A disease-resistant gene of psa and its use

Abstract

This invention provides a Psa disease resistance gene and its application. Specifically, this invention demonstrates through genetic and molecular experiments that the Psa disease resistance gene is effective against the hardy kiwifruit (Actinidia arguta). Actinidia arguta Wild germplasm Aa11251 containing the G932 protein sequence triggered an immune response upon injection of the HopAO2 effector protein from *Actinidia chinensis*, while materials lacking the G932 protein did not. Transient co-expression experiments on the model plant *Nicotiana benthamiana* showed that co-expression of the resistance protein G932 and the effector protein triggered an HR immune response in the plant. Simultaneously, in *Actinidia chinensis* (Chinese kiwifruit...),... A. chinensis The stable expression of G932 in the transgenic 'Donghong' variety significantly enhances its resistance to pathogens. This indicates that the G932 protein and its encoding gene can be used in agricultural production for the breeding of resistant kiwifruit varieties to bacterial canker. This invention is of great significance for the breeding of disease-resistant kiwifruit varieties and can be used in agricultural production.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a disease resistance gene for Psa and its application. Background Technology

[0002] Pathogenic strain of Actinobacillus syringae in kiwifruit ( Pseudomonas syringae pv. actinidiae , Psa Kiwifruit canker, caused by [unspecified disease], is a devastating disease in global kiwifruit (Actinidia) production, especially in the widely cultivated Chinese kiwifruit (Actinidia chinensis). A. chinensis All varieties are highly susceptible to the disease. Utilizing disease-resistant genes to enhance the disease resistance of kiwifruit is an important means of green control of kiwifruit canker. Currently, there are no effective disease-resistant genes for kiwifruit canker. Kiwifruit originated in China, and my country has abundant wild kiwifruit resources. Extracting disease-resistant materials from wild resources and isolating disease-resistant genes is the most effective way to control kiwifruit canker.

[0003] Kiwi fruit canker, due to its high pathogenicity and extreme difficulty in eradication, has long been referred to as the "cancer" of the kiwi fruit industry. Currently in my country, the control methods for canker mainly rely on chemical and biological control methods, combined with cultivation techniques such as rain-sheltered cultivation. For example, patent CN115974972A discloses an antimicrobial peptide for controlling kiwi fruit canker pathogens, primarily focusing on biological reagents for prevention and control; patent CN110791505A also discloses the kiwi fruit canker resistance gene AcLac35 and its application. Overall, research on canker resistance genes and varieties is still relatively lacking, and there is still significant room for further exploration of kiwi fruit canker resistance genes. Summary of the Invention

[0004] The purpose of this invention is to improve the resistance of kiwifruit to bacterial canker caused by *Pseudomonas syringae*. Nucleotide-binding (NLR) receptors (Leucine-rich Repeat Receptors) are major plant disease resistance proteins. They activate plant resistance after recognizing effector proteins, often accompanied by a hypersensitive response (HR), which inhibits disease occurrence. Based on the phenotype of HR triggered by *Pseudomonas syringae* effector proteins, NLR resistance genes were isolated and identified from wild kiwifruit resources, providing gene resources for kiwifruit disease resistance breeding.

[0005] To achieve the above objectives, this invention provides a kiwifruit canker resistance gene, wherein the gene is a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.1. It is understood that the nucleotide sequence encoding a specific amino acid sequence can vary greatly due to different codons or mutations in non-coding sequences such as introns. Therefore, in this invention, based on the conventional knowledge and understanding of those skilled in the art, the resistance gene or nucleic acid sequence includes all nucleic acid sequences capable of encoding the G932 protein. Furthermore, if the G932 protein mutates but still exhibits resistance, it also belongs to the G932 resistance protein described in this invention. For example, if certain amino acids are missing, added, or replaced with functionally similar amino acids, but the higher-order structure of the original protein is not changed, and thus the function of the protein is not altered, i.e., resistance is maintained, then this mutated protein also belongs to the G932 protein described in this invention.

[0006] Preferably, the disease-resistant gene is a gene in which one or more nucleotides are substituted, deleted, or added to the nucleic acid sequence of the aforementioned nucleic acid molecule, but which still has the function of resisting peptic ulcer disease. Based on common knowledge in the art, individual nucleotide or sequence changes do not affect the function of the gene; therefore, the nucleic acid sequence still belongs to the disease-resistant gene described in this invention.

[0007] Preferably, the nucleic acid sequence of the disease-resistant gene is shown in SEQ ID NO.2. Specifically, in this invention, the sequence actually used is from the hardy kiwifruit.

[0008] The present invention also provides a kiwi fruit canker resistance protein, wherein the resistance protein is a protein with the amino acid sequence shown in SEQ ID NO.1; or, the resistance protein is a protein with one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID NO.1, but still having canker resistance function.

[0009] The present invention also provides the application of the disease resistance gene in the following (1) or (2): (1) Improve the resistance of kiwifruit to peptic ulcer disease; (2) Cultivate kiwi fruit varieties resistant to ulcer disease.

[0010] The disease-resistant gene provided by this invention can be applied to the breeding of kiwifruit varieties resistant to bacterial canker. By transferring the disease-resistant gene into the target variety through transgenic technology, the target variety can trigger a HR immune response in the plant when infected with Psa. Preferably, the kiwifruit is the Chinese kiwifruit 'Donghong' variety.

[0011] As a preferred method, expressing disease-resistant genes in plants can enhance their resistance to bacterial canker or breed kiwifruit varieties resistant to bacterial canker. The G932 gene can also be used as a molecular marker for breeding disease-resistant varieties.

[0012] The present invention also provides a detection composition for detecting resistance to kiwifruit canker, comprising at least one detection reagent capable of specifically recognizing the G932 gene; The detection reagent is selected from one of the following: (a) Primer pair used to amplify the disease resistance gene; (b) A probe that specifically hybridizes with the said disease resistance gene; (c) Antibodies used to specifically recognize the disease-fighting proteins.

[0013] This invention provides a variety of identification and detection reagents for identifying the G932 gene. Specifically, the G932 gene can be identified by amplifying the target object using PCR technology with specific amplification primers. Alternatively, specific nucleic acid probes can be used to identify the target gene through specific binding and signal markers such as fluorescent dyes. Furthermore, antibodies against disease resistance genes can be used to identify the target protein, thereby determining whether the plant has resistance.

[0014] Preferably, the primer pair is as follows: G932_M1-F: CAGTTCACGACACACAGGTTT, G932_M1-R: GCCGTCAGTGCACCAAAAT.

[0015] This invention also provides the application of the G932 gene or protein in identifying kiwifruit resistance to bacterial canker. Specifically, the G932 gene can be used as a molecular marker for identifying bacterial canker resistance, and the G932 protein can be used as an antigenic marker for identifying disease resistance.

[0016] The present invention also provides a kiwifruit cell, a kiwifruit transformant, or a kiwifruit plant, wherein the kiwifruit transformant, kiwifruit cell, or kiwifruit plant contains the aforementioned disease-resistant gene, and the kiwifruit cell, kiwifruit transformant, or kiwifruit plant exhibits resistance to kiwifruit canker disease.

[0017] Preferably, the transformant is kiwifruit callus or regenerated bud containing the disease-resistant gene.

[0018] Preferably, the present invention obtains the kiwifruit cells, kiwifruit transformants, or kiwifruit plants by introducing a recombinant expression vector containing the disease-resistant gene into Agrobacterium, then transforming kiwifruit tissue with Agrobacterium, and finally selecting for resistance.

[0019] The beneficial technical effects of this invention are as follows: 1. This invention provides a kiwifruit canker resistance gene and its application. Specifically, this invention demonstrates through genetic and molecular experiments that wild kiwifruit germplasm containing the G932 protein sequence can trigger an immune response when injected with the canker pathogen effector protein HopAO2, while materials without the G932 protein cannot trigger an HR immune response. In a transient co-expression experiment on the model plant Nicotiana benthamiana, it was found that the co-expression of the resistance protein G932 and the effector protein triggers the plant's HR immune response.

[0020] 2. This invention provides a practical application example: stable transgenic expression of G932 in the Chinese kiwifruit 'Donghong' significantly enhances its resistance to pathogens. This demonstrates that the G932 protein and its encoding gene can be used in agricultural production for the breeding of kiwifruit varieties resistant to bacterial canker. This invention is of great significance for the breeding of disease-resistant kiwifruit varieties and can be used in agricultural production.

[0021] 3. This invention provides a detection reagent for identifying the G932 gene or its protein products. Specifically, the detection reagent may be a specific probe or amplification primer of the G932 gene. It also provides an antibody for identifying the G932 protein, which can detect the resistance of kiwifruit plants with unknown resistance.

[0022] 4. This invention also provides intermediate materials for cultivating ulcer disease-resistant varieties, such as disease-resistant kiwi cells, kiwi callus, and kiwi regenerated teeth, which can cultivate disease-resistant kiwi plants or varieties and have good application prospects. Attached Figure Description

[0023] Figure 1 This is a cloning map of disease resistance genes. A represents the disease resistance gene associated site Chr25B; B represents the significance of the association signal; C represents the disease resistance gene annotation analysis at the associated site, which includes two gene clusters, Cluster 1 and Cluster 2; and D represents the collinearity analysis of the parental disease resistance genes. Blue squares represent genes annotated as encoding NLR, and white squares represent non-NLR genes.

[0024] Figure 2The images show the effect of G932 recognizing the Psa effector protein HopAO2 and enhancing the resistance of kiwifruit to bacterial canker. A shows the Nitrous oxide HR test. Transient expression verified that the resistance gene NLR recognizes HopAO2; after recognition, leaf cells die and turn black; when recognition fails, the normal leaf color is red. The image was taken under UV light 48 hours after injection. B shows the stable transformation of the resistance gene G932 into the variety 'Donghong'. Protein expression detection showed negative results for DH and #N5, and positive results for #N8 and N9. C shows the left side of the leaf vein inoculated with Psa M228 WT, and the right side inoculated with the knockout mutant △. hopAO2 The inoculation concentration was OD=0.0005. Symptoms were observed 5 days after inoculation, and colony counts were performed. Figure 2 Figure D shows the molecular markers amplified in different kiwifruit materials. The target band is 1,000 bp, of which Aa11251 contains the disease resistance gene G932, while AmN4441, DH (Donghong), and HY (Hongyang) do not. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the described embodiments of this invention are within the scope of protection of this invention.

[0026] Example 1: Materials and Methods 1. Experimental Materials Soft-fleshed kiwifruit ( A. arguta Aa11251 (female plant), Black-stamen kiwifruit ( A. melanandra AmN4441 (male plant), all tetraploid; Actinopteryx 'Donghong', diploid; model plant Nicotiana benthamiana ( Nicotiana benthamiana ).

[0027] The sequence of the G932 protein (as shown in SEQ ID NO.1): MAEIAVFHLLANFAPFLQEEVNLLSGVREEIEYIRGEFERMTAFLRVADAMEETDPGIAVWVKQVREAAYDTRDALDMHMLRLGHHQGNGVRGFLRKVFCYIKTIKARHQIASEVKRIKSRLINISEGHQRYSDIYRRQEQGSRPAVAWYDSRGDALLLEEAELVGIKKPKSQLIQWLAEDDPQLKVVSIAGMGGLGKTTLTKKVYDDPIVKKHFQNHAWITVSESFKIEKLLQSMIEQLFEEVKQPIPQGVENMDTNSLKGIINAFLQQKRYVLVLDDVWDIHAWQSFRYAFPNGNCGSRVILTTRKIDLASFSSREYHGKVYNLTPLAPEDSWTLFCRKTFHGNSCPSYLEGLSRDILRRCEGLPLAIVAISGLLSTKEKSVEEWERISRSLGAELEGNEKLTSMGRILSLSFFDLPSNLKLCFLYLSIFPEDYSIDHWRLIRLWVAEGFVDAKDGMTIEEVAQSYLNGLINRSLIQVAERMHDGRIKTYRIHDLWREIIVSKSREQSIATVASERGIVWPKKVRRLSVHQNLDSEQESSCFTHLRSLIVFSSIDSFSILSKVAFLGDDLRLLTLLDFEGTQLETFPNEVVKLCHLRHLSLRRTNLKTIPKSIGNLQNLETLDLKHTHVTELPDEILKLQRLRHLLLYRNDLKLFASSFHYQTGFKAPMGIGSLPSLQKLGSIEANHDNNNSVVLREVGKLTQLRRVRILKLRREDGKVLCSSLEKLKNLRSLLVSAIQEDEIIDLDALSSPPQHLRTLYLVGHLQRLPRWIPSAFNLVRVFLVFSKLRDSDSLRSLQDLPNLATLEIFNAYDGEELCFKAGAFQNLETLWIDLLQELKLVRVEASSMPRLKNLCVVNCKLMEDLPSGIEHLTNLERLQLLDMPYNLISRLRRDLQGGDYWKVSHIPDVVIGGWKDGHWQGSFLSEIRRKKEFSCLYFDLSDCDK >Full-length sequence of G932 (specifically shown in SEQ ID NO.2) >G932_cDNA (as shown in SEQ ID NO.3) 2. Strains and vectors engineered strains Pst D36E ( Pseudomonas syringae pv. tomato (deletion of 36 effectors), Agrobacterium tumefaciens EHA105 is preserved in our laboratory; Kiwi fruit ulcer pathogen Psa M228 was provided by Professor Huang Lili of Northwest A&F University and was developed using homologous recombination. [1] (Schäfer et al., 1994) Construction Psa By knocking out hopAO2, the strain obtained Psa M228 hopAO2 This invention Psa The effector protein HopAO2 was cloned into the empty vectors pCAMBIA1300-35S-Flag and pUCP20tk::HopAO2-HA [2] (Zheng et al., 2022), and transformed into EHA105 and respectively. Pst D36E; The G932 gene was cloned into the empty vector pCAMBIA1300-35S-HA (EV) and transformed into EHA105.

[0028] [1] Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A. Small mobilizable multi-purpose cloning vectors derived from the Escherichiacoli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 1994 Jul 22;145(1):69-73. doi: 10.1016 / 0378-1119(94)90324-7. PMID: 8045426. [2] Zheng, X., Zhou, Z., Gong, Z., Hu, M., Ahn, YJ, Zhang, actinidiae. J Genet Genomics 49,823-832. 3. Test Methods 3.1 Effector protein-triggered HR phenotype identification The effector protein HopAO2 was cloned into the vector pUCP20tk, expressed via its own promoter, and fused with an HA tag. The constructed plasmid was then transformed into strain D36E to obtain strain D36E HopAO2. This strain was injected into the abaxial leaf surface of resistant kiwifruit material, with the empty vector EV transformed from D36E serving as a control. The triggered HR immune response was observed after 24 h.

[0029] 3.2 Correlation Analysis By identifying the effector protein-triggered immune response phenotype, wild-type kiwifruit material Aa11251, which responds to the effector protein HopAO2 (i.e., exhibits an HR response), was screened and hybridized with material AmN4441, which does not respond to the effector protein, to obtain 100 F1 hybrid populations. All F1 hybrids underwent whole-genome next-generation sequencing. The HR phenotype of the F1 hybrid populations was identified, and the phenotypic data were correlated with the genomic data to identify candidate loci; specifically, Chr25B 15.88-22.14 Mb.

[0030] 3.3 Gene Cloning The coding region cDNA of gene G932 was cloned into vector pCAMBIA1300, driven by the 35S promoter, fused with an HA tag, and primers G932-F and G932-R were used to clone the recombinant vector pCAMBIA1300-35S-G932-HA. Additionally, the gene expression vector driven by G932's own promoter, consisting of the first 2055 bp of the start codon and the full-length G932 gDNA, was cloned and constructed into vector pCAMBIA1300 using primers G932-NP-F and G932-R, resulting in the recombinant vector pCAMBIA1300::G932-HA. The primer sequences are as follows: G932-F: CGGGGGACGAGCTCGGTACCATGGCTGAAATTGCGGTG (as shown in SEQ ID NO.4); G932-R: ACATCGTATGGGTAGTCGACTTTGTCACAATCACTTAAATC (as shown in SEQ ID NO.5); G932-NP-F: AAACGACGGCCAGTGAATTCATCTCGAGGATTAGCAATG (as shown in SEQ ID NO.6).

[0031] 3.4 Verification of transient expression of Benedict's smoke The EHA105 strain, expressing HopAO2, G932, and other genes at this site, was co-expressed on *Nicotiana benthamiana*. HopAO2 and G932 co-expression, and HopAO2 co-expression with the empty vector (EV) and other genes at this site served as negative controls. All strains were shaken overnight (200 rpm, 12 h) until the OD value reached approximately 0.8, then collected and resuspended in sterile water. When injecting the above strains into *Nicotiana benthamiana*, the final concentration of each strain was OD=0.5, and two strains were added in a 1:1 ratio and mixed thoroughly before injection.

[0032] 3.5 Identification of Disease Resistance Gene Function The recombinant vector pCAMBIA1300::G932-HA was stably expressed in Donghong kiwifruit via transgenic synthesis. The resulting transgenic kiwifruit material was used in bacterial growth assays to differentiate between wild-type (WT) and blast ulcer disease strain Psa M228. hopAO2 Knockout mutant strains (△ hopAO2 The strain was injected into the leaves of the transgenic material with a concentration of OD=0.0005. The transgenic negative material was used as a control. The samples were placed at 20℃, under 12 hours of light and 12 hours of darkness, with a humidity of 80%. After 5 days of culture, samples were taken for colony counting.

[0033] Example 2: Experimental Results and Analysis 1. Cloning of disease-resistant genes Based on whether HopAO2 triggers human vegetative growth (HR), female plants Aa11251 (which triggers HR) and male plants AmN4441 (which does not trigger HR) were selected as parents for hybridization, resulting in F1 generation, totaling 100 plants. Phenotypic analysis of the F1 plants revealed that 50 plants triggered HR and 50 did not, consistent with single-gene inheritance patterns. Further whole-genome sequencing of the F1 plants and association analysis with phenotypes identified the associated region as the 15.88-22.14 Mb region of Chr25B in the maternal parent Aa11251 material. Figure 1A). From the Q-Q plot, we find ( Figure 1 (B) Under the null hypothesis, the observed The log10(p) value is basically consistent with the theoretical expected value, and the vast majority of the scatter points are distributed along the diagonal, with the tail of the distribution ( The log10(p) > 3 indicates an upward bias, suggesting a significant association signal. Further analysis of the genes within the interval revealed that the segment contains two gene clusters encoding NLR proteins (…). Figure 1 The gene cluster (C) was compared with the parent gene, revealing a greater number of NLRs in Aa11251 Chr25B. Furthermore, the second gene cluster was specifically present in Aa11251, suggesting that the candidate resistance gene recognizing the effector protein HopAO2 resides in this second cluster. To further validate the resistance gene's function, the NLR genes from both clusters were cloned into the pCAMBIA1300-35s-HA vector and transformed into Agrobacterium EHA105 for preservation and functional validation.

[0034] 2. Validation of disease resistance gene function To further confirm the disease resistance gene that recognizes the effector protein HopAO2, the effector protein HopAO2 was cloned into the vector pCAMB1300-35s-Flag and transiently expressed on Nicotiana benthamiana and the NLR strain obtained in the previous step. After 48 hours, it was observed that HopAO2 only produced HR when co-expressed with G932, indicating that G932 recognizes the effector protein HopAO2. Figure 2 To further verify whether G932 activates plant disease resistance after recognizing effector proteins, G932 was stably expressed in the Chinese kiwifruit 'Donghong' (DH), and Psa M228 WT and Psa M228 WT were injected into the same leaf, respectively. Psa hopAO2 Western blot analysis of protein expression in transgenic materials revealed that seedling DH and transgenic negative material #N5, produced from 'Donghong' fruit, served as negative controls; #N8 and #N9 were transgenic positive materials. Disease symptoms were observed 5 days after inoculation of both transgenic positive and negative materials. Figure 2 As shown in B, #N8 and #N9 (repeated experiments) showed greater resistance to Psa M228 WT strains compared to DH and #N5. hopAO2 All showed high susceptibility. Further quantification of symptoms and bacterial growth tests revealed that the colony count of the transgenic positive material Psa M228 WT was significantly lower than that of the negative material. hopAO2The colony counts did not differ significantly and were consistent with the observed symptoms. Figure 2 (C and D). The above results indicate that G932, as a disease resistance gene, specifically recognizes HopAO2 to enhance plant disease resistance.

[0035] To further apply this technology in breeding, we designed molecular markers to assist in breeding detection. The molecular marker primer sequences are G932_M1-F: CAGTTCACGACACACAGGTTT (as shown in SEQ ID NO.7) and G932_M1-R: GCCTGTCAGTGCACCAAAAT (as shown in SEQ ID NO.8). The product was 1000 bp. Amplification was performed on different materials, and it was found that the primers could only specifically amplify in the material Aa11251 containing G932. Figure 2 The results above indicate that this molecular marker can be effectively used in breeding kiwifruit for resistance to bacterial canker.

[0036] HopAO2, an effector protein of *Actinidia kiwifruit* causal agent of bacterial canker, belongs to the tyrosine phosphatase family. Homologous proteins exist in various crop pathogens. The toxicity and non-toxicity of this family of proteins depend on their enzymatic active sites (Castañeda-Ojeda et al., 2017) (see "Suppression of plant immune responses by the..."). Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III effector tyrosine phosphatases HopAO1 and HopAO2” (Front Plant Sci., May 2017); and the HR hypersensitive response generated by the recognition of effector proteins by receptor resistance proteins in plant cells, thereby activating plant disease resistance, is a common phenomenon in plants (Balint-Kurti, P. (2019). The plant hypersensitive response: concepts, control and consequences. Molecular Plant Pathology, 20(8), 1163-1178.); for example, similar disease resistance responses are common in Solanaceae, Leguminosae, and Gramineae plants. Therefore, the disease resistance gene G932 in this invention can be applied to disease resistance breeding of various crops.

[0037] The above are preferred embodiments of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kiwifruit canker resistance gene, characterized in that, The gene is a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.

1.

2. The disease-resistant gene as described in claim 1, characterized in that, The nucleic acid sequence of the disease-resistant gene is shown in SEQ ID NO.

2.

3. A kiwifruit canker-resistant protein, characterized in that, The disease-resistant protein is a protein with the amino acid sequence shown in SEQ ID NO.

1.

4. The application of the disease-resistant gene according to any one of claims 1-2 in improving the resistance of kiwifruit to bacterial canker; characterized in that, By expressing disease-resistant genes in plants, the resistance of plants to bacterial canker can be improved.

5. The application as described in claim 4, characterized in that, The kiwifruit mentioned is the Chinese kiwifruit 'Donghong' variety.

6. The application of the disease-resistant gene according to any one of claims 1-2 in the breeding of kiwifruit varieties resistant to citrus canker; characterized in that, By expressing disease-resistant genes in plants, kiwifruit varieties resistant to bacterial canker can be bred.

7. The application as described in claim 6, characterized in that, The kiwifruit mentioned is the Chinese kiwifruit 'Donghong' variety.

8. A detection composition for detecting resistance to kiwifruit canker, characterized in that, The assay comprises a detection reagent capable of specifically recognizing the disease resistance gene of claim 1; the detection reagent is a primer pair for amplifying the disease resistance gene of claim 1, specifically comprising: G932_M1-F: CAGTTCACGACACACAGGTTT, G932_M1-R: GCCGTCAGTGCACCAAAAT.

9. The use of the disease-resistant gene as described in claim 1 or the protein encoded by said disease-resistant gene in identifying kiwifruit resistance to bacterial canker.

10. The application as described in claim 9, characterized in that, The aforementioned disease-resistant gene was used as a molecular marker to identify the resistance of kiwifruit to bacterial canker.

11. A transformant, characterized in that: The transformant contains the disease-resistant gene as described in any one of claims 1-2, and the transformant exhibits resistance to kiwifruit canker.

12. The transformant as described in claim 11, characterized in that: The transformant is a kiwi callus or regenerated bud containing the disease-resistant gene.

13. The transformant as described in claim 11, characterized in that: The transformant was obtained by introducing a recombinant expression vector containing the disease resistance gene into Agrobacterium, then transforming kiwifruit tissue with Agrobacterium, followed by resistance screening.

14. The transformant according to any one of claims 11-13, characterized in that: The transformant is used for kiwifruit.

15. A cell, characterized in that: The cell contains the disease-resistant gene according to any one of claims 1-2, and the cell has resistance to kiwifruit canker.

16. The cell as claimed in claim 15, characterized in that: The cells were obtained by introducing a recombinant expression vector containing the disease-resistant gene into Agrobacterium, then transforming kiwifruit tissue with Agrobacterium, and finally selecting for resistance.

17. A plant resistant to ulcer disease, characterized in that: The plant contains the disease-resistant gene according to any one of claims 1-2, or the plant contains the disease-resistant protein according to claim 3, or the plant contains the transformant according to any one of claims 11-14, or the plant contains the cell according to claim 15 or 16.

18. The plant as described in claim 17, characterized in that: The plant in question is a kiwifruit.

Images