Soybean GmSGT1 gene and application thereof in improving plant alkali tolerance

By overexpressing the GmSGT1 gene in soybean and Arabidopsis thaliana, the unclear regulatory function of soybean alkali tolerance was resolved, significantly improving the plant's tolerance to alkali stress and filling the research gap in the alkali tolerance function of the soybean GmSGT1 gene.

CN122445671APending Publication Date: 2026-07-24JIANGSU OPEN UNIVERSITY (THE CITY VOCATIONAL COLLEGE OF JIANGSU)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU OPEN UNIVERSITY (THE CITY VOCATIONAL COLLEGE OF JIANGSU)
Filing Date
2026-05-29
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

The alkali tolerance regulatory function of the soybean GmSGT1 gene has not been clearly defined in the existing technology, and there is a lack of core genes for alkali-tolerant soybean breeding, making it difficult to improve the plant's tolerance to alkali stress.

Method used

By overexpressing the soybean GmSGT1 gene, and using recombinant expression vectors and genetically engineered bacteria, stable overexpression of the GmSGT1 gene was achieved in soybean and Arabidopsis thaliana, thereby enhancing the plant's tolerance to alkaline stress.

Benefits of technology

It significantly increased the relative water content of plant leaves under alkaline stress, reduced the relative electrical conductivity of leaves, alleviated growth inhibition, and enhanced the plant's alkali tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445671A_ABST
    Figure CN122445671A_ABST
Patent Text Reader

Abstract

The application discloses a soybean GmSGT1 gene and application thereof in improving plant alkali tolerance, identifies alkali tolerance regulation function of the soybean GmSGT1 gene for the first time, provides the GmSGT1 gene shown in SEQ ID NO.1 and the coding protein shown in SEQ ID NO.2, constructs two kinds of recombinant expression vectors and corresponding gene engineering bacteria suitable for different transformation systems, and proves that the gene can positively regulate plant alkali tolerance by overexpressing the GmSGT1 gene in Arabidopsis thaliana, soybean root chimeric body and stable transgenic soybean strain.Under alkali stress conditions, overexpression of the GmSGT1 gene can effectively improve the relative water content of plant leaves, reduce the relative conductivity of the leaves, reduce cell membrane damage and plant wilting due to water loss, and relieve the inhibition of alkali stress on plant growth and development.The application provides a new functional gene resource and technical support for saline-alkali soil improvement and molecular breeding of alkali-tolerant soybean new varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and plant stress resistance breeding technology, specifically to the soybean GmSGT1 gene and its application in improving plant alkali tolerance. Background Technology

[0002] Soybeans are a crucial grain and oilseed crop in my country, rich in high-quality plant protein and oils, and widely used in human diets, livestock feed processing, and industrial raw material preparation, possessing extremely high economic and application value. Currently, the United States and Brazil are the world's major soybean exporters, while my country is the world's largest soybean consumer and importer, with an extremely high dependence on imports. In 2020, my country imported 100.327 million tons of soybeans, while domestic soybean production was only 19.6 million tons, with domestic supply accounting for less than 20% of imports, indicating a significant shortage in soybean production capacity. Soil salinity stress is a core abiotic stress factor restricting large-scale soybean cultivation and reducing soybean yield and quality. Soybeans are moderately salt-tolerant crops; when soil salinity exceeds 5 dS / m, soybean growth and development are significantly inhibited, and yield drops sharply. Therefore, identifying endogenous salt-alkali tolerance functional genes in soybeans, analyzing their stress resistance regulation mechanisms, and cultivating new salt-alkali tolerant soybean varieties are key pathways to improve domestic soybean production capacity, expand soybean planting areas in saline-alkali land, and ensure my country's food and oil security.

[0003] During long-term natural evolution, plants have developed a sophisticated network for regulating abiotic and biotic stress responses. This network relies on the synergistic regulation of numerous stress-resistance and disease-resistance functional genes. SGT1, RAR1, and HSP90 are core functional elements in plant stress signaling pathways. SGT1, short for the G2 allele repressor of SKP1, also known as the serine glyoxylate transaminase gene, was first discovered in yeast. It can suppress the phenotype of the G2 allele mutant of the SKP1 gene. It is a highly conserved functional protein in eukaryotes, widely present in both plants and animals, and mainly participates in physiological processes such as cell cycle regulation, plant immune responses, and biotic stress resistance and disease defense.

[0004] The SGT1 protein participates in centromere assembly and protein ubiquitination regulation, interacts with the SCF-type E3 ubiquitin ligase complex, and precisely regulates the G1-S and G2-M phases of the cell cycle, making it a key factor in maintaining normal plant cell division and growth. Structural analysis of plant SGT1 proteins typically reveals five conserved domains: SGT1special, TPR, VR1, VR2, and CS. The VR1 and VR2 domains exhibit significant sequence differences among different plant species, determining the species-specific function of the SGT1 gene.

[0005] Existing research confirms that HSP90, RAR1, and SGT1 can form a functional protein-protein interaction complex, and this interaction mode is the core basis for their function in exercising resistance to biological stress. SGT1, as a core factor in plant immune regulation, plays an irreplaceable role in the immune activation pathway mediated by NLR-type disease resistance proteins. It can assemble molecular chaperone complexes with HSP90 and RAR1, assisting NLR disease resistance proteins in completing spatial folding and maintaining protein structural stability. The specific interaction mechanism is as follows: the SGS domain of SGT1 binds to the LRR domain of NLR proteins, and the CS domain interacts with the CHORDI domain of RAR1 and HSP90. Through the assembly of this functional complex, the conformation of disease resistance proteins is regulated, thereby mediating protein folding modification and immune signal transduction.

[0006] Existing technologies have disclosed the biological functions of various plant SGT1 genes: Wild peanut AdSGT1 significantly enhances the resistance of transgenic plants to peanut late leaf spot; the peanut HSP90-RAR1-SGT1 functional complex stabilizes various NLR resistance proteins and positively regulates plant disease resistance defense responses; in tomato, SGT1 is an essential functional element in the Sw-5b gene-mediated pathway against tomato leaf spot virus; and in cabbage, BoSGT1 significantly enhances the plant's tolerance to various abiotic stresses such as high temperature, low temperature, and salt stress. Simultaneously, grape SGT1 homologs can respond to gray mold infection-induced expression, widely participating in the two core immune pathways of plant PTI (pathogen-associated molecular pattern triggered immunity) and ETI (effector-triggered immunity), regulating the plant's allergic necrosis resistance response and exhibiting broad-spectrum resistance to various pathogenic stresses such as fungi, bacteria, and viruses.

[0007] In summary, current research only confirms that the SGT1 gene family is generally involved in plant stress responses such as disease resistance, high temperature tolerance, low temperature tolerance, and salt tolerance, belonging to a multi-stress response gene family. However, the functions of homologous genes in this gene family vary greatly among different species, and the current technology does not disclose the function of the soybean GmSGT1 gene in plant alkali stress response and regulation of soybean alkali tolerance, nor are there any reports on the application of the GmSGT1 gene to alkali-tolerant soybeans or the breeding of alkali-tolerant model plants. Furthermore, there is a lack of systematic and in-depth research on the stress regulation mechanism of the soybean SGT1 gene. Those skilled in the art cannot predict that the soybean GmSGT1 gene possesses specific alkali tolerance function based on the known functions of existing SGT1 family genes, let alone foresee that its overexpression can significantly enhance plant alkali tolerance. Summary of the Invention

[0008] The purpose of this invention is to provide the soybean GmSGT1 gene and its application in improving plant alkali tolerance. By overexpressing the GmSGT1 gene, the alkali tolerance of soybean, Arabidopsis thaliana and other plants is significantly improved, filling the research gap in the alkali tolerance function of the soybean GmSGT1 gene, and providing new functional gene resources and technical support for the breeding of new stress-resistant soybean varieties in saline-alkali land and molecular breeding of alkali-tolerant plants.

[0009] To achieve the above objectives, the technical solution provided by the present invention is as follows: The first aspect of this application provides a soybean alkali tolerance-related gene GmSGT1, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The second aspect of this application provides a soybean alkali tolerance-related protein GmSGT1, which is a protein encoded by the GmSGT1 gene, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0011] A third aspect of this application provides a recombinant expression vector comprising the GmSGT1 gene described above; the recombinant expression vector is either a pLY1-GmSGT1 vector or a pBinGFP4-GmSGT1 vector.

[0012] The pLY1-GmSGT1 vector inserts the GmSGT1 gene through Asc I and Pac I restriction sites; the pBinGFP4-GmSGT1 vector inserts the GmSGT1 gene through Kpn I and Sma I restriction sites.

[0013] A fourth aspect of this application provides a genetically engineered bacterium, the genetically engineered bacterium comprising the recombinant expression vector described above; the genetically engineered bacterium is Agrobacterium rhizogenes EHA101 or Agrobacterium rhizogenes K599.

[0014] The fifth aspect of this application provides the application of the aforementioned GmSGT1 gene, GmSGT1 protein, recombinant expression vector, and genetically engineered bacteria in the cultivation of alkali-tolerant plants.

[0015] Overexpression of the GmSGT1 gene can increase the relative water content of plant leaves and reduce the relative electrical conductivity of leaves under alkali stress, thereby alleviating the growth inhibition of plants under alkali stress and improving plant alkali tolerance.

[0016] Specifically, the plant is soybean or Arabidopsis thaliana; wherein, Arabidopsis thaliana is transformed by flower dip method and screened for glufosinate to obtain homozygous lines, and soybean is transformed by Agrobacterium stem infection, combined with fluorescence screening, glufosinate resistance screening and PCR identification to obtain positive transgenic lines and homozygous lines.

[0017] The sixth aspect of this application provides a method for cultivating alkali-tolerant transgenic plants, comprising the following steps: 1) Cloning the GmSGT1 gene as described in claim 1, and constructing a recombinant expression vector containing the GmSGT1 gene; 2) The recombinant expression vector was introduced into Agrobacterium to obtain a transgenic engineered bacterium; 3) Using the aforementioned transgenic engineered bacteria to infect plants, transgenic alkali-tolerant plant lines that stably overexpress the GmSGT1 gene were screened and obtained.

[0018] The seventh aspect of this application provides a primer set for amplifying the GmSGT1 gene, the primer set including primers for amplifying the GmSGT1 open reading frame, primers for amplifying the GmSGT1-GFP vector, primers for one-step cloning the pLY1-GmSGT1 vector, and primers for quantitative real-time detection of GmSGT1, the primer sequences of which are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.7, and SEQ ID NO.8, respectively; the internal reference gene is GmUKN1, and the primer sequences of which are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0019] Compared with the prior art, the beneficial effects of the present invention are: This invention clarifies for the first time the alkali tolerance regulatory function of the soybean GmSGT1 gene, providing the GmSGT1 gene, its encoded protein, recombinant vector, and engineered bacteria. It also identifies and discloses for the first time a novel function of the soybean GmSGT1 gene—positive regulation of plant alkali tolerance. Overexpression of the GmSGT1 gene through genetic engineering significantly enhances the plant's tolerance to alkali stress, filling the research gap in the existing technology on the alkali tolerance function of the soybean GmSGT1 gene, enriching the functional annotation of the plant SGT1 gene family, and breaking through the inherent understanding in the field that the SGT1 gene is only involved in disease resistance, salt tolerance, and temperature stress tolerance.

[0020] This invention validates gene function through multiple experimental systems, yielding stable and reliable results. Utilizing a triple validation system—Arabidopsis heterologous overexpression, a soybean rooted chimera transient transformation system, and a stable soybean genetic transformation system—it confirms that GmSGT1 overexpression significantly enhances plant alkali tolerance. The technical approach demonstrates strong reproducibility and high reliability. The soybean rooted chimera transformation system exhibits near 100% infection efficiency, a short experimental cycle, and rapid identification of gene alkali tolerance function. Stable transgenic soybean lines exhibit stable phenotypes, allowing for accurate verification of gene function.

[0021] This invention clarifies the alkali tolerance regulation mechanism of the GmSGT1 gene. Overexpression of GmSGT1 can enable plants under alkali stress to maintain higher relative leaf water content and lower relative leaf electrical conductivity, reduce cell membrane damage and leaf water loss, and maintain normal plant growth. This invention elucidates the stress resistance mechanism of the gene from a physiological perspective.

[0022] This invention provides a complete system for the application of genetic engineering, including gene sequences, protein sequences, vector construction schemes, engineered bacteria, transformation methods, and detection primers. It can be directly used for molecular breeding of alkali-tolerant soybeans and alkali-tolerant crops, and provides new and efficient gene resources and technical solutions for the planting of crops in saline-alkali land and the breeding of new varieties of stress-resistant crops. It has high scientific research value and industrial application prospects. Attached Figure Description

[0023] Figure 1 The image shows a comparison of the overall phenotypes of wild-type Arabidopsis thaliana and GmSGT1-overexpressing Arabidopsis thaliana lines after 18 days of alkali stress treatment; Col represents wild-type Arabidopsis thaliana (Col-0), and OE#1, OE#2, and OE#3 represent GmSGT1-overexpressing Arabidopsis thaliana lines.

[0024] Figure 2 A bar chart comparing root lengths of wild-type Arabidopsis and GmSGT1-overexpressing Arabidopsis lines after 18 days of alkali stress treatment; data are the mean ± standard deviation of three biological replicates, used to quantify the recovery effect of GmSGT1 overexpression on root growth in Arabidopsis under alkali stress.

[0025] Figure 3 Figure 1 shows the results of alkali tolerance identification of soybean rooting chimeras. Figure 2 shows the GFP fluorescence screening of empty vector (EV) and GmSGT1 overexpressing soybean rooting chimeras, used to identify positive transgenic rooting. Figure 3 shows the comparison of growth phenotypes of empty vector and GmSGT1 overexpressing chimera plants after 4 days of alkali stress treatment with 90mM NaHCO3. Figure 4 shows the comparison of relative leaf water content of the two groups of plants after alkali stress treatment. Figure 5 shows the comparison of fresh weight of the two groups of plants after alkali stress treatment.

[0026] Figure 4 Figure 1 shows the results of alkali tolerance identification of T3 generation stable transgenic soybean lines. Figure 2 shows the comparison of plant phenotypes between wild-type Tianlong 1 (TL1) and GmSGT1 overexpressing soybean lines after 14 days of alkali stress treatment under normal conditions and 90mM NaHCO3. Figure 3 shows the results of relative expression level detection of GmSGT1 gene in wild-type and overexpressing soybean lines. Figure 4 shows the comparison of relative leaf water content of soybean plants in the two groups after alkali stress treatment. Figure 5 shows the comparison of relative leaf conductivity of soybean plants in the two groups after alkali stress treatment. Detailed Implementation

[0027] The present invention will be further described in detail below through specific embodiments, but it should not be construed as limiting the scope of the subject matter of the present invention to the following embodiments. All technologies implemented based on the above content of the present invention fall within the scope of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents, methods and equipment used are conventional reagents, methods and equipment in this technical field.

[0029] Existing research on the SGT1 gene family mainly focuses on its disease resistance function under plant biotic stress and its salt and temperature stress tolerance function in a few species. The alkali tolerance regulatory function of the soybean GmSGT1 gene has not yet been discovered and confirmed, leaving a gap in our understanding of gene function. The SGT1 gene family has numerous members, with significant functional differentiation among homologous genes in different plants, and no unified stress resistance pattern exists within the family. Currently, the number of soybean alkali tolerance functional genes identified is limited, and there is a lack of core genes that can be stably applied to molecular breeding for alkali tolerance in soybeans. This makes it difficult to efficiently breed new soybean varieties with high alkali tolerance and to meet the industrial needs of soybean cultivation in saline-alkali land. Based on this, this invention has conducted the following research: Example 1: Cloning and Sequence Identification of the Soybean GmSGT1 Gene The soybean material used in this embodiment is the local soybean variety Zhongdou 8 (Glycine max (L.) Merr.), which was provided by the Germplasm Resources Research Laboratory of the National Soybean Improvement Center of Nanjing Agricultural University. In this embodiment, the complete cDNA sequence of the GmSGT1 gene was cloned from Zhongdou 8.

[0030] The specific operating steps are as follows: Root tip tissue from healthy Zhongdou No. 8 plants was selected and thoroughly ground into powder in liquid nitrogen. Total RNA was extracted from the plants using the RNAprep Pure Plant Kit from Tiangen Biotech Co., Ltd. 5 μg of qualified total RNA was then extracted using the PrimeScript assay from TaKaRa Corporation (Japan). TM The RT Master Mix kit is used to reverse transcribe soybean cDNA according to the kit's standard operating procedure.

[0031] Using the obtained cDNA as a template, PCR amplification was performed using GmSGT1 gene open reading frame specific primers. The forward primer sequence is shown in SEQ ID NO.3: ATGGCTTCCGATCTTGAGCTT, and the reverse primer sequence is shown in SEQ ID NO.4: TTACCATTTCTTTAACTCCATG.

[0032] Prepare a 50 μL standard PCR reaction system: 2 μL cDNA template (0.05 μg), 2 μL each of 10 μM forward and reverse primers, 5 μL 10× PCR buffer, 1 μL 10 mM dNTP mixture, 2 U Taq DNA polymerase, and make up the remaining volume to 50 μL with ultrapure water.

[0033] The PCR amplification program was set as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 50 s, 58℃ annealing for 50 s, 72℃ extension for 1 min, for a total of 35 cycles; after the cycles, 72℃ final extension for 10 min, and stored at 4℃ for later use.

[0034] The PCR amplification product was recovered, purified, and sequenced for identification. Sequence alignment results showed that the open reading frame sequence of the amplified gene was completely consistent with SEQ ID NO.1. The gene is 1074 bp in length and encodes 357 amino acids as shown in SEQ ID NO.2. The complete soybean GmSGT1 gene was successfully cloned.

[0035] Example 2: Construction of transgenic Arabidopsis thaliana lines and identification of alkali-tolerant phenotypes Based on the CDS sequence of the GmSGT1 gene and the multiple cloning site information of the plant stable expression vector pLY1, Asc I and Pac I were selected as specific restriction enzyme sites. Dedicated primers were designed and constructed using the one-step cloning method. The primer sequences are SEQ ID NO.11 and SEQ ID NO.12, respectively. Using restriction enzyme digestion and one-step cloning ligation technology, the GmSGT1 gene from Zhongdou 8 was completely inserted into the multiple cloning site region of the pLY1 vector, thus constructing the pLY1-GmSGT1 recombinant stable expression vector.

[0036] The successfully constructed pLY1-GmSGT1 recombinant vector was transformed into Agrobacterium rhizogenes EHA101 to obtain positive engineered bacterial strains. Wild-type Arabidopsis thaliana plants were genetically transformed using the classic flower dip method, and T0 generation transgenic seeds were harvested.

[0037] T0 generation Arabidopsis seeds were disinfected by rinsing with 75% ethanol and 0.9% sodium hypochlorite sequentially, followed by multiple rinses with sterile ultrapure water, and then vernalized at 4℃ for 2–3 days. After vernalization, the seeds were sown in sterilized vermiculite nutrient soil (vermiculite: nutrient soil = 1.5:1) and cultured normally. Three weeks after sowing, the seeds were screened by spraying with 70 mg / L glufosinate solution once a week to obtain surviving resistant plants. These plants were then transplanted and propagated to obtain T1 generation seeds.

[0038] After undergoing the same disinfection and vernalization treatment, T1 generation seeds were sown in 1 / 2 MS solid medium containing 20 mg / L glufosinate for further screening. After one week of culture, transgenic positive plants germinated normally with vibrant green and robust cotyledons, while non-transgenic wild-type plants failed to grow normally, exhibiting phenotypes such as yellowing and wilting of cotyledons, or even failure to germinate. The resistant plants were then transplanted into nutrient soil for further propagation, and glufosinate resistance screening was continued for multiple generations until the offspring seeds consistently grew normally in the resistant medium, thus preliminarily identifying homozygous transgenic lines.

[0039] Plant DNA was extracted from leaves of homozygous candidate lines at the bolting stage. The integration of the target gene was verified by PCR molecular identification. Homozygous lines with the correct target fragment size were screened out and propagated for subsequent alkali tolerance tests.

[0040] Homozygous Arabidopsis thaliana lines overexpressing GmSGT1 were simultaneously propagated and seeds were harvested from wild-type Arabidopsis thaliana Col-0. Seeds were sterilized and vernalized at 4℃ for 2–3 days before use. The two types of seeds were sown separately in a blank control group (0 mM NaHCO3) without alkali stress and in a half MS medium containing 4 mM NaHCO3 alkali stress, respectively. The plants were cultured under standard conditions for 18 days, and plant phenotypes were observed and recorded, and root length was calculated.

[0041] The test results are as follows Figure 1 , Figure 2 As shown: Under normal culture conditions, there was no significant difference in plant growth and root length between wild-type Arabidopsis and GmSGT1 overexpression lines; under 4mM NaHCO3 alkaline stress, root growth of wild-type Arabidopsis was significantly inhibited, resulting in stunted plants and significantly shortened root length, while the root growth of GmSGT1 overexpression lines was good, and the degree of growth inhibition was significantly lower than that of wild-type.

[0042] Figure 1 This is a comparison of the overall phenotypes of wild-type and overexpressing Arabidopsis thaliana after 18 days of alkali stress treatment. Col represents wild-type Arabidopsis thaliana (Col-0), and OE#1, OE#2, and OE#3 are GmSGT1 overexpressing Arabidopsis thaliana lines.

[0043] Figure 2 The bar chart shows the statistical comparison of Arabidopsis root length after 18 days of alkali stress treatment. #1, #2, and #3 correspond to the three overexpression lines. The experimental data are the mean ± standard deviation of three biological replicates (n=3×9). The same uppercase letter is marked above the error line of the same index to indicate that there is no significant difference at the 0.01 level of Duncan's multiple test.

[0044] Example 3 Construction and alkali-resistant phenotype identification of GmSGT1-overexpressing soybean root chimeras Based on the CDS sequence of the GmSGT1 gene and the multiple cloning site information of the fluorescent co-expression vector pBinGFP4, KpnI and SmaI were selected as restriction enzyme sites to design a one-step cloning construction primer. The upstream primer sequence is shown in SEQ ID NO.5, and the downstream primer sequence is shown in SEQ ID NO.6. Using restriction enzyme digestion and one-step cloning ligation technology, the GmSGT1 gene was inserted into the pBinGFP4 vector to construct the pBinGFP4-GmSGT1 fluorescent fusion expression vector. The recombinant plasmid was then transformed into Agrobacterium rhizogenes K599, resulting in positive-infected engineered bacteria.

[0045] Tianlong No. 1 soybean seeds with plump and uniform size were selected, surface-sterilized with 75% ethanol, rinsed with sterile ultrapure water to remove residual ethanol, and then germinated in sterile sand. The culture conditions were set as 14h light / 10h darkness and day / night temperature of 28℃ / 25℃. Healthy soybean seedlings that had grown for 3 days and whose cotyledons had not yet unfolded were selected and transferred to sterile centrifuge tubes containing 40 mL of 1 / 2 Hoagland nutrient solution for 1 day of acclimatization.

[0046] Empty bacterial culture and GmSGT1 overexpression engineered bacterial culture were inoculated into YEB liquid medium and cultured at 28℃ and 220 rpm with shaking until the OD600 of the bacterial culture reached 0.6-0.8. The bacterial cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in 10 mM MgCl2 solution, washed twice, and the OD600 of the bacterial culture was adjusted to 0.6 for use in infection.

[0047] Make a 1cm penetrating wound 1cm below the cotyledons of the soybean seedling stem using the tip of a syringe needle. Use the syringe to draw up bacterial solution and repeatedly infect the wound. After infection, the seedlings are cultured in the dark for 1 day, and then resumed normal light cultivation the next day. From the 3rd day of cultivation, humidify the plants regularly every day and change the nutrient solution every 3 days to maintain normal plant growth and transpiration pull.

[0048] Once the newly sprouted roots at the wound site reach approximately 5 cm in length, gradually remove the main root and aerial roots from non-wound areas, retaining only the newly sprouted transgenic roots from the infected area. Then, transfer the plants to 1L beakers and cultivate them hydroponically using 1 / 2 Hoagland nutrient solution. After one week of continuous cultivation, use a fluorescence stereomicroscope to screen for GFP-positive roots, completely remove all non-positive roots, and continue acclimatization cultivation for another week. Select healthy chimeric plants with consistent growth for alkali stress treatment.

[0049] The experiment included a blank control group and an alkali stress treatment group. The control group was cultured in normal 1 / 2 Hoagland nutrient solution (pH=5.8), while the treatment group was cultured in 1 / 2 Hoagland nutrient solution containing 90 mM NaHCO3 (pH=8.5). Each group contained 15 plants, with three biological replicates. Plant phenotypes were observed after 4 days of continuous treatment, and leaf relative water content and plant fresh weight were measured. The results are as follows: Figure 3 As shown.

[0050] Figure 3 Figures show the results of alkali tolerance identification of soybean root chimeras. Figure A shows the GFP fluorescence screening of roots with empty vector (EV) and GmSGT1 overexpression; Figure B shows the comparison of growth phenotypes of the two groups of plants after 4 days of alkali stress treatment with normal conditions and 90mM NaHCO3; Figures C and D are bar charts comparing the relative leaf water content and plant fresh weight of the two groups of plants, respectively. The experimental data are the mean ± standard deviation of three biological replicates (n=3×3). The same uppercase letter above the error line indicates no significant difference at the 0.01 level of the Duncan test.

[0051] The experimental results showed that under normal culture conditions, there was no significant difference in plant growth between the empty control group and the GmSGT1 overexpression chimeric group. After 4 days of alkali stress treatment with 90mM NaHCO3, both groups of plants exhibited varying degrees of yellowing and wilting phenotypes. The empty control group showed severe wilting and yellowing leaves, with some plants dying, while the GmSGT1 overexpression plants showed significantly better growth than the empty control group. Physiological indicators showed that under alkali stress, the relative water content of leaves and the fresh weight of aboveground parts of the GmSGT1 overexpression group were significantly higher than those of the empty control group, demonstrating that overexpression of the GmSGT1 gene can significantly enhance the alkali tolerance of soybean rooting chimeras.

[0052] Example 4: Obtaining stable GmSGT1 overexpressing soybean lines and identifying alkali-tolerant phenotypes Using the pLY1-GmSGT1 recombinant expression vector, soybean recipient material Tianlong 1 (TL1) was genetically transformed through an Agrobacterium-mediated stable genetic transformation system. Genetically stable T3 generation GmSGT1 overexpressing homozygous soybean lines were obtained through foliar smear resistance screening with 135 mg / L glufosinate combined with PCR molecular identification.

[0053] Alkali stress treatment was applied to homozygous T3 transgenic lines and wild-type TL1 plants. The experimental groups were as follows: the blank control group was cultured in normal 1 / 2 Hoagland nutrient solution (pH=8.5), and the alkali stress group was cultured in 1 / 2 Hoagland nutrient solution (pH=8.5) containing 90 mM NaHCO3 for 14 days. After treatment, the middle functional leaf of the trifoliate compound leaf was selected, and the relative water content and relative electrical conductivity of the leaf were measured. The experimental results are as follows: Figure 4 As shown.

[0054] Figure 4 Figure 1 shows the results of alkali tolerance identification in T3 generation transgenic soybeans. Figure A compares the phenotypes of the two groups of plants under normal conditions and alkali stress treatment for 14 days. Figure B shows the relative expression level of the GmSGT1 gene in wild-type and overexpression lines. Figures C and D show the statistical results of relative leaf water content and relative leaf electrical conductivity in the two groups of plants, respectively. 35S:GmSGT1 represents the overexpression soybean line, and TL1 represents the wild-type Tianlong 1. Data are the mean ± standard deviation of three biological replicates (n=3×3). This indicates a highly significant difference at the 0.01 level (t-test).

[0055] The results of plant phenotypic observation showed that under normal culture conditions, there was no significant difference in growth and morphology between the transgenic lines and the wild-type TL1 plants. After 14 days of alkali stress treatment with 90mM NaHCO3, the leaves of the wild-type TL1 plants withered and turned yellow, the plants were stunted, and the growth was severely degraded, while the GmSGT1 overexpressing soybean lines showed good growth and significantly less stress damage.

[0056] Physiological index detection results showed that under normal conditions, there was no significant difference in the relative water content and relative electrical conductivity of leaves between the two groups of plants; under alkaline stress, the relative water content of leaves of the GmSGT1 overexpressing line was significantly higher than that of the wild type, and the relative electrical conductivity of leaves was significantly lower than that of the wild type.

[0057] In summary, the physiological results confirm that overexpression of the GmSGT1 gene can effectively alleviate water loss and wilting in soybean plants under alkaline stress by maintaining a higher relative leaf water content and reducing electrolyte leakage caused by cell membrane damage, thus significantly improving the alkali tolerance of soybean plants and ensuring normal growth of soybean plants under alkaline stress.

[0058] The sequence listing involved in this invention is as follows: SEQ ID NO.1: Complete open reading frame nucleotide sequence of the soybean GmSGT1 gene; atggcttccg atcttgagct taaggccaaa gaggctttcg aagatgataa ctatgatctcgcctacgacc tcttaactca ggccattggt ctcagcccca acaacgcaga cctatatgct gaccgtgcgcaagtcaacat caaagtcaac aacctcaccg aggctgtttc tgatgcaaac aaggcgattg agttgaatccttctcactca aaagcatatt tgcgaaaagg taccgcatgc atcaagcttg aggaatatca gactgctaaggcagctctag agatgggtgc ttcattggct cctggagatt ctaaatttac tgatttgatc aaagactgcg atgaactgat tgcagaagaatctggtgtca tacccataca agaagagagc acaacacagg gtgctgctac aaaagctgtt gaggcagagaatgatcttcc agagccacct acagtaaccg tggttaaacc taaatacagg catgaattct accagaaacctgatgaaatg gttattacca tatttgcaaa gggcattcca cgagacagca ttactgttga ctttggtgaacaaatattaa gtgttacaat taatatccct tgcaaagatg cttatgtctt ccaacctcgc ttatttggaa agatcatacc ctccaaatgccggtatgaag ttttgtccac caaaattgaa atttgccttg caaaagcaga tcatatccaa tggacatctctagaattcaa caagggtagc acagttgcac agaggtttag tgttttgcca gttgcaagag gtgaaaaacctacttatcca tcctcaaaac cgaaaataac agattgggat aagcttgaag ctcaagttaa gaaagaggagaaagaagaaa aacttgatgg tgatgctgcg ttgaacaaat ttttccgtga tatatatcaa gatgcagatg aggacacaag aagagcaatgagcaaatcat ttgtggagtc taatggaaca gtactgtcta caaactggaa agaagtggga tcaatgaaggtacaggaaag tcctcctgat ggcatggagt taaagaaatg gtaa SEQ ID NO.2: The amino acid sequence of the protein encoded by the soybean GmSGT1 gene; MASDLELEKAK EAFEDDNYDL AYDLLTQAIG LSPNNADLYAdRAQVNIKVN NLTEAVSDANKAIELNPSHS KAYLRKGTAC IKLEEYQTAK AALEMGASLA PGDSKFTDLI KDCDELIAEE SGVIPIQEESTTQGAATKAV EAENDLPEPP TVTVVKPKYR HEFYQKPDEM VITIFAKGIP RDSITVDFGE QILSVTINIPCKDAYVFQPR LFGKIIPSKC RYEVLSTKIE ICLAKADHIQ WTSLEFNKGS TVAQRFSVLP VARGEKPTYPSSKPKITDWD KLEAQVKKEE KEEKLDGDAA LNKFFRDIYQdADEDTRRAM SKSFVESNGT VLSTNWKEVGSMKVQESPPD GMELKKW SEQ ID NO.3: Primers for amplifying the open reading frame of the GmSGT1 gene; atggcttccgatcttgagctt SEQ ID NO.4: Primers for amplifying the open reading frame of the GmSGT1 gene; ttaccatttctttaactccatg SEQ ID NO.5: Primers for GmSGT1-GFP vector amplification; gcccttgctcaccatggatccatggcttccgatcttgagctt SEQ ID NO.6: Primers for GmSGT1-GFP vector amplification; atttacgaacgatagggtaccccatttctttaactccatgcca SEQ ID NO.7: Primers for quantitative real-time detection of the GmSGT1 gene; ccccaacaacgcagacctat SEQ ID NO.8: Primers for quantitative real-time detection of the GmSGT1 gene; ctgtctcgtggaatgccctt SEQ ID NO.9: Primers for quantitative real-time analysis of soybean internal reference gene GmUKN1; tggtgctgccgctatttactg SEQ ID NO.10: Primers for quantitative real-time analysis of soybean internal reference gene GmUKN1; ggtggaaggaactgctaacaatc SEQ ID NO.11: Primers for one-step cloning of the pLY1-GmSGT1 vector; tctagaggatctcgaggcgcgccatggcttccgatcttgagctt SEQ ID NO.12: Primers for one-step cloning of the pLY1-GmSGT1 vector; attcgagctcactagttaattaaccatttctttaactccatgcca.

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent substitutions, and improvements made by those skilled in the art to the above embodiments without departing from the scope of the technical solution of the present invention, based on the technical essence of the present invention, shall still fall within the protection scope of the technical solution of the present invention.

Claims

1. A soybean alkali tolerance-related gene GmSGT1, characterized in that, The nucleotide sequence of the GmSGT1 gene is shown in SEQ ID NO.

1.

2. A soybean alkali tolerance-related protein GmSGT1, characterized in that, The protein is encoded by the GmSGT1 gene according to claim 1, and the amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the GmSGT1 gene as described in claim 1; the recombinant expression vector is either the pLY1-GmSGT1 vector or the pBinGFP4-GmSGT1 vector.

4. The recombinant expression vector according to claim 3, characterized in that, The pLY1-GmSGT1 vector inserts the GmSGT1 gene through AscI and Pac I restriction sites; the pBinGFP4-GmSGT1 vector inserts the GmSGT1 gene through Kpn I and Sma I restriction sites.

5. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria comprises the recombinant expression vector as described in claim 3 or 4; the genetically engineered bacteria is Agrobacterium rhizogenes EHA101 or Agrobacterium rhizogenes K599.

6. The application of the GmSGT1 gene of claim 1, the GmSGT1 protein of claim 2, the recombinant expression vector of claim 3 or 4, and the genetically engineered bacteria of claim 5 in the cultivation of alkali-tolerant plants.

7. The application according to claim 6, characterized in that, The specific application is as follows: by overexpressing the GmSGT1 gene, the relative water content of plant leaves under alkali stress is increased, the relative electrical conductivity of leaves is reduced, the growth inhibition of plants by alkali stress is alleviated, and the alkali tolerance of plants is improved.

8. The application according to claim 7, characterized in that, The plants are soybean or Arabidopsis thaliana; Arabidopsis thaliana was transformed by flower dip method and screened for glufosinate to obtain homozygous lines, while soybean was transformed by Agrobacterium stem infection, and positive transgenic lines and homozygous lines were obtained by combination of fluorescence screening, glufosinate resistance screening and PCR identification.

9. A method for cultivating alkali-tolerant transgenic plants, characterized in that, Includes the following steps: 1) Cloning the GmSGT1 gene as described in claim 1, and constructing a recombinant expression vector containing the GmSGT1 gene; 2) The recombinant expression vector was introduced into Agrobacterium to obtain a transgenic engineered bacterium; 3) Using the aforementioned transgenic engineered bacteria to infect plants, transgenic alkali-tolerant plant lines that stably overexpress the GmSGT1 gene were screened and obtained.

10. A primer set for amplifying the GmSGT1 gene of claim 1, characterized in that, The primer set includes primers for amplifying the GmSGT1 open reading frame, primers for amplifying the GmSGT1-GFP vector, primers for one-step cloning the pLY1-GmSGT1 vector, and primers for quantitative real-time detection of GmSGT1. The primer sequences are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.7, and SEQ ID NO.8, respectively. The internal reference gene is GmUKN1, and the primer sequences are shown in SEQ ID NO.9 and SEQ ID NO.10.