A method for preparing 1,2-phenyl ethylene glycol by using double enzyme pathway normalized catalysis and application

By using a dual-enzyme pathway of E. coli/pveh2G191A/N195Q, E. coli/sfeh3, and E. coli/smeh to catalyze rac-SO, the problems of high cost and poor stereoselectivity in the synthesis of chiral vicinal diols in existing technologies have been solved, and high-efficiency, low-cost preparation of 1,2-phenylethylene glycol with high optical purity has been achieved.

CN122405752APending Publication Date: 2026-07-17ANHUI POLYTECHNIC UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ANHUI POLYTECHNIC UNIV
Filing Date
2026-04-30
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Existing technologies for synthesizing chiral vicinal diols suffer from problems such as high cost, reliance on heavy metal catalysts, numerous byproducts, poor stereoselectivity, and harsh reaction conditions.

Method used

Three genetically engineered bacteria, E. coli/pveh2G191A/N195Q, E. coli/sfeh3, and E. coli/smeh, were used as whole-cell catalysts to catalyze the generation of high-optical-purity (R)-PED or (S)-PED from rac-SO via a dual-enzyme pathway. The complementary hydrolysis was carried out by utilizing the natural properties of epoxidase, thus avoiding the use of immobilized enzymes and expensive cofactors.

Benefits of technology

The method achieves efficient and low-cost preparation of 1,2-phenylethylene glycol with high optical purity, with a total conversion rate of 99.9%, an enantiomeric excess rate of 98%, and a space-time yield of 96%. The reaction conditions are mild and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122405752A_ABST
    Figure CN122405752A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biocatalysis technology and discloses a method and application for the preparation of 1,2-phenylethylene glycol using a dual-enzyme pathway with normalized catalysis. This invention uses racemic epoxide phenylethane as the starting substrate and first utilizes epoxide hydrolase-engineered E. coli / pveh2 cells. G191A / N195Q Alternatively, selective hydrolysis can be performed using E. coli / sfeh3, followed by normalization transformation using E. coli / smeh engineered bacteria expressing SmEH epoxide hydrolase as a catalyst, directly generating high-optical-purity (R)-1,2-phenylethylene glycol or (S)-1,2-phenylethylene glycol. The reaction conditions of this invention are mild, require no expensive cofactors or heavy metal catalysts, and have a substrate utilization rate close to 100%, significantly reducing production costs and environmental pollution.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biocatalysis, specifically relating to a method and application for the preparation of 1,2-phenylethylene glycol using a dual-enzyme pathway with normalized catalysis. Background Technology

[0002] Chiral vicinal diols are a class of high-value synthetic building blocks containing adjacent hydroxyl groups. They can be used as pharmaceutical intermediates and catalyst intermediates, and are widely used in the fields of pharmaceuticals, pesticides, materials synthesis, and fine chemicals. Among them, 1,2-phenylethylene glycol (PED) is a common chiral intermediate that directly participates in the preparation of a variety of highly active drugs (J Biotechnol. 2017, 243: 1-9.).

[0003] (R)-PED is used in the synthesis of β-blockers and is also a chiral synthon for triazole antifungal drugs such as fluconazole and anti-HIV nucleoside analogs. By precisely controlling the stereoconfiguration of the sugar ring or active site, it enhances the targeting and safety of drugs (Environ Pollut. 2016, 214: 787-794.). (S)-PED, on the other hand, can be used to produce pharmaceutical intermediates such as preservatives, cefotaxime, and pemoline, as well as compounds with biological activity, such as KDMSO inhibitors (Enzyme Microb Technol. 2023, 166: 110228.).

[0004] However, existing technologies for synthesizing chiral vicinal diols still face problems such as high cost, reliance on toxic heavy metal catalysts, numerous byproducts, poor stereoselectivity, and harsh reaction conditions. Summary of the Invention

[0005] The purpose of this invention is to provide a method and application for the preparation of 1,2-phenylethylene glycol using a dual-enzyme pathway with normalized catalysis, wherein the method is derived from E. coli / pveh2 G191A / N195Q Alternatively, E. coli / sfeh3 can be used as a catalyst followed by E. coli / smeh to normalize rac-SO (racemic epoxide) to (R)-PED or (S)-PED.

[0006] The present invention also aims to provide the application of the above method in chemical or pharmaceutical production.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] This invention provides a method for preparing 1,2-phenylethylene glycol using a dual-enzyme pathway with normalized catalysis, the preparation method comprising the following steps:

[0009] 1) E. coli / pveh2 engineered bacterial cells containing epoxidase G191A / N195Q E. coli / sfeh3 and E. coli / smeh were cultured separately as whole-cell catalysts. After induction of expression, the bacterial cell pellet was collected by centrifugation and the bacterial cell was resuspended in buffer to obtain a bacterial suspension.

[0010] 2) Take the E. coli / pveh2 obtained in step 1). G191A / N195Q Alternatively, a bacterial suspension of E. coli / sfeh3 can be mixed with racemic phenylene oxide (rac-SO) and reacted. After the reaction is complete, the mixture is centrifuged to obtain the supernatant.

[0011] 3) Mix the E. coli / smeh bacterial suspension obtained in step 1) with the supernatant obtained in step 2) and react them. After the reaction is complete, 1,2-phenylethylene glycol is obtained.

[0012] When step 2) uses E. coli / pveh2 G191A / N195Q When using a bacterial suspension of E. coli / sfeh3 in step 2), the product obtained in step 3) is (R)-1,2-phenylethylene glycol; when using a bacterial suspension of E. coli / sfeh3 in step 2), the product obtained in step 3) is (S)-1,2-phenylethylene glycol.

[0013] In step 1), the epoxidase PvEH2 G191A / N195Q For enzyme A, E. coli / pveh2 G191A / N195Q The first is a genetically engineered bacterium expressing enzyme A, and the nucleotide sequence encoding enzyme A is shown in SEQ ID NO. 1; the second is a genetically engineered bacterium expressing epoxidase SmEH, and the nucleotide sequence encoding SmEH is shown in SEQ ID NO. 3; the third is a genetically engineered bacterium expressing epoxidase SfEH3, and the nucleotide sequence encoding SfEH3 is shown in SEQ ID NO. 5.

[0014] The amino acid sequence of enzyme A is shown in SEQ ID NO. 2.

[0015] The amino acid sequence of the epoxide hydrolase SmEH is shown in SEQ ID NO. 4.

[0016] The amino acid sequence of the epoxide hydrolase SfEH3 is shown in SEQ ID NO. 6.

[0017] In step 1), the concentration of the bacterial suspension is 0.1~0.4 g / mL, and the pH of the buffer solution is 6-10.

[0018] According to a specific embodiment of the present invention, preferably, the buffer solution is a Na2HPO4-NaH2PO4 buffer solution with a pH of 7.0.

[0019] In step 2), the bacterial suspension is mixed with racemic phenyl oxyethane to make the concentration of racemic phenyl oxyethane in the system 30~60 mmol / L.

[0020] In step 2), the reaction temperature is either 25 or 30 °C, the reaction time is 30 to 60 min, and the reaction condition is oscillation.

[0021] In step 3), the reaction temperature is 30 °C, the reaction time is 50 min, and the reaction condition is oscillation.

[0022] This invention provides an application of the above method in chemical or pharmaceutical production.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] (1) This invention uses rac-SO as a starting substrate at a concentration of 40 mmol / L to prepare (R)-PED and (S)-PED. The reaction route is relatively short, and the total conversion rate catalyzed by different dual-enzyme combinations is 99.9%. The enantiomeric excess rate (ee) of the (R)-PED product is also high. p r The space-time productivity (STY) is 98%. r The concentration was 1.84 g·L. -1 ·h -1 The enantiomeric excess of (S)-PED products (ee) p s The space-time productivity (STY) is 96%. s The concentration was 8.12 g·L. -1 ·h -1 This indicates that the yields of products (R)-PED and (S)-PED are at a high level;

[0025] (2) E. coli / pveh2 G191A / N195Q The three whole-cell catalysts, E. coli / sfeh3 and E. coli / smeh, can be used directly without immobilization, simplifying the operation and maintaining enzyme activity.

[0026] (3) This invention relies on the natural properties of epoxidase, which has advantages such as wide availability, mild reaction conditions, and environmental friendliness. Furthermore, the synergistic effect of the two enzymes achieves complementary hydrolysis of rac-SO4, E. coli / pveh2. G191A / N195Q The specific hydrolysis of (S)-SO3, the specific hydrolysis of (R)-SO3 by E. coli / sfeh3, and the efficient conversion of (R)-SO3 and (S)-SO3 by E. coli / smeh ensured the high optical purity of the product.

[0027] (4) In addition, epoxide hydrolase is a cofactor-independent enzyme. The reaction does not require the addition of expensive cofactors or metal catalysts, and the substrate utilization rate is close to 100%, which significantly reduces production costs. Attached Figure Description

[0028] Figure 1 This is a flowchart of the method for the normalized catalytic synthesis of highly optically pure (R)- and (S)-1,2-phenylethylene glycol via a dual-enzyme pathway according to the present invention.

[0029] Figure 2 The effect of different temperatures on PvEH2 in this invention G191A / N195Q The effects of SfEH3 and SmEH enzymes on the catalytic activity of enzymes;

[0030] Figure 3 This is a reaction progress curve for the synthesis of (R)-1,2-phenylethylene glycol in Example 1;

[0031] Figure 4 The reaction progress curve for the synthesis of (S)-1,2-phenylethylene glycol in Example 2 is shown. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0034] The culture medium and phosphate buffer used in the embodiments of the present invention have the following compositions:

[0035] The preparation method for Luria-Bertani (LB) liquid culture medium includes the following steps:

[0036] A mixed solution of peptone, NaCl, and yeast extract was prepared, wherein the concentration of peptone was 10 g / L, the concentration of NaCl was 10 g / L, and the concentration of yeast extract was 5 g / L. The pH of the mixed solution was then adjusted to 7.0 with NaOH, and then sterilized at 121 °C and 103.0 kPa for 20 min to obtain the LB liquid culture medium.

[0037] The preparation method of Na2HPO4-NaH2PO4 buffer solution includes the following steps:

[0038] Weigh and dissolve 17.9 g of Na2HPO4·12H2O and 7.8 g of NaH2PO4·2H2O respectively, add NaOH to adjust the pH of the buffer solution to 7.0 and bring the volume to 1 L to obtain the Na2HPO4-NaH2PO4 buffer solution, and store it at 4 ℃ for later use.

[0039] E. coli / pveh2 used in the embodiments of the present invention G191A / N195Q The method for preparing bacterial cells specifically includes the following steps:

[0040] E. coli / pveh2 G191A / N195Q Single colonies were inoculated into LB liquid medium containing 0.1 mg / mL ampicillin and cultured at 37 °C and 220 r / min for 10 h. Then, they were transferred to LB liquid medium at a 2% (v / v) inoculation rate and cultured with shaking at 37 °C. The colonies were then counted at OD... 600 When the concentration reached 1.0, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mmol / L. After induction at 15 °C for 24 h, the mixture was collected by centrifugation at 4 °C to obtain the E. coli / pveh2. G191A / N195Q Bacterial cells.

[0041] The method for preparing E. coli / sfeh3 cells used in the embodiments of the present invention specifically includes the following steps:

[0042] Single colonies of E. coli / sfeh3 were inoculated into LB liquid medium containing 0.1 mg / mL ampicillin and cultured at 37 °C and 220 r / min for 10 h. Then, they were transferred to fresh LB liquid medium at a 2% (v / v) inoculation rate and cultured with shaking at 37 °C. The colonies were then counted at OD... 600 When the concentration reached 0.8, IPTG was added to a final concentration of 0.2 mmol / L. After induction at 15 °C for 24 h, the cells were collected by centrifugation at 4 °C to obtain the E. coli / sfeh3 cells.

[0043] The method for preparing E. coli / smeh cells used in the embodiments of the present invention specifically includes the following steps:

[0044] Single colonies of *E. coli* / smeh were inoculated into LB liquid medium containing 0.1 mg / mL kanamycin sulfate and cultured at 37 °C and 220 r / min for 12 h. Then, a 2% (v / v) inoculum was transferred to LB liquid medium and cultured at 37 °C with shaking. The OD of the culture medium was measured. 600 When the value reached the optimal combination of 0.6, IPTG was added until the final concentration reached the optimal combination of 0.2 mmol / L. Then, induction was carried out at the induction temperature of 20 °C for 14 h. After induction, the cells were collected by centrifugation at room temperature to obtain the E. coli / smeh cells.

[0045] The E. coli / pveh2 G191A / N195Q To express epoxide hydrolase PvEH2 G191A / N195Q The genetically engineered bacteria encoding enzyme A has the following nucleotide sequence:

[0046] atggaataca tagtacacag aacagtggaa gtcaatggca tcaaaatgca tgttgcagagaaaggagagg gtcctgccgt cttgttcctc catggcttcc ctgaactatg gtacacctgg cgccaccagattcttgatct cagctcccga ggatatcacg cggttgcacc agatctacga ggctacggtg acacagaggcaccagcttcc atgagcagct acagctgctt tgacatagtg ggtgatctgg ttgcgcttat agaccttctgggtgttgatc aagtcttcct tgtggctcat gactggggtg ccatcatagg ttggtacctc tgcatgtttcgccccgacag agtcaaggcc tatgtctgcc tcagtgtgcc tttctggccc agaaacccaa aggtgaagcccgttgatgcc atgcgggccc tatacggaga tgactactat atctgcagat tccaggaggc aggaaaggcagaaggtgagt tagccaaaaa tagcactgaa gaggtattga aaaaacttct gacaaatcgc acacctgggccaccaatctt gcaaaaagaa gcaatgggtt cacagctgaa cacttcaatg ccccttcctt cttggctttcactccaagat ctcaagtact atgcttccaa atttgaaaag acaggcttca ctggaggcct caactactacagaaatatca acttaaattg ggagctcaca gcaccttgga ctggagcaca ggtcaaagtt ccagtgaagttcattactgg tgatttggat tcagtataca cttcactagg gatgaagaac tacatagaga gtggtgctttcaagaaagat gtgccaaatt tggaggaagt tattgtgcag gaaggagttg ctcatttcaa caaccaagaagctgcagaag atgtcagcaatcacatttat gattttatca acaagttctg a, as shown in SEQ ID NO. 1.

[0047] The E. coli / smeh strain is a genetically engineered bacterium expressing the epoxide hydrolase SmEH. The nucleotide sequence encoding SmEH is shown below:

[0048] atgaacgtag aacacattcg tcctttccgt gtagaagtac cacaggacgc tctggatgatctgcgcgatc gcctggcgcg tacgcgttgg ccagagaagg aaaccgtgga tgattgggat caaggtattccgctggccta tgcacgtgaa ctggccacgt actggcgtga cgaatacgat tggcgtcgca ttgaagcgcgtctgaacact tggccgaatt tcctggcaac ggttgacggt ctggacatcc atttcctgca cattcgctctgataacccgg ccgcccgtcc gctggttctg acccacggct ggccgggctc tgtcctggaa ttcctggatgttatcgaacc gctgagcg gactaccacc tggtaattcc gtctctgccg ggtttcggct tctctggcaaaccgactcgc tctggttggg acgtcgaaca gattgcagcc gcgtgggacg cactgatgcg tgctctgggctacgaccgtt atttcgcaca gggtggtgac tggggtagcg cagttacctc cgcgattggt atgcatcacgcaggtcattg cgcgggtatc cacgttaaca tggtgacggg tgcaccgcct cctgaactga tgagcgacctgaccgacgaa gagaaactgt acctggcccg tttcggctgg tatcaggcca aagacaacgg ctacagcacccagcaggcta ctcgtccgca gaccatcggc tatgcactga ccgattctcc ggcgggtcag atggcctggatcgcagaaaa atttcacggt tggaccgatt gtggccacca accgggtggt cagagcatcg gcggtcatccggagcaggcg gtgtccaaag acgcaatgct ggacaccatc agcctgtatt ggctgaccgc gtctgctgcgtcttctgcgc gtctgtactggcacagcttt cgtcagttcg cagccggcga aattgatgtc cctactggctgctccctgtt cccgaacgaa atcatgcgtc tgtcccgccg ctgggcggaa cgtcgttacc gcaacattgtctactggtct gaagcagcac gtggtggtca cttcgccgcc tgggaacagc cggaactgtt tgctgcggaagttcgcgcag ctttcgccca gatggatctg, as shown in SEQ ID NO.3.

[0049] The E. coli / sfeh3 is a genetically engineered bacterium expressing the epoxide hydrolase SfEH3, and the nucleotide sequence encoding SfEH3 is shown below:

[0050] atgcgtgtgg aactcgccga agtggccctg gaggtcgagg acagcggtgg tccgggccccgcggtgctgc tggtgcacgg cttcccggac acccgcgcgt gctggcgccg ccaggtgccc gtgctgaacgcggccgggta ccggacgatc acccccgatc tgcgcgggtt cggcggctcc ggccggccgg ctcggacggctgcctacgca ccgcgccgtt cggcggcgga catggtggag ctgctcgacc ggctgggcgt ggaccgggtgcacctcgtgg gccacgactg ggggtcgggc gtcgtgcagg gcgtggccat ggccgtgccg gaccgggtggcgagcctgtc gctgctgtcc gtgggccacc gtggcgcgct gggcgacggc ggctgggagc agcgcagccgctcctggtac atgctgctgt tccagtacga ggggatcgcc gaggagtggc tgctgcggga cggggccgcgcacctgcgcg agttcctggc cgagcacccg gacgccgggg aggccgtgga gcggctggcg gagccgggcgcgctcaccgc ggcgctggcg gtctaccggg cggggctgcc gccgaaggcg ctgttcgggc cggatgtgccgctcccctcg ctgccgggcc ccgtgctggg gatgtggagc accggggacc gcttcctcac cgaggaggcgatgacgggca cggagaagta cgtggacggc tcctggcgtt acgagcgggt cgagggcgcg gggcactggctgcagctgga ggcgcccgag, as shown in SEQ ID NO. 5.

[0051] The epoxy hydrolase PvEH2 G191A / N195Q has the following amino acid sequence:

[0052] MEYIVHRTVE VNGIKMHVAE KGEGPAVLFL HGFPELWYTW RHQILDLSSR GYHAVAPDLRGYGDTEAPAS MSSYSCFDIV GDLVALIDLL GVDQVFLVAH DWGAIIGWYL CMFRPDRVKA YVCLSVPFWPRNPKVKPVDA MRALYGDDYY ICRFQEAGKA EGELAKNSTE EVLKKLLTNR TPGPPILQKE AMGSQLNTSMPLPSWLSLQD LKYYASKFEK TGFTGGLNYY RNINLNWELT APWTGAQVKV PVKFITGDLD SVYTSLGMKNYIESGAFKKD VPNLEEVIVQ EGVAHFNNQE AAEDVSNHIY DFINKF, as shown in SEQ ID NO.2.

[0053] The amino acid sequence of the epoxide hydrolase SmEH is shown below:

[0054] MNVEHIRPFR VEVPQDALDD RLARTWPEKE TVDWQGPPLA YARELATYWR DEYDRRIEARLNTPNPFATV DGLDIHFLHI RSDNPARPLV LTHGPGSVLE FLDVIEPLSA DYHLVPSLPG FSKPTRSWDVEQIAAWDALM RALGYDRYAQ GGDWSATTSA IGHHAGHCAG IHVNMVTGPP ELMSDLTDEK LYLARFGWYQKNNSYSTQQA TRPQTIGYTS PSPGQMAWIA EKFGWTCGHQ PGGSIGGHPQ AVSKDDMLDT ISLYWLTSASASRLYWHFQF AAGIDVPTGC SLFNEIMRLS RRWAERRNIV YWSARGGHFA AWQPELFAVE VRAAQMD, as shown in SEQ ID NO.4.

[0055] The amino acid sequence of the epoxide hydrolase SfEH3 is shown below:

[0056] MRVELAEVAL EVEDSGGPGP AVLLVHGFPD TRACWRRQVP VLNAAGYRTI TPDLRGFGGSGRPARTAAYA PRRSAADMVE LLDRLGVDRV HLVGHDWGSG VVQGVAMAVP DRVASLSLLS VGHRGALGDGGWEQRSRSWY MLLFQYEGIA EEWLLRDGAA HLREFLAEHP DAGEAVERLA EPGALTAALA VYRAGLPPKALFGPDVPLPS LPGPVLGMWS TGDRFLTEEA MTGTEKYVDG SWRYERVEGA GHWLQLEAPE RVNAALLAFLAEHS as shown in SEQ ID NO.6.

[0057] To determine the optimal temperature for the enzyme-catalyzed reactions produced by the above-mentioned bacterial cells, the following experiments were conducted:

[0058] The obtained E. coli / pveh2 G191A / N195Q Take 1g of each of E. coli / sfeh3 and E. coli / smeh cells and add them to 4 ml of non-denaturing lysis buffer to fully resuspend the cells. Then add 4 mg of lysozyme, mix well, and place on ice for 30 min. After completion, sonicate the cells in an ultrasonic cell disruptor at 300W power for 3.0 s per sonication, with a 5.0 s interval between each sonication, for a total of 30 min. Collect the supernatant to obtain the bacterial lysis supernatant. Take 1 ml of well-mixed 50% BeyoGold His-tag Purification Resin, centrifuge at 6000 r / min for 10 s at 4 ℃ and discard the stock solution. Add 0.5 ml of non-denaturing lysis buffer to the gel and mix well to equilibrate the gel. Centrifuge at 6000 r / min for 10 s at 4 ℃ and discard the liquid. Repeat the equilibration process once more and discard the liquid. Add 4 ml of bacterial lysis supernatant to the solution, and incubate at 4 °C on a horizontal shaker for 60 min with gentle shaking to mix thoroughly. Then pack the solution into a chromatography column. Wash the column 5 times, adding 0.5 ml of non-denaturing wash buffer each time. Elute 6 times, using 0.5 ml of non-denaturing eluent each time. Collect the eluent from each elution in separate centrifuge tubes. The collected eluent is the purified PvEH2. G191A / N195Q Enzyme solutions, epoxidase SfEH3 enzyme solution, and epoxidase SmEH enzyme solution. The non-denaturing lysis buffer, non-denaturing wash buffer, non-denaturing elution buffer, 50% BeyoGold His-tag Purification Resin, and chromatography column were all from Beyotime: His-tag protein purification kit - denaturing formulation.

[0059] Example 1

[0060] A method for preparing (R)-1,2-phenylethylene glycol using a two-enzyme pathway with normalized catalysis specifically includes the following steps:

[0061] 1) Add 0.5 g of E. coli / pveh2 to a 50 mL EP tube. G191A / N195Q The bacterial cells were mixed with 2.5 mL of Na2HPO4-NaH2PO4 buffer by shaking to obtain E. coli / pveh2. G191A / N195Q Bacterial suspension; Add 0.5g of E. coli / smeh cells and 2.5mL of Na2HPO4-NaH2PO4 buffer to a 50mL EP tube and vortex to mix well to obtain E. coli / smeh bacterial suspension;

[0062] 2) E. coli / pveh2 G191A / N195Q The bacterial suspension was preheated at a constant temperature of 25 °C for 5 min, and rac-SO was added to a concentration of 40 mmol / L. The mixture was then reacted at 25 °C and 220 r / min for 40 min, during which time (S)-SO was completely consumed. The E. coli / pveh2 suspension was then removed by centrifugation and filtration. G191A / N195Q Bacterial cells were collected, and the supernatant was obtained.

[0063] 3) Add E. coli / smeh bacterial suspension to the supernatant and react at 30 ℃ and 220 r / min for 50 min to obtain (R)-1,2-phenylethylene glycol.

[0064] Example 2

[0065] A method for preparing (S)-1,2-phenylethylene glycol using a two-enzyme pathway with normalized catalysis specifically includes the following steps:

[0066] The difference between this embodiment and Embodiment 1 is that in step 1), E. coli / pveh2 G191A / N195Q Replace the bacterial cells with E. coli / sfeh3 cells in step 2), and replace E. coli / pveh2 cells in step 2). G191A / N195Q The bacterial suspension was replaced with E. coli / sfeh3 bacterial suspension, and the resulting product was (S)-1,2-phenylethylene glycol.

[0067] Determining the temperature of enzyme-catalyzed reactions:

[0068] The purified epoxidase PvEH2 G191A / N195QThe enzyme solution, epoxidase SfEH3 enzyme solution, and epoxidase SmEH enzyme solution were diluted to 20 mg / ml. 800 μL of Na2HPO4-NaH2PO4 buffer was added to each of the enzyme solutions. The solutions were preheated for 5 min at target temperatures of 20, 25, 30, 35, 40, and 45 °C, respectively. While maintaining the temperature, rac-SO was added to make the initial concentration of rac-SO 20 mmol / L. After shaking and mixing, the reaction was carried out for 10 min.

[0069] After the reaction, the enzyme activity at each temperature point was determined by gas chromatography, with the highest activity taken as 100%. A temperature-relative enzyme activity curve was plotted, and the temperature corresponding to the peak of the curve was the optimal reaction temperature. Figure 2 As shown in the figure, analysis reveals that when the reaction temperature is 25 °C, PvEH2 G191A / N195Q The relative enzyme activity of SfEH reached 100% at a reaction temperature of 30 ℃; the relative enzyme activity of SmEH reached 100% at a reaction temperature of 30 ℃.

[0070] Gas chromatography analysis:

[0071] The test method was as follows: 200 μL of 1,2-phenylethylene glycol prepared in Examples 1 and 2 was sampled at regular intervals, and 800 μL of ethyl acetate containing 1 mmol / L n-hexanol as an internal standard was added and extracted. The supernatant was collected by centrifugation, and 0.35 g of anhydrous magnesium sulfate was added and dried for gas chromatography analysis. The chiral gas chromatography analysis method was as follows: injection port temperature 250 ℃; flame ionization detector, temperature 300 ℃; initial column temperature 100 ℃, increased to 195 ℃ at a rate of 4 ℃ / min; carrier gas was nitrogen, flow rate 3.0 mL / min; split ratio 1:40; the gas chromatograph used was an Agilent 8860 GC System, and the column was an Agilent Technologies CYCLOSIL-B chiral capillary column, catalog number: 112-6632, 30 m × 0.250 mm × 0.25 μm.

[0072] Figure 3 and Figure 4 The reaction process curves for Examples 1 and 2 are shown below. Figure 3 As shown, the overall conversion rate of rac-SO reached 99.9%, and the ee of the product (R)-PED was [missing information]. p r 98%, STY r It is 1.84 g·L -1 ·h -1 ;like Figure 4The total conversion rate of rac-SO shown is 99.9%, and the ee of the product (S)-PED is... p s 96%, STY s It is 8.12 g·L -1 ·h -1 .

[0073] It should be noted that the above embodiments are merely some preferred embodiments of the present invention, and not all embodiments. Obviously, based on the above embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0074] The above description of the embodiments is intended to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A method for preparing 1,2-phenylethylene glycol using a dual-enzyme pathway with normalized catalysis, characterized in that, The preparation method includes the following steps: 1) E. coli / pveh2 engineered bacterial cells containing epoxidase G191A / N195Q E. coli / sfeh3 and E. coli / smeh were cultured separately as whole-cell catalysts. After induction of expression, the bacterial cell pellet was collected by centrifugation and the bacterial cell was resuspended in buffer to obtain a bacterial suspension. 2) Take the E. coli / pveh2 obtained in step 1). G191A / N195Q Alternatively, a bacterial suspension of E. coli / sfeh3 can be mixed with racemic phenylene oxide and reacted. After the reaction is complete, the mixture is centrifuged to obtain the supernatant. 3) Mix the E. coli / smeh bacterial suspension obtained in step 1) with the supernatant obtained in step 2) and react them. After the reaction is complete, 1,2-phenylethylene glycol is obtained. When step 2) uses E. coli / pveh2 G191A / N195Q When using a bacterial suspension of E. coli / sfeh3 in step 2), the product obtained in step 3) is (R)-1,2-phenylethylene glycol; when using a bacterial suspension of E. coli / sfeh3 in step 2), the product obtained in step 3) is (S)-1,2-phenylethylene glycol.

2. The method according to claim 1, characterized in that, In step 1), the epoxidase PvEH2 G191A / N195Q For enzyme A, E. coli / pveh2 G191A / N195Q The first is a genetically engineered bacterium expressing enzyme A, and the nucleotide sequence encoding enzyme A is shown in SEQ ID NO. 1; the second is a genetically engineered bacterium expressing epoxidase SmEH, and the nucleotide sequence encoding SmEH is shown in SEQ ID NO. 3; the third is a genetically engineered bacterium expressing epoxidase SfEH3, and the nucleotide sequence encoding SfEH3 is shown in SEQ ID NO.

5.

3. The method according to claim 2, characterized in that, The amino acid sequence of enzyme A is shown in SEQ ID NO.

2.

4. The method according to claim 2, characterized in that, The amino acid sequence of the epoxide hydrolase SmEH is shown in SEQ ID NO.

4.

5. The method according to claim 2, characterized in that, The amino acid sequence of the epoxide hydrolase SfEH3 is shown in SEQ ID NO.

6.

6. The method according to claim 1, characterized in that, The concentration of the bacterial suspension is 0.1~0.4 g / mL, and the pH of the buffer solution is 6-10.

7. The method according to claim 1, characterized in that, In step 2), the bacterial suspension is mixed with racemic phenyl oxyethane to make the concentration of racemic phenyl oxyethane in the system 30~60 mmol / L.

8. The method according to claim 1, characterized in that, In step 2), the reaction temperature is either 25 or 30°C, the reaction time is 30 to 60 minutes, and the reaction condition is oscillation.

9. The method according to claim 1, characterized in that, In step 3), the reaction temperature is 30 °C, the reaction time is 50 min, and the reaction condition is oscillation.

10. The application of the method as described in claim 1 in chemical or pharmaceutical production.