Acid-resistant high-efficiency nitrate-reducing bacterial strain and application thereof

Abstract

The application discloses an acid-resistant high-efficiency nitroglycerin denitrifying strain and application thereof, and relates to the technical field of microorganisms. Pseudomonas The strain is Pseudomonas sp. TYF-ZS-P94, is preserved in the China General Microbiological Culture Collection Center (CGMCC), has a preservation number of CGMCC No. 36445, a preservation date of October 31, 2025, a classification name of Pseudomonas sp., and a preservation address of No. 3, Xibaixili, Chaoyang District, Beijing, with a postal code of 100101. Pseudomonas The strain is an acid-resistant high-efficiency nitroglycerin denitrifying strain, can efficiently remove nitroglycerin nitrogen pollution in water bodies, has good denitrification performance under acid stress, has strong acid resistance, is suitable for pharmaceutical wastewater and nitroglycerin industrial wastewater treatment, and has a good application prospect in the field of nitroglycerin nitrogen industrial pollution treatment.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and in particular relates to an acid-resistant, highly efficient nitroglycerin denitrifying strain and its application. Background Technology

[0002] Nitrogen pollution in water bodies has become a prominent challenge in my country's water environment management. Excessive nitroglycerin nitrogen in industrial wastewater not only affects the compliance of wastewater treatment by enterprises with discharge standards, but also disrupts the balance of aquatic ecosystems. As a characteristic pollutant in nitroglycerin-based industrial wastewater, nitroglycerin nitrogen exhibits biotoxicity and chemical stability, making it difficult to degrade spontaneously in natural water bodies. Long-term accumulation can cause continuous harm to the aquatic ecological environment. Therefore, developing efficient and reliable nitroglycerin nitrogen removal technologies is of significant environmental importance and an urgent industrial need.

[0003] Biological denitrification technology has become the mainstream technology for the treatment of nitric acid and glycoside nitrogen pollution in water bodies due to its advantages such as low cost, no secondary pollution, and thorough denitrification. Its core lies in the screening and application of highly efficient nitric acid and glycoside denitrification strains. Currently, most publicly reported denitrification strains are adapted to neutral or weakly alkaline conditions. These strains exhibit optimal denitrification activity in an environment with a pH of around 7.0. However, in acidic water bodies with a pH < 6.0, the cell membrane permeability of these strains decreases, and enzyme activity is inhibited, leading to a significant drop in nitric acid and glycoside denitrification efficiency, or even the loss of nitric acid and glycoside denitrification function. In actual water bodies, pharmaceutical wastewater and nitric acid and glycoside industrial wastewater often exhibit acidic characteristics due to the presence of large amounts of organic and inorganic acids, with pH values ​​typically between 3.0 and 6.0. Conventional denitrification strains are insufficient to meet the treatment requirements of such acidic nitric acid and glycoside wastewater, making acidic nitric acid and glycoside wastewater a long-standing challenge and pain point in the field of biological denitrification technology.

[0004] In existing technologies, solutions for denitrification of acidic nitroglycerin wastewater mostly employ a combined process of "acid-base neutralization + biological treatment." This involves first adding alkaline agents such as sodium hydroxide and lime to the acidic nitroglycerin wastewater to adjust the pH to neutral, followed by biological denitrification. However, this process has significant drawbacks: First, acid-base neutralization increases reagent costs and sludge production, raising the overall cost of nitroglycerin wastewater treatment. Second, the neutralization process easily leads to excessive pH fluctuations, affecting the stability of subsequent biological treatment systems. Third, for highly acidic nitroglycerin wastewater, precise pH control during neutralization is difficult, easily causing secondary pollution. Furthermore, the large amount of chemical sludge generated during neutralization requires additional disposal, further increasing the environmental burden and risks for enterprises.

[0005] Therefore, screening a strain with excellent acid resistance and high nitroglycerin denitrification efficiency for direct application in the treatment of nitroglycerin nitrogen pollution in acidic water bodies without additional pH adjustment is of great significance for simplifying the nitroglycerin wastewater treatment process, reducing treatment costs, and improving nitroglycerin denitrification efficiency. It is also a technical pain point that urgently needs to be solved in the field of biological denitrification technology for nitroglycerin industrial wastewater. Summary of the Invention

[0006] The technical problem this invention aims to solve is to address the shortcomings of existing nitroglycerin denitrifying strains, which lack sufficient acid resistance and cannot directly adapt to the denitrification requirements of acidic nitroglycerin wastewater, as well as the high cost, complex process, and poor stability of existing acidic nitroglycerin wastewater denitrification processes employing a combination of "acid-base neutralization + biological treatment." This invention provides an acid-resistant, highly efficient nitroglycerin denitrifying strain and its applications. This strain can directly and efficiently remove nitroglycerin nitrogen and nitrate nitrogen from nitroglycerin wastewater under acidic conditions without additional pH adjustment, thus achieving efficient and low-cost removal of nitroglycerin nitrogen pollutants from acidic water bodies.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solutions.

[0008] In a first aspect, the present invention provides an acid-resistant, highly efficient nitroglycerin-denitrifying bacterium, wherein the strain is *Pseudomonas* (…). Pseudomonas sp.) TYF-ZS-P94 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36445 and deposit date of October 31, 2025.

[0009] The *Pseudomonas* strain TYF-ZS-P94 was obtained from aerobic tank packing material and wastewater samples from an industrial wastewater treatment plant containing nitroglycerin in Shanxi Province. The process involved enrichment, separation, purification, and rescreening under acidic conditions. The 16S rRNA sequence of this strain is shown in SEQ ID No. 1. BLAST alignment analysis in the GenBank database showed that it was similar to that of *Pseudomonas* spp. (…). Pseudomonas The homology of sp. was as high as 99%, and combined with phylogenetic tree analysis, it was identified as a strain of the genus Pseudomonas.

[0010] Secondly, the present invention provides the application of the acid-resistant and highly efficient nitroglycerin denitrifying bacteria in the denitrification of nitroglycerin wastewater.

[0011] The *Pseudomonas* strain TYF-ZS-P94 can efficiently remove one or a combination of organic nitrogen and nitrate nitrogen from nitroglycerin wastewater under acidic conditions, achieving simultaneous removal of nitroglycerin and nitrate nitrogen. Nitroglycerin nitrogen is progressively degraded via intermediate products such as dinitroglycerin and mononitroglycerin. Furthermore, under acidic conditions, *Pseudomonas* TYF-ZS-P94 can sequentially convert nitroglycerin in nitroglycerin wastewater into dinitroglycerin and mononitroglycerin, ultimately degrading it into glycerol, while nitrate nitrogen is directly converted into gaseous nitrogen, achieving complete removal of both nitroglycerin and nitrate nitrogen.

[0012] In one specific embodiment, the *Pseudomonas* TYF-ZS-P94, under acidic conditions of pH 4.0, achieved a 95.0% removal efficiency of organic nitrogen from nitroglycerin wastewater within 48 hours, thus reducing NO3 in the nitroglycerin wastewater.- The removal rate of -N reached 96.3%.

[0013] Thirdly, the present invention provides a microbial agent for removing nitrate nitrogen pollutants from water, which is prepared by fermentation of the Pseudomonas TYF-ZS-P94.

[0014] The preparation method of the microbial agent specifically includes the following steps: Pseudomonas TYF-ZS-P94 is inoculated into a mineral salt culture medium and then placed in a shaker at 30°C for activation. After it grows to the logarithmic phase, the activated bacterial solution is inoculated into 100 mL of mineral salt culture medium at 5% by volume and cultured for 48 h at 30°C and 120 r / min.

[0015] Fourthly, the present invention provides the application of the aforementioned microbial agent in removing nitroglycerin from aquatic environments.

[0016] The microbial agent can efficiently remove one or a combination of organic nitrogen and nitrate nitrogen from nitroglycerin wastewater under acidic conditions, achieving deep removal of both nitroglycerin nitrogen and nitrate nitrogen. Specifically, the microbial agent can convert organic nitrogen and nitrate nitrogen in the nitroglycerin wastewater into glycerol and gaseous nitrogen, respectively.

[0017] The specific method of application is as follows: the microbial agent is added to the nitroglycerin wastewater environment to be treated at an inoculation rate of 0.8% to 20% (v / v), with a pH of 3.0 to 6.0, thereby achieving the removal of nitroglycerin nitrogen and nitrate nitrogen pollutants from the water. The nitroglycerin wastewater includes, but is not limited to, pharmaceutical wastewater and nitroglycerin industrial wastewater.

[0018] Compared with the prior art, the present invention has the following advantages and technical effects: (1) The Pseudomonas TYF-ZS-P94 strain of the present invention can use organic nitrogen and nitrate nitrogen in nitroglycerin wastewater as the sole nitrogen source for growth, and can also use the two nitrogen sources simultaneously to achieve simultaneous removal of organic nitrogen and nitrate nitrogen in nitroglycerin wastewater with high removal efficiency.

[0019] (2) The strain of the present invention has overcome the technical bottleneck of insufficient acid resistance of conventional denitrifying strains. It maintains high nitroglycerin denitrification activity in an extremely acidic environment (pH 4.0) and has effective denitrification ability in an acidic range of pH 3.0 to 6.0. It solves the technical problem of low denitrification efficiency of conventional strains in acidic nitroglycerin wastewater.

[0020] (3) In a mixed nitrogen source system in which nitroglycerin and nitrate nitrogen coexist, the strain of the present invention exhibits substrate utilization characteristics of preferentially utilizing nitroglycerin and then utilizing nitrate nitrogen. There is no accumulation of nitrite nitrogen during the entire degradation process, the denitrification process is thorough, and the final products are glycerol and nitrogen gas, with no secondary pollution.

[0021] (4) The strain of the present invention can be directly added to acidic nitroglycerin wastewater without the need for additional alkaline agents to adjust the pH. This eliminates the essential acid-base neutralization step in the traditional process, significantly reducing the cost of agent procurement and sludge disposal. At the same time, the simplified process reduces equipment investment and operating steps, avoids the impact of drastic pH fluctuations on the biological treatment system during neutralization, and improves the operational stability of the nitroglycerin wastewater treatment system.

[0022] (5) The preparation method of the microbial agent of the present invention is simple, the culture conditions are mild, and it is easy to scale up production and promote application. It shows good application prospects in the field of nitroglycerin nitrogen pollution control, such as pharmaceutical wastewater and nitroglycerin industrial wastewater treatment.

[0023] Preservation information: The Pseudomonas aeruginosa involved in this invention ( Pseudomonas sp.) TYF-ZS-P94 has been deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCC No. 36445 and deposit date of October 31, 2025. It is classified as *Pseudomonas*. Pseudomonas sp. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 Phylogenetic tree diagram of Pseudomonas TYF-ZS-P94.

[0026] Figure 2 Morphological characterization of Pseudomonas TYF-ZS-P94.

[0027] Figure 3 This is a schematic diagram of the denitrification performance of Pseudomonas TYF-ZS-P94 under pH 4.0 conditions using organic nitrogen from nitroglycerin wastewater as the sole nitrogen source.

[0028] Figure 4 The figure shows the denitrification performance of Pseudomonas TYF-ZS-P94 under pH 4.0 conditions with nitrate nitrogen in nitroglycerin wastewater as the sole nitrogen source, and the growth curve of the strain.

[0029] Figure 5This is a schematic diagram of the denitrification performance of Pseudomonas TYF-ZS-P94 under pH 4.0 conditions using organic nitrogen and nitrate nitrogen from nitroglycerin wastewater as a mixed nitrogen source.

[0030] Figure 6 This is a schematic diagram of the final nitroglycerin denitrification performance of Pseudomonas TYF-ZS-P94 under pH 3.0-6.0 conditions using organic nitrogen and nitrate nitrogen from nitroglycerin wastewater as a mixed nitrogen source. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] All raw materials used in this invention are not particularly restricted in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.

[0033] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.

[0034] The culture medium formulation and main experimental instruments involved in this invention are as follows: Beef extract peptone medium: 5 g beef extract, 10 g peptone, 5 g NaCl, 1000 mL distilled water, pH 7.0-7.2.

[0035] Mineral salt culture medium: K2HPO4 1.4 g, KH2PO4 0.8 g, NaCl 0.5 g, MgSO4·7H2O 0.12 g, trace element solution 1.0 mL, distilled water 1000 mL, pH 7.0-7.2.

[0036] Trace element solution formula: H3BO3 0.1 g, FeCl3·6H2O 0.24 g, ZnSO4·7H2O 0.31 g, Na2MoO2·6H2O 0.03 g, MnSO4·4H2O 0.0228 g, CuSO4·5H2O 0.06 g, CoCl2·6H2O 0.04 g, distilled water 1000 mL, pH 7.0-7.2.

[0037] Phosphate buffer: NaCl 8 g, KCl 0.2 g, KH2PO4 0.24 g, Na2HPO4 1.44 g, distilled water 1000 mL, pH 7.0-7.2.

[0038] Solid culture media are prepared by adding 2%-2.5% agar to the above-mentioned culture media. All culture media must be autoclaved at 121 °C for 30 min before use and cooled to room temperature before subsequent experiments.

[0039] The main experimental instruments include: Constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, ultra-clean workbench, vertical pressure steam sterilizer, pH meter, full-wavelength microplate reader, PCR instrument, etc.

[0040] Example 1: Screening of Pseudomonas TYF-ZS-P94 This embodiment details the screening process of Pseudomonas TYF-ZS-P94 strain, including three steps: strain enrichment, isolation and purification, and rescreening under acidic conditions.

[0041] (1) Enrichment of microbial strains The strains screened in the experiment were obtained from an industrial wastewater treatment plant in Shanxi Province that contained nitroglycerin. 10 mL each of the aerobic tank packing material and wastewater sample from the nitroglycerin-containing industrial wastewater treatment plant were inoculated into Erlenmeyer flasks containing 90 mL of sterilized beef extract peptone medium and cultured at 120 r / min and 30℃ for 5 days to complete the enrichment of the strain.

[0042] (2) Isolation and preservation of bacterial strains In a clean bench, the enriched culture solution was serially diluted with sterile water and spread onto mineral salt solid medium. After standing for 30 min, the plates were inverted and incubated at 30℃ for at least 24 h. Single colonies with different morphological characteristics were picked and inoculated into mineral salt liquid medium. After incubation at 120 r / min and 30℃ for 24 h, the culture was further purified by streak plating. This purification process was repeated three times. The finally purified single colonies were inoculated into mineral salt liquid medium and incubated under the same conditions for 24 h. Then, they were inoculated into paraffin slant agar and stored at 4℃. Simultaneously, 500 μL of bacterial culture was mixed with 50% glycerol at a 1:1 ratio and frozen at -80℃. The nitroglycerin content in the culture solution was measured to further screen strains that can efficiently degrade nitroglycerin in nitroglycerin wastewater for further experiments.

[0043] (3) Secondary screening of strains under acidic conditions The selected bacterial cultures were inoculated at a 5% inoculum into mineral salt medium at pH 4.0, with a blank medium as a control. Three replicates were set up for each group. The cultures were incubated at 120 r / min and 30℃ for 48 h, with samples taken every 12 h to determine the nitroglycerin nitrogen concentration. By comparing the nitroglycerin denitrification efficiency of each strain under acidic conditions, the strain with the best nitroglycerin denitrification effect was finally determined as the target strain, designated TYF-ZS-P94. The colony morphology of this strain on solid medium is shown below. Figure 2 As shown.

[0044] Example 2: Molecular biological identification of the strain The purified bacterial strain TYF-ZS-P94 was inoculated into mineral salt medium and cultured at 120 r / min and 30℃ for at least 12 h. Using the cultured bacterial solution as a template, PCR amplification was performed using the universal primer pair 27F / 1492R. The sequence of the upstream primer 27F was 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID No. 2), and the sequence of the downstream primer 1492R was 5'-TACGGCTACCTTGTACGACTT-3' (SEQ ID No. 3). The PCR amplification reaction conditions were as follows: pre-denaturation at 95℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 90 s, repeated 30 times from step two, followed by another extension at 72℃ for 5–10 min, and finally storage at 4℃ for 15 min.

[0045] The 16S rDNA product obtained by PCR amplification was sent to Sangon Biotech Co., Ltd. for first-generation sequencing. The obtained sequence was submitted to the NCBI website and compared with existing strain data in the GenBank database. BLAST was then used to search for strains with high similarity. The results showed that this strain was similar to... Pseudomonas sp. The homology was as high as 99%. Using MEGA 12.0 software, a phylogenetic tree was constructed using the Neighbor Joining method, such as... Figure 1 As shown, this further confirms the taxonomic position of the strain, identifying it as belonging to the genus *Pseudomonas*. Pseudomonas sp. It was named Pseudomonas TYF-ZS-P94.

[0046] The 16S rRNA sequence of Pseudomonas TYF-ZS-P94 is shown in SEQ ID No. 1: CCTAACCATGCAAGTCGAGCGGCAGCACGGGTACTTGTACCTGGTGGCGAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTAGTAGTGGGGGATAACGTCCGGAAACGGGCGCTAA TACCGCATACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATTAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGT CTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTTACCTAATACGTGATTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCACCCCCCCGGTAAAA Example 3: Test of nitroglycerin denitrification performance of Pseudomonas TYF-ZS-P94 at pH 4.0 using organic nitrogen from nitroglycerin wastewater as the sole nitrogen source. This example investigates the denitrification capacity of Pseudomonas TYF-ZS-P94 to a single organic nitrogen source under acidic conditions (pH 4.0).

[0047] The TYF-ZS-P94 strain, preserved at -80℃ in Example 1, was inoculated into mineral salt medium and activated in a shaker at 30℃. After reaching the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of simulated nitroglycerin wastewater, with organic nitrogen from the nitroglycerin wastewater as the sole nitrogen source (concentration 100 mg / L), and cultured for 48 h under the following conditions: pH 4.0, 120 r / min, and 30℃. Samples were taken at 0 h, 12 h, 24 h, 36 h, and 48 h, and the heterotrophic nitrification performance of the strain was tested after centrifugation and filtration. Simultaneously, intermediate products that may occur during the degradation process, such as dinitroglycerin, mononitroglycerin, and NO3, were also detected. - -N and NO2 - The content of -N.

[0048] The determination of dinitroglycerin and mononitroglycerin content was performed using high-performance liquid chromatography (HPLC). NO3 -The NO2- content was determined using ultraviolet spectrophotometry. - The N-N content was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method.

[0049] Test results are as follows Figure 3 As shown in the figure, the removal efficiency of nitroglycerin nitrogen in nitroglycerin wastewater by this strain reached 89.2% at 24 h, and 95.0% at 48 h. Intermediate products such as dinitroglycerin and mononitroglycerin were detected during the experiment, indicating that nitroglycerin nitrogen is gradually degraded through intermediate products such as dinitroglycerin and mononitroglycerin, ultimately degrading into glycerol. Throughout the degradation process, NO3-... - -N and NO2 - -N showed no significant accumulation.

[0050] Example 4: Test of nitroglycerin denitrification performance of Pseudomonas TYF-ZS-P94 at pH 4.0 using nitrate nitrogen from nitroglycerin wastewater as the sole nitrogen source. This embodiment investigates the denitrification ability of Pseudomonas TYF-ZS-P94 under acidic conditions (pH 4.0) for single nitrate nitrogen, while monitoring the growth of the strain.

[0051] The TYF-ZS-P94 strain, stored at -80℃ in Example 1, was inoculated into a mineral salt medium and then activated in a shaker at 30℃. After it reached the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of NO3- from nitroglycerin wastewater. - The strain was cultured for 48 h in simulated nitroglycerin wastewater with -N as the sole nitrogen source (concentration of 100 mg / L) under the following conditions: pH 4.0, 120 r / min, and 30℃. Samples were taken at 0 h, 12 h, 24 h, 36 h, and 48 h, and the denitrification performance of the strain was tested after centrifugation and filtration. Simultaneously, NO2, a product that may appear during the degradation process, was also detected. - -N content and OD 600 The value is used to monitor the growth status of the strain.

[0052] Among them, NO3 - The NO2- content was determined using ultraviolet spectrophotometry. - The N-N content was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method, OD 600 The measurement method was to measure the absorbance of the bacterial solution at a wavelength of 600 nm using a full-wavelength microplate reader.

[0053] Test results are as follows Figure 4As shown in the growth curve, the strain was in the adaptation phase from 0 to 12 hours, and its growth was relatively slow; from 12 to 36 hours, the strain entered the logarithmic growth phase, and its growth rate increased significantly. At 36 hours, the OD of the strain... 600 The concentration reached 0.912, then decreased slightly after 48 hours. In terms of denitrification performance, this strain showed good denitrification of NO3 in nitroglycerin wastewater at 12 hours. - The removal efficiency of NO3- reached 23.5% after 48 hours. - The removal efficiency of -N reached 96.3%. No NO2 was generated during the entire degradation process. - The accumulation of -N indicates the presence of NO3 in nitroglycerin wastewater. - -N can be rapidly converted into gas (i.e. gaseous nitrogen) by this strain, thereby achieving efficient removal of nitrate nitrogen.

[0054] Example 5: Test of nitroglycerin denitrification performance of Pseudomonas TYF-ZS-P94 at pH 4.0 using nitroglycerin nitrogen and nitrate nitrogen from nitroglycerin wastewater as a mixed nitrogen source. This embodiment simulates a situation closer to actual nitroglycerin wastewater, investigates the ability of Pseudomonas TYF-ZS-P94 to simultaneously denitrify a mixed nitrogen source of nitroglycerin and nitrate nitrogen under acidic conditions (pH 4.0), and explores the degradation sequence when the two substrates coexist.

[0055] The TYF-ZS-P94 strain, which was stored at -80℃ in Example 1, was inoculated into a mineral salt medium and then activated in a shaker at 30℃. After it reached the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of a solution containing nitroglycerin nitrogen (50 mg / L) and NO3- from nitroglycerin wastewater. - Simulated nitroglycerin wastewater containing a mixed nitrogen source (NO3-N at a concentration of 50 mg / L) was cultured for 48 h under the following conditions: pH 4.0, 120 r / min, and 30℃. Samples were taken at 0 h, 12 h, 24 h, 36 h, and 48 h. After centrifugation and filtration, the supernatant was obtained, and the nitroglycerin nitrogen and NO3- content in the supernatant were measured. - -N and NO2 - -N concentration.

[0056] The nitroglycerin content was determined by high performance liquid chromatography (HPLC). NO3 - The NO2- content was determined using ultraviolet spectrophotometry. - The N-N content was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method.

[0057] Test results are as follows Figure 5 As shown. In nitroglycerin wastewater, nitroglycerin nitrogen and NO3... -When nitroglycerin (N-N) is present and at the same initial concentration, nitroglycerin in the culture medium is rapidly degraded in the first 24 hours, with a removal rate of 93.2%, while NO3- is removed during the same period. - The degradation rate of NO3- was only 31.8%. After 24 hours, when the nitroglycerin in the culture medium was almost completely consumed, NO3-... - The degradation rate of NO3- was significantly accelerated. By 48 h, NO3- - The removal rate of -N reached 95.1%. During the degradation process, NO2... - -N has no significant accumulation.

[0058] The above results indicate that in the case of nitroglycerin and NO3... - When both -N and -N are present, strain TYF-ZS-P94 preferentially utilizes nitroglycerin as a nitrogen source, and then rapidly utilizes NO3 after the nitroglycerin is largely depleted. - -N, exhibiting a clear substrate utilization order. Furthermore, this strain was able to achieve efficient simultaneous removal of two nitrogen sources within 48 h.

[0059] Example 6: Denitrification performance of Pseudomonas TYF-ZS-P94 under different pH conditions using organic nitrogen and nitrate nitrogen from nitroglycerin wastewater as a mixed nitrogen source This embodiment examines the denitrification ability of Pseudomonas TYF-ZS-P94 to mixed nitrogen sources over a wider range of acidic pH (pH 3.0–6.0) to verify its adaptability and stability under acidic conditions.

[0060] The TYF-ZS-P94 strain, preserved at -80℃ in Example 1, was inoculated into mineral salt medium and activated in a shaker at 30℃ and 120 r / min. After the strain reached the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of nitroglycerin wastewater containing nitroglycerin nitrogen (50 mg / L) and NO3. - Simulated nitroglycerin wastewater containing 50 mg / L NO3- (Ni-N) as a mixed nitrogen source was cultured for 48 h. Four acid gradient experimental groups were set up with culture conditions of pH 3.0, pH 4.0, pH 5.0, and pH 6.0, respectively, at 120 r / min and 30℃. After 48 h of culture, samples were taken, centrifuged, filtered, and the supernatant was obtained. The nitroglycerin nitrogen and NO3- in the supernatant were measured. - -N and NO2 - -N concentration.

[0061] The nitroglycerin content was determined by high performance liquid chromatography (HPLC). NO3 - The NO2- content was determined using ultraviolet spectrophotometry. - The N-N content was determined using the N-(1-naphthyl)-ethylenediamine spectrophotometric method.

[0062] Test results are as follows Figure 6 As shown. The strain TYF-ZS-P94, under acidic conditions (pH 3.0–6.0), effectively controlled the levels of nitroglycerin nitrogen and NO3 in nitroglycerin wastewater. - Both -N exhibited degradation capabilities, and no significant NO2 was observed throughout the process. - -N accumulation. As the pH of the system gradually increased from 3.0 to 6.0, the strain's resistance to nitroglycerin and NO3- increased. - The final degradation rate of -N shows an increasing trend: At pH=3.0, the final degradation rate of nitroglycerin is approximately 93.2%, and NO3... - The final degradation rate of -N was approximately 92.4%; At pH=4.0, the degradation rates of the two increased to approximately 95.0% and 95.1%, respectively. At pH=5.0, the purity further increases to approximately 96.5% and 96.4%; At pH 6.0, the highest value within the experimental gradient was reached, with a final degradation rate of approximately 98.3% for nitroglycerin and NO3. - The final degradation rate of -N is approximately 98.7%.

[0063] Meanwhile, NO2 - The final concentration of -N increased only slightly with increasing pH and remained at a very low level, indicating that the denitrification process of the strain was complete within this pH range, with no secondary accumulation of nitrite intermediates.

[0064] The above results indicate that the denitrification performance of strain TYF-ZS-P94 in nitroglycerin wastewater is significantly positively correlated with the ambient pH value. Within the acidic range of pH 3.0–6.0, the strain's denitrification performance for nitroglycerin nitrogen and NO3 increases with increasing pH. - The final degradation rate of -N was improved, exhibiting the best denitrification effect at pH=6.0. Importantly, this strain did not experience secondary accumulation of nitrite nitrogen throughout the entire acidic gradient, and maintained extremely high denitrification activity even under extremely acidic conditions at pH=3.0. It is suitable for the acidic water quality characteristics of nitroglycerin industrial wastewater, providing strain support for the biological denitrification treatment of acidic nitroglycerin wastewater.

[0065] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An acid-resistant, highly efficient nitroglycerin-denitrifying bacterium, characterized in that, The acid-resistant, highly efficient nitroglycerin denitrifying bacteria are Pseudomonas ( ). Pseudomonas sp.) TYF-ZS-P94 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36445 and deposit date of October 31, 2025.

2. The application of the acid-resistant and highly efficient nitroglycerin denitrifying bacteria as described in claim 1 in the denitrification of nitroglycerin wastewater.

3. The application according to claim 2, characterized in that, The Pseudomonas TYF-ZS-P94 strain can efficiently remove one or a combination of organic nitrogen and nitrate nitrogen from nitroglycerin wastewater under acidic conditions, achieving simultaneous removal of nitroglycerin nitrogen and nitrate nitrogen; wherein, nitroglycerin nitrogen is gradually degraded by dinitroglycerin and mononitroglycerin intermediates.

4. The application according to claim 3, characterized in that, The described *Pseudomonas* strain TYF-ZS-P94 can, under acidic conditions, sequentially convert nitroglycerin nitrogen in nitroglycerin wastewater into dinitroglycerin and mononitroglycerin, ultimately degrading it into glycerol. Nitrate nitrogen is directly converted into gaseous nitrogen, achieving complete removal of both nitroglycerin nitrogen and nitrate nitrogen. Under acidic conditions of pH 4.0, the removal efficiency of organic nitrogen in nitroglycerin wastewater reaches 95.0% within 48 hours, effectively reducing NO3- in the wastewater. - The removal rate of -N reached 96.3%.

5. A microbial agent for removing nitrate nitrogen pollutants from water, characterized in that, The microbial agent was prepared by fermentation of Pseudomonas TYF-ZS-P94 as described in claim 1.

6. The microbial agent according to claim 5, characterized in that, The preparation method of this microbial agent includes the following steps: Pseudomonas TYF-ZS-P94 is inoculated into a mineral salt medium and then placed in a shaker at 30℃ for activation. After it grows to the logarithmic phase, the activated bacterial solution is inoculated into 100 mL of mineral salt medium at 5% by volume and cultured for 48 h at 30℃ and 120 r / min.

7. The application of the microbial agent according to claim 5 in removing nitroglycerin from aquatic environments.

8. The application according to claim 7, characterized in that, The microbial agent can efficiently remove one or a combination of organic nitrogen and nitrate nitrogen from nitroglycerin wastewater under acidic conditions, achieving deep removal of nitroglycerin nitrogen and nitrate nitrogen; wherein, the microbial agent can convert organic nitrogen and nitrate nitrogen in nitroglycerin wastewater into glycerol and gaseous nitrogen, respectively.

9. The application according to claim 8, characterized in that, The method of application is as follows: the microbial agent is added to the nitroglycerin wastewater environment to be treated at an inoculation amount of 0.8% to 20% by volume, with a pH of 3.0 to 6.0, thereby removing nitroglycerin nitrogen and nitrate nitrogen pollutants from the water.

10. The application according to claim 9, characterized in that, The nitroglycerin wastewater is pharmaceutical wastewater or nitroglycerin industrial wastewater.

Images