order structures; Specificity: The standard probe binds specifically to the corresponding reverse complementary sequence only and does not bind to any other non-target DNA sequence.

[0033] In the specific design, 1000 candidate sequences of 50mer length composed of random bases are first generated. The thermodynamic properties of the candidate sequences, such as GC content, Tm value and secondary structure, are calculated. Based on the above probe standards, 616 preliminary screening probe sequences are obtained. Then, they are compared with possible genomic sequences in the sample to be tested, and a second screening is conducted to find sequences that cannot match at all, totaling 352. One of these sequences is randomly selected as the standard probe sequence.

[0034] The standard probe sequence ultimately selected in this embodiment is: AACAACCAAACTTTACTGTGCCACCAAGTTTGGGTCGTCGGTCACGATTC (SEQ ID No. 1) Simultaneously, standard DNA with reverse sequence complementation to the standard probe was synthesized. During synthesis, Cyanine 3-dUTP and Cyanine 5-dUTP were used for fluorescent labeling to obtain two fluorescently labeled standard DNAs (which can be used to detect two samples).

[0035] 2. Probe Layout Standard probes are arranged at equal intervals on the starting template of the gene chip to construct two-dimensional reference points for three-dimensional spatial signal data. The following factors should be considered when setting up the standard probes: (1) Spacing between standard probes The interval between standard probes should not be too small, otherwise too many points will be occupied, resulting in a reduction in the number of detection probes; the interval should not be too large either, otherwise too few standard reference points will be provided, making it impossible to construct a suitable spatial trend surface.

[0036] In this embodiment, the number of standard probes is set to 2.5% of the total number of probes. The gene chip used to detect cyanobacteria includes one array, and each array includes 62,976 probe sites (384 rows and 164 columns). Specifically, for each array, standard probes are placed at the intersection sites of row 1, row 8, row 15, row 22... with column 1, column 8, column 15, column 22.

[0037] (2) Conflicts at probe sites Gene chips typically have positive and negative control probes on their initial templates, and these control probes are randomly distributed on the gene chip. When standard probes are arranged, they inevitably conflict with these control probes.

[0038] For example, in an array, there is a control probe in column 8, row 15, such as... Figure 3For a point with coordinates (col=8, row=15), a standard probe cannot be placed at that point. To resolve this site conflict, the inventors chose to place standard probes at two adjacent sites to the conflicting site.

[0039] In addition to the control probes and standard probes, detection probes are set at other sites. In this embodiment, the gene chip includes a total of 1570 detection probes.

[0040] A partial schematic diagram of the final standard probe layout is shown below. Figure 1 As shown.

[0041] Example 2: Application of gene chips containing standard probes refer to Figure 2 This embodiment provides the application of the gene chip containing standard probes prepared in Example 1 in the detection of cyanobacteria in environmental water bodies, and how to reduce spatial effects after obtaining detection signal data.

[0042] 1. DNA extraction After obtaining environmental water samples, total DNA from cyanobacteria was extracted from the samples using the HiPure SF Plant DNA Mini Kit.

[0043] Purification was performed using magnetic beads: OnePure MagBeads equilibrated at room temperature were mixed with an equal volume of the DNA sample, vortexed, and allowed to stand at room temperature for 5 minutes. The supernatant was discarded after magnetic separation, and the sample was washed twice with 80% ethanol. After drying the magnetic beads, 43 μL of sterile water was added for resuspending. 42 μL of the purified DNA supernatant was then transferred using magnetic separation.

[0044] 2. DNA sample labeling Taking Cyanine 3-dUTP labeling as an example (the method for Cyanine 5-dUTP labeling is the same), take 250 ng of purified DNA, add random primers, denature at 98°C for 10 minutes, and then incubate on ice. Add a dNTP mixture containing Cyanine 3-dUTP and Exo(-)Klenow enzyme, label at 37°C for 4 hours, and inactivate at 95°C for 3 minutes.

[0045] The labeled product was purified by centrifugation column (Agilent Oligo aCGH kit): 1×TE buffer was added in fractions and centrifuged. After washing, 40–64 μL of the product was recovered, concentrated and dried to 10 μL for later use.

[0046] The fluorescently labeled DNA sample, concentrated to 10 μL, was mixed with 45 μL of hybridization buffer, pipetted to mix, and then centrifuged. The hybridization buffer consisted of: 27.5 μL 2× Hi-RPM buffer, 5.5 μL 10× Blocking Agent, 3 μL formamide, 2.4 μL Cot-1 Human DNA, 2.2 μL Cyanine 3-dUTP-labeled standard DNA, 2.2 μL Cyanine 5-dUTP-labeled standard DNA, and 2.2 μL ddH2O.

[0047] 3. Hybridization and scanning The labeled sample with standard DNA was incubated with the gene chip. Before the formal hybridization, a pre-hybridization was performed by denaturing at 98°C for 3 minutes and then pre-incubating at 37°C for 30 minutes. After that, the formal hybridization was performed by adding 47 μL of the mixture to the gasket chamber, inverting the chip and sealing it, and rotating it at 67°C (20 rpm) for 22 hours.

[0048] After hybridization, unbound or non-specifically bound labeled molecules are removed by washing with water to improve the signal-to-noise ratio. The chip is then scanned using a laser scanner within 4 hours. The fluorescently labeled probe regions emit light of specific wavelengths, which are captured by the scanner. Finally, the scanned image data is converted into digital signals to obtain a microarray data file.

[0049] 4. Data import, quality control, and cleaning Import the microarray data files into the microarray data preprocessing software. Verify the integrity of the data files and ensure that the file format is compatible with the preprocessing software. Perform quality control on the microarray data: (1) Set an outlier detection threshold of ±3 standard deviations to identify and remove outliers, artifacts, etc. (2) Remove probes with signal strength <100, and remove or mark low-quality or unreliable probes or spots from the data; (3) Set background correction algorithms RMA, mas5, and model-based background correction parameters to remove non-specific hybridization signals.

[0050] The final result is clean spatial signal data, which includes the coordinates of each detection point and the corresponding signal value.

[0051] 5. Spatial signal correction After obtaining clean spatial signal data, the LOESS algorithm is used to reduce spatial effects. Specifically, the spatial trend of the standard probe is used to correct the probe signal value. The detailed steps are as follows: Based on the off-machine signal data from the gene chip, a spatial dataset was constructed, which includes coordinate information (x, y) and signal value z.

[0052] The number of points k in the neighborhood is selected based on the actual chip conditions (set to 200 in this embodiment) to determine the neighborhood size and the polynomial order (set to order 2 in this embodiment). A cubic function is selected as the weighting function, defined as: , Where u is the standardized distance (the distance from the current point to a point in the neighborhood divided by the distance from the current point to its k-th nearest neighbor).

[0053] Perform LOESS local weighted regression: For each probe site (target site, including non-standard probe sites) on the chip, perform the following steps to obtain the signal trend surface of the entire gene chip: (1) Determine the neighborhood: Based on the coordinates of the target site, use the K-nearest neighbor algorithm (KNN) to find the k nearest standard probe sites and obtain the neighborhood point set.

[0054] (2) Calculate the weights: For each point in the neighborhood point set, calculate its Euclidean distance to the target point, and then calculate the weights through the weight function to obtain the weight matrix.

[0055] According to the aforementioned weighting function, the closer a site is to the target site, the greater its weight, and vice versa.

[0056] (3) Weighted polynomial regression: Polynomial features are used to convert the coordinates (x, y) of neighborhood points into a polynomial feature matrix (a second-order polynomial including 1, x, y, x). 2 , y 2 The polynomial characteristic matrix and signal value vector are weighted using a weight matrix (i.e., each row of the characteristic matrix is ​​multiplied by the square root of the weight of the corresponding point, and the signal value is multiplied by the square root of the weight of the corresponding point). The weighted linear equations are solved using the least squares method to obtain the coefficients of the local polynomial model.

[0057] Calculate the correction coefficient: Calculate the mean of the fitted values ​​of all standard probes (denoted as ). For each probe site (including non-standard probes), calculate the correction factor: , in, It is the fitted value of the i-th probe point.

[0058] Signal correction: Multiply the original signal value of each probe point by the corresponding correction coefficient to obtain the corrected signal value. Corrected signal = Original signal × Correction coefficient Figure 3The diagram illustrates the distribution of standard probe signal values ​​before (left) and after (right) the reduction of spatial effects in the detection items of this embodiment. It is evident that the spatial effects are significantly reduced.

[0059] Example 3: The Influence of Standard Probe Ratio on the Fitting Trend Surface Constructing a trend surface using standard probes is crucial for reducing spatial effects. To verify this, the specification provides three gene chips in this embodiment, where the proportion of standard probes to the total number of probes is 2.5%, 0.9%, and 0.3%, respectively. The trend surface is constructed using the same method as in Example 2, as follows: Figure 4 As shown.

[0060] Depend on Figure 4 It can be seen that when the number of standard probes accounts for a small proportion of the total number of probes, the spacing between the standard probes increases, making it difficult to capture local changes.

[0061] Example 4: The Influence of Neighborhood Point Set Size on the Fitted Trend Surface In Example 3, a local polynomial model is constructed based on the neighborhood point set to complete the fitting trend surface for the entire chip. Therefore, the size of the neighborhood point set also affects the fitting trend surface. In this example, the inventors set k to 200, 100, and 50, respectively, and the resulting fitting trend surface is as follows: Figure 5 As shown.

[0062] Depend on Figure 5 It is known that the neighborhood point set should be large enough (e.g., 200) to ensure sufficient data support for the fitted trend surface. If the k value is set too small, it will lead to overfitting of the trend surface; the smaller the k value, the more significant the overfitting. In this embodiment, overfitting already occurs when k=100, and when k=50, the overfitting is very severe.

[0063] It's worth noting that a larger k value isn't always better; an excessively large k value can reduce computational efficiency. The inventors have verified that k=200 is an ideal choice.

[0064] Example 5: The Influence of Polynomial Order on the Fitting Trend Surface To illustrate the impact of polynomial order on the fitting trend surface, the inventors compared the fitting trend surfaces obtained using first-order, second-order, and third-order polynomials, as follows: Figure 6 As shown. For a first-order polynomial, the overall fitting trend surface is too smooth, and local changes cannot be captured well, especially the fitting degree at the edges is insufficient ( Figure 6 (Left figure). For third-order polynomials, this leads to overfitting ( Figure 6 As shown in the right figure, signals at the edges are clearly overfitted, easily leading to data distortion, and are also unsuitable for gene chip-type signal data. Only by choosing a second-order polynomial can the resulting surface capture curvature changes better ( Figure 6 (Chinese map).

[0065] Furthermore, it should be understood that after reading the foregoing teachings of this application, those skilled in the art can make various alterations or modifications to this application, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A standard probe, characterized in that, Its nucleotide sequence is shown in SEQ ID No.

1.

2. The application of the standard probe according to claim 1 in the preparation of gene chips capable of reducing spatial effects of detection signals, characterized in that, The standard probes are arranged at the same intervals on the gene chip, which also includes detection probes.

3. The application according to claim 2, characterized in that, The gene chip also includes control probes. If the site of the standard probe coincides with the site of the control probe, then the standard probe is placed at a site adjacent to the control probe.

4. The application according to claim 3, characterized in that, The number of standard probes is set to 2% to 3% of the total number of probes on the gene chip.

5. The application according to any one of claims 2 to 4, characterized in that, Reduce spatial effects on gene chip detection signals using the following steps: Obtain fluorescently labeled standard DNA that is inversely complementary to the standard probe; The standard DNA and the fluorescently labeled DNA to be tested are hybridized with the gene chip, and the fluorescence image is scanned and digitized to obtain a microarray data file; Based on the microarray data file, a spatial dataset is constructed, containing two-dimensional coordinate information and signal values; Trend surface construction and signal value correction: The spatial dataset is modeled using a polynomial model, and the signal values ​​are fitted to obtain a trend surface. The correction coefficient of each probe site is calculated using the fitted value of each probe site on the trend surface, and the original signal values ​​are corrected.

6. The application according to claim 5, characterized in that, For each probe site on the gene chip, local weighted regression is performed using the following steps to obtain the signal trend surface of the entire gene chip: (1) Based on the coordinates of the target site, the k nearest standard probe sites are obtained using the k-nearest neighbor algorithm, thus obtaining the neighborhood point set; (2) For each point in the neighborhood point set, calculate its distance to the target point, and use the weight function to calculate the weight to obtain the weight matrix; (3) Use a polynomial feature converter to convert the coordinates of each point in the neighborhood point set into a polynomial feature matrix, use the weight matrix to weight the polynomial feature matrix and the signal value vector, and use the least squares method to solve the weighted linear equation system to obtain the coefficients of the local polynomial model.

7. The application according to claim 6, characterized in that, The weighting function is as follows: ， Where u is the standardized distance, which represents the distance from the target site to a point in the neighborhood point set divided by the distance from the target site to its k-th nearest neighbor.

8. The application according to any one of claims 5 to 7, characterized in that, Use the following steps to correct it: (1) Calculate the mean of the fitted values ​​of all standard probes. For each probe site, calculate the correction coefficient: ， in, It is the first i Fitted values ​​for each probe point; (2) Multiply the original signal value of each probe site by the corresponding correction coefficient to obtain the corrected signal value: Corrected signal value = original signal value × correction coefficient.

Images