Use of expression agonist of lncrna morrbid in preparation of medicine for delaying heart failure and pharmaceutical composition
By using mouse models of myocardial fibroblasts that specifically overexpress or knock out lncRNA Morrbid, we clarified its protective effect in heart failure. We then used an expression agonist of lncRNA Morrbid to prepare a drug, which solved the problem of limited efficacy in the treatment of heart failure and achieved improvement in cardiac function and inhibition of fibrosis.
Patent Information
- Application Number
- CN202610742013.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-27
- Publication Date
- 2026-07-24
Smart Images

Figure CN122440658A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to lncRNA. Morrbid The application of expression agonists in the preparation of drugs for delaying heart failure and pharmaceutical compositions. Background Technology
[0002] Heart failure (HF) is the end stage of many cardiovascular diseases, characterized by ventricular remodeling, myocardial fibrosis, and progressive decline in cardiac function. Although various drugs are available to improve the prognosis of HF patients, limitations in efficacy and significant individual variability persist, resulting in a persistently high five-year mortality rate. Therefore, exploring novel molecular targets is crucial for early intervention and precision treatment of HF.
[0003] In recent years, long non-coding RNAs (lncRNAs), a class of RNAs longer than 200 nucleotides, have gradually attracted attention for their role in cardiovascular diseases. lncRNAs participate in processes such as myocardial hypertrophy, fibrosis, and inflammatory responses by regulating gene transcription, epigenetic modifications, and signaling pathways.
[0004] Morrbid Myeloid RNA regulator of Bim-induced death is a lncRNA abundantly expressed in myeloid cells, and studies have shown that it plays an important role in regulating apoptosis and inflammatory responses. However, current understanding of lncRNAs... Morrbid Its role and mechanism in heart failure remain unclear, especially its function in the activation of myocardial fibroblasts and myocardial fibrosis, which still lacks systematic research.
[0005] Therefore, the lncRNA is clearly identified. Morrbid Understanding its role in heart failure and exploring its underlying molecular mechanisms is of great significance for developing new treatment strategies. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides lncRNA. Morrbid The application of expression agonists in the preparation of drugs for delaying heart failure and pharmaceutical compositions.
[0007] lncRNA Morrbid The application of expression agonists in the preparation of drugs for delaying heart failure.
[0008] This invention discovers lncRNA MorrbidIts expression was significantly upregulated in the myocardial tissue of mice with heart failure; lncRNA was specifically overexpressed in myocardial fibroblasts. Morrbid It can significantly improve cardiac function in mice with heart failure, inhibit myocardial hypertrophy and fibrosis, and reduce cardiomyocyte apoptosis; conversely, it can specifically knock out lncRNAs in myocardial fibroblasts. Morrbid This significantly exacerbates the heart failure phenotype, manifested as further deterioration of cardiac function and increased ventricular remodeling; therefore, lncRNA was proposed. Morrbid The application of expression agonists in the preparation of drugs for delaying heart failure is noteworthy. It is important to note that detecting upregulation of a gene expression under pathological conditions does not equate to that gene having a pathogenic effect; conversely, many endogenous protective molecules are expressed at higher levels under stress, but further overexpression can still enhance protection, while inhibition will aggravate damage. Therefore, this invention clarifies... Morrbid The relationship between changes in expression and functional effects in heart failure.
[0009] Preferably, the lncRNA Morrbid Sourced from human sources Morrbid Genes and their mammalian homologs.
[0010] Preferably, the mammalian homolog includes the mouse. Morrbid rats Morrbid .
[0011] Derived from mice Morrbid lncRNA of genes Morrbid
[0012] Preferably, the drug is used to improve cardiac function deterioration caused by heart failure, inhibit myocardial hypertrophy and fibrosis, and reduce myocardial cell apoptosis.
[0013] Preferably, the expression agonist comprises a lncRNA carrier. Morrbid Viral vectors.
[0014] Preferably, the viral vector is selected from adeno-associated virus.
[0015] Preferably, the adeno-associated virus serotype is AAV9 and carries the cardiomyocyte-fibroblast-specific promoter postn.
[0016] A pharmaceutical composition for delaying heart failure, comprising a therapeutically effective amount of the expressed agonist, and pharmaceutically acceptable excipients.
[0017] Preferably, the dosage form of the pharmaceutical composition is an injection or a lyophilized powder for injection.
[0018] The lncRNA Morrbid Application of drug targets in screening drugs for delaying heart failure.
[0019] This invention, through the construction of an animal model of heart failure induced by stress overload and the combination of myocardial fibroblast-specific overexpression and knockout techniques, has for the first time discovered lncRNA. Morrbid Its expression was significantly upregulated in the myocardial tissue of mice with heart failure; lncRNA was specifically overexpressed in myocardial fibroblasts. Morrbid It can significantly improve cardiac function in mice with heart failure, inhibit myocardial hypertrophy and fibrosis, and reduce cardiomyocyte apoptosis; conversely, it can specifically knock out lncRNAs in myocardial fibroblasts. Morrbid This significantly exacerbates the heart failure phenotype, manifested as further deterioration of cardiac function and increased ventricular remodeling. The above evidence, both positive and negative, fully demonstrates the role of lncRNA. Morrbid LncRNA plays a crucial protective role in delaying heart failure; transcriptome sequencing analysis suggests its role. Morrbid It may participate in the above process by regulating the AMPK signaling pathway. It should be noted that this invention detected [the virus] in a heart failure model. Morrbid Increased expression levels, along with overexpression Morrbid It can improve cardiac function, while knockout worsens heart failure. This phenomenon can be reasonably explained from a pathophysiological perspective as: heart failure-induced... Morrbid Upregulation is an endogenous compensatory protective response with limited compensatory capacity; exogenous overexpression enhances this compensatory pathway and therefore has therapeutic value. The above two opposing pieces of evidence are not contradictory but rather mutually reinforcing.
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is the first to clearly define lncRNA Morrbid Its protective effect in heart failure has been demonstrated; it has been shown to significantly inhibit the activation of myocardial fibroblasts and collagen deposition; it has been revealed that it participates in the regulation of key fibrosis and inflammatory signaling pathways; it provides a new molecular intervention target for heart failure and has potential clinical application value. Attached Figure Description
[0021] Figure 1 This image shows the expression changes of lncRNA Morrbid in the myocardial tissue of mice with heart failure and the model validation. A is a schematic diagram of aortic coarctation (TAC) surgery, showing a 27G needle placed parallel to the aortic arch for ligation to establish a pressure overload-induced heart failure model. B shows aortic ultrasound, blood flow, and spectral ultrasound. C shows the echocardiographic EF statistics of the Sham group (sham surgery group) and the TAC group; D shows the echocardiographic FS statistics of the Sham group (sham surgery group) and the TAC group; E shows the relative expression levels of lncRNA Morrbid in the myocardial tissue of mice in the Sham group and the TAC model group detected by real-time quantitative PCR, indicating the expression of Morrbid in heart failure. Morrbid Upregulation of expression (endogenous compensatory response).
[0022] Figure 2 This is a schematic diagram of the recombinant plasmid.
[0023] Figure 3 lncRNA specifically overexpressed in cardiomyocytes Morrbid The figure shows the effect on cardiac function in mice with heart failure. In the figure, A is a representative M-mode echocardiogram of each group; BC is the statistical result of echocardiogram, showing the quantitative comparison of EF and FS of mice in each group.
[0024] Figure 4 lncRNA specifically overexpressed in cardiomyocytes Morrbid The diagram shows the effect of heart weight on myocardial hypertrophy in mice with heart failure. In this diagram, A is a gross photograph of the heart, showing the morphology of the heart in each group of mice; B is a statistical graph of heart weight / body weight ratio (HW / BW), showing the quantitative comparison of the four groups of mice; and C is a statistical graph of heart weight / tibia length ratio (HW / TL), showing the quantitative comparison of the four groups of mice.
[0025] Figure 5 lncRNA specifically overexpressed in cardiomyocytes Morrbid The image shows the effects of Masson staining and Sirius red staining on myocardial fibrosis and related gene expression in mice with heart failure. A represents representative images of myocardial interstitial fibrosis detected by Masson staining and Sirius red staining; B represents the detection of lncRNA in myocardial tissue by real-time quantitative PCR.Morrbid Statistical graph of expression levels; C represents the expression level detected by real-time quantitative PCR in myocardial tissue. Ccn2 Statistical graph of expression levels; D represents collagen in myocardial tissue detected by real-time quantitative PCR. Col3a1 Statistical graph of expression levels; E represents the expression level detected by real-time quantitative PCR in myocardial tissue. [[ID= Statistical charts representing levels of expression.
[0026] For some fibroblasts specific Genotyping results of knockout mice, where A represents... PCR identification results of the flox allele 3'loxP site: 261 bp is wild type, 347 bp is flox allele; B is... PCR identification results of the 5'loxP site of the flox allele: 206 bp is wild type; 291 bp is flox allele; CD is the PCR identification results of the Col1a2-Cre gene: 410 bp is wild type; 454 bp is Cre mutant; the simultaneous appearance of 410 bp and 454 bp indicates heterozygote; 1-23 in AD refers to the mouse numbers 1-23.
[0027] Knockout lncRNA specifically for cardiomyocytes The graph shows the effect of echocardiography on cardiac function in mice with heart failure. In the graph, A is a representative image of M-mode echocardiography; B is a statistical graph of echocardiographic detection of EF; C is a statistical graph of echocardiographic detection of FS; and D is a statistical graph of echocardiographic detection of LVIDd.
[0028] Knockout lncRNA specifically for cardiomyocytes The effects of heart weight on gross morphology and weight index in mice with heart failure are shown in the figure. A shows gross photographs of the heart, displaying the morphology of the heart in each group of mice; B is a statistical graph of heart weight / body weight ratio (HW / BW); and C is a statistical graph of heart weight / tibia length ratio (HW / TL).
[0029] Knockout lncRNA specifically for cardiomyocytes The effects of these staining methods on myocardial fibrosis and related protein expression in mice with heart failure are shown in the following figures: A) Representative images of myocardial interstitial fibrosis detected by Masson staining and Sirius red staining; B) Statistical graph of the percentage of fibrotic area calculated by Masson staining in the hearts of mice in each group; C) Statistical graph of the percentage of fibrotic area calculated by Sirius red staining in the hearts of mice in each group; D) Representative images of the expression of Col3a1, α-Sma, and Ccn2 proteins in the hearts of mice in each group; E) Statistical graph of the relative expression level of α-Sma protein in the hearts of mice in each group; F) Statistical graph of the relative expression level of Ccn2 protein in the hearts of mice in each group; and G) Statistical graph of the relative expression level of Col3a1 protein in the hearts of mice in each group. Detailed Implementation
[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.
[0031] Example 1: Establishment and validation of an animal model of heart failure Experimental animals: Male C57BL / 6J mice, aged 8-10 weeks and weighing 24-26g, were purchased from Chengdu Yaokang Biotechnology Co., Ltd. All animal experimental protocols in this invention comply with the relevant provisions of the "Animal Experiment Guidelines of Southwest Medical University" and have been approved by the Experimental Animal Ethics Committee of Southwest Medical University.
[0032] Establishment of a heart failure model: A pressure overload-induced heart failure model was established using transverse aortic constriction (TAC). Mice were anesthetized with isoflurane (induction concentration 3%-4%, maintenance concentration 1.5%-2%) and fixed in a supine position. A longitudinal incision of approximately 0.5 cm was made along the suprasternal notch. After splitting the manubrium of the sternum, the anterior tracheal muscles were bluntly dissected, and the thymus was dissected to expose the aortic arch. The transverse aortic arch was dissected between the right brachiocephalic trunk and the left common carotid artery. A 27G needle was placed parallel above the aorta, and ligated with 6-0 nylon sutures around the aorta and the needle. The suture was then quickly removed, creating a fixed stenosis. A). The muscles and skin were sutured layer by layer. The sham surgery group underwent the same procedure as the TAC surgery, except that the aortic arch was not ligated. Patients were fed for 12 weeks post-surgery until the end of the observation period.
[0033] Model validation: Twelve weeks post-surgery, echocardiography was used to assess the aortic arch and blood flow velocity at the constricted area, while cardiac function was monitored to evaluate the success of model construction. Compared to the sham-operated group, the TAC-operated mice showed significant aortic arch constriction and significantly increased blood flow velocity. B); Left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) decreased significantly ( The CD indicates that the heart failure model has been successfully constructed.
[0034] lncRNA Expression detection: RNA was extracted from myocardial tissue of mice in the sham-operated group and TAC model group, and lncRNA was detected by real-time quantitative PCR. The expression level. The results showed ( E), compared with the sham-operated group, lncRNA in the myocardial tissue of TAC-induced heart failure mice The expression level was significantly upregulated ( E), suggesting that it may be involved in the pathological process of heart failure.
[0035] This upward trend does not contradict the results of overexpression protection and knockout aggravation in subsequent functional experiments of this invention (Examples 3-5, 7-9). A reasonable explanation is that during heart failure... The elevated expression of [a specific substance] is an endogenous compensatory protective response of the body—the heart attempts to respond by upregulating [a specific substance] under stress overload. While endogenous overexpression can limit damage, its increase is insufficient to completely counteract the pathological process; exogenous overexpression further enhances this protective effect, while knockout disrupts the compensatory balance and worsens the condition. Therefore, in a disease state... Upregulation and overexpression protection are logically consistent and jointly support As an endogenous protective factor.
[0036] Example 2: Cardiac fibroblast-specific lncRNAs Construction and validation of adeno-associated virus overexpression 1. Vector selection and target gene information This invention employs an adeno-associated virus vector system driven by the cardiomyocyte-fibroblast-specific promoter postn. An overexpression plasmid pAAV-postn- was constructed. (Constructed by Hanheng Biotechnology (Shanghai) Co., Ltd., see...) The Morrbid gene has a postn promoter, enabling its specific expression in cardiomyocytes. The target gene is a mouse lncRNA. Its full-length nucleotide sequence is shown in SEQ ID NO.1. The target fragment was obtained by PCR amplification, and the primers were designed as follows:
[0037] AAV-m-Morrbid-F: CAGATCTCTTCCTGGACGGAGGGATCCGAGTCAGCACGAGTCATCTG, denoted as SEQ ID NO.2; AAV-m-Morrbid-R: TATCGATAAGCTTGATATCGAATTCAAGATTTATTTATTTATTTATTG, denoted as SEQ ID NO.3.
[0038] Sequencing confirmed that the amplified fragment sequence was completely identical to the target sequence.
[0039] 2. Construction and Validation of Recombinant Plasmids lncRNA obtained by PCR amplification After double digestion of the target fragment, it was ligated into the linearly digested PHBAAV-postn-MCS-null vector (abbreviated as pAAV-postn-Control, purchased from Hanheng Biotechnology (Shanghai) Co., Ltd., with the company's catalog number HH20250806CDNWH-AAV01, batch number 108101414, and titer of 2.2 × 10⁻⁶) using the HB infusion™ one-step cloning method. 12 Transform DH5α competent cells with a solution of (vg / mL), plate them on ampicillin-resistant plates, and incubate at 37°C for 12-16 hours. Select single clones for colony PCR identification, and sequence positive clones.
[0040] The sequencing results were consistent with the target sequence, indicating that the recombinant plasmid pAAV-postn- Successfully built ( Simultaneously, an empty vector pAAV-postn-Control was constructed as a negative control.
[0041] 3. Virus packaging and purification Using a three-plasmid adeno-associated virus packaging system (Hanheng Biotechnology Shanghai Co., Ltd.), the recombinant plasmid pAAV-postn- AAV-293 cells were co-transfected with the empty vector pAAV-postn-Control, helper plasmid pAAV-RC, and pHelper in a ratio of 10 μg:10 μg:20 μg using Lipofiter™ transfection reagent. Cells were collected 72 hours after transfection, and residual nucleic acids were removed by repeated freeze-thaw lysis and treatment with totipotent nucleases. High-purity adeno-associated virus (AAV) was obtained using column purification. Recombinant AAV-9 serotype was obtained and named AAV9- (Overexpression group) and AAV9-postn-Control (negative control group).
[0042] 4. Virus titer detection Viral titers were detected using real-time quantitative PCR. Primers on the WPRE or ITR regions (as shown in Table 1) were used. The purified viral samples were digested with DNase I and proteinase K and used as templates. The samples were then subjected to qPCR reactions with standards of known copy numbers. The viral genome copy number was calculated based on the standard curve.
[0043] The titer test results showed: AAV9-control: 2.2 × 10⁻⁶ 12 vg / mL; AAV9- 1.9×10 12 vg / mL. The above viral titer meets the requirements for in vivo experiments.
[0044] Table 1: Primer sequences 5. Method of virus injection Two weeks prior to TAC, the aforementioned viral suspension was injected into mice via tail vein injection, with each mouse receiving an injection volume of 100 μL (containing approximately 1 × 10⁶ viral particles). 11 (vg). The AAV9 serotype exhibits high affinity for myocardial tissue and can be effectively transduced into cardiac tissue after tail vein injection. Patients continued feeding for 12 weeks after TAC surgery were then further tested. Real-time quantitative PCR was used to verify lncRNA in myocardial fibroblasts. The level of expression.
[0045] The results showed AAV9- lncRNA in cardiac fibroblasts of injected mice The expression level was significantly upregulated compared to the control group. B)(P<0.01) indicates that the overexpression effect is good.
[0046] Example 3: Specific overexpression of lncRNA in cardiomyocytes Protective effect on cardiac function in mice with heart failure Echocardiographic examination: Twelve weeks after viral injection, cardiac function in mice of each group was assessed using the Vevo 3100 small animal ultrasound imaging system. The measured parameters included left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS).
[0047] Result: As As shown, 12 weeks after TAC surgery, compared with the AAV9-Control+TAC group, AAV9- The EF and FS of mice in the +TAC group were significantly increased (P<0.01), indicating that myocardial fibroblasts specifically overexpress lncRNA. It can significantly improve cardiac function in mice with heart failure.
[0048] Example 4: Specific overexpression of lncRNA in cardiomyocytes Inhibitory effect on myocardial hypertrophy in mice with heart failure Gross morphology examination: Mice were sacrificed 12 weeks after viral injection and TAC surgery. Heart perfusion was performed, and tissue samples were taken for photographic analysis to understand the gross morphology of the heart. At the same time, the heart weight, mouse body weight, and tibia length were measured, and the heart weight / body weight ratio (HW / BW) and heart weight / tibia length ratio (HW / TL) were calculated.
[0049] Result: As As shown in Figure A, gross morphological observation of the heart further confirms that AAV9- The hearts of the mice in the AAV9-Control + TAC group were significantly smaller than those in the TAC model control group, and more closely resembled the heart morphology of the sham-operated group. Compared with the AAV9-Control + TAC group, the AAV9- +TAC group mice had significantly reduced HW / BW and HW / TL ( BC) indicates that myocardial fibroblasts specifically overexpress lncRNA. It can significantly inhibit myocardial hypertrophy induced by stress overload.
[0050] Example 5: Specific overexpression of lncRNA in cardiomyocytes Inhibitory effect on myocardial fibrosis in mice with heart failure Histological staining: Mice were sacrificed 12 weeks after TAC surgery following viral injection. Heart tissue was embedded in paraffin and sectioned for Masson and Sirius red staining to observe the degree of myocardial interstitial fibrosis.
[0051] Fibrosis-related gene detection: RNA was extracted from myocardial tissue, and the expression levels of collagen-related genes Col3a1, Ccn2, and α-Sma were detected by real-time quantitative PCR.
[0052] Result: As As shown in Figure A, both Masson staining and Sirius red staining indicate that fibroblasts specifically overexpress [the substance / method / indication]. back( (B) In TAC model mice, the deposition area of collagen fibers in the myocardial interstitium was significantly reduced, the collagen arrangement was more loose, and the degree of fibrosis was significantly alleviated. At the molecular level, qRT-PCR detection showed that AAV9- Overexpression was significantly downregulated and The mRNA expression level suggests that the transcriptional activity of fibrosis-related genes is suppressed. CE). This indicates that myocardial fibroblasts specifically overexpress lncRNA. It can significantly inhibit stress overload-induced myocardial fibrosis.
[0053] Example 6: Cardiac fibroblast-specific lncRNAs Knockout mice ( cKO Construction and identification of ) Knockout mouse construction: This invention uses the Cre-LoxP system to construct cardiomyocyte-specific knockout mice. Knockout mice ( cKO First, Beijing Biocytogen Biotechnology Co., Ltd. was commissioned to use CRISPR / Cas9 technology in C57BL / 6J background mice. By inserting loxP sites at both ends of the locus, the following was obtained: flox / flox Mouse, fluxed area coverage The key exons of the gene can be knocked out by Cre recombinase. flox / flox Mice were crossed with transgenic mice containing fibroblast-specific Cre recombinase, Col1a2-iCre (purchased from Cyagen Biosciences). Through a complex hybridization and propagation strategy, fibroblast-specific Cre recombinase was ultimately obtained. Knockout mice, genotype Col1a2-iCre + / - flox / flox (abbreviation) cKO ), Col1a2-iCre born in the nest - / - flox / flox (abbreviated as) fl / fl ( ) served as a control. All mice were housed in the SPF-grade animal facility of Southwest Medical University under constant temperature (23±1℃) and humidity (40%-50%), with a 12-hour light-dark cycle, and free access to food and water. All experimental protocols were approved by the Experimental Animal Ethics Committee of Southwest Medical University.
[0054] Genotyping using agarose gel electrophoresis: This invention uses Identification of PCR amplification and agarose gel electrophoresis results of flox allele and Col1a2-Cre transgene ( The Cre gene amplification product was measured using a 100 bp DNA marker as the molecular weight standard. Mutant (Cre-positive) mice showed a specific band at 454 bp, Heterozygote mice showed bands at both 454 bp and 410 bp, and Wild type mice showed only a band at 410 bp. CD).
[0055] genotyping of flox mice was performed using PCR amplification and agarose gel electrophoresis targeting the 5'loxP and 3'loxP sites. The DL2000 DNA Marker was used as the molecular weight standard; the wild-type 5'loxP site was 206 bp, and the mutant site was 291 bp. B); the wild-type 3'loxP site is 261 bp, and the mutant site is 347 bp (B). A). Based on the combined genotype results, fibroblasts were successfully screened and obtained. Conditional knockout mice and corresponding control mice provide reliable animal models for subsequent experiments.
[0056] The genotypes of mice 1-23 in AD are shown in Table 2.
[0057] Table 2: List of Genotypes of Mice Nos. 1-23 Example 7: Specific knockout of lncRNA in cardiomyocytes Effects on cardiac function at baseline Establishment of a heart failure model: for 8-10 week old infants cKO Mice and their littermates fl / fl Mice underwent either TAC surgery or sham surgery. They were fed for 12 weeks post-surgery.
[0058] Echocardiography was used to assess cardiac function: Twelve weeks after TAC surgery, cardiac function in mice of each group was assessed using echocardiography. The parameters measured included left ventricular ejection fraction (EF), left ventricular fractional shortening (FS), and left ventricular end-diastolic diameter (LVID;d).
[0059] Result: As As shown, 12 weeks after TAC, compared with fl / fl Compared to the +TAC group cKO The cardiac function of mice in the +TAC group deteriorated further, as evidenced by a significant decrease in EF and FS. BC), LVIDd significantly increased ( D). The above results indicate that cardiomyocyte-specific knockout of lncRNAs... This further exacerbated the deterioration of cardiac function in mice with heart failure.
[0060] Example 8: Specific knockout of lncRNA in cardiomyocytes Effects on myocardial hypertrophy in mice with heart failure Gross morphological observation of the heart: Mice were sacrificed 12 weeks after TAC, and heart tissue was removed for observation and photographic recording of the heart's appearance.
[0061] Heart weight index determination: Weigh the mouse heart weight (HW), body weight (BW), and tibia length (TL), and calculate the heart weight / body weight ratio (HW / BW) and heart weight / tibia length ratio (HW / TL).
[0062] Results: The gross morphology of the heart was as follows As shown in Figure A, in the TAC model... cKO The mouse heart was significantly larger in appearance than fl / fl Mice, indicating knockout This further exacerbates ventricular remodeling. The cardiac mass index results are as follows: As shown in BC: with fl / fl Compared to the +TAC group cKO The HW / BW and HW / TL ratios in the +TAC group mice were significantly increased, further confirming the specific knockout of cardiomyocyte fibroblasts. It aggravated myocardial hypertrophy.
[0063] Example 9: Specific knockout of lncRNA in cardiomyocytes Effects on myocardial fibrosis in mice with heart failure Histological staining: Mice were sacrificed 12 weeks after TAC surgery. Heart tissue was paraffin-embedded and sectioned for Masson staining to observe the degree of myocardial interstitial fibrosis and calculate the collagen volume fraction (collagen-positive area / total field of view). Sirius red staining was also performed to observe collagen deposition in the myocardial tissue and calculate the percentage of fibrosis area.
[0064] Detection of fibrosis-related proteins: Proteins were extracted from myocardial tissue, and the protein expression levels of fibrosis-related molecules Col3a1, α-Sma, and Ccn2 were detected by Western Blot. β-actin was used as an internal control, and the relative expression levels were calculated.
[0065] Results: Masson staining and Sirius red staining results were consistent, showing that... fl / fl Compared to the +TAC group cKO In the +TAC group of mice, there was increased deposition of collagen fibers in the myocardial interstitium, the collagen arrangement was more compact, the degree of fibrosis was significantly aggravated, and the proportion of fibrotic area in myocardial tissue was significantly increased. AC), indicating knockout It promoted the process of myocardial fibrosis. Western blot results showed that... cKO The protein expression levels of collagen molecules α-Sma, Ccn2, and Col3a1 in the myocardial tissue of mice in the +TAC group were significantly higher than those in the +TAC group. fl / fl +TAC group ( DG), consistent with the trend of histological staining results.
[0066] Conclusion: The above results indicate that specific knockout of lncRNA in cardiomyocytes is effective. It can significantly promote myocardial fibrosis in the progression of heart failure and aggravate cardiac dysfunction, further confirming the role of lncRNA from a reverse perspective. It plays a key protective role in slowing the progression of heart failure.
[0067] Based on the above results, a long non-coding RNA (lncRNA) is proposed. Its application in delaying the development of heart failure, especially its role in regulating myocardial remodeling and resisting myocardial fibrosis.
[0068] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0069] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0070] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. lncRNA Morrbid The application of expression agonists in the preparation of drugs for delaying heart failure.
2. The application according to claim 1, characterized in that, The lncRNA Morrbid Sourced from human sources Morrbid Genes and their mammalian homologs.
3. The application according to claim 1, characterized in that, The drug is used to improve cardiac function deterioration caused by heart failure, inhibit myocardial hypertrophy and fibrosis, and reduce myocardial cell apoptosis.
4. The application according to claim 1, characterized in that, The expression agonist includes a lncRNA-carrying agent. Morrbid Viral vectors.
5. The application according to claim 4, characterized in that, The viral vector was selected from adeno-associated virus.
6. The application according to claim 5, characterized in that, The adeno-associated virus serotype is AAV9 and carries the cardiomyocyte-fibroblast-specific promoter postn.
7. A pharmaceutical composition for delaying heart failure, characterized in that, It comprises a therapeutically effective amount of the expression agonist as described in claim 1, and pharmaceutically acceptable excipients.
8. The pharmaceutical composition according to claim 7, characterized in that, The dosage form of the pharmaceutical composition is an injection or a lyophilized powder for injection.
9. The lncRNA in claim 1 Morrbid Application of drug targets in screening drugs for delaying heart failure.