A shrna combination library targeting gage2a, recombinant expression vectors comprising the same and use thereof

Abstract

The application belongs to the technical field of bioengineering, and particularly relates to a shRNA combination library targeting GAGE2A, a recombinant expression vector containing the same and application thereof. Research results show that the shRNA combination library can efficiently inhibit the expression of GAGE2A in hepatocellular carcinoma cells, further interfere with the downstream signal pathways mediated by GAGE2A, block abnormal activation of tumor cell survival and drug resistance related pathways, and improve the sensitivity of cancer cells to chemotherapeutic drugs. The present study not only provides an important experimental basis for in-depth understanding of the molecular mechanism of hepatocellular carcinoma, but also reveals the potential clinical transformation value of the GAGE2A-targeted shRNA combination library in improving the response of hepatocellular carcinoma to chemotherapy.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a shRNA combinatorial library targeting GAGE2A, a recombinant expression vector containing it, and their applications. Background Technology

[0002] Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide, characterized by high incidence and mortality rates. Despite significant advancements in surgical resection, liver transplantation, local ablation, and targeted immunotherapy in recent years, early diagnosis remains challenging, resulting in most patients being diagnosed at an advanced stage and losing the opportunity for radical treatment. For patients with advanced HCC, systemic therapy, primarily chemotherapy and targeted therapy, remains the mainstay. However, the development of tumor drug resistance severely limits its clinical efficacy, leading to poor patient prognosis.

[0003] Cancer / Testis Antigens (CTAs) are a family of proteins that are expressed only in testicular germ cells in normal tissues, but are aberrantly expressed in various tumors. Due to their high tumor specificity, CTAs have become ideal targets for tumor diagnosis and immunotherapy. GAGE2A is a member of the GAGE ​​family, and recent studies have found that it is significantly overexpressed in hepatocellular carcinoma (HCC) tissues, and its high expression is closely related to poor patient prognosis. However, the specific functional mechanism of GAGE2A in the development and progression of HCC remains unclear, and there are currently no effective interventions targeting this protein.

[0004] RNA interference (RNAi) technology has been widely used in gene function research and cancer therapy exploration due to its ability to efficiently and specifically silence target gene expression. Short hairpin RNA (shRNA) can be introduced into cells via vectors, where it is processed into small RNA molecules with interfering activity, achieving sustained and stable gene silencing. Compared to single shRNAs, a library of combined shRNAs can simultaneously target multiple sites of the same gene, significantly improving silencing efficiency, avoiding off-target effects, and exhibiting stronger functional intervention effects.

[0005] Therefore, developing a shRNA combinatorial library targeting GAGE2A and systematically evaluating its impact on the malignant phenotype and chemotherapy resistance of liver cancer cells has significant scientific value and clinical translational potential. Summary of the Invention

[0006] To address the limitations of existing technologies in intervening in the progression of hepatocellular carcinoma, this invention aims to provide a shRNA combinatorial library targeting GAGE2A, a recombinant expression vector containing it, and their applications. This shRNA combinatorial library can effectively silence the expression of the GAGE2A gene in hepatocellular carcinoma, thereby exerting an anti-tumor effect.

[0007] Previous histochemical analyses have shown that the GAGE2A gene is significantly overexpressed in primary liver cancer tissues. Therefore, this study constructed a shRNA combinatorial library targeting the GAGE2A gene family using genetic engineering techniques, aiming to effectively silence this gene expression and systematically explore the value of the shRNA combinatorial library targeting GAGE2A in hepatocellular carcinoma phenotypes and clinical treatment.

[0008] In a first aspect, the present invention provides a shRNA combinatorial library targeting GAGE2A, the shRNA combinatorial library containing three independent shRNA sequences, the nucleotide sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0009] shRNA-1 (SEQ ID NO.1):

[0010] TTACGTGCGGGCTCTGGATTTTTCAAGAGAAAATCCAGAGCCCGCACGTAATTTTT

[0011] shRNA-2 (SEQ ID NO.2):

[0012] GCATCAGAAAGCCGAATGTTTTTCAAGAGAAAACATTCGGCTTTCTGATGCTTTTT

[0013] shRNA-3 (SEQ ID NO.3):

[0014] TCAGCAAATACATCGTGAATGTTCAAGAGACATTCACGATGTATTTGCTGATTTTT

[0015] In some embodiments of the present invention, the shRNA combinatorial library is constructed by tandemly connecting three independent shRNA sequences, and the tandem nucleotide sequence is shown in SEQ ID NO.4.

[0016] shRNA combinatorial library (SEQ ID NO.4)

[0017] 1 CCGGCTACGT AGAGCCTCCT GAAATTCAAG AGAATTTCAG GAGGCTCTAC GTAGTTTTTG

[0018] 61 GAGGGCCTAT TTCCCATGAT TCCTTCATAT TTGCATATAC GATACAAGGC TGTTAGAGAG

[0019] 121 ATAATTAGAA TTAATTTGAC TGTAAACACA AAGATATTAG TACAAAATAC GTGACGTAGA

[0020] 181 AAGTAATAAT TTCTTGGGTA GTTTGCAGTT TTAAAATTAT GTTTTAAAAT GGACTATCAT

[0021] 241 ATGCTTACCG TAACTTGAAA GTATTTCGAT TTCTTGGGTT TATATATCTT GTGGAAAGGA

[0022] 301 CGCGGGATCC CGGTACGTAG AGCCTCCTGA AATGTCAAGA GACATTTCAG GAGGCTCTAC

[0023] 361 GTATTTTTGG AGGGCCTATT TCCCATGATT CCTTCATATT TGCATATACG ATACAAGGCT

[0024] 421 GTTAGAGAGA TAATTAGAT TAATTTGACT GTAAACACAA AGATATTAGT ACAAAATACG

[0025] 481 TGACGTAGAA AGTAATAATT TCTTGGGTAG TTTGCAGTTT TAAAATTATG TTTTAAAATG

[0026] 541 GACTATCATA TGCTTACCGT AACTTGAAAG TATTTCGATT TCTTGGGTTT ATATATCTTG

[0027] 601 TGGAAAGGAC GCGGGATCCC GGACGTAGAG CCTCCTGAAA TGATCAAGAG ATCATTTCAG

[0028] 661 GAGGCTCTAC GTTTTTTG

[0029] In a second aspect, the present invention provides a recombinant expression vector containing the coding gene of the shRNA combinatorial library of claim 1 or 2.

[0030] In some embodiments of the present invention, the expression vector is pSilencer-U6.

[0031] In a third aspect, the present invention provides the use of the above-described shRNA combinatorial library or the above-described recombinant expression vector in the preparation of a drug for treating liver cancer.

[0032] In some embodiments of the present invention, the drug is used to inhibit the expression of chemotherapy resistance-related genes MCL1, BCL2 and BCL2L1 in hepatocellular carcinoma.

[0033] In some embodiments of the present invention, the drug is used to increase the sensitivity of liver cancer cells to chemotherapy drugs.

[0034] In some embodiments of the present invention, the chemotherapy drug is cisplatin or paclitaxel.

[0035] In some embodiments of the present invention, the drug is used in combination with a chemotherapy drug, wherein the chemotherapy drug is cisplatin or paclitaxel.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] This invention utilizes genetic engineering technology to tandemly clone multiple independent shRNA sequences targeting the GAGE2A gene into the pSilencer-U6 eukaryotic expression vector. PCR identification and sequence determination confirmed the successful construction of a recombinant shRNA library targeting GAGE2A. Transfection of this library into hepatocellular carcinoma cells demonstrated its effective downregulation of GAGE2A protein expression levels using Western blotting. Further functional studies showed that this shRNA library significantly inhibited the expression of chemotherapy resistance-related genes MCL1, BCL2, and BCL2L1 in hepatocellular carcinoma, thereby weakening the chemotherapy resistance of tumor cells. This study provides a novel strategy for molecular targeted intervention in hepatocellular carcinoma and demonstrates promising clinical application prospects. Attached Figure Description

[0038] Figure 1This is the PCR validation result of the shRNA combinatorial library targeting GAGE2A in Example 1;

[0039] Figure 2 This is the validation result of the intervention efficiency of the shRNA combinatorial library targeting GAGE2A in liver cancer in Example 2 (***, P < 0.001).

[0040] Figure 3 This is the validation result of the GAGE2A-targeting shRNA combinatorial library in Example 3 on the expression of chemotherapy resistance-related genes in liver cancer (***, P < 0.001).

[0041] Figure 4 This is the functional validation result of the GAGE2A-targeting shRNA combinatorial library in Example 4 against drug resistance in liver cancer cells (***, P < 0.001). Detailed Implementation

[0042] Example 1: Construction and PCR validation of a shRNA combinatorial library targeting GAGE2A

[0043] 1. Vector linearization processing

[0044] Take 2 μg of pSilencer-U6 plasmid and add 1 μL each of BamHI and HindIII restriction endonucleases to a 50 μL enzyme digestion system. Mix well and incubate at 37 °C for 4 hours. After enzyme digestion, load the entire reaction solution onto a 1.2% agarose gel and electrophores at 100 V for 30 minutes. After electrophoresis, quickly cut the target band under UV light and purify and recover it using a commercial DNA gel extraction kit to obtain a linearized vector for later use.

[0045] 2. Target fragment connection

[0046] The shRNA combinatorial library sequence targeting the GAGE2A gene was chemically synthesized in its entirety (approximately 700 bp) by Shanghai Sangon Biotech Co., Ltd., yielding a double-stranded DNA fragment. This fragment was directionally inserted into the linearized pSilencer-U6 vector using Gibson seamless cloning technology. The ligation reaction system was as follows: 1 ng of the linearized vector was mixed with 0.5 ng of the synthesized fragment, 10 μL of 2×Gibson recombinant cloning premix (D7010S, Beyotime) was added, and sterile water was added to a total volume of 20 μL. After gentle mixing, the mixture was incubated in a 50 °C water bath for 2 hours to complete the recombination ligation.

[0047] 3. Transformation and positive clone screening

[0048] Add 4 μL of the ligation product to 100 μL of DH5α competent cells, incubate on ice for 30 minutes, then heat shock in a 42 °C water bath for 90 seconds, and quickly transfer to ice to cool for 5 minutes. Add 500 μL of SOB medium to the bacterial culture and incubate at 37 °C with shaking at 220 rpm for 60 minutes to resuscitate. Spread 50 μL of the resuscitated bacterial culture evenly on an LB solid bacterial culture plate containing 100 μg / mL ampicillin, and incubate upside down in a 37 °C incubator overnight.

[0049] The following day, several single colonies were picked from the plates and inoculated into LB broth containing ampicillin, and cultured overnight at 37 °C with shaking. PCR identification was performed using the extracted recombinant plasmid as a template. The reaction mixture consisted of 1 μL plasmid template (approximately 50 ng), 10 μL 2×PCR premix, 1 μL of 5 μM upstream and downstream primer mixture, and ddH2O to a final volume of 20 μL. The amplification program was set as follows: 95 °C denaturation for 15 seconds, 60 °C annealing for 15 seconds, and 72 °C extension for 60 seconds, for a total of 30 cycles. The amplification products were analyzed by 1.5% agarose gel electrophoresis (100 V, 45 minutes), and positive clones were screened based on the size of the target band.

[0050] PCR cloning results confirmed that the shRNA combinatorial library targeting GAGE2A (hereinafter referred to as the shRNA combinatorial library) sequence was successfully constructed into the pSilencer-U6 plasmid. Figure 2 ).

[0051] Example 2: Evaluation of the GAGE2A silencing efficiency of a shRNA combinatorial library targeting GAGE2A

[0052] Human liver cancer cell line HUH7 in the logarithmic growth phase was used, with 2 × 10⁶ cells per dish. 6 Cells were seeded at a density of 1000 μL in 6 cm cell culture dishes. After 24 hours of culture, the original culture medium was discarded and replaced with 4 mL of serum-containing DMEM complete medium. In a sterile 1.5 mL microcentrifuge tube, 200 μL of Opti-DMEM serum-depleted medium, 12 μL of Fugene6 transfection reagent, and 4 μg of shRNA library plasmid targeting GAGE2A were added sequentially, gently pipetting and mixing after each addition. The mixture was incubated at room temperature for 15 minutes to allow for complete transfection complex formation. Then, the mixture was slowly added dropwise to the cell culture dish, gently shaken to mix, and placed in an incubator for further culture.

[0053] Thirty-six hours after transfection, the culture medium was discarded, and the cells were gently washed once with pre-chilled PBS. 200 μL of RIPA lysis buffer containing a mixture of protease inhibitors was added to each dish. Adherent cells were scraped from the bottom of the dish using a cell scraper, and the cell suspension was collected and transferred to pre-chilled 1.5 mL centrifuge tubes. The cells were incubated on ice for 30 minutes for lysis. Subsequently, the cells were centrifuged at 4 °C and 12000 × g for 15 minutes. The supernatant was carefully transferred to a new centrifuge tube to obtain the total protein extract.

[0054] Quantitative analysis of protein samples was performed using the BCA method. 20 μg of total protein was taken from each sample, and an appropriate amount of 5×SDS-PAGE protein loading buffer was added. The volume was adjusted to the same level with sterile water, and the samples were denatured in a 98 °C metal bath for 5 minutes. The treated samples were separated by 12% SDS-polyacrylamide gel electrophoresis and wet-transferred to a PVDF membrane at a constant current of 200 mA for 45 minutes. After transfer, the membrane was blocked in TBST blocking buffer containing 5% skim milk powder at room temperature for 1 hour. Then, GAGE2A specific primary antibody was added, and the membrane was incubated overnight at 4 °C on a shaker. The next day, the membrane was washed three times with TBST for 10 minutes each time, and then incubated with HRP-labeled secondary antibody at room temperature for 1 hour. After washing again, the membrane was developed and images were acquired using a Bio-Rad chemiluminescence imaging system.

[0055] Western blot analysis showed that, compared with the control group, the intensity of the GAGE2A protein band was significantly reduced after transfection with the shRNA combo library targeting GAGE2A, indicating that the constructed shRNA combo library can effectively silence the expression of the GAGE2A gene in HUH7 cells. Figure 2 ).

[0056] Example 3: Validation of the regulation of chemotherapy resistance gene expression in liver cancer by a shRNA combinatorial library targeting GAGE2A.

[0057] Human liver cancer cell line HUH7 in the logarithmic growth phase was used, with 2 × 10⁶ cells per dish. 6Cells were seeded at a density of 1000 mcg in 6 cm cell culture dishes. They were transfected with either a control empty vector plasmid or a shRNA library plasmid targeting GAGE2A. After 36 h of transfection, cells were collected, and total RNA was extracted using TRIZol reagent according to the kit instructions. The RNA was then reverse transcribed into cDNA using the Thermo RevertAid cDNA synthesis kit. The expression of key chemotherapy resistance genes MCL1, BCL2, and BCL2L1 in liver cancer was then detected using the SYBR Green assay. The experimental method followed the SYBR Green kit instructions, and the reaction mixture was as follows: 0.5 μL cDNA, 1 μL 5 μM primer mixture, 8.5 μL ddH2O, and 10 μL 2×SYBR master mixture. The reaction was performed according to the standard real-time quantitative PCR program: 95°C pre-denaturation for 10 min; 95°C denaturation for 30 s; 60°C annealing and extension for 30 s; 40 cycles. After the reaction, the expression of the genes was detected using the SYBR Green assay. ΔΔ The relative expression of each gene in different groups was calculated using the Ct method. Primer sequences are shown in the table below:

[0058]

[0059] According to the results of real-time quantitative PCR, transduction of a GAGE2A-targeting shRNA combinatorial library can significantly inhibit the expression of chemotherapy resistance genes. Figure 3 ).

[0060] Example 4: Functional validation of a GAGE2A-targeting shRNA combinatorial library enhancing the sensitivity of liver cancer cells to chemotherapeutic drugs

[0061] 1. Cell seeding and transfection

[0062] Human hepatocellular carcinoma cell line HUH7 in logarithmic growth phase was transfected with a GAGE2A-targeting shRNA library plasmid and a negative control plasmid, respectively, according to the method described in Example 3. Thirty-six hours after transfection, the culture medium was discarded, cells were washed once with trypsin, and then digested with an appropriate amount of trypsin to collect the cells. After counting, the cell density was adjusted to 5 × 10⁶ cells / year. 4 Units / mL are available for use.

[0063] 2. Treatment with chemotherapy drugs

[0064] The cell suspension was seeded into 96-well plates at 100 μL per well (containing 5 × 10³ cells), with four replicates per group. Cells were incubated overnight at 37 °C in a 5% CO2 incubator to allow cell adhesion. The following day, the original culture medium was discarded, and fresh DMEM complete medium (200 μL per well) containing different concentrations of cisplatin or paclitaxel was added. A control group without the drug and a blank control group without cells were also included. Drug treatment lasted for 48 hours.

[0065] 3. Alamar blue cell viability assay

[0066] After drug incubation, 20 μL of Alamar blue reagent was added to each well, gently vortexed to mix, and incubated for another 4 hours in an incubator. The fluorescence intensity of each well was measured using a microplate reader at an excitation wavelength of 560 nm and an emission wavelength of 590 nm. Cell viability was calculated based on the fluorescence readings: Cell viability (%) = (Fluorescence value of experimental group - Fluorescence value of blank well) / (Fluorescence value of control group without drug - Fluorescence value of blank well) × 100%.

[0067] 4. Experimental Results

[0068] Alamar blue assay results showed that HUH7 cells exhibited significantly enhanced sensitivity to both cisplatin and paclitaxel after transfection with a GAGE2A-targeting shRNA library. Compared with the negative control group, the IC50 values ​​of both cisplatin and paclitaxel were significantly decreased after treatment with the shRNA library (P < 0.001). This result demonstrates that the GAGE2A-targeting shRNA library can effectively inhibit the resistance of liver cancer cells to chemotherapy drugs and promote their sensitivity to cisplatin and paclitaxel. Figure 4 ).

Claims

1. A shRNA combinatorial library targeting GAGE2A, characterized in that, The shRNA combinatorial library contains three independent shRNA sequences, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

2. The shRNA combinatorial library targeting GAGE2A according to claim 1, characterized in that, The shRNA combo library is constructed by tandemly connecting three independent shRNA sequences, and the tandem nucleotide sequence is shown in SEQ ID NO.

4.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the encoding gene of the shRNA combinatorial library as described in claim 1 or 2.

4. The recombinant expression vector of claim 3, wherein, The expression vector is pSilencer-U6.

5. The use of the shRNA combinatorial library of claim 1 or 2 or the recombinant expression vector of claim 3 or 4 in the preparation of a drug for treating liver cancer.

6. Use according to claim 5, characterized in that, The drug is used to inhibit the expression of chemotherapy resistance-related genes MCL1, BCL2, and BCL2L1 in hepatocellular carcinoma.

7. Use according to claim 5, characterized in that, The drug is used to increase the sensitivity of liver cancer cells to chemotherapy drugs.

8. Use according to claim 8, characterized in that, The chemotherapy drug is cisplatin or paclitaxel.

9. Use according to claim 5, characterized in that, The drug is used in combination with a chemotherapy drug, wherein the chemotherapy drug is cisplatin or paclitaxel.

Images