Rapid PCR detection kit based on staphylococcus aureus specific protein target gene and detection method thereof

Abstract

This invention discloses a rapid PCR detection kit and method based on a Staphylococcus aureus-specific protein target gene, belonging to the field of microbial molecular biology detection technology. The kit includes primer pairs and fluorescent probes for amplifying the Staphylococcus aureus-specific protein target gene. The kit also includes PCR reaction buffer, DNA polymerase, nuclease-free water, positive control, and negative control. This rapid PCR detection kit and method based on a Staphylococcus aureus-specific protein target gene, using a primer-probe combination with specific protein 2 reagent, validated 216 clinical isolates of Staphylococcus aureus confirmed by national standards, achieving a 100% positive rate. In contrast, the positive rate of the food industry standard fluorescent PCR method is only 87.0%, and the cosmetic industry standard fluorescent PCR method is 98.1%, thus solving the problem of missed detection in existing technologies.

Description

Technical Field

[0001] This invention relates to the field of microbial molecular biology detection technology, specifically to a rapid PCR detection kit and detection method based on Staphylococcus aureus-specific protein target genes. Background Technology

[0002] Staphylococcus aureus is a widespread zoonotic pathogen found in nature and is the most pathogenic species in the Staphylococcus genus to humans. This bacterium can cause localized purulent infections in humans, and even lead to serious diseases such as sepsis. Furthermore, its enterotoxins are a significant cause of food poisoning, second only to Salmonella and Vibrio parahaemolyticus in my country. In addition, due to the increasing multidrug resistance of Staphylococcus aureus, it has become a key pathogen for hospital infection control. Therefore, developing a rapid, accurate, and highly sensitive detection method for Staphylococcus aureus is of paramount public health importance in areas such as food safety, cosmetic hygiene, hospital infection control, and animal disease prevention.

[0003] Currently, my country has not issued national standards for polymerase chain reaction (PCR) detection of Staphylococcus aureus. The main industry standards relied upon include SN / T 1870-2016 (Real-time Fluorescent PCR Method for Detection of Foodborne Pathogens in Exported Food) and SN / T 2206.10-2014 and SN / T 2206.11-2014 (PCR Method for Microbiological Testing of Cosmetics). Existing local standards include DB22 / T 1828-2013 and DB22 / T 3678-2024. The target genes used in these existing standards are mostly the thermostable nuclease gene (nuc) and the methicillin-resistant femB gene. However, large-scale validation of 216 Staphylococcus aureus strains detected by standard methods revealed significant false negatives in detection methods based on the nuc and femB genes: the positive rate of the food industry standard fluorescent PCR method (nuc gene) was only 87.0%, while the positive rate of the cosmetic industry standard fluorescent PCR method (nuc / femB) was 98.1%. This indicates that existing target genes and their detection systems cannot achieve 100% detection rates and suffer from false negatives. Therefore, there is an urgent need to develop a rapid PCR detection kit and method based on Staphylococcus aureus-specific protein target genes to reduce the risk of false negatives, improve the reliability of detection results, and shorten the detection time. Summary of the Invention

[0004] The purpose of this invention is to provide a rapid PCR detection kit and detection method based on Staphylococcus aureus specific protein target genes, so as to solve the problem of missed detection in the existing Staphylococcus aureus PCR detection.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a rapid PCR detection kit based on Staphylococcus aureus specific protein target genes, the kit comprising primer pairs and fluorescent probes for amplifying Staphylococcus aureus specific protein target genes;

[0006] The upstream primer sequence of the primer pair is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:2; the sequence of the fluorescent probe is shown in SEQ ID NO:3.

[0007] SEQ ID NO:1:

[0008] Upstream primer (F): GCAGATCATGCATCCAACA;

[0009] SEQ ID NO:2:

[0010] Downstream primer (R): AAATAAGTGCGGGTAATGCG;

[0011] SEQ ID NO:3:

[0012] Fluorescent probe (P): CCAAACACAGTAACTTTCGAACAGCCA.

[0013] Furthermore, the kit also includes PCR reaction buffer, DNA polymerase, nuclease-free water, a positive control, and a negative control; the positive control is a recombinant plasmid solution containing a Staphylococcus aureus-specific protein target gene fragment; the negative control is nuclease-free water.

[0014] Furthermore, the kit also includes an internal control system, wherein the internal control system is an internal control gene uidA for fecal samples.

[0015] Furthermore, the fluorescent probe is labeled with a fluorescent reporter group Vic at its 5' end and a fluorescent quencher group BHQ1 at its 3' end.

[0016] This invention also discloses a rapid PCR detection method based on Staphylococcus aureus-specific protein target genes, specifically including the following steps:

[0017] S1. Extract the nucleic acid template from the sample to be tested;

[0018] S2. Using the nucleic acid template extracted in S1 as a template, real-time quantitative PCR amplification was performed using primer pairs and fluorescent probes for amplifying Staphylococcus aureus-specific protein target genes, and the fluorescence signal was collected.

[0019] S3. Determine whether Staphylococcus aureus is present in the sample based on the real-time fluorescence PCR amplification curve and Ct value:

[0020] Presence: S-shaped amplification with Ct value ≤ 35.0;

[0021] Not present: No amplification or Ct value > 38;

[0022] Furthermore, the reaction system for real-time quantitative PCR amplification in S2 is as follows: 0.5 μL each of upstream and downstream primers, 0.5 μL of fluorescent probe, 12.5 μL of Premix EX Taq™ RR390A, 6 μL of nuclease-free water, 5 μL of nucleic acid template, and a total volume of 25 μL.

[0023] Furthermore, the concentrations of both upstream and downstream primers are 10 μmol / L, and the concentration of the fluorescent probe is 5 μmol / L.

[0024] Furthermore, the reaction procedure for real-time quantitative PCR amplification in S2 is as follows: pre-denaturation at 95℃ for 20s; then 40 cycles of denaturation at 95℃ for 1s, annealing at 55℃~60℃ and extension for 20s, and fluorescence signal is collected.

[0025] Furthermore, the sample to be tested in S1 is at least one of the following: fecal sample, pure bacteria, enrichment solution, food sample, cosmetic sample, and clinical sample.

[0026] Furthermore, the method yielded negative results for all non-Staphylococcal strains, including Salmonella Typhimurium, Shigella sonnei, Shigella flexneri, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli, Vibrio cholerae, Campylobacter jejuni, and Listeria monocytogenes.

[0027] Compared with existing technologies, the rapid PCR detection kit and detection method based on Staphylococcus aureus specific protein target genes provided by this invention have the following beneficial effects:

[0028] (1) The detection kit provided by the present invention selects the primer and probe combination of the specific protein 2 reagent as the specific protein target gene, which has higher conservation and representativeness compared with the nuc and femB genes commonly used in the industry standard. The positive rate reached 100% by verifying 216 clinical isolates of Staphylococcus aureus confirmed by the national standard, while the positive rate of the food industry standard fluorescent PCR method was only 87.0% and the cosmetic industry standard fluorescent PCR method was 98.1%, which solved the problem of missed detection in the prior art.

[0029] (2) The primer-probe combination provided by the present invention has species specificity for Staphylococcus aureus. It can detect 16 common pathogenic bacteria, including Salmonella typhimurium, various serotypes of Shigella, Vibrio parahaemolyticus, Vibrio vulnificus, pathogenic Escherichia coli (EAEC, EPEC, ETEC, EIEC, EHEC), Vibrio cholerae, Campylobacter jejuni, and Listeria monocytogenes. All results were negative, with no cross-reaction, and the specificity was high.

[0030] (3) The detection method provided by the present invention has high sensitivity. When the plasmid standard is detected by gradient dilution, the detection limit can reach 5 copies / μL, which can meet the stringent requirements for detecting target bacteria from trace pathogen samples.

[0031] (4) The present invention conducted intra-batch repeatability tests on 10-fold serial dilutions of Staphylococcus aureus standard strain ATCC26003. The results showed that the CV% of each dilution was between 0.23% and 0.59%, indicating that the detection method provided by the present invention has good intra-batch repeatability and stability.

[0032] (5) Fast detection speed and simple operation: The real-time fluorescence PCR detection program of the present invention significantly shortens the time of each cycle, and the detection time is significantly shorter than that of ordinary PCR and culture method. Moreover, the closed tube operation reduces the risk of contamination. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this invention. For those skilled in the art, other drawings can be obtained based on these drawings.

[0034] Figure 1 A standard curve for sensitivity detection of Staphylococcus aureus specific protein target gene plasmid standard by the specific protein No. 2 reagent provided in the embodiments of the present invention;

[0035] Figure 2 The amplification curve of repeatable detection of Staphylococcus aureus standard strain ATCC26003 by 10-fold serial dilution using the specific protein 2 reagent provided in this embodiment of the invention;

[0036] Figure 3 The image shows the detection results of Staphylococcus aureus standard strain and other strains using the specific protein 2 reagent provided in this embodiment of the invention.

[0037] Figure 4 The graph shows the detection results of plasmid concentration (5 copy / mL) at different storage periods of the same batch of reagents provided in this embodiment of the invention.

[0038] Figure 5 This is a diagram showing the detection of 216 clinical isolates of Staphylococcus aureus using the specific protein 2 reagent provided in this embodiment of the invention.

[0039] Figure 6 This is a plasmid gradient diagram showing the sensitivity detection of Staphylococcus aureus specific protein target gene plasmid standard by the specific protein 2 reagent provided in this embodiment of the invention. Detailed Implementation

[0040] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.

[0041] Example 1:

[0042] A rapid PCR detection kit based on Staphylococcus aureus-specific protein target genes includes primer pairs and fluorescent probes for amplifying Staphylococcus aureus-specific protein target genes; wherein, the upstream primer sequence of the primer pair is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:2; the sequence of the fluorescent probe is shown in SEQ ID NO:3; the 5' end of the fluorescent probe is labeled with a fluorescent reporter group Vic, and the 3' end is labeled with a fluorescent quencher group BHQ1.

[0043] SEQ ID NO:1:

[0044] Upstream primer (F): GCAGATCATGCATCCAACA;

[0045] SEQ ID NO:2:

[0046] Downstream primer (R): AAATAAGTGCGGGTAATGCG;

[0047] SEQ ID NO:3:

[0048] Fluorescent probe (P): CCAAACACAGTAACTTTCGAACAGCCA.

[0049] The kit also includes PCR reaction buffer, DNA polymerase, nuclease-free water, positive control, and negative control; the positive control is a recombinant plasmid solution containing a Staphylococcus aureus-specific protein target gene fragment; the negative control is nuclease-free water.

[0050] The kit also includes an internal control system, which consists of primers and probes for the internal control gene uidA targeting fecal samples. No internal control is required for food samples. The primers and probes for the internal control gene uidA are shown in Table 1.

[0051]

[0052] Primer and probe concentrations:

[0053] The primers and probes were 10 μmol / L each, the fluorescent probe was 5 μmol / L, and the primer-probe mixture was 1.5 μL (0.5 μL each for the upstream primer, downstream primer, and fluorescent probe). The reaction system consisted of 1.5 μL of primer-probe mixture, 12.5 μL of PremixEX Taq™ RR390A buffer, 6 μL of nuclease-free water, and 5 μL of nucleic acid template, for a total of 25 μL.

[0054] The specific implementation method involves the design and screening of primers and probes:

[0055] Target sequence acquisition: The whole genome sequence of Staphylococcus aureus was retrieved from the NCBI GenBank database, and a gene fragment encoding a specific protein (accession number: CP151821.1, located at 416863-416879) was selected as the target region. The gene encoding this protein is highly conserved among different strains of Staphylococcus aureus, while showing significant interspecies differences with other Staphylococcus genera and common pathogenic bacteria, ensuring species specificity of the detection.

[0056] The nucleotide sequence of the specific protein-coding gene is shown in SEQ ID NO:16:

[0057] SEQ ID NO:16:

[0058] GCATCCAACAGGTCCAAACACAGTAACTTTCGAACAGCCATATTTATTCACACTCAACATCATTATAATGGTATTAGTCGCATTACCCGCACTTATTTTAGCTATATTCAATAATATGAGTTTTAGAATTTCTTCTGCTATTTTACAATTTCTAGGGGGCTATCTCTTGGTTCTTTTTATCATTGATATTATCGCTCACACAATTTACACCT.

[0059] Primer and probe design: Primers and fluorescent probes were designed using the PrimerQuest™ tool on the idtDNA website. The parameters were set as follows: Tm = 55-60℃, GC = 40%-60%, and no hairpins, dimers, or mismatches.

[0060] Screening process: The tool outputs 10 pairs of candidate primer-probe combinations. All candidate combinations were synthesized, and preliminary qPCR screening was performed using a recombinant plasmid solution containing a Staphylococcus aureus-specific protein target gene fragment as a template. Based on the criteria of a typical S-shaped amplification curve, the lowest Ct value, and the highest fluorescence signal intensity (ΔRn), specific protein reagent 1 and specific protein reagent 2 were obtained through comparison and screening.

[0061] In the primer-probe combination of the specific protein 2 reagent, the upstream primer sequence is shown in SEQ ID NO:1, the downstream primer sequence is shown in SEQ ID NO:2, and the fluorescent probe sequence is shown in SEQ ID NO:3.

[0062] SEQ ID NO:1:

[0063] Upstream primer (F): GCAGATCATGCATCCAACA;

[0064] SEQ ID NO:2:

[0065] Downstream primer (R): AAATAAGTGCGGGTAATGCG;

[0066] SEQ ID NO:3:

[0067] Fluorescent probe (P): CCAAACACAGTAACTTTCGAACAGCCA.

[0068] In the primer-probe combination of the specific protein reagent No. 1, the upstream primer sequence is shown in SEQ ID NO:4, the downstream primer sequence is shown in SEQ ID NO:5, and the fluorescent probe sequence is shown in SEQ ID NO:6.

[0069] SEQ ID NO:4:

[0070] Upstream primer (F): CGACGATTGTTTGCTTGTTCTT;

[0071] SEQ ID NO:5:

[0072] Downstream primer (R): GTGCGGGTAATGCGACTAATA;

[0073] SEQ ID NO:6:

[0074] Fluorescent probe (P): ACTGTGTTTGGACCTGTTGGATGC.

[0075] Nucleic acid was extracted from 216 Staphylococcus aureus strains detected according to national standards. The optimal target gene was identified by comparing the detection positive rates of the target gene of specific protein reagent 1, the target gene of specific protein reagent 2, and the target gene of the industry standard. The specific target gene and primer probes are shown in Table 2.

[0076] Table 2 Primer and probe sequences

[0077]

[0078] Comparison results: nuc gene SN / T 1870-2016: 199 samples detected, positive rate 93.4%; nuc gene SN / T2206.11-2014: 209 samples detected, positive rate 98.1%; femB gene SN / T2206.11-2014: 209 samples detected, positive rate 98.1%; specific protein reagent 1: 208 samples detected, positive rate 97.7%; specific protein reagent 2: 213 samples detected, positive rate 100%. Among these, specific protein reagent 2 amplified samples without any missed detections; therefore, the primer-probe combination for specific protein reagent 2 was determined to be the optimal choice.

[0079] Example 2:

[0080] A rapid PCR detection method based on Staphylococcus aureus-specific protein target genes includes the following steps:

[0081] S1. Extract the nucleic acid template from the sample to be tested.

[0082] S2. Using the nucleic acid template extracted in S1 as a template, real-time quantitative PCR amplification was performed using the primer pair and fluorescent probe of the specific protein 2 reagent in Example 1, and the fluorescence signal was collected.

[0083] The reaction system for real-time quantitative PCR amplification is as follows:

[0084] 0.5 μL each of forward and reverse primers, 0.5 μL of fluorescent probe, 12.5 μL of Premix EX Taq™ RR390A, 6 μL of nuclease-free water, and 5 μL of nucleic acid template, for a total volume of 25 μL; wherein the concentration of forward and reverse primers is 10 μmol / L and the concentration of fluorescent probe is 5 μmol / L.

[0085] The reaction procedure for real-time quantitative PCR amplification was as follows: pre-denaturation at 95℃ for 20 seconds; followed by 40 cycles of denaturation at 95℃ for 1 second, annealing at 55℃ for 20 seconds, and fluorescence signal acquisition at 55℃. The specific protein reagent 2 exhibited an S-shaped curve at 55℃, and the Ct value decreased with decreasing temperature; therefore, the optimal annealing and extension temperature was determined to be 55℃.

[0086] S3. Determine whether Staphylococcus aureus is present in the sample based on the real-time fluorescence PCR amplification curve and Ct value:

[0087] Presence: S-shaped amplification with Ct value ≤ 35.0;

[0088] Not present: No amplification or Ct value > 38.

[0089] Example 3:

[0090] Sensitivity determination:

[0091] Experimental materials:

[0092] Using the specific protein 2 reagent primer-probe combination of this invention, and with a synthetic plasmid solution containing the Staphylococcus aureus specific protein target gene as a standard, such as... Figure 5 As shown, since the specific protein 2 reagent of this invention showed positive results for all 216 clinical isolates of Staphylococcus aureus, the sensitivity was verified by the gradient dilution method of the synthetic plasmid.

[0093] The preparation method of the synthetic plasmid solution containing the Staphylococcus aureus-specific protein target gene is as follows:

[0094] (1) Design of target gene fragments:

[0095] The nucleotide sequence of the target gene fragment in the synthesized plasmid is shown in SEQ ID NO:20:

[0096] SEQ ID NO:20:

[0097] CTTGTTCTTAGCAGCAATGCATCCAACAGGTCCAAACACAGTAACTTTCGAACAGCCATATTTATTCACACTCAACATCATTATAATGGTATTAGTCGCATTACCCGCACTTATTTTAGCTATATT, 126bp in length.

[0098] (2) Construction of plasmid vectors:

[0099] The target gene fragment was cloned into the pUC57 plasmid vector (full length 2710 bp) to construct the recombinant plasmid.

[0100] (3) The recombinant plasmid was transformed into Escherichia coli and then amplified and cultured. The plasmid was extracted and its concentration and integrity were measured.

[0101] (4) Plasmid copy number calculation:

[0102] For double-stranded DNA plasmids (dsDNA), the copy number (copies / μL) is calculated using the following formula:

[0103]

[0104] in:

[0105] 6.02×10 23 Avogadro's constant (number of molecules per mole);

[0106] Concentration: The concentration of the plasmid solution, in ng / μL;

[0107] Plasmid length: the number of base pairs in the plasmid (bp);

[0108] 660: Average molecular weight of double-stranded DNA (Daltons / bases).

[0109] Preparation of standards by gradient dilution:

[0110] Perform 10-fold serial dilutions using nuclease-free water, setting the dilution gradient as follows: 5 × 10⁻⁶. 7 Copy / μL, 5×10 6 Copy / μL, 5×10 5 Copy / μL, 5×10 4 Copy / μL, 5×10 3 Copy / μL, 5×10 2 Copy / μL, 5×10 1 Copy / μL, 5 Copy / μL.

[0111] Sensitivity test method:

[0112] (1) Prepare PCR reaction solution according to the 25μL reaction system determined in this invention: 1.5μL primer and probe mixture, 12.5μL Premix EX Taq™ RR390A, 6μL nuclease-free water, and 5μL of serially diluted plasmid template.

[0113] (2) Real-time fluorescence PCR amplification was performed according to the amplification conditions of the specific protein No. 2 reagent: 95℃ pre-denaturation for 20s; 95℃ denaturation for 1s, 55℃ annealing extension for 20s and collection of fluorescence signal, 40 cycles.

[0114] (3) Each plasmid dilution was tested in parallel 3 times, and the Ct value corresponding to each gradient was recorded. The average value was used to plot the standard curve.

[0115] (4) Establish a standard curve with the logarithm of plasmid copy number as the abscissa and the corresponding Ct value as the ordinate, and calculate the correlation coefficient, amplification efficiency and limit of detection (LOD).

[0116] Experimental results:

[0117] The Ct values ​​obtained from real-time fluorescence PCR detection of plasmid templates of various gradients are shown in Table 3 below:

[0118] Table 3. Ct values ​​of real-time fluorescence PCR detection for each gradient plasmid template.

[0119]

[0120] The test results are as follows Figure 1 , Figure 6 As shown in Table 3, the key parameters of the standard curve obtained through linear regression analysis are: slope -3.227, intercept 37.319, and correlation coefficient R. 2 =0.998, amplification efficiency of 104.102%, standard error of 0.036, and limit of detection (LOD) of 5 copies / μL. This indicates that the method of this invention is effective within the range of 5 copies / μL to 5 × 10⁻⁶. 7 It exhibits excellent linearity and amplification efficiency within the copy / μL range, with accurate and reliable quantification and high sensitivity.

[0121] Example 4:

[0122] Specificity verification:

[0123] Test strains: Common foodborne pathogens, enteropathogenic bacteria, and Staphylococcus spp. strains were selected for specificity verification, including:

[0124] Salmonella Typhimurium (ATCC50115); Shigella sonnei (ATCC5133); Shigella flexneri (ATCC12022); Vibrio parahaemolyticus (ATCC17802); Vibrio vulnificus (ATCC27526); Escherichia coli (ATCC44102); Enteroaggregative Escherichia coli (EAEC) (CICC21530); Enteropathogenic Escherichia coli (EPEC) (CICC24189); Enterotoxigenic Escherichia coli (ETEC) (CICC10667); Enterotoxigenic Escherichia coli (ETEC) (laboratory strain, stp gene positive); Enteroinvasive Escherichia coli (EIEC) (CICC10662); Enterohemorrhagic Escherichia coli (EHEC) (CICC24187); Staphylococcus aureus (ATCC26003, standard strain); Vibrio cholerae (Inaba type, provided by Zhejiang Provincial Center for Disease Control and Prevention); Campylobacter jejuni (laboratory isolation and preservation); Listeria monocytogenes (laboratory isolation and preservation). The Campylobacter jejuni and Listeria monocytogenes mentioned above are both laboratory strains, not standard strains.

[0125] Test method:

[0126] (1) Take pure cultures of the above strains and extract genomic nucleic acids by boiling.

[0127] (2) Real-time fluorescence PCR detection was performed using specific protein reagent No. 2, according to the established 25 μL reaction system and 55℃ annealing fluorescence acquisition amplification conditions.

[0128] (3) For each batch of experiments, a positive control (containing the target recombinant plasmid) and a negative control (water without nuclease) were set up as references for result judgment.

[0129] (4) Record the changes in fluorescence signal in real time, observe the shape of the amplification curve, read the Ct value, and determine whether the kit can perform non-specific cross-amplification on non-target strains.

[0130] Experimental results:

[0131] like Figure 3 As shown, only the Staphylococcus aureus standard strain ATCC26003 exhibited a typical and complete S-type amplification curve, with a valid Ct value, and the test result was positive. The 15 non-target strains / nucleic acid samples, including Salmonella typhimurium, Shigella sonnei, Shigella flexneri, Vibrio parahaemolyticus, Vibrio vulnificus, various pathogenic subtypes of Escherichia coli, Vibrio cholerae, Campylobacter jejuni, and Listeria monocytogenes, showed no significant increase in fluorescence signal, no amplification curve, and no Ct value, and the test results were all negative.

[0132] Experiments have fully demonstrated that the detection kit based on the Staphylococcus aureus specific protein target gene of this invention has strong interspecies specificity and no cross-reaction with common foodborne pathogens, enteropathogenic bacteria, and Gram-positive / negative bacteria. It can effectively avoid false positives caused by interference from non-target bacteria, and the detection results are accurate and reliable.

[0133] Example 5:

[0134] Repeatability test:

[0135] Experimental materials:

[0136] Staphylococcus aureus standard strain ATCC26003, TSB broth, 0.5 McFarland tubes, nuclease-free water.

[0137] Test method:

[0138] (1) Culture of strain: Staphylococcus aureus ATCC26003 was inoculated into a suitable culture medium and cultured at 36℃ for 24h to obtain a fresh pure culture.

[0139] (2) Preparation of bacterial culture: Select a typical single colony and inoculate it into TSB broth. Shake well to mix thoroughly. Adjust the turbidity of the bacterial culture using a 0.5 McFarland turbidity tube to achieve a bacterial concentration of 1×10⁻⁶. 8 ~2×10 8 CFU / mL.

[0140] (3) Nucleic acid extraction: Take 1 mL of the above bacterial solution and use the boiling method to quickly extract the genomic nucleic acid of the strain. After centrifugation, take the supernatant as the nucleic acid template.

[0141] (4) Serial dilution: The extracted nucleic acid template was serially diluted 10-fold with nucleic acid dilution buffer to prepare 10-fold serial dilutions. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 Gradient dilution buffer was used as the template for testing.

[0142] (5) PCR amplification: Real-time fluorescence PCR detection was performed using specific protein No. 2 reagent, with a reaction system of 25 μL and fluorescence acquisition conditions of 55℃.

[0143] Each dilution was replicated in triplicate, and the Ct values ​​for each group were recorded. The coefficient of variation (CV%) of the Ct values ​​was calculated, and the intra-batch repeatability of the method was evaluated using CV%.

[0144] The test results are as follows Figure 2 As shown in Table 4:

[0145] Table 4 Results of Repeatability Experiments

[0146]

[0147] From the results in Table 4, 10 -6 and 10 -7 The nucleic acid concentration at the dilution was too low, resulting in no effective Ct value; all effective gradients (10) -5 ~10 -1 The CV% of all samples were less than 0.6%, which is far below the acceptable range of variation for molecular detection methods. This indicates that the specific protein reagent No. 2 and the fluorescent PCR detection method used in this invention have excellent intra-batch repeatability, stable amplification, and reliable results, and can meet the requirements for accuracy and reproducibility in actual detection.

[0148] Example 6:

[0149] Stability study of the reagent kit:

[0150] To determine the effective shelf life of the kit under different storage conditions, stability studies were conducted on the dry powder and liquid components of the kit, providing experimental basis for the storage, transportation, and shelf life setting of the kit.

[0151] Examination criteria:

[0152] Based on the actual production and application scenarios of the reagent kit, two typical storage methods were set up for stability evaluation:

[0153] (1) Dry powder storage method:

[0154] Primer-probe mixtures were prepared in lyophilized / dry powder form, sealed, and stored under normal light-protected conditions. They were prepared immediately before use to simulate long-term room temperature / refrigerated storage and transportation scenarios.

[0155] (2) Liquid preservation methods:

[0156] After the primers and probes are dissolved into working solution, they are sealed and stored in the dark at -20℃. The number of repeated freeze-thaw cycles is strictly controlled during the experiment to simulate the normal storage conditions in the laboratory.

[0157] Examination methods:

[0158] (1) Take the dry powder component and liquid component of the same batch of kits and store them for a long time under the set conditions for observation;

[0159] (2) Sampling was performed regularly, and the nucleic acid of the standard strain of Staphylococcus aureus ATCC26003 was used as a template. Fluorescent PCR detection was performed using the specific protein No. 2 reagent of this invention and the predetermined reaction system.

[0160] (3) Record key data such as amplification curve, Ct value, and amplification efficiency, and compare them with the detection results of freshly prepared reagents;

[0161] (4) Continue monitoring until the reagent performance shows a significant decline, and determine the longest effective storage time.

[0162] Observation results:

[0163] (1) Results of dry powder component stability:

[0164] When primers and probes are stored in dry powder / lyophilized form, they are minimally affected by environmental temperature, humidity, and light. The reagent structure is stable and not easily degraded, maintaining excellent amplification performance even after long-term storage. Stability studies have confirmed that the dry powder components have excellent stability and an effective shelf life of over 10 years, making them suitable for long-term storage, long-distance transportation, and emergency stockpiling.

[0165] (2) Results of liquid component stability:

[0166] After the primers and probes are dissolved into liquid, they should be stored at -20℃ in a sealed, light-protected environment to effectively maintain the structural integrity and amplification activity of the primers and probes. During the investigation, the plasmid concentration (5 copies / mL) of the same batch of liquid reagents was measured at different storage periods (1 month, 3 months, 6 months, and 12 months). The Ct values ​​at each time point are shown in Table 5.

[0167] Table 5. Detection results of plasmid concentration (5 copies / mL) at different storage periods for the same batch of reagents.

[0168]

[0169] The results are as follows Figure 4 As shown in Table 5, the Ct value of the liquid reagent fluctuated very little within its 12-month shelf life, with no significant increase, and the amplification curve morphology was consistent with that of the fresh reagent, without any decrease in amplification efficiency or weakening of fluorescence signal. The results indicate that the reagent kit in liquid state has a shelf life of one year. Repeated freeze-thaw cycles during storage can lead to primer and probe degradation or damage to the fluorescent labeling groups, resulting in decreased amplification efficiency, increased Ct value, and weakened fluorescence signal, affecting detection accuracy and sensitivity. Therefore, repeated freeze-thaw cycles should be avoided as much as possible in practical use.

[0170] Conclusion of the investigation:

[0171] The reagent kit of this invention can achieve long-term stable preservation in dry powder form, and has good stability and a clear shelf life in liquid form under standardized storage conditions. It can meet the storage, transportation and use needs of different scenarios such as food testing, cosmetic testing, clinical screening, and disease control monitoring, and has good practicality and promotion value.

[0172] The foregoing has only described certain exemplary embodiments of the present invention by way of illustration. Undoubtedly, those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the foregoing drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A rapid PCR detection kit based on Staphylococcus aureus-specific protein target genes, characterized in that, The kit includes primer pairs and fluorescent probes for amplifying Staphylococcus aureus-specific protein target genes; The upstream primer sequence of the primer pair is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:2; the sequence of the fluorescent probe is shown in SEQ ID NO:

3.

2. The rapid PCR detection kit based on Staphylococcus aureus specific protein target genes according to claim 1, characterized in that, The kit also includes PCR reaction buffer, DNA polymerase, nuclease-free water, a positive control, and a negative control; the positive control is a recombinant plasmid solution containing a Staphylococcus aureus-specific protein target gene fragment; the negative control is nuclease-free water.

3. The rapid PCR detection kit based on Staphylococcus aureus specific protein target genes according to claim 2, characterized in that, The kit also includes an internal control system, which is an internal control gene uidA for fecal samples.

4. The rapid PCR detection kit based on Staphylococcus aureus specific protein target genes according to claim 1, characterized in that, The fluorescent probe is labeled with a fluorescent reporter group Vic at its 5' end and a fluorescent quencher group BHQ1 at its 3' end.

5. A rapid PCR detection method based on Staphylococcus aureus-specific protein target genes, characterized in that, Specifically, the following steps are included: S1. Extract the nucleic acid template from the sample to be tested; S2. Using the nucleic acid template extracted in S1 as a template, and employing the primer pair and fluorescent probe described in claim 1, perform real-time quantitative PCR amplification and collect fluorescence signals. S3. Determine whether Staphylococcus aureus is present in the sample based on the real-time fluorescence PCR amplification curve and Ct value: Presence: S-shaped amplification with Ct value ≤ 35.0; Not present: No amplification or Ct value > 38.

6. The rapid PCR detection method based on Staphylococcus aureus specific protein target genes according to claim 5, characterized in that, The reaction system for real-time quantitative PCR amplification in S2 is as follows: 0.5 μL each of upstream and downstream primers, 0.5 μL of fluorescent probe, 12.5 μL of Premix EX Taq™ RR390A, 6 μL of nuclease-free water, 5 μL of nucleic acid template, and a total volume of 25 μL.

7. The rapid PCR detection method based on Staphylococcus aureus specific protein target genes according to claim 6, characterized in that, The concentrations of both upstream and downstream primers were 10 μmol / L, and the concentration of the fluorescent probe was 5 μmol / L.

8. The rapid PCR detection method based on Staphylococcus aureus specific protein target genes according to claim 6, characterized in that, The reaction procedure for real-time quantitative PCR amplification in S2 is as follows: pre-denaturation at 95℃ for 20s; then 40 cycles of denaturation at 95℃ for 1s, annealing at 55℃~60℃ for 20s, and fluorescence signal acquisition.

9. The rapid PCR detection method based on Staphylococcus aureus specific protein target genes according to claim 5, characterized in that, The sample to be tested in S1 is at least one of the following: fecal sample, pure bacteria, enrichment solution, food sample, cosmetic sample, and clinical sample.

10. The rapid PCR detection method based on Staphylococcus aureus-specific protein target genes according to claim 5, characterized in that, The method yielded negative results for all non-Staphylococcal strains, including Salmonella Typhimurium, Shigella sonnei, Shigella flexneri, Vibrio parahaemolyticus, Vibrio vulnificus, Escherichia coli, Vibrio cholerae, Campylobacter jejuni, and Listeria monocytogenes.

Images