Application of reducing expression of l-asparaginase in improving plant antiviral ability and antiviral plant material

By reducing the expression level of L-asparaginase in plants and regulating the SA, Eth, and ROS signaling pathways, the problem of insufficient plant defense against viruses was solved, and the plant's resistance to viruses such as pepper mild mottle virus was enhanced.

CN122445697APending Publication Date: 2026-07-24ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610583277.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-29
Publication Date
2026-07-24

Smart Images

  • Figure CN122445697A_ABST
    Figure CN122445697A_ABST
Patent Text Reader

Abstract

The application relates to the technical field of genetic engineering, in particular to application of reducing expression amount of L-asparaginase in improving plant antiviral ability and antiviral plant material. The application finds that 126 kDa protein of PMMoV virus directly targets L-asparaginase (LA), manipulates amino acid metabolism by enhancing the enzyme activity of LA to benefit the survival of the virus, and the plant antiviral ability can be improved by reducing the expression amount of L-asparaginase. The application establishes the connection between virus infection and host amino acid metabolism, and provides a new application perspective for preventing and treating plant viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of reducing the expression level of L-asparaginase in improving the antiviral ability of plants and antiviral plant materials. Background Technology

[0002] Pepper mild mottled virus (PMMoV) is a globally prevalent pathogen with a natural infection rate approaching 95%, resulting in an average yield reduction of 15-40%, causing severe damage to peppers and other Solanaceae crops. Therefore, elucidating the pathogenic mechanism of PMMoV is crucial for developing control strategies for viral diseases in peppers and tomatoes.

[0003] Plant antiviral immunity depends on multiple pathways, including salicylic acid (SA), ethylene (Eth), and reactive oxygen species (ROS). SA plays a crucial role in antiviral defense by activating systemically acquired resistance (SAR). Ethylene regulates defense responses and programmed cell death. Reactive oxygen species (ROS) often confer resistance to viral infections in plants.

[0004] Amino acids, as the main form of nitrogen transport in plants, not only participate in metabolic processes but also act as signaling molecules to regulate immune responses. Amino acid hydrolases play a crucial role in amino acid metabolism. Among them, L-asparaginase (LA) catalyzes the hydrolysis of asparagine to aspartic acid and is widely present in both plants and animals. However, whether there is an interaction between LA and PMMoV has not been reported in the current technology. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides the application of reducing L-asparaginase expression in enhancing plant antiviral capabilities and antiviral plant materials. This invention discovers that L-asparaginase interacts with various viral proteins (such as the PMMoV 126kDa protein), and that reducing L-asparaginase expression can improve plant antiviral capabilities.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides the application of L-asparaginase in regulating plant antiviral ability, wherein the regulation is: increasing the expression level of L-asparaginase to reduce plant antiviral ability, or decreasing the expression level of L-asparaginase to increase plant antiviral ability.

[0007] Preferably, the virus includes one or more of pepper mild mottle virus, cucumber mosaic virus, rice stripe leaf blight virus, and tomato dwarf virus.

[0008] Preferably, increasing the expression level of L-asparaginase reduces the expression level of plant antiviral response genes, or decreasing the expression level of L-asparaginase increases the expression level of plant antiviral response genes; the response genes include one or more of salicylic acid response genes, ethylene response genes, and reactive oxygen species response genes.

[0009] Preferably, the salicylic acid response gene includes PR1 , PR2 and PR5 One or more of the following; the ethylene response genes include DUF26 , EIN3 and ERF1 One or more of the following; the reactive oxygen species response genes include BIK1 , EX1 and SIK1 One or more of them.

[0010] Preferably, the plant includes chili peppers or tobacco.

[0011] This invention provides the application of biomaterials that reduce the expression level of L-asparaginase in improving the antiviral ability of plants.

[0012] Preferably, the plant includes chili peppers or tobacco.

[0013] Preferably, the biomaterial includes an LA gene silencing vector.

[0014] This invention provides a method for improving the antiviral ability of plants, comprising: reducing the expression level of L-asparaginase in plants by using a virus-induced gene silencing method.

[0015] This invention provides an antiviral plant material, which is a transgenic plant material with reduced L-asparaginase expression relative to wild type; the plant includes pepper or tobacco.

[0016] Beneficial effects: This invention discovers that the 126 kDa protein of the PMMoV virus directly targets L-asparaginase (LA), manipulating amino acid metabolism by enhancing its enzyme activity to facilitate viral survival. Furthermore, reducing L-asparaginase expression can improve plant antiviral capabilities. This invention establishes the link between viral infection and host amino acid metabolism, providing a new perspective for the control of plant viruses. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0018] Figure 1The results validate the interaction between PMMoV 126 kDa protein and LA in vitro and in vivo; where A represents the interaction results between 126 kDa protein and LA in yeast two-hybrid assay; B and C represent the interaction results between 126 kDa protein and LA validated by LCI assay.

[0019] Figure 2 The results show that LA negatively regulates host antiviral defense; where A represents the silencing effect in PMMoV-infected tobacco plants. NbLA-1 / 2 Gene (TRV-) NbLA-1 / 2 Phenotypic results of A: A) and symptoms were recorded on day 3 post-inoculation; B) is the immunoblotting analysis result of PMMoV CP protein levels in A; C) is the phenotype of PMMoV-infected pepper plants. CaLA-1 / 2 Gene silencing (TRV-) CaLA-1 / 2 The phenotype of PMMoV was observed at 5 days; D represents the immunoblot analysis results of PMMoV CP protein levels in C; E represents the phenotype of PMMoV-infected wild-type (WT), OE–NbLA-1, and OE–NbLA-2 tobacco plants at 3 days; FG represents the immunoblot analysis results of PMMoV CP levels in plants in E. P <0.01, n=3 biological replicates).

[0020] Figure 3 for CaLA-1 / 2 or NbLA-1 / 2 Phenotype of silent plants; where A represents the plant constructed using the TRV construct (TRV- GUS TRV- NbLA-1 / 2 TRV- NbPDS )silence GUS , NbLA-1 / 2 or NbPDS The phenotype of tobacco plants was observed 18 days post-infection; B was based on TRV- NbLA-1 / 2 In the plant NbLA-1 and NbLA-2 The results of RT-qPCR analysis of expression; C represents the expression using TRV vector (TRV- GUS TRV- NbLA-1 / 2 TRV- NbPDS )silence GUS , CaLA-1 / 2 or CaPDS The phenotype of the pepper plants was observed 28 days post-infection; D was TRV- CaLA-1 / 2 In the plant CaLA-1 and CaLA-2 Results of RT-qPCR analysis of expression ( P <0.05, P <0.01, n=3 biological replicates).

[0021] Figure 4 Phenotypes of NbLA-1 and NbLA-2 transgenic tobacco plants; where A represents the phenotypes of wild-type and NbLA-1 or NbLA-2 overexpression lines; and B represents the results of Western blot analysis of NbLA-1-3HA and NbLA-2-3HA proteins.

[0022] Figure 5 Phenotypes of wild-type and 126 kDa transgenic tobacco plants are shown; where A represents the phenotype of wild-type tobacco plants expressing 126 kDa protein, and B represents the phenotype of 126 kDa #6 transgenic plants. 126 kDa Results of RT-PCR detection of the gene.

[0023] Figure 6 This section presents experimental results showing how asparagine enhances PMMoV resistance by activating hormone signaling and reactive oxygen species (ROS) pathways. Specifically, AB represents the phenotypes of tobacco and pepper infected with PMMoV after treatment with H2O, 400 µM asparagine (Asn), or 400 µM aspartic acid (Asp), with symptoms appearing 3 days (tobacco) and 5 days (pepper) post-infection; CD represents the immunoblotting analysis results of PMMoV coat protein levels in AB; E is a heatmap of differentially expressed genes (DEGs) in tobacco treated with water or 400 µM asparagine; F represents DEGs involved in the SA, Eth, and ROS pathways in tobacco treated with water or 400 µM aspartic acid; G represents the in situ detection results of ROS in tobacco leaves by staining with diaminobenzidine (DAB) and nitroblue tetrazolium (NBT); H represents the percentage of NBT and DAB staining results in G expressed as total leaf area using ImageJ; I–K represent the ROS levels in plants treated with H2O, Asn, or Asp. PR1 , PR2 , PR5 (Salicylic acid pathway) DUF26 , EIN3 , ERF1 (Ethylene pathway) and BIK1 , EX1 , SIK1 RT-qPCR analysis results of (reactive oxygen species pathway) expression P <0.05, P <0.01, ns = no statistical significance; n = 3 biological replicates).

[0024] Figure 7Transcriptome analysis results of *Nicotiana benthamiana* treated with asparagine or water; where A shows the distribution of differentially expressed genes between the 400 µM asparagine-treated group and the water-treated group; B shows the counts of upregulated and downregulated genes between the asparagine-treated group and the water-treated group; C shows the KEGG pathway enrichment analysis results of DEGs (corrected). P <0.05); D is the Gene Ontology (GO) enrichment map, showing 15 representative genes of DEGs under ASN treatment (corrected). P <0.05).

[0025] Figure 8 Experimental results showing that LA negatively regulates the ethylene, salicylic acid, and reactive oxygen species signaling pathways; where A–C represents TRV– GUS and NbLA-1 / 2 In silent tobacco plants, SA-responsive genes ( PR1 , PR2 , PR5 ), and Eth-responsive genes ( DUF26 , EIN3 , ERF1 ) and ROS-responsive genes ( BIK1 , EX1 , SIK1 RT-qPCR analysis results of wild-type (WT), NbLA-1 overexpression, and NbLA-2 overexpression transgenic plants; D–F are RT-qPCR analysis results of the same gene set in wild-type (WT), NbLA-1 overexpression, and NbLA-2 overexpression transgenic plants; G is the in situ detection result of reactive oxygen species in the leaves of WT, NbLA-1-OE, and NbLA-2-OE tobacco plants by DAB and NBT staining; H is the quantitative analysis result of DAB and NBT staining area as a percentage of total leaf area using ImageJ software. P <0.05, P <0.01, ns = no significant difference; n = 3 biological replicates).

[0026] Figure 9 Experimental results showing that the 126 kDa protein inhibits ethylene, salicylic acid, and reactive oxygen species signaling and promotes PMMoV infection; where A represents the phenotype of wild-type tobacco plants infected with PMMoV and those expressing the 126 kDa protein 3 days after infection; B represents the immunoblotting analysis results of PMMoV coat protein (CP) accumulation in A; C–E represent the phenotypes of wild-type and 126 kDa protein-expressing tobacco plants. PR1 / PR2 (SA) EIN3 / ERF1 (Eth) and BIK1 / EX1RT-qPCR analysis results of the (ROS) gene; C–E represent the results of treatment with H2O or 400 µM asparagine on wild-type and 126 kDa expression plants. PR1 / PR2 (SA) EIN3 / ERF1 (ethylene) and BIK1 / EX1 RT-qPCR analysis results of (reactive oxygen species) genes; F represents in situ ROS detection results of 126 kDa expression plants by DAB and NBT staining; G represents quantitative analysis results of DAB and NBT staining in F using ImageJ. P <0.05, P <0.01, ns = no statistical significance; n = 3 biological replicates).

[0027] Figure 10 Experimental results showing the effect of 126 kDa protein targeting the active region of LA and enhancing its enzymatic activity; where A is a schematic diagram of the predicted asparaginase active sites in NbLA-1 and NbLA-2; B is the interaction between 126 kDa protein and the active regions of NbLA-1 and NbLA-2 asparaginase as shown by the Y2H experiment; C is the relative activity of asparaginase in wild-type and 126 kDa-expressing tobacco plants; D is the detection results of 126 kDa-enhanced in vitro asparaginase activity; E is the quantitative analysis results of asparagine and aspartic acid content in WT and 126 kDa-expressing plants. P <0.05, P <0.01, ns = no statistical significance; n = 3 biological replicates). LA was divided into two parts: a region containing catalytic sites and a region without catalytic sites ( Figure 6 (A)

[0028] Figure 11 Experimental results showing the influence of key binding sites mediating the interaction between the 126 kDa protein and LA on viral infection; where A is the binding interface between the 126 kDa protein and NbLA-1 / 2 predicted by AlphaFold; B is a schematic diagram of the 126 kDa protein, showing the mutation location at the predicted interaction site; C is a yeast two-hybrid assay verifying the interaction between the mutant 126 kDa protein and NbLA-1 / 2; D is the relative asparaginase activity regulated by the 126 kDa mutant; E is a schematic diagram of infectious clones PMMoV (wild-type) and PMMoV (126 kDa mutant); F is the phenotype of PMMoV or PMMoV (126 kDa mutant) infected in tobacco; G is the immunoblotting analysis results of PMMoV coat protein accumulation in experiment F. P <0.01, n=3 biological replicates).

[0029] Figure 12 Experimental results showing how multiple viral effector factors hijack LA to promote viral infection; A shows the interaction between NbLA-1 / 2 and viral proteins P19, 2b, NS3, and NSs in a yeast two-hybrid assay; B shows the results of SDS-PAGE gel imaging stained with Coomassie Brilliant Blue; C shows the results of in vitro experiments demonstrating that P19 enhances asparaginase activity; D shows that co-expression of NbLA-1 / 2 enhances the infection efficiency of Tomato dwarf virus TBSV-GFP in tobacco; E shows the immunoblotting analysis results of Tomato dwarf virus TBSV-GFP accumulation in D; F is a schematic model illustrating how the 126 kDa protein hijacks LA to promote viral infection. P <0.05, P <0.01, n=3 biological replicates).

[0030] Figure 13 The experimental results show that salicylic acid positively regulates the resistance of tobacco to PMMoV; where A represents the phenotypes observed 3 days after inoculation in simulated and PMMoV-inoculated tobacco plants treated with H2O or 500 μM salicylic acid; B represents the results of immunoblotting analysis of PMMoV coat protein (CP) accumulation in PMMoV-infected plants. P <0.05, n=3 independent biological samples).

[0031] Figure 14 The experimental results show the positive regulation of tobacco resistance to PMMoV by ACC; where A represents the phenotypes observed 3 days after inoculation in tobacco plants that were simulated and PMMoV-inoculated, after treatment with H2O or 20 μM ACC; B represents the results of immunoblotting analysis of PMMoV coat protein (CP) accumulation in PMMoV-infected plants. P <0.01, n=3 independent biological samples).

[0032] Figure 15 The experimental results show that H2O2 positively regulates the resistance of Arabidopsis thaliana to PMMoV; where A represents the phenotypes observed 3 days after inoculation in simulated and PMMoV-inoculated Arabidopsis thaliana plants treated with H2O or 1 mM H2O2; B represents the results of immunoblotting analysis of PMMoV coat protein (CP) accumulation in PMMoV-infected plants. P <0.01, n=3 independent biological samples). Detailed Implementation

[0033] This invention provides the application of L-asparaginase in regulating plant antiviral ability, wherein the regulation involves: increasing the expression level of L-asparaginase to decrease plant antiviral ability, or decreasing the expression level of L-asparaginase to increase plant antiviral ability. As one embodiment, the virus includes one or more of pepper mild mottle virus, cucumber mosaic virus, rice stripe leaf blight virus, and tomato dwarf virus. As one embodiment, the plant includes pepper or tobacco.

[0034] As one implementation method, increasing the expression level of L-asparaginase decreases the expression level of plant antiviral response genes, or decreasing the expression level of L-asparaginase increases the expression level of plant antiviral response genes; the response genes include one or more of salicylic acid response genes, ethylene response genes, and reactive oxygen species response genes. As one implementation method, the salicylic acid response gene includes... PR1 , PR2 and PR5 One or more of the following; the ethylene response genes include DUF26 , EIN3 and ERF1 One or more of the following; the reactive oxygen species response genes include BIK1 , EX1 and SIK1 One or more of them.

[0035] This invention, using yeast two-hybrid and luciferase complementation imaging (LCI) techniques, discovered that the 126 kDa protein of PMMoV interacts with LA in vitro and in vivo. LA negatively regulates plant antiviral defense. Asparagine confers antiviral resistance by activating SA, Eth, and ROS pathways. LA negatively regulates SA, Eth, and ROS signaling pathways. The 126 kDa protein of PMMoV enhances PMMoV infection by inhibiting SA, Eth, and ROS signaling pathways. The 126 kDa protein of PMMoV enhances enzymatic activity by binding to the active site of LA. Key sites of interaction between the 126 kDa protein of PMMoV and LA enzymes affect viral infection. Multiple viral effector proteins hijack LA to promote infection. This invention establishes the link between viral infection and host amino acid metabolism, providing a new application perspective for the control of plant viruses. By reducing the expression level of L-asparaginase in plants (e.g., through virus-induced gene silencing), the antiviral ability of plants can be improved.

[0036] Based on the above advantages, this invention provides the application of biomaterials that reduce the expression level of L-asparaginase in improving the antiviral ability of plants. As one embodiment, the plant includes pepper or tobacco. As one embodiment, the biomaterial includes an LA gene silencing vector.

[0037] This invention provides a method for improving the antiviral ability of plants, comprising: reducing the expression level of L-asparaginase in plants using a virus-induced gene silencing method. As one embodiment, the plant includes pepper or tobacco. Based on the above advantages, this invention provides an antiviral plant material, wherein the plant material is a transgenic plant material with reduced L-asparaginase expression compared to the wild type; the plant includes pepper or tobacco. In this invention, the antiviral plant material is a non-stable genetic material with significantly reduced L-asparaginase expression after viral-induced gene silencing methods, etc., which differs from new plant varieties and does not possess uniformity and stability, i.e., there is phenotypic segregation in other phenotypic traits.

[0038] To further illustrate the present invention, the application of reducing L-asparaginase expression in improving plant antiviral ability and the antiviral plant materials provided by the present invention are described in detail below with reference to embodiments and accompanying drawings. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0039] The sequence information of the main genes in this invention was obtained from Solgenomics (https: / / solgenomics.net / ), and the accession numbers are as follows: NbLA-1 (Niben101Scf05643g05001.1), NbLA-2 (Niben101Scf01143g02011.1), CaLA-1 (Capana04g000601), CaLA-2 (Capana10g000717).

[0040] Example Plant materials and growing conditions This invention uses tobacco ( N. benthamiana ) and chili peppers ( C. annuum cv. Zunla-1 was used as plant material. The full-length coding sequence (CDS) of the PMMoV 126 kDa protein was amplified by viral cDNA and inserted into the binary vector pCAMBIA2300 to obtain the recombinant vector 35S:126 kDa. The primer sequences are as follows: pCAM2300-126 kDa-F (SEQ ID NO.1): AGCTTTCGCGAGCTCGGTACCatggcttacacacaacaa; pCAM2300-126 kDa-R (SEQ ID NO.2): CAGGTCGACTCTAGAGGATCCctattgagtcgacacatcaactttg; Among them, the uppercase unbolded sequences AGCTTTCGCGAGCTC (SEQ ID NO.3) and CAGGTCGACTCTAGA (SEQ ID NO.4) are homologous arm sequences; the uppercase bolded sequences GGTACC and GGATCC are restriction endonuclease sites; the lowercase bolded sequences atggcttacacacaacaa (SEQ ID NO.5) and ctattgagtcgacacatcaactttg (SEQ ID NO.6) are gene primer sequences, and the primer sequences in the following text are similar.

[0041] Full-length CDS of tobacco-derived NbLA-1 and NbLA-2 were cloned into the pCAM2300-3HA vector (which was modified with three HA tags by pCAMBIA2300 vector) to obtain recombinant vectors 35S:NbLA-1-3HA and 35S:NbLA-2-3HA. The primer sequences used are as follows: NbLA-1-3HA-F (SEQ ID NO.7): AGCTTTCGCGAGCTCGGTACCatgggtggttgggctatcgcggt; NbLA-1-3HA-R (SEQ ID NO.8): AACATCGTATGGGTAGGATCCttcccaaataccaacttccata; NbLA-2-3HA-F (SEQ ID NO.9): AGCTTTCGCGAGCTCGGTACCatgggttgggctatagcgttgca; NbLA-2-3HA-R (SEQ ID NO.10): AACATCGTATGGGTAGGATCCccaaattgctaattctgtgtga.

[0042] The constructed recombinant vectors 35S:126 kDa, 35S:NbLA-1-3HA, and 35S:NbLA-2-3HA were transformed into plants via Agrobacterium GV3101. Tobacco plants were cultured in an artificial growth chamber under the following conditions: 25℃, 50-60% relative humidity, 3000-4000 LUX light intensity, and a 16-hour light / 8-hour dark photoperiod. Pepper plants were maintained under the same conditions: 25℃, 50-60% relative humidity, 6000-8000 LUX light intensity, and a 16-hour light / 8-hour dark photoperiod.

[0043] The primer sequences used for 126 kDa RT-qPCR are as follows: RT-126 kDa-F (SEQ ID NO.97): AGTGCTTTGTAGCGCTTCTCAC; RT-126 kDa-R (SEQ ID NO.98): CTATTGAGTCGACACATCAAC; RT-Actin-F (SEQ ID NO.99):TTCTACAATGAGCTTCGTGTTGCCC; RT-Actin-R (SEQ ID NO. 100):CATGGCCGGAACATTGAAGGTCTCA.

[0044] Yeast two-hybrid (Y2H) experiment The coding sequence of the PMMoV 126 kDa protein was cloned into the pGBKT7 vector to obtain the pGBKT7–126 kDa recombinant vector. The primer sequences used are as follows: pGBKT7-126 kDa-F (SEQ ID NO.11): GAGGAGGACCTGCATATGGCCATGGAGGCCGAATTCatggcttacacacaacaagctacc; pGBKT7-126 kDa-R (SEQ ID NO.12): ATGCTAGTTATGCGGCCGCTGCAGGTCGACGGATCCctattgagtcgacacatcaactttg.

[0045] The pGBKT7–126 kDa recombinant vector was transformed into Saccharomyces cerevisiae Y2H Gold cells and cultured in SD / –Trp medium until OD600. 600 =0.8, collected and resuspended in 5 mL SD / –Trp medium. Take 1 mL of the carrier... C. annuumThe yeast culture containing the cDNA library was mixed with 5 mL of pGBKT7–126 kDa yeast culture medium in 44 mL of 2×YPD medium and incubated at 30°C for 25 hours. After centrifugation, the cells were resuspended in 10 mL of 0.5×YPDA medium and inoculated onto SD / –Leu / –Trp / –His / –Ade selective plates and incubated at 30°C for 7 days. Positive colonies were verified by Sanger sequencing, and the target protein was identified by BLAST alignment using the NCBI database (https: / / www.ncbi.nlm.nih.gov / ).

[0046] In a two-way yeast two-hybrid experiment, NbLA-1, NbLA-2, NbLA-1-N-terminus, NbLA-1-C-terminus, NbLA-2-N-terminus, NbLA-2-C-terminus, CaLA-1, and CaLA-2, as well as viral effector proteins, were detected and cloned into the pGADT7 and pGBKT7 vectors, respectively. The viral effector proteins were 126 kDa and 126 kDa mutants (see schematic diagram of the mutants). Figure 11 The recombinant vectors constructed included B (artificially synthesized encoding gene), TSWV NSs (NSs), CMV 2b (2b), RSV NS3 (NS3), and TBSV P19 (P19). These recombinant vectors were co-transformed into Y2H Gold cells. The transformed strains were first cultured at 30°C on SD / –Leu / –Trp medium for 3 days, and then transferred to SD / –Trp / –Leu / –His / –Ade medium for interaction verification. The primer sequences are as follows: pGADT7-NbLA-1-F (SEQ ID NO. 13): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggtggttgggctatcgcggt; pGADT7-NbLA-1-R (SEQ ID NO. 14): GATTCATCTGCAGCTCGAGCTCGATGGATCCctattcccaaataccaacttccata; pGADT7-NbLA-2-F (SEQ ID NO.15): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggttgggctatagcgttgca; pGADT7-NbLA-2-R (SEQ ID NO. 16): GATTCATCTGCAGCTCGAGCTCGATGGATCCttaccaaattgctaattctgtgtga; pGADT7-CaLA-1-F(SEQ ID NO.17): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggtggttgggctatagcg; pGADT7-CaLA-1-R(SEQ ID NO.18): GATTCATCTGCAGCTCGAGCTCGATGGATCCctattcccaaataccaacttcc; pGADT7-CaLA-2-F(SEQ ID NO.19): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggttgggcaatagcgttacac; pGADT7-CaLA-2-R(SEQ ID NO.20): GATTCATCTGCAGCTCGAGCTCGATGGATCCttaccaaattgctaattctgagtg; pGADT7-NbLA-1(1-249aa)-F(SEQ ID NO.21): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggtggttgggctatcgcggt; pGADT7-NbLA-1(1-249aa)-R(SEQ ID NO.22): GATTCATCTGCAGCTCGAGCTCGATGGATCCctatccttcaccagtacaagag; pGADT7-NbLA-1(250-327aa)-F(SEQ ID NO.23): CGCTCATATGGCCATGGAGGCCAGTGAATTCatggaagccatcatacgtggaac; pGADT7-NbLA-1(250-327aa)-R(SEQ ID NO.24): GATTCATCTGCAGCTCGAGCTCGATGGATCCctattcccaaataccaacttccata; pGADT7-NbLA-2(1-239)-F(SEQ ID NO.25): CGCTCATATGGCCATGGAGGCCAGTGAATTCatgggttgggctatagcgttgca; pGADT7-NbLA-2(1-239)-R(SEQ ID NO.26): GATTCATCTGCAGCTCGAGCTCGATGGATCCctaaccgtggcctgtagcagag; pGADT7-NbLA-2(240-328)-F(SEQ ID NO.27): CGCTCATATGGCCATGGAGGCCAGTGAATTCatggatgctataatccgtgcaac; pGADT7-NbLA-2(240-328)-R(SEQ ID NO.28): GATTCATCTGCAGCTCGAGCTCGATGGATCCttaccaaattgctaattctgtgtga; pGBKT7-TSWV NSs-F(SEQ ID NO.29): CTGCATATGGCCATGGAGGCCGAATTCatgtcttcaagtgtttatgagtcgatc; pGBKT7-TSWV NSs-R(SEQ ID NO.30): CCGCTGCAGGTCGACGGATCCttattttgatcctgaagcatgtgcttc; pGBKT7-CMV 2b-F(SEQ ID NO.31): CTGCATATGGCCATGGAGGCCGAATTCatggaattgaacgtaggtgc; pGBKT7-CMV 2b-R(SEQ ID NO.32): CCGCTGCAGGTCGACGGATCCtcagaaagcaccttccgcccat; pGBKT7-RSV NS3-F(SEQ ID NO.33): CTGCATATGGCCATGGAGGCCGAATTCatgaacgtgttcacatcgtctg; pGBKT7-RSV NS3-R (SEQ ID NO.34): CCGCTGCAGGTCGACGGATCCctacagcacagctggagag; pGBKT7-TBSV P19-F (SEQ ID NO.35): CTGCATATGGCCATGGAGGCCGAATTCatggaacgagctatacaagg; pGBKT7-TBSV P19-R (SEQ ID NO.36): CCGCTGCAGGTCGACGGATCCttactcgctttctttttcgaagg.

[0047] Firefly luciferase complementation imaging (LCI) detection The complete coding sequence of the 126 kDa protein was inserted into the pCAMBIA1300–nLUC vector, and the coding sequences of NbLA-1, NbLA-2, CaLA-1, and CaLA-2 were cloned into the pCAM1300–cLUC vector, respectively. The vectors were then introduced into Agrobacterium GV3101 strain via electroporation. The bacterial suspension was adjusted to OD0.05. 600 =0.5, mixed at a 1:1 (v:v) ratio and then used to soak tobacco together. N. benthamiana Leaves were sprayed with 1 mM D-luciferase (40901ES03, Yisheng, China) dissolved in 0.01% (v / v) Triton X-100 after 48 hours. Luciferase activity was detected using a plant imaging system (Tanon ABL X5, Tianneng, China).

[0048] 126 kDa-nLUC-F (SEQ ID NO. 37): GGGGGACGAGCTCGGTACCCGGGATCCatggcttacacacaacaagctacc; 126 kDa-nLUC-R (SEQ ID NO. 38): CCCGGGACGCGTACGAGATCTGGTCGACttgagtcgacacatcaactttg; cLUC-NbLA-1-F (SEQ ID NO.39): ATCTCGTACGCGTCCCGGGGCGGTACCatgggtggttgggctatcgcggt; cLUC-NbLA-1-R (SEQ ID NO.40): GATACGAACGAAAGCTCTGCAGGTCGACctattcccaaataccaacttccata; cLUC-NbLA-2-F (SEQ ID NO.41): ATCTCGTACGCGTCCCGGGGCGGTACCatgggttgggctatagcgttgca; cLUC-NbLA-2-R (SEQ ID NO.42): GATACGAACGAAAGCTCTGCAGGTCGACttaccaaattgctaattctgtgtga; cLUC-CaLA-1-F (SEQ ID NO.43): ATCTCGTACGCGTCCCGGGGCGGTACCatgggtggttgggctatagcg; cLUC-CaLA-1-R (SEQ ID NO.44): GATACGAACGAAAGCTCTGCAGGTCGACctattcccaaataccaacttc; cLUC-CaLA-2-F (SEQ ID NO.45): ATCTCGTACGCGTCCCGGGGCGGTACCatgggttgggcaatagcgttacac; cLUC-CaLA-2-R (SEQ ID NO.46): GATACGAACGAAAGCTCTGCAGGTCGACttaccaaattgctaattctgagtg.

[0049] Virus inoculation Agrobacterium cultures carrying full-length infectious clones of PMMoV (pCB301-PMMoV) and tomato dwarf virus (pCB301-TBSV-GFP) were prepared, and the method is described in reference [Han, KL, Zheng, HY, Yan, DK, Zhou, HJ, Jia, ZX, Zhai, YS, Wu, J., Lu, YW, Wu, GW, Rao, SF, et al. (2023). Pepper mild mottle virus coat protein interacts with pepperchloroplast outer envelope membrane protein OMP24 to inhibit antiviral immunity in plants]. Hortic Res-England . 10: uhad046. http: / / doi.org / 10.1093 / hr / uhad046] and [Zhang, H., Feng, H., Lu, X., Wang, CF, Yang, WN, and Li, F. (2020a). An asymmetric bulge enhances artificial microRNA-mediated virus resistance. Plant Biotechnol J 18:608-610. http: / / doi.org / 10.1111 / pbi.13250. Regarding tobacco ( N. benthamiana When inoculating, adjust the Agrobacterium suspension carrying the viral clone to OD. 600 =0.5, then soak the leaves. Plants are cultured in an artificial growth chamber for 3-4 days, followed by assessment of PMMoV symptoms. Early PMMoV infection typically causes leaf margin curling in tobacco and peppers, which then develops into wrinkling and severe mottling. When inoculating peppers, symptomatic tobacco leaves are ground in 1×PBS buffer (2 ml buffer per 1 gram of leaf tissue), and the agglomerate is applied to the surface of pepper leaves that have been abraded with emery. Inoculated plants are cultured in a controlled environment, and viral symptoms are assessed 4-5 days after inoculation.

[0050] Virus-induced gene silencing (VIGS) Silencing fragments (300 bp) of NbLA-1, NbLA-2, CaLA-1, and CaLA-2 were screened using the VIGS design tool (https: / / vigs.solgenomics.net / ). Tandem fragments were generated by fusing NbLA-1 with NbLA-2 and CaLA-1 with CaLA-2 using overlap PCR, and then inserted into the pTRV2 vector to obtain pTRV2-NbLA-1 / 2 and pTRV2-CaLA-1 / 2, respectively. The GUS and PDS genes served as negative and positive controls, respectively. The negative and positive controls used are described in [Chen, J., Zhao, Y., Luo, X. et al. NLR surveillance of pathogen interference with hormone receptors induces immunity. Nature 613, 145–152 (2023). https: / / doi.org / 10.1038 / s41586-022-05529-9]. All constructs were transformed into Agrobacterium GV3101 strain by electroporation. In tobacco ( N. benthamiana When performing gene silencing in Agrobacterium suspension (OD), 600 =0.5) were mixed at a 1:1 ratio and used to soak 4-week-old plants. The PDS gene silencing phenotype appeared after 18 days, and its silencing efficiency was verified by RT-qPCR.

[0051] pTRV2-NbLA-1 / 2-F1 (SEQ ID NO.47): CGAGACGCGTGAGCTCGGTACCGGATCCtgggtggttgggctatcgcggtg; pTRV2-NbLA-1 / 2-R1 (SEQ ID NO.48): CGACCCCAATCTGTAAGCAATAGCcggtggtgatacccgagacggcgc; pTRV2-NbLA-1 / 2-F2 (SEQ ID NO. 49): GCGCCGTCTCGGGTATCACCACCGgctattgcttacagattggggtcg; pTRV2-NbLA-1 / 2-R2 (SEQ ID NO.50): TGTGAGTAAGGTTACCGAATTCTCTAGAccctagcaaatgcttccgctccctc; pTRV2-CaLA-1 / 2-F1 (SEQ ID NO.51): CGAGACGCGTGAGCTCGGTACCGGATCCtgggtggttgggctatagcg; pTRV2-CaLA-1 / 2-R1 (SEQ ID NO.52): GTTTACTAGTCCTCCAGTAGAcggtggatataccagaaacg; pTRV2-CaLA-1 / 2-F2 (SEQ ID NO.53): CGTTTCTGGTATATCCACCGtctactggaggactagtaaac; pTRV2-CaLA-1 / 2-R2 (SEQ ID NO.54): TGTGAGTAAGGTTACCGAATTCTCTAGAagctctaaacattccggttgtat; chili( C. annuum The gene silencing procedure is as follows: Agrobacterium culture carrying pTRV1, pTRV2-GUS, pTRV2-CaLA-1 / 2, and pTRV2-CaPDS is resuspended in buffer (containing 1 / 4 MS medium, pH 6.0, 1% sucrose, 100 μM acetylsalicylic acid, and 0.005% Silwet L-77) to OD. 600 =0.5. Mix each pTRV2 construct with pTRV1 at a 1:1 (v / v) ratio, and use a syringe to inoculate the cotyledons of three-week-old seedlings. Air-dry the plants under light for 1 hour, then incubate in the dark for 24 hours before transferring them to a culture room. Inoculate with PMMoV after 28 days.

[0052] Other primers and their uses 1) The PMMoV 126 kDa gene was amplified and cloned into the pET28a vector to obtain the plasmid pET28a-126 kDa; the plasmid pET28a-126 kDa was transformed into E. coli Rosetta to obtain the 126 kDa protein expressed in prokaryotes; then, the effect of 126 kDa on LA activity was detected in vitro, and the results are shown in […]. Figure 10 D.

[0053] The PMMoV 126 kDa mutant gene (mut) was amplified and cloned into the pET28a vector to obtain the plasmid pET28a-126 kDa(mut). The plasmid pET28a-126 kDa(mut) was transformed into *E. coli* Rosetta to obtain the 126 kDa mutant protein expressed in prokaryotes. The effect of 126 kDa(mut) on LA activity was then detected in vitro; the results are shown below. Figure 11 D.

[0054] The primers for constructing plasmid pET28a-126 kDa are the same as those for constructing plasmid pET28a-126 kDa(mut), the difference being the amplification template. The amplification template for plasmid pET28a-126 kDa is wild-type PMMoV virus, while the amplification template for plasmid pET28a-126 kDa(mut) is based on... Figure 11 The mutation site in B was artificially synthesized, and the specific primer sequences are as follows: FLAG-126 kDa-F (SEQ ID NO.55): AACTTTAAGAAGGAGATATACCATGGCAGATTACAAGGATGATGATGACAAGatggcttacacacaacaagct; FLAG-126 kDa-R (SEQ ID NO.56): CTCAGTGGTGGTGGTGGTGGTGCTCGAGctattgagtcgacacatcaac.

[0055] 2) Amplify the NbLA-1 or NbLA-2 gene and clone it into the pGEX-2TK-GST vector to obtain plasmids pGEX-2TK-NbLA-1-GST and pGEX-2TK-NbLA-2-GST; Plasmids pGEX-2TK-NbLA-1-GST and pGEX-2TK-NbLA-2-GST were transformed into *E. coli* Rosetta to obtain prokaryotically expressed NbLA-1-GAT and NbLA-2-GST proteins; then, in vitro LA activity was detected, and the results are shown in [the table below]. Figure 10 D, Figure 11 D, Figure 12 The primer sequences for C are as follows: NbLA-1-GST-F (SEQ ID NO.57): TCTCGTCGTGCATCTGTTGGATCcatgggtggttgggctatcgcggt; NbLA-1-GST-R (SEQ ID NO.58): TCGTCAGTCAGTCACGATGAATTCttcccaaataccaacttccata; NbLA-2-GST-F (SEQ ID NO.59): TCTCGTCGTGCATCTGTTGGATCcatgggttgggctatagcgttgca; NbLA-2-GST-R (SEQ ID NO.60): TCGTCAGTCAGTCACGATGAATTCccaaattgctaattctgtgtga.

[0056] 3) The PMMoV 126 kDa (mut) gene was amplified and cloned into the pCB301 vector to obtain pCB301-PMMoV 126 kDa (mut). The plasmid pCB301-PMMoV 126 kDa (mut) was transformed into Agrobacterium GV3101 to obtain an infectious PMMoV clone carrying the 126 kDa mutant. Agrobacterium-mediated virus infection experiments were then performed to detect the effect of the 126 kDa mutation site on PMMoV infection. The results are shown in […]. Figure 11 The primer sequences are as follows: pCB301-PMMoV(126mut)-F1 (SEQ ID NO.61): TACAAAGTTGATGTGTCGACTCAATAGcaattacagatagaatcggtgt; pCB301-PMMoV(126mut)-R1 (SEQ ID NO.62): AGCTTGTTGTGTGTAAGCCATtgtagttgtaatttgtttgtaatgtt; pCB301-PMMoV(126mut)-F2 (SEQ ID NO.63): AAATTACAAACAAATTACAACTACAatggcttacacacaacaagct; pCB301-PMMoV(126mut)-R2 (SEQ ID NO.64): ACACCGATTCTATCTGTAATTGctattgagtcgacacatcaactttgta.

[0057] 4) The TBSV P19 gene was amplified and cloned into the pET28a vector to obtain pET28a-P19; the plasmid pET28a-P19 was transformed into *E. coli* Rosetta to obtain prokaryotically expressed P19 protein; then, the effect of P19 on LA activity was detected in vitro; the results are shown in […]. Figure 12 B, Figure 12 The primer sequences for C are as follows: pET28a-P19-F (SEQ ID NO. 65): GTTTAACTTTAAGAAGGAGATATACCATGGcaatggaacgagctatacaag; pET28a-P19-R (SEQ ID NO. 66): CTCAGTGGTGGTGGTGGTGGTGCTCGAGctcgctttctttttcgaagg.

[0058] Hormone, amino acid and H2O2 treatment The following reagents were used: ACC (14A1180001F, PhytoTech, USA), SA (A600817-0250, Sangon, China), H2O2 (H112517, Aladdin, China), Asn (A694341-0100, Sangon, China), and Asp (A600091-0250, Sangon, China). The compounds were dissolved in sterile water and sprayed evenly on the leaves before virus inoculation, followed by two additional sprays at 24-hour intervals. Each treatment had three independent biological replicates.

[0059] Nitroblue tetrazolium (NBT) and diaminobenzidine (DAB) staining Leaves were immersed in staining solutions containing 0.2% NBT (N6639, Sigma-Aldrich, USA) or 1 mg / mL DAB (D8001, Sigma-Aldrich, USA), and O2 was measured respectively. - And H2O2. Samples were incubated in the dark at room temperature for 12–16 hours, followed by boiling in anhydrous ethanol for 10 minutes to remove chlorophyll. The blue color (O2) was quantified using ImageJ software. - The ratio of ) to brown (H2O2) spots.

[0060] Total RNA extraction, RT-PCR and RT-qPCR Total RNA was extracted from tobacco leaves using an RNA extraction kit (R711, Novizan, China). First-strand cDNA was synthesized using a first-strand cDNA synthesis kit (11119ES60, Yisheng, China). PCR amplification products were analyzed by 1% agarose gel electrophoresis and developed under UV light. RT-qPCR was performed using SYBR Green premix (11201ES08, Yisheng, China) under the following conditions: 95°C pre-denaturation for 5 min, followed by 40 cycles (95°C denaturation for 1 sec, 60°C extension for 30 sec). Actin Actin As an internal reference gene. Relative expression levels were measured using 2... -ΔΔCt Calculation by method.

[0061] Table 1 Primer sequences used for RT-qPCR

[0062] RNA sequencing (RNA-seq) and data analysis Nicotiana benthamiana plants were treated with either H2O or 400 μM asparagine. Leaves from three plants in each treatment group were collected for RNA sequencing analysis, performed by Shanghai Paisenno Biotechnology Co., Ltd. After library preparation, paired-end sequencing was performed on the Illumina platform. Expression levels were normalized to fragments per kilobase (FPKM). Principal component analysis (PCA) was performed based on the expression matrix using DESeq software, with log2FoldChange > 1 and... P Differential expression analysis was performed using a threshold of <0.05. Volcano plots were generated using ggplot2, and bidirectional hierarchical clustering analysis of differentially expressed genes was performed using pheatmap. Gene ontology (GO) enrichment analysis was conducted using topGO, and the results were evaluated using the hypergeometric test (…). P Significant GO terms were identified with a p-value <0.05. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed, visualizing the top 15 pathways with the lowest p-values. Supplemental analyses were conducted using the GenesCloud online platform (https: / / www.genescloud.cn / home).

[0063] Detection of LA activity in vivo and in vitro.

[0064] The LA activity in plants was determined using a LA activity assay kit (JL-T1111, Jianglai Biotechnology, China). LA catalyzes the hydrolysis of asparagine to aspartic acid and ammonia; under alkaline conditions, ammonia reacts with hypochlorite and phenol to generate a substance with an absorption peak at 630 nm, thus achieving indirect quantification of LA activity. The specific operation was performed according to the kit instructions.

[0065] Quantitative analysis and statistical processing All statistical analyses were performed using t-tests with GraphPad software (version 10.1.2). Protein abundance quantification was performed using ImageJ software (version 1.51).

[0066] Results and Analysis The results of in vivo and in vitro validation of the interaction between PMMoV 126 kDa protein and LA are shown in [the table below]. Figure 1 The results showed that the PMMoV 126kDa protein interacts with the LA gene in both yeast and plants.

[0067] Experimental results on the negative regulation of host antiviral defense by LA are shown in […]. Figures 2-5 The results showed that silencing the LA-1 and LA-2 genes in peppers and tobacco resulted in LA-1 / 2-silenced plants exhibiting milder PMMoV symptoms and reduced accumulation of the PMMoV coat protein (CP). Transgenic tobacco lines overexpressing NbLA-1-3HA or NbLA-2-3HA showed enhanced susceptibility to PMMoV. This indicates that LA negatively regulates plant antiviral defenses.

[0068] Experimental results showing that asparagine enhances PMMoV resistance by activating hormone signaling and reactive oxygen species pathways are shown in [the table]. Figure 6 and Figure 7 The results showed that Asn treatment significantly alleviated PMMoV symptoms in chili peppers and Nicotiana benthamiana, while Asp promoted infection. RNA sequencing analysis revealed that Asn treatment induced a significant enrichment of genes related to the SA, Eth, and ROS pathways. Histochemical staining with diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) confirmed that Asn promoted ROS accumulation, while Asp inhibited ROS generation. RT-qPCR analysis further revealed that Asn treatment significantly upregulated SA response genes (…). PR1 , PR2 and PR5 Eth response genes ( DUF26 , EIN3 and ERF1 ) and ROS response genes ( BIK1 , EX1 and SIK1 Aspartic acid (SA) is expressed by α, while Asp (P) inhibits its expression. This demonstrates that aspartic acid confers antiviral resistance in plants by activating the SA, Eth, and ROS pathways.

[0069] Experimental results on the negative regulation of ethylene, salicylic acid, and reactive oxygen species signaling pathways by LA are shown in […]. Figure 8 The results showed that SA response genes ( PR1 , PR2 , PR5 ), ethylene response ( DUF26 , EIN3 , ERF1) and reactive oxygen species response ( BIK1 , EX1 , SIK1 The expression of these genes was partially upregulated. In transgenic tobacco plants overexpressing NbLA-1-3HA or NbLA-2-3HA, the expression levels of these genes showed a partial decrease. The insignificant changes in some response genes may be due to the negative impact of elevated reactive oxygen species (ROS) levels on the expression of specific defense genes, but this does not impair overall resistance, a phenomenon previously confirmed (Peleg-Grossman S, Melamed-Book N, Levine A. 2012. ROS production during symbiotic infection suppresses pathogenesis-related gene expression. Plant Signaling & Behavior 7, 409-415.). DAB and NBT staining further confirmed that LA overexpression inhibited ROS accumulation. Therefore, LA negatively regulates the SA, Eth, and ROS signaling pathways.

[0070] Experimental results showing that the 126 kDa protein inhibits ethylene, salicylic acid, and reactive oxygen species signaling and promotes PMMoV infection are shown in [the original text]. Figure 9 The results showed that transgenic tobacco plants expressing 126 kDa tobacco exhibited significantly more severe symptoms after PMMoV inoculation. RT-qPCR analysis revealed differential expression of some SA, Eth, and ROS response genes in 126 kDa overexpressing plants compared to wild-type plants; after Asn treatment, the expression levels of most SA, Eth, and ROS response genes in transgenic 126 kDa overexpressing plants were significantly reduced. DAB and NBT staining confirmed that 126 kDa protein expression inhibited reactive oxygen species accumulation, with the inhibitory effect being more significant after Asn treatment. Therefore, 126 kDa protein enhances PMMoV infection by inhibiting the SA, Eth, and ROS signaling pathways.

[0071] Experimental results showing that the 126 kDa protein targets the active region of LA and enhances its enzymatic activity are shown in [the table below]. Figure 10 The results showed that the yeast two-hybrid assay confirmed the specific binding of the 126 kDa protein to the LA catalytic domain. The presence of the 126 kDa protein significantly enhanced LA activity. The 126 kDa protein enhances enzymatic activity by binding to the LA active site.

[0072] Experimental results on the influence of key binding sites mediating the interaction between the 126 kDa protein and LA on viral infection are shown below. Figure 11The amino acid residues that interact with NbLA-1 and NbLA-2 by the 126 kDa protein were predicted using AlphaFold3 (https: / / golgi.sandbox.google.com / welcome). Yeast two-hybrid experiments showed that yeast expressing the mutant 126 kDa protein exhibited significantly inhibited growth. The mutant 126 kDa protein significantly reduced its ability to enhance LA enzyme activity. Figure 11 (Middle D). Furthermore, PMMoV carrying the 126 kDa mutation (PMMoV-126mut) showed reduced infectivity. This indicates that a key site in the interaction between the 126 kDa protein and the LA enzyme affects viral infection.

[0073] Experimental results on the hijacking of LA by multiple viral effector factors to promote viral infection are shown in [reference needed]. Figure 12 Yeast two-hybrid assays were used to investigate the interactions between effector proteins of cucumber mosaic virus (CMV 2b), rice stripe leaf blight virus (RSV NS3), and tomato dwarf virus (TBSV P19) and NbLA-1 and NbLA-2. In vitro enzymatic assays confirmed that both P19 and NS3 enhanced LA activity. Tobacco leaves were co-impregnated with TBSV-GFP and either NbLA-1-HA or NbLA-2-HA. Fluorescence intensity showed a significant increase in TBSV accumulation. This indicates that multiple viral effector proteins hijack LA to promote infection.

[0074] Experimental results on the positive regulation of tobacco's resistance to PMMoV by salicylic acid (SA) are shown in [the table below]. Figure 13 .

[0075] Experimental results on the positive regulation of tobacco resistance to PMMoV by ACC are shown in […]. Figure 14 .

[0076] The experimental results of H2O2 positively regulating tobacco resistance to PMMoV are shown in […]. Figure 15 .

[0077] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of L-asparaginase in regulating plant antiviral ability, wherein the regulation is: increasing the expression level of L-asparaginase to reduce plant antiviral ability, or decreasing the expression level of L-asparaginase to increase plant antiviral ability.

2. The application according to claim 1, characterized in that, The viruses include one or more of the following: pepper mild mottle virus, cucumber mosaic virus, rice stripe leaf blight virus, and tomato dwarf virus.

3. The application according to claim 1, characterized in that, Increasing the expression level of L-asparaginase decreases the expression level of plant antiviral response genes, or decreasing the expression level of L-asparaginase increases the expression level of plant antiviral response genes; the response genes include one or more of salicylic acid response genes, ethylene response genes, and reactive oxygen species response genes.

4. The application according to claim 3, characterized in that, The salicylic acid response gene includes PR1 , PR2 and PR5 One or more of the following; the ethylene response genes include DUF26 , EIN3 and ERF1 One or more of the following; the reactive oxygen species response genes include BIK1 , EX1 and SIK1 One or more of them.

5. The application according to any one of claims 1-4, characterized in that, The plants mentioned include chili peppers or tobacco.

6. Application of biomaterials with reduced L-asparaginase expression in enhancing plant antiviral capabilities.

7. The application according to claim 6, characterized in that, The plants mentioned include chili peppers or tobacco.

8. The application according to claim 6, characterized in that, The biomaterials include LA gene silencing vectors.

9. A method for improving the virus resistance of plants, characterized in that, include: The expression level of L-asparaginase in plants was reduced by using a virus-induced gene silencing method.

10. A virus-resistant plant material, characterized in that, The plant material is a transgenic plant material with reduced L-asparaginase expression relative to the wild type; the plant includes pepper or tobacco.