Application of Vvbhlh68 gene in regulating anthocyanin synthesis in grape in cooperation with Vverf104 gene

By overexpressing the VvbHLH68 and VvERF104 genes in grapes, the synthesis of anthocyanins and flavonoids was synergistically regulated, solving the problem of grape fruit color regulation, achieving significant anthocyanin and flavonoid synthesis effects, and improving fruit quality.

CN122445701APending Publication Date: 2026-07-24GANSU AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GANSU AGRI UNIV
Filing Date
2026-05-21
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate anthocyanin synthesis in grapes, affecting fruit color formation and market value.

Method used

By overexpressing the VvbHLH68 gene in synergistic overexpression of the VvERF104 gene, the synthesis of anthocyanins and flavonoids in grapes is positively regulated. The specific interaction between VvbHLH68 and VvERF104 enhances the synthesis capacity of anthocyanins and flavonoids in grape callus.

Benefits of technology

It significantly enhanced the synthesis of anthocyanins and flavonoids in grape callus, promoted fruit coloring, provided target genes for fruit color-related breeding, and provided a basis for early germplasm identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445701A_ABST
    Figure CN122445701A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to application of VvbHLH68 gene and VvERF104 gene in regulation of anthocyanin synthesis in grape. The VvbHLH68 gene transcription factor is subcellularly located in the nucleus, and specific interaction exists between the VvbHLH68 gene and the VvERF104 gene, which is verified by yeast two-hybrid and luciferase complementation assay. The co-transformation test shows that the VvbHLH68 gene and the VvERF104 gene can significantly enhance the anthocyanin and flavonoid synthesis capacity of grape callus in synergistic action.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the VvbHLH68 gene in conjunction with the VvERF104 gene in regulating grape anthocyanin synthesis. Background Technology

[0002] 1.1 Color is an important appearance quality trait of grapes, and anthocyanins are an important reason for the formation of fruit color.

[0003] Grapes (Vitis vinifera L.) are a fruit tree-based economic crop. As one of the most widely cultivated fruit trees globally, the quality of their fruit coloring plays a crucial role in the industry. The color of the grape is not only the first impression it gives to consumers, directly influencing market value and consumer purchasing preferences, but also a key factor determining the quality of grape winemaking and processing. In the table grape market, brightly colored and uniformly shaped grapes tend to attract more consumers and command higher prices. In the winemaking industry, the depth and hue of grape color directly determine the color, taste, and flavor of the wine, thus affecting its competitiveness and price positioning in the international market.

[0004] The color change of grape berries is a complex and orderly physiological process closely related to chlorophyll degradation and anthocyanin synthesis. In the early stages of fruit development, the grape skin is rich in chlorophyll, exhibiting a bright green color. This is because chlorophyll can absorb light energy and participate in photosynthesis, providing energy and material basis for fruit growth and development. As the fruit gradually enters the color-changing stage, chlorophyll synthesis gradually decreases, while the degradation process accelerates. Simultaneously, anthocyanin synthesis also begins during the color-changing stage. Anthocyanins are an important class of water-soluble flavonoids. The multiple phenolic hydroxyl groups in their chemical structure endow them with unique optical properties—they can absorb light of specific wavelengths, thus enabling plant tissues to display a variety of colors such as red and purple, and are a major material basis for the rich diversity of plant colors.

[0005] 1.2 Light conditions are a key environmental factor for anthocyanin synthesis in fruits.

[0006] Light signals influence the expression of nearly 3,000 genes in plants, and the main regulators of these gene expressions are light-regulated transcription factors, among which HY5 is the most critical and representative. HY5 can directly or indirectly bind to the promoter regions of about one-third of the genes in plants, thereby regulating their expression. Changes in these genes directly affect the light-regulated growth and development processes of plants, including photomorphogenesis. In darkness, HY5 is ubiquitinated and degraded by COP1; under light, accumulated HY5 has the ability to regulate the expression of downstream target genes. At the transcriptional and protein levels, HY5 is regulated by photoreceptors and COP / DET / FUS, demonstrating that HY5 is downstream in this regulatory system. In other words, the light signal-photoreceptor-COP / DET / FUS system affects the expression of a large number of genes in plants by regulating HY5, thereby ultimately regulating photomorphogenesis in plants.

[0007] 1.3 The bHLH family is widely involved in anthocyanin metabolism and is an important regulator of anthocyanin synthesis.

[0008] To date, the bHLH family in many plants has been identified and its functions analyzed. In the model plant Arabidopsis thaliana, 162 bHLHs have been identified, divided into 26 subfamilies. Among them, the IIIf members of Arabidopsis thaliana are considered to be involved in flavonoid biosynthesis. bHLH transcription factors play a core regulatory role in the anthocyanin metabolic pathway in plants, precisely regulating the anthocyanin synthesis process through positive and negative regulation and protein-protein interactions, making them important regulators of anthocyanin synthesis. Experiments have shown that transient overexpression of FabHLH110 in pink strawberry petals significantly promotes anthocyanin biosynthesis, while inhibiting its expression through virus-mediated gene silencing significantly reduces anthocyanin content, indicating that FabHLH110 has a positive regulatory effect on anthocyanin biosynthesis. In sorghum (Sorghum bicolor L.), genetic analysis demonstrated that overexpression of SbPLSH1 induced anthocyanin deposition and purple petioles in Arabidopsis thaliana. Deep sequencing of the jujube genome identified three key regulatory factors—ZjGL3a, ZjGL3b, and ZjTT8—from 138 bHLH members. Experiments confirmed that these genes play important functions in the anthocyanin synthesis pathway. Phylogenetic analysis of 115 bHLH genes in the grape vine genome, combined with protein interaction network prediction, located the candidate gene VdbHLH037, and its regulatory role in grape anthocyanin accumulation was verified through transient expression experiments.

[0009] 1.4 The ERF family is involved in the regulation of anthocyanin metabolism in fruits.

[0010] Numerous related studies have shown that the ERF subfamily, as an important branch of the AP2 / ERF family, has members widely involved in the regulation of secondary metabolism of flavonoids in plants, with a particularly prominent role in the regulation of anthocyanin synthesis. Furthermore, the regulatory mechanisms of ERF members differ among different species. For example, in Rosa hybrida, researchers used virus-induced gene silencing technology to transiently silence the RhERF113 gene in rose petals. The results showed that, compared to the control group without silencing, the petals with the silenced RhERF113 gene completely faded after 15 days of culture, and almost no anthocyanins were detected in the petals. This indicates that the RhERF113 gene plays a crucial regulatory role in anthocyanin synthesis in rose petals. In pears, a dual-luciferase assay revealed that PbERF22 can significantly activate the PbUFGT promoter, promoting the biosynthesis of anthocyanins in early-maturing pears.

[0011] The study found that the specific interaction between VvbHLH68 and VvERF104 proteins significantly increased the anthocyanin content in callus tissue after co-transformation. This confirms that the synergistic effect of VvbHLH68 and VvERF104 can significantly enhance the anthocyanin synthesis capacity of grape callus tissue, indicating that the VvbHLH68-VvERF104 module can promote anthocyanin accumulation and can serve as a target gene for fruit color-related breeding, providing a basis for early germplasm identification.

[0012] When VvbHLH68-OE and VvbHLH68-RNAi transgenic callus were cultured under light for 15 days, VvbHLH68-OE transgenic callus showed deeper and faster staining, which was significantly better than the empty vector and wild-type control group, while VvbHLH68-RNAi transgenic callus showed no staining. Summary of the Invention

[0013] To address the aforementioned issues, this invention provides the application of the VvbHLH68 gene in synergy with the VvERF104 gene in regulating grape anthocyanin synthesis.

[0014] To achieve the above objectives, the present invention provides the following technical solution:

[0015] This invention provides the application of the VvbHLH68 gene in synergy with the VvERF104 gene in regulating grape anthocyanin synthesis.

[0016] Preferably, overexpression of the VvbHLH68 gene synergistically with overexpression of the VvERF104 gene positively regulates grape anthocyanin synthesis.

[0017] This invention also provides the application of the VvbHLH68 gene in synergy with the VvERF104 gene in regulating the synthesis of grape flavonoids.

[0018] Preferably, overexpression of the VvbHLH68 gene synergistically with overexpression of the VvERF104 gene positively regulates grape flavonoid synthesis.

[0019] Preferably, the nucleotide sequence of the VvbHLH68 gene is shown in SEQ ID No. 1.

[0020] Preferably, the nucleotide sequence of the VvERF104 gene is shown in SEQ ID No. 2.

[0021] Preferably, the grapes include grape callus tissue.

[0022] The beneficial effects of this invention are:

[0023] The VvbHLH68 gene transcription factor is subcellularly located in the cell nucleus. Yeast two-hybrid and luciferase complementation assays confirmed a specific interaction between the VvbHLH68 and VvERF104 genes. Co-transformation experiments showed that the synergistic effect of the VvbHLH68 and VvERF104 genes significantly enhanced the synthesis of anthocyanins and flavonoids in grape callus. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0025] Figure 1 Construction of the BD-VvbHLH68 vector; (A) Cloning of BD-VvbHLH68; (B) PCR of BD-VvbHLH68 in E. coli;

[0026] Figure 2 For the detection of VvbHLH68 transcriptional self-activation;

[0027] Figure 3 Screening of the VvbHLH68 library; (A) Screening of some blue-turning strains from the VvbHLH68 library; (B) PCR amplification detection diagram;

[0028] Figure 4 Point-to-point validation of VvbHLH68 and VvERF104 proteins;

[0029] Figure 5Construction of NLuc-VvbHLH68 and CLuc-VvERF104 vectors; (A) Schematic diagram of NLuc-VvbHLH68 and CLuc-VvERF104 vector construction; (B) PCR diagram of NLuc-VvbHLH68; (C) PCR diagram of CLuc-VvERF104;

[0030] Figure 6 LCA detection between VvbHLH68 and VvERF104; Note: Nluc represents pCAMBlA1300-Nluc, Cluc represents pCAMBlA1300-Cluc;

[0031] Figure 7 Bioinformatics analysis of VvERF104; (A) evolutionary relationship analysis (B) tertiary structure prediction (C) protein sequence alignment;

[0032] Figure 8 Construction of the VvERF104-eGFP vector (A) Amplification of VvERF104-eGFP; (B) PCR detection of Agrobacterium;

[0033] Figure 9 To obtain and identify grape callus co-transformed with VvbHLH68 and VvERF104 and VvERF104-OEs; (A) Screening of callus co-transformed with VvbHLH68 and VvERF104; (B) Screening of callus overexpressed with VvERF104; (C) qRT-PCR detection of callus.

[0034] Figure 10 (A) Phenotype of callus tissue under light conditions; (B) Anthocyanin content diagram; (C) Determination of anthocyanin content; (D) Determination of flavonoid content;

[0035] Figure 11 This study describes the expression of genes related to the anthocyanin synthesis pathway in callus tissue. Detailed Implementation

[0036] This invention provides the application of the VvbHLH68 gene in synergy with the VvERF104 gene in regulating grape anthocyanin synthesis. In this invention, overexpression of the VvbHLH68 gene in synergy with overexpression of the VvERF104 gene preferably positively regulates grape anthocyanin synthesis.

[0037] This invention also provides the application of the VvbHLH68 gene in synergy with the VvERF104 gene in regulating grape flavonoid synthesis. In this invention, overexpression of the VvbHLH68 gene in synergy with overexpression of the VvERF104 gene preferably positively regulates grape flavonoid synthesis.

[0038] In this invention, the nucleotide sequence of the VvbHLH68 gene is shown in SEQ ID No. 1, and is as follows:

[0039] ATGGCTGGAAACCCTAACTGGTGGAGCATGAATAACATGCGACCACCCTCATCGCAGCAGTCTTCTTCTGCTTTCTTATCTCCCCCCACTCTCTTCTCTCCTAGATATGTACCTGAATCTTCTTCATCACTGCCTTTCAATTCTTTGGCTGACACCCCAGACCTTCCACACTCATGGAGCCAGCTACTTCTGGTTGGATCATCAGGTGAGGAAGATAGGTTTGGTTCAGTGATTTTCAAGCTAAGAATGTGGAATGGGAAGACCAAATCTTGAATACATCCCAGAGGATTCCCGCAGTTGATGTAAAGCAAGAAGTAGTCTCTCAAAGTAGCCACCCCTATAATCATGGAGATGAAGGCTTTCAGACATCAAGACCTCCTTGGTCCCAAATCATGCCAGTTTCCTCTCCTAGGTCGTGCGTTACAAACTTGAGCACTAACATATTAGACTTCTCTAACAAGGCTGGTGTTAGGAATCAACATGCAGATCATTCAACTGAGTGTAACAGCACGGCGACTGGTGGGGCATGTAAAAAGGCTAGGGTTCAACCCTCTCCGAGCCAACCACCACTAAAGGTGAGAAAGGAGAAGCTGGGTGATAGAATAACAGCCCTTCACCAGTTAGTTTCCCCATTTGGAAAGACTGACACTGCTTCTGTCTTGTTAGAAGCTATTGGGTATATCAGATTCCTTCAGGGTCAAATTGAGGCCCTTAGCTCTCCGTACTTGGGCAATGCATCAGGAAACATGAGGAACCAACAGTGTGTTCAAGGCGAAATGAATTGTATATTTCCCAAAGACCCTGGTCAGCTCCTGAACGACAACTGCCTCAAAAGAAAAGGATCAGCACCTAATCAGCAGGATACACAAGATGCACCAAAGGACTTGAAGAGTAGAGGGTTGTGCCTGGTTCCGGTTTCGTGCACTCAGCAGGTTGGAAGTGACAATGGAGCCGATTATTGGTCTCCGGCTCTCGGTGGAGGGTTTTGA。

[0040] In the present invention, the nucleotide sequence of the VvERF104 gene is as shown in SEQ ID No. 2, specifically as follows:

[0041] ATGGGAGATGAAGCTTCATCACTGCAACTCATCCACCACCTCCTCCTCTCCGAATTTGATTCTATGGAGACCTTCATCTCTCATGTAAGTCATTCGTTACAATCTTCGGCCTCTGATTCAAGTGTTTCTACCGATGATATTACTCAAGTTTCTGAGAACCCGAAACTCCATGAAGATGAAAGCAACGCTTTTCTCTTCGACTGCTCTACCTCTTCTCCATCTGCCGTTTTCCAGTTTCAAAACGAATCCCCAAAACCTTCCAGATTAAGTCATCGGCGACCCCCAGTCAGCATCTCCCTTCCTCCGCCACCAATTTCTCACACTTCGTCTTCGTTAGATTCCGGCGAGAGCAGGCACTATCGAGGCGTGCGCCGCCGGCCTTGGGGAAAATTCGCCGCGGAGATTCGAGACCCGAATCGGAGAGGACATAGGGTTTGGCTTGGAACCTTCGAGACAGCCATTGAAGCCGCCAGAGGTTATGATCGAGCTGCTTTCAAGATGCGTGGCTCCAAAGCTGTTCTTAATTTTCCTCTCGAAGCAGGGAATTGGTCGGATTCTGACCCACCGGCGACTTCCATCCGGAAAAGGGAGAGAGAAAGCGAAAGTGAAAGTGAAGAGAGCAAACAACCGGAGATAAAGGCTTTAAAGCAAGAAGAAGCCTCACCGGATTCTGACAGCCCCGTGGTGACAGAGGCGGCGGCGGCTAATGTTTTGCAGGCGGGTCCGCTAACGCCGTCAAGTTGGAGGACCGTTTGGGAGGAGAGAGACATGGAGGGGACATTCCATTTGCCTCCGTTAACCCCGTTATCACCCCATCCTTGGGTTGGATATTCTCGGCTCGTAACTTAA。

[0042] In the present invention, the grape preferably includes grape callus.

[0043] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] Screening VvbHLH68 interacting proteins and analyzing the anthocyanin synthesis function of candidate proteins.

[0046] 1.1 Materials and Methods

[0047] 1.1.1 Test Materials

[0048] Yeast two-hybrid strain: Yeast Y2H.

[0049] Yeast two-hybrid vectors: pGBKT7, pGADT7, pGBKT7-Lam, pGADT7, pGBKT7-53 vectors.

[0050] LUC experiment: VvbHLH68 vector Nluc, VvERF104 vector: Cluc.

[0051] The subcellular localization material was Nicotiana benthamiana.

[0052] 1.1.2 Carrier Construction and Connection

[0053] 1.1.2.1 Gene Cloning

[0054] Amplification system: cDNA: 1.5 μL, upstream primer: 1 μL, downstream primer: 1 μL, Green Taq Mix: 10 μL, ddH2O: 6.5 μL, total volume 20 μL.

[0055] PCR reaction procedure: initial denaturation at 95°C for 5 min; 50 cycles, each cycle consisting of denaturation at 95°C for 30 s, annealing at 58°C for 45 s, extension at 72°C for 1 min 30 s; final extension at 72°C for 10 min; storage at 4°C.

[0056] PCR products were separated by 1% agarose gel electrophoresis, and the target fragments were detected using a UV imaging system. The gel recovery procedure for the DNA target fragments was performed according to the kit instructions.

[0057] 1.1.2.2 Linearization of the carrier

[0058] The system is as follows: PGBKT7 and PGADT7 vectors

[0059] Table 1 System

[0060] AD / BD carriers 3 μL BamHI 1 μL Total volume: 30 μL 10×quickCut green buffer 3 μL <![CDATA[ddH2O]]> 23 μL

[0061] The system is as follows: Nluc and Cluc vectors

[0062] Table 2 System

[0063] NLuc / Cluc vector 3 μL SacI 1 μL XbaI 1 μL Total volume: 30 μL 10×quickCut green buffer 3 μL <![CDATA[ddH2O]]> 22 μL

[0064] Digest at 37°C for 30 min, then incubate at 37°C.

[0065] 1.1.3 Introduction of recombinant plasmid into E. coli DH5α competent cells

[0066] (1) Take 50 μL of DH5α competent cells, mix them thoroughly with the ligation product and set aside.

[0067] (2) Place it on ice for 30 min, then place it in a 42°C water bath for 1 min 30 s, and then place it on ice for 5 min.

[0068] (3) Add 600 μL of LB medium to the mixture of competent cells and ligation products, and culture with shaking at 37°C and 180 rpm for 1 hour.

[0069] (4) Centrifuge at 12000 rpm for 2 minutes. Discard part of the supernatant, mix the remaining supernatant with the bacterial cells, spread evenly on the surface of LB solid medium containing 50 mg·mL⁻¹ antibiotic, and then place the plate in a 37°C constant temperature incubator for overnight incubation.

[0070] 1.1.4 Identification of positive clones

[0071] Positive bacterial plaques growing on the surface of the culture medium were picked and diluted to a concentration of 50 mg / mL. -1 The bacteria were cultured in Kana's LB liquid medium. After the culture became turbid, primers were added for PCR verification. If bands appeared, the samples were sent to a sequencing company for sequencing.

[0072] 1.1.5 Plasmid Extraction

[0073] The appropriate bacterial culture was added to LB medium containing antibiotics and cultured overnight. The target plasmid DNA was then extracted using a plasmid extraction kit.

[0074] 1.1.6 Transformation of Agrobacterium with recombinant plasmids

[0075] The specific steps are as follows:

[0076] (1) Mix 5 μL of recombinant vector with 50 μL of Agrobacterium competent cells thoroughly and place on ice for 30 min.

[0077] (2) Freeze the mixture with liquid nitrogen for 5 min, and then quickly transfer it to a 37°C water bath for 5 min.

[0078] (3) First, perform an ice bath treatment for 2 minutes, then add 1 mL of LB liquid medium without antibiotics, and incubate for 3 hours at 28°C and 6,000 rpm.

[0079] (4) Centrifuge at 1,2000 rpm for 2 minutes, and retain 100 μL of liquid for resuspending. Spread the bacterial culture onto LB solid medium containing 50 mg·mL⁻¹ Str and 50 mg·mL⁻¹ Rif. Incubate at 28°C for 2 to 3 days.

[0080] (5) Pick the spots that grow on the culture medium into LB liquid culture medium, incubate overnight, and then perform PCR verification.

[0081] 1.1.7 Yeast two-hybrid screening for VvbHLH68 interacting proteins

[0082] 1.1.7.1 VvbHLH68 Self-Activation Detection

[0083] 1. Take competent yeast cells and add 10 μL of pGBKT7-VvbHLH68 recombinant plasmid, 3 μL of pre-warmed carrier DNA, and 600 μL of PEG / LiAc solution to each tube. Immediately shake vigorously. Incubate at 30°C and 200 rpm on a shaker for 30 min.

[0084] 2. After incubation for 30 min, add 70 μL LDMSO, invert to mix, and heat shock at 42°C for 15 min (turn on the water bath beforehand). Invert the tube every 3 min (the movement should be as gentle as possible) to improve the yeast conversion efficiency. After incubation, immediately insert the centrifuge tube into ice and let it stand for 5 min.

[0085] Centrifuge at 3.25°C, 12000 rpm for 1 min, discard the supernatant, then use a pipette to remove the remaining liquid (avoiding the removal of precipitate), and finally resuspend the yeast cells in 100 μL of sterile deionized water.

[0086] 4. Take 100 μL of the resuspended yeast cells and spread them onto SD / -Trp, SD / -Trp(x-α-gal) and SD / -Trp(x-α-gal+Aba) plates (Kana), respectively, and incubate them upside down in a 30 °C incubator for 2 days.

[0087] 1.1.7.2 Mating hybridization

[0088] (1) Pick fresh colonies from the culture plate with a white sterilization pipette tip, add them to 600 μL SD / -Trp liquid medium, and place them in an incubator at 30°C for 2-3 days.

[0089] (2) Transfer 200 μL of the above bacterial culture to an Erlenmeyer flask containing 50 ml of SD / -Trp liquid medium, place it in a shaker at 30°C and 250-270 rpm, and incubate with shaking until the OD of the bacterial culture reaches a certain value. 600 =0.8.

[0090] (3) Centrifuge at 3000 rpm for 5 min, discard the supernatant, and resuspend the cells in 4-5 mL of SD / -Trp liquid.

[0091] (4) Take 1 mL of AD bacterial solution and add it together with 4-5 mL of bait bacterial solution into a 2 L sterile conical flask.

[0092] (5) Add 45 ml of 2×YPDA liquid culture medium (containing 50 mg / L Kan) to the conical flask, and rinse the EP tube containing AD bacterial solution with 1 mL of this liquid culture medium. Repeat the rinsing twice.

[0093] (6) Place the culture in a 30°C environment and shake it at 30-50 rpm for 20-24 h. After 20 h of culture, observe the bacterial culture for clover-shaped conjugates using a 40x microscope. If clover-shaped conjugates are present, centrifuge at 3000 rpm for 10 min.

[0094] (7) Rinse the conical flask with 50 mL of 0.5×YPDA liquid medium containing Kana, and then resuspend the cells in the same medium. Next, resuspend the cells in 10 mL of 0.5×YPDA liquid medium containing Kana.

[0095] (8) Spread the above-treated mixture evenly on SD / -Trp / -Leu / −His / −Ade solid culture plates, 180 μL per plate, for a total of 50 plates. After spreading, seal the culture plates and place them in an incubator at 30°C for 3-5 days.

[0096] (9) The grown colonies were re-seeded in SD / -Trp / -Leu / -His / -Ade / X-α-gal medium and cultured to observe whether the plaques turned blue. If they turned blue, the colonies were shaken again in SD / -Trp / -Leu / -His / -Ade liquid medium and cultured overnight at 30°C and 250-270 rpm. Using the sequences at both ends of the insertion site during library construction as primers, the bacterial culture was amplified by PCR and sent for sequencing and sequence alignment.

[0097] 1.1.7.3 Verification of interactions between candidate interacting proteins

[0098] The candidate interacting gene was co-transformed with VvbHLH68 into competent yeast cells. 100 μL of the transformation product was evenly spread onto SD / -Trp / -Leu dual-deficient medium plates and incubated upside down in a yeast incubator at 30°C for 3–7 days. After the emergence of circular positive colonies, a point-to-point verification experiment was performed. Positive colonies co-transformed with the candidate interacting protein and VvbHLH68 were spotted onto quadruple-deficient medium plates (SD / -Trp / -Leu / -Ade / -His and SD / -Trp / -Leu / -Ade / -His + X-α-gal), and their growth and color changes were observed.

[0099] 1.1.8 Luciferase Complementation Assay

[0100] A bimolecular luciferase reporter vector containing VvbHLH68 was co-transformed into Agrobacterium competent cells. After activation, Agrobacterium infection solution was prepared using the same subcellular localization method as described in Chapter 2. The bacterial solution was injected into healthy Nicotiana benthamiana leaves using an injection-permeation method. The leaves were initially cultured in darkness for 24 hours, then placed in a light incubator and watered. Between 36 and 48 hours, a luciferin substrate was sprayed onto the injection sites on the leaves. The fluorescence signal intensity was detected using a live in vivo imaging system, and the presence of interactions between the target proteins was determined based on the intensity of the fluorescence signal.

[0101] 1.1.9 Determination of Anthocyanin and Flavonoid Content

[0102] Accurately weigh 2.0 g of callus tissue, grind it into powder in liquid nitrogen, and then transfer it to a 10 mL centrifuge tube. Add 5 mL of 1% HCl-methanol solution to the centrifuge tube. Extract in an ice bath under dark conditions for 1 h, shaking 3-4 times during extraction. Centrifuge at 10000 rpm to collect the supernatant, transfer it to a 20 mL graduated test tube, add 5 mL of 1% HCl-methanol solution to the residue, shake to mix, extract for 2 h, centrifuge again, combine the supernatants from the two extractions, and bring the volume to 20 mL in a graduated test tube. Using 1% HCl-methanol solution as a blank reference for zeroing, measure the absorbance at wavelengths of 325 nm, 600 nm, and 530 nm, repeating each sample three times. The relative content of flavonoids is expressed as the absorbance at 325 nm, i.e., OD. 325 μg / g; the relative anthocyanin content in the fruit is expressed as the difference between the absorbance values ​​at 530 nm and 600 nm, i.e., U(OD). 530 -OD 600 ) μg / g.

[0103] 1.1.10 qRT-PCR analysis

[0104] Grape callus tissue treated with light was sampled, flash-frozen in liquid nitrogen, and RNA was extracted. RNA extraction was performed using the RNAplant-RTR2303 plant RNA extraction kit (Zhongke Ruitai Biotechnology Co., Ltd., Beijing), following the instructions. The CDS sequences of anthocyanin synthesis-related genes (Vv4CL, VvCHS, VvPIF, VvHY5, VvUFGT, VvDFR) were identified through literature review. Primers were designed based on the CDS sequences (Table 3) for qRT-PCR analysis.

[0105] Table 3 Real-time fluorescence quantification of anthocyanin synthesis pathway genes

[0106] Gene upstream primer Downstream primer VvHY5 SEQ ID No.3:TCAGGCGATGGTCAGAGAAAAA SEQ ID No.4: CCTCTCCAAGTCTTTGACCCTC VvPIF4 SEQ ID No.5: AGGAGGAGATGCTAAAGAGGGT SEQ ID No.6:CAGTAGGTTCAAGCGTCTCTGT Vv4CL SEQ ID No.7:CGGATGTTTCCAACCTTGACAC SEQ ID No.8:GAGGTGGTTGGAGATGGGAAT VvCHS SEQ ID No.9: CTCAGGTGTAGAAATGCCTGGT SEQ ID No.10: TCTCTGCAAGATCCTTGGCAAT VvDFR SEQ ID No.11: GTGTTGCTGAAGCCATTGAAT SEQ ID No.12: TCACACGTCAAATTCAATGGCC VvF3H SEQ ID No.13: CACTATGGGCACTAGGTGTTGT SEQ ID No.14: CCATCCAAGAAGCCAGAAGAGT VvUFGT SEQ ID No.15: GTGCATTTGCCAGAAGGTTTCT SEQ ID No.16: TCTGTGAAAACCCCACCTTCAA

[0107] 1.2 Results and Analysis

[0108] 1.2.1 Conversion and self-activation detection of VvbHLH68

[0109] To construct a yeast two-hybrid bait vector for the VvbHLH68 gene, BD primers targeting the VvbHLH68 gene were designed (Table 4). PCR-specific amplification yielded the VvbHLH68 target fragment of the expected size. Figure 1(A). The target fragment was then ligated into the pGBKT7 (BD) vector to construct a recombinant expression vector. The ligation product was transformed into competent *E. coli* cells, and positive colonies were selected. Positive clones were screened using PCR. The results showed that the PCR products obtained through screening were completely identical in size to the target gene fragment (A). Figure 1 (B) Finally, the single colonies identified as positive were inoculated into LB liquid medium containing ampicillin and cultured under suitable conditions. After the culture was completed, the recombinant plasmid was extracted and sent to a biological sequencing company for sequencing verification to confirm the correctness of the target gene insertion and the accuracy of the sequence.

[0110] Table 4 Primer Sequences

[0111] VvbHLH68-BD-F SEQ ID No.17: aggccgaattcccggggatccTTATGGCTGGAAACCCTAACTGG VvbHLH68-BD-R SEQ ID No.18: ccgctgcaggtcgacggatccAAACCCTCCACCGAGAGCC

[0112] After constructing the pGBKT7-VvbHLH68 recombinant plasmid, it was transformed into Y2H yeast competent cells. The transformed bacterial cultures were plated on mono- and triple-deficient medium plates and cultured under suitable conditions for screening. The results showed that the yeast transformed with the recombinant plasmid grew normally and formed distinct colonies on SD / -Trp mono-deficient medium plates, but no colonies grew on SD / -Trp / -Leu / -His triple-deficient medium plates. This result indicates that the VvbHLH68 protein does not exhibit self-activation activity in the yeast two-hybrid system and can be used as a bait protein for subsequent screening experiments of interacting proteins. Figure 2 ).

[0113] 1.2.2 Yeast library screening and PCR identification

[0114] Using pGBKT7-VvbHLH68 as the bait protein, interacting proteins with VvbHLH68 were initially screened on quadruple-deficient medium. Positive clones were seeded on quadruple-deficient medium containing X-α-gal for colorimetric verification. Figure 3 (A) Select well-grown, blue-colored positive colonies for PCR verification. Figure 3 (B) Products with different PCR fragment sizes were selected and sequenced to obtain their CDS sequences. The sequences were compared with those in the NCBI database, and it was found that genes such as VvERF104 and VvB6-F may interact with VvbHLH68. The selected genes were found to be mainly related to plant abiotic stress responses.

[0115] 1.2.3 Point-to-point verification of the interaction between VvbHLH68 protein and interacting proteins

[0116] Recombinant plasmids pGBKT7-VvbHLH68, pGADT7-VvERF104, and pGBKT7-VvbHLH68+pGADT7 were co-transfected into yeast competent cells. The positive control was pGBKT7-p53+pGADT7-T, and the negative control was pGBKT7-p53+pGADT7-Lam. The plasmids were plated on plates with two-cell deficiency, two-cell deficiency plus X-α-gal, four-cell deficiency, and four-cell deficiency plus X-α-gal, respectively. Growth and color changes were observed on different culture media. Results are as follows: Figure 4 As shown, yeast cells co-transformed with pGBKT7-VvbHLH68 and pGADT7-VvERF104, as well as the positive control, grew and exhibited a blue phenotype on selective medium plates with and without X-α-gal (two-fold and four-fold X-α-gal deficiency). However, the negative control and pGBKT7-VvbHLH68+pGADT7 grew only on plates without X-α-gal deficiency and did not turn blue; they failed to grow on plates without X-α-gal (four-fold and four-fold X-α-gal deficiency). This indicates an interaction between VvbHLH68 and VvERF104.

[0117] 1.2.4 Luciferase complementation assay of VvbHLH68 and VvERF104 proteins

[0118] To clarify the interaction characteristics between VvbHLH68 and VvERF104 proteins, such as Figure 5 As shown in Figure A, this experiment constructed recombinant expression vectors of NLuc-VvbHLH68 and CLuc-VvERF104. The target gene fragment was obtained by PCR amplification. Figure 5 (B) The size of the electrophoretic bands is consistent with the size of the target gene fragment. After the DNA fragments are ligated to NLuc and CLuc vectors respectively, the ligation products are transformed into E. coli, such as... Figure 5 As shown in C, the positive clones were then sequenced for verification.

[0119] The successfully constructed Agrobacterium tumefaciens NLuc-VvbHLH68 and CLuc-VvERF104 bacterial cultures were mixed in equal proportions and injected into tobacco leaves using a transient co-transformation method. After 24 h of dark incubation, the luciferase activity and fluorescence signal of the tobacco leaves were detected. The results showed that compared with the control groups (NLuc-VvbHLH68+CLuc, CLuc-VvERF104+NLuc), the luciferase complementary reporter system in the NLuc-VvbHLH68 and CLuc-VvERF104 co-treatment group showed a significantly enhanced specific fluorescence signal. Figure 6The study further confirmed that VvbHLH68 and VvERF104 can specifically interact within plant cells, and that they can bind to form a stable protein complex, which plays an indispensable role in the regulation of grape anthocyanin biosynthesis.

[0120] 1.2.5 Evolutionary relationship and protein structure analysis of VvERF104

[0121] ERF104 gene sequences from 14 different species were obtained through BLAST sequence alignment in the NCBI database, and a phylogenetic tree was constructed based on these sequences. The results showed that grape VvERF104 is most closely related to rose RrERF104. Figure 7 (A). Next, the tertiary structure of the VvERF104 protein was predicted, and its structural model is as follows: Figure 7 As shown in Figure B. Next, multiple sequence alignment analysis was performed on the ERF104 protein sequences of the above 14 species. The results showed that the ERF104 protein sequences were generally highly conserved across different species, all containing the typical AP2 conserved domain. Figure 7 (C)

[0122] 1.2.6 VvbHLH68, in synergy with VvERF104, significantly enhanced anthocyanin synthesis in grape callus.

[0123] 1.2.6.1 Construction and transformation of VvERF104 overexpression vector

[0124] The CDS sequence of the VvERF104 gene was downloaded from the NCBI database. Specific primers were designed for PCR amplification, yielding a target fragment of 861 bp consistent with the expected size. The target fragment was constructed into the pART-CAM-eGFP vector to obtain the pART-CAM-VvERF104-eGFB fusion expression vector, and the recombinant plasmid was ligated and transformed. The recombinant plasmid was transformed into *E. coli* DH5α competent cells. After PCR identification of positive clones, positive clones were selected for sequencing analysis to confirm the sequence was correct. The correctly sequenced recombinant plasmid was transformed into *Agrobacterium* competent cells, and bacterial PCR detection showed a band consistent with the size of the target gene. Figure 8 ).

[0125] 1.2.6.2 Co-transformation of VvbHLH68 and VvERF104 and the acquisition and identification of VvERF104 overexpression grape callus

[0126] Grape callus overexpressing VvbHLH68 was obtained by infecting it with Agrobacterium carrying the VvERF104 gene to obtain co-transformed callus simultaneously overexpressing VvbHLH68 and VvERF104; simultaneously, wild-type grape callus was obtained by infecting it with Agrobacterium vulgaris carrying the VvERF104 gene to obtain VvERF104 single-gene overexpressing callus. The infected callus was inoculated onto selective medium containing 10 mg·L⁻¹ kanamycin for resistance selection. After multiple subcultures, newly formed resistant callus was successfully obtained. Figure 9 (A and B). The selected resistant callus tissues were transferred to culture media with the same antibiotic concentration and cultured for another 30 days. Genomic DNA was extracted and qRT-PCR was performed. The results showed that all tested materials were positive callus tissues. Figure 9 (C). Subsequently, VvbHLH68 co-transformed with VvERF104 and VvERF104 overexpression lines were randomly selected from genetically stable materials, and after propagation and culture, they were used for subsequent functional analysis.

[0127] 1.2.6.3 Analysis of the synergistic regulation of anthocyanin and flavonoid accumulation in grape callus by VvbHLH68 and VvERF104

[0128] To elucidate the functions of VvbHLH68 and VvERF104 in flavonoid metabolism in grape fruit, transgenic grape callus was treated with light, with wild-type (WT) and empty vector (eGFP) callus as controls. The results showed that compared with wild-type and empty vector controls, the VvbHLH68-OEs and VvbHLH68 / VvERF104 treatment groups exhibited significantly deeper coloration in the callus, displaying a more pronounced red phenotype; while the VvERF104-OEs group showed only weak coloration, and the VvbHLH68-RNAi group showed almost no coloration, with significant differences. Figure 10 (A). Further visual comparison of the color of anthocyanin extract from callus tissue was conducted. Figure 10 In the B group, the extracts of callus tissue from the VvbHLH68-OEs and VvbHLH68 / VvERF104 groups were dark red, while those from the VvERF104-OEs and VvbHLH68-RNAi groups were nearly colorless, consistent with the phenotypic observation results. This preliminarily indicates that VvbHLH68 can have a synergistic effect with VvERF104 and positively regulate the accumulation of grape anthocyanins.

[0129] The anthocyanin content of different treatment groups was determined. Figure 10(C). The results showed that there was no significant difference in anthocyanin content between WT and eGFP calli, which were 0.13 μg / g and 0.137 μg / g, respectively. The anthocyanin content of VvbHLH68-OEs calli was significantly increased to 0.4 μg / g, approximately three times that of wild-type calli. The anthocyanin content of VvbHLH68 / VvERF104 co-transformed calli was 0.5 μg / g, 3.7 times that of the control group. This indicates that co-expression of both can further enhance the accumulation of anthocyanins in grape calli. The anthocyanin content of VvERF104-OEs calli was only 0.09 μg / g, and the content of VvbHLH68-RNAi was the lowest at 0.008 μg / g, both of which significantly inhibited anthocyanin synthesis. The above results indicate that VvbHLH68 is a key positive regulator of anthocyanin synthesis and has a synergistic regulatory effect with VvERF104, while VvERF104 alone has a weak effect on anthocyanin accumulation and may be an inhibitor of anthocyanin synthesis.

[0130] Flavonoids are another important class of secondary metabolites in grape berries. This study also measured the flavonoid content in different treatment groups. Figure 10 (D). The results showed that the flavonoid content in WT and eGFP callus tissues was similar, at 0.37 μg / g and 0.39 μg / g, respectively. The flavonoid content in VvbHLH68-OEs callus tissues was significantly increased to 0.61 μg / g, and further increased to 0.76 μg / g in the VvbHLH68 / VvERF104 co-transformation group, more than twice that of the control group. The flavonoid content in the VvERF104-OEs group and the VvbHLH68-RNAi group were 0.33 μg / g and 0.29 μg / g, respectively, both significantly lower than that in the control group, indicating that VvbHLH68 also positively regulates flavonoid synthesis, and its synergistic effect with VvERF104 is also reflected in the flavonoid metabolic pathway.

[0131] 1.2.6.4 Analysis of the expression of genes related to the anthocyanin synthesis pathway in grape callus after co-transformation of VvbHLH68 and VvERF104 and overexpression of VvERF104.

[0132] To further elucidate the molecular mechanisms by which VvbHLH68 and VvERF104 regulate flavonoid metabolism, real-time quantitative qRT-PCR analysis was performed on seven key structural genes (Vv4CL, VvCHS, VvDFR, VvF3H, VvHY5, VvPIF4, and VvUFGT) in the flavonoid synthesis pathway. Figure 11Vv4CL (4-coumarate-coenzyme A ligase) and VvCHS (chalcone synthase) are key early enzymes in flavonoid synthesis. Compared with the WT control group, Vv4CL expression was upregulated 2.2-fold and VvCHS expression was upregulated 1.5-fold in the VvbHLH68-OEs group; in the VvbHLH68 / VvERF104 co-transformation group, Vv4CL expression reached 1.9-fold and VvCHS expression significantly increased to 4.3-fold, both significantly higher than the single-transformation group. VvDFR (dihydroflavonol reductase) and VvUFGT (flavonoid-3-O-glucosyltransferase) are core downstream genes in anthocyanin synthesis. In the VvbHLH68-OEs group, the expression levels of VvDFR and VvUFGT were upregulated to 14.7-fold and 19-fold, respectively. In the VvbHLH68 / VvERF104 co-transformation group, the expression levels of the above genes were further increased to 19-fold and 18-fold, respectively. In the VvERF104-OEs group, the expression levels of VvDFR, VvF3H, and VvUFGT were significantly lower than those of the control, further confirming that VvERF104 cannot activate the anthocyanin-specific synthesis pathway on its own. VvHY5 (photomorphogenesis factor) and VvPIF4 (phytochrome interaction factor) are key regulatory genes connecting light signaling and flavonoid metabolism. In the VvbHLH68-OEs group, the expression levels of VvHY5 and VvPIF4 were upregulated to 2.1-fold and 7-fold, respectively. In the VvbHLH68 / VvERF104 co-transformation group, the expression level of VvPIF4 was further increased to 8.2-fold.

[0133] This invention, by screening interacting proteins of VvbHLH68 and verifying their functions in anthocyanin synthesis, reveals the interaction between VvbHLH68 and VvERF104 and their synergistic regulatory role in grape anthocyanin synthesis. This provides a foundation for further in-depth analysis of the specific molecular mechanisms by which these two proteins regulate anthocyanin synthesis—such as target genes, downstream pathways, and external signals. Furthermore, the interacting proteins screened in this study also include several proteins related to abiotic stress responses, indicating that VvbHLH68 may simultaneously participate in both abiotic stress responses and anthocyanin synthesis in grapes. The regulatory relationship between these two processes will be an important direction for future research.

[0134] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of VvbHLH68 gene in synergy with VvERF104 gene in regulating grape anthocyanin synthesis.

2. The application according to claim 1, characterized in that, Overexpression of the VvbHLH68 gene, in conjunction with overexpression of the VvERF104 gene, positively regulates grape anthocyanin synthesis.

3. Application of VvbHLH68 gene in synergy with VvERF104 gene in regulating grape flavonoid synthesis.

4. The application according to claim 3, characterized in that, Overexpression of the VvbHLH68 gene, in conjunction with overexpression of the VvERF104 gene, positively regulates the synthesis of grape flavonoids.

5. The application according to claim 1 or 3, characterized in that, The nucleotide sequence of the VvbHLH68 gene is shown in SEQ ID No.

1.

6. The application according to claim 1 or 3, characterized in that, The nucleotide sequence of the VvERF104 gene is shown in SEQ ID No.

2.

7. The application according to claim 1 or 3, characterized in that, The grapes include grape callus tissue.