Gnras targeting ttr v50m mutant gene and application

CN122648423APending Publication Date: 2026-08-28THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610881765.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-17
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

[0004]本发明的主要目的在于提供一种靶向TTR V50M突变基因的gRNA及应用,以解决现有技术中难以在基因层面校正TTR V50M突变基因位点的问题

Benefits of technology

[0015] By applying the technical solution of this invention and utilizing the above-mentioned gRNA targeting the TTR V50M mutant gene, it is possible to directly correct the TTR V50M mutant gene site at the gene level, achieve a lasting and stable therapeutic effect through precise base editing, thereby reducing the risks associated with long-term drug administration and lowering treatment costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122648423A_ABST
    Figure CN122648423A_ABST
Patent Text Reader

Abstract

The application provides a gRNA for targeting a TTR V50M mutant gene and an application. The gRNA for targeting the TTR V50M mutant gene is a nucleotide sequence as shown in any one of SEQ ID NOs: 2-21. The problem that it is difficult to correct a TTR V50M mutant gene site at a gene level in the prior art can be solved. The application is suitable for the field of gRNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gRNA, and more specifically, to a gRNA that targets the TTR V50M mutant gene and its application. Background Technology

[0002] Transthyretin (TTR) V50M mutations can significantly disrupt the stability of TTR protein tetramers, leading to the aggregation of misfolded TTR monomers into insoluble extracellular amyloid protein fibers, which are abnormally deposited in multiple tissues such as the heart, peripheral nerves, and gastrointestinal tract, thereby triggering hereditary transthyretin amyloidosis (hATTR), especially myocardial amyloidosis, which seriously endangers the life and health of patients.

[0003] Current treatments for this type of disease mostly rely on long-term medication, which makes it difficult to fundamentally correct the mutated gene. Furthermore, long-term medication may lead to cumulative adverse reactions and high treatment costs. Therefore, providing a technical solution that can directly correct the TTR V50M mutated gene site at the gene level is a pressing issue that needs to be addressed in the treatment of transthyretin amyloidosis. Summary of the Invention

[0004] The main objective of this invention is to provide a gRNA targeting the TTR V50M mutant gene and its application, in order to solve the problem that it is difficult to correct the TTR V50M mutant gene site at the gene level in the prior art.

[0005] To achieve the above objectives, according to a first aspect of the present invention, a gRNA targeting the TTR V50M mutant gene is provided, wherein the gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 2-21.

[0006] Furthermore, the above-mentioned gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 7-10.

[0007] To achieve the above objective, according to a second aspect of the present invention, a gRNA expression vector targeting the TTR V50M mutant gene is provided, wherein the gRNA expression vector contains a nucleotide sequence encoding the gRNA.

[0008] To achieve the above objectives, according to a third aspect of the present invention, a CRISPR base editing system for targeting the TTR V50M mutant gene is provided, wherein the CRISPR base editing system comprises the aforementioned gRNA.

[0009] To achieve the above objectives, according to a fourth aspect of the present invention, a composition for targeting the TTR V50M mutant gene is provided, the composition comprising: a gRNA system and the above-mentioned CRISPR base editing system, wherein the gRNA system is selected from any one or more of the following: the above-mentioned gRNA, or the above-mentioned gRNA expression vector, or the above-mentioned CRISPR base editing system.

[0010] Furthermore, the aforementioned CRISPR base editing system includes: a) a Cas enzyme or a nucleic acid encoding the aforementioned Cas enzyme, and b) a base deaminase or a nucleic acid encoding the aforementioned base deaminase.

[0011] Furthermore, the aforementioned base deaminases include one or more of adenosine deaminase, cytidine deaminase, or uracil glycosyltransferase.

[0012] Furthermore, the aforementioned CRISPR base editing system includes the base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e.

[0013] To achieve the above objectives, according to a fifth aspect of the present invention, the use of the above-described gRNA, the above-described gRNA expression vector, the above-described CRISPR base editing system, or the above-described composition in the preparation of a medicament for treating transthyretin amyloidosis disease is provided.

[0014] Furthermore, the aforementioned drugs include formulations administered intravenously.

[0015] By applying the technical solution of this invention and utilizing the above-mentioned gRNA targeting the TTR V50M mutant gene, it is possible to directly correct the TTR V50M mutant gene site at the gene level, achieve a lasting and stable therapeutic effect through precise base editing, thereby reducing the risks associated with long-term drug administration and lowering treatment costs. Attached Figure Description

[0016] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0017] Figure 1 The diagram shows the spectral results of a plasmid capable of expressing SpRY Cas9-ABE8e according to Embodiment 1 of the present invention.

[0018] Figure 2 The diagram shows the spectral results of a plasmid capable of expressing SpRY Cas9-ABE9e according to Embodiment 1 of the present invention.

[0019] Figure 3The sequencing results diagram according to Embodiment 2 of the present invention is shown. Wherein, Figure 3 Figure A shows the sequencing results of sgRNA 1. Figure 3 Figure B shows the sequencing results of sgRNA 2. Figure 3 The image in C represents the sequencing results of sgRNA 3. Figure 3 The image in the middle (D) shows the sequencing results of sgRNA 4.

[0020] Figure 4 The diagram shows the sequencing results of the SpRY Cas9-ABE8e and sgRNA 1 combination according to Example 3 of the present invention.

[0021] Figure 5 The diagram shows the sequencing results of the SpRY Cas9-ABE9e and sgRNA 1 combination according to Example 3 of the present invention.

[0022] Figure 6 The diagram shows the sequencing results of the SpRY Cas9-ABE8e and sgRNA 2 combination according to Example 3 of the present invention.

[0023] Figure 7 The diagram shows the sequencing results of the SpRY Cas9-ABE9e and sgRNA 2 combination according to Example 3 of the present invention.

[0024] Figure 8 The diagram shows the sequencing results of the SpRY Cas9-ABE8e and sgRNA 3 combination according to Example 3 of the present invention.

[0025] Figure 9 The diagram shows the sequencing results of the SpRY Cas9-ABE9e and sgRNA 3 combination according to Example 3 of the present invention.

[0026] Figure 10 The diagram shows the sequencing results of the SpRY Cas9-ABE8e and sgRNA 4 combination according to Example 3 of the present invention.

[0027] Figure 11 The diagram shows the sequencing results of the SpRY Cas9-ABE9e and sgRNA 4 combination according to Example 3 of the present invention.

[0028] Figure 12 A schematic diagram of the chemical modification of gRNA2 according to Example 4 of the present invention is shown.

[0029] Figure 13 The figure shows the results of LNP delivery of gRNA2 and SpRY-ABE9e mRNA to edit TTR V50M in the liver of 4-5 week old mice according to Example 4 of the present invention.

[0030] Figure 14 The figure shows the results of LNP delivery of gRNA2 and SpRY-ABE9e mRNA to edit TTR V50M in the liver of 12-13 week old mice according to Example 4 of the present invention.

[0031] Figure 15A An immunohistochemical image showing the deposition of TTR protein in the cardiac tissue of the WT group according to Example 4 of the present invention is shown.

[0032] Figure 15B An immunohistochemical image showing the deposition of TTR protein in the heart tissue of the CON group according to Example 4 of the present invention is shown.

[0033] Figure 15C An immunohistochemical image showing the deposition of TTR protein in cardiac tissue from the 4-5W LNP group according to Example 4 of the present invention is shown.

[0034] Figure 15D An immunohistochemical image showing the deposition of TTR protein in cardiac tissue from the 12-13W LNP group according to Example 4 of the present invention is shown. Detailed Implementation

[0035] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0036] Hereditary transthyretin amyloidosis (hATTR) is a rare but serious multisystemic disease. Clinically, hATTR primarily affects the cardiac and nervous systems, and most patients exhibit two clinical phenotypes simultaneously. Cardiac involvement leads to hereditary transthyretin amyloid cardiomyopathy (hATTR-CM), characterized by nonspecific, restrictive heart failure with preserved ejection fraction. It is easily missed or misdiagnosed as heart failure associated with hypertension or hypertrophic cardiomyopathy. Due to its progressive onset, patients often present with severe systemic manifestations at diagnosis. Studies report a median time from diagnosis to death of 2–6 years. Therefore, hATTR-CM presents with severe symptoms and a high mortality rate, warranting increased attention and diagnostic vigilance from clinicians. The transthyretin (TTR) protein encoded by the TTR gene is mainly synthesized by the liver. Under physiological conditions, TTR protein mainly participates in the transport of vitamin A, but its role is limited. The earliest discovered and most common mutation in hATTR-CM is TTR p.Val50Met, which is caused by the mutation of the guanine base (G) at position 148 of the TTR genome to the adenine base (A), resulting in the replacement of valine (Val) at position 50 of the TTR protein with methionine (Met). This mutation disrupts the stability of the TTR protein tetramer, causing misfolded TTR monomers to aggregate into insoluble extracellular amyloid protein fiber deposits. Abnormal TTR protein deposits in the heart, leading to myocardial amyloidosis. It can also deposit in the nerves, intestines, and other sites, leading to systemic multisystemic amyloidosis.

[0037] For hereditary transthyretin amyloidosis, the existing treatment options are mainly as follows: (1) using stabilizers such as diflunisic acid or tafamid to stabilize the tetramer form of TTR protein and prevent TTR protein deposition; (2) using patisiran (small interfering RNA) or inotersen (antisense oligonucleotide) to degrade TTR mRNA, thereby inhibiting TTR protein synthesis and reducing TTR protein deposition; (3) the latest therapy is to use the CRISPR / Cas9 system to achieve in vivo gene editing and target the mechanism of silencing TTR mRNA in transthyretin amyloidosis.

[0038] However, existing treatment options have many drawbacks: (1) Stabilizers such as diflunisic acid or tafamid require long-term use to maintain the stability of TTR protein; (2) Patisiran (small interfering RNA) or inotersen (antisense oligonucleotide) both require long-term use to maintain low expression of TTR protein. Long-term patisiran treatment will lead to continuous exposure to glucocorticoids and antihistamines as precursors. Inotersen treatment will cause serious side effects such as glomerulonephritis and thrombocytopenia; (3) The treatment method of CRISPR / Cas9 system targeting and silencing TTR mRNA is still in Phase I clinical trials. The CRISPR / Cas9 system relies on DNA double-strand breaks to stimulate the gene editing process. It can delete thousands of base pairs and generate new genotypes. Some of these genotypes may have potential pathogenic consequences in cells with active mitosis, which may compromise its safety. Its gene editing efficiency is acceptable, but it is still not as efficient as ABE (Adenine Base Editor). The accuracy of targeting gene sequences and the control of off-target effects are not as good as those of the base editor.

[0039] The gRNA molecule in this application contains a region complementary to the TTR V50M mutant gene sequence. The gRNA molecule in this application can be chemically modified on any nucleotide.

[0040] In this application, "Cas enzyme" refers to CRISPR-associated nucleases, including CRISPR-associated nuclease molecules or their fusion proteins, including but not limited to Type II, V, and VI nucleases.

[0041] In this application, “Cas” includes, but is not limited to, SpCas9, SaCas9, Nme2Cas9, Nme3Cas9, CjCas9, NmCas9, FnCas9, nCas9, dCas9, slugcas9, and SpeCas9 molecules, as well as their fusion proteins and mutants.

[0042] The term "deaminase" in this application includes, but is not limited to, adenosine deaminase, cytidine deaminase, uracil glycosyltransferase, and their fusion proteins and mutants.

[0043] Unless otherwise specified, all reagents and materials used in the following examples are commercially available; and unless otherwise specified, all experimental methods are conventional experimental methods in the art.

[0044] As mentioned in the background section, it is difficult to correct the TTR V50M mutation site at the gene level using existing technologies. Therefore, in this application, the inventors attempted to develop a new gRNA targeting the TTR V50M mutation gene, and thus proposed a series of protection schemes in this application.

[0045] In a first typical embodiment of this application, a gRNA targeting the TTR V50M mutant gene is provided, wherein the gRNA is any of the nucleotide sequences shown in SEQ ID NOs:2-21 (including but not limited to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21).

[0046] In a preferred embodiment, the gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 7-10 (including but not limited to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10).

[0047] In a preferred embodiment, the gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 7-8 (including but not limited to SEQ ID NO: 7 or SEQ ID NO: 8).

[0048] In a preferred embodiment, a gRNA targeting the TTR V50M mutant gene is provided, wherein the gRNA is an extended sequence having ≥40% sequence identity of any of the nucleotide sequences shown in SEQ ID NOs:2-21 (including but not limited to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21).

[0049] In a preferred embodiment, the sequence identity can be ≥50% (including but not limited to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, or 59%), ≥60% (including but not limited to 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), ≥60%, 70% (including but not limited to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), ≥80% (including but not limited to 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%), or ≥90% (including but not limited to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). The extended sequence can be obtained by deleting, inserting, or replacing bases in the base sequence, while still retaining the function of targeting the TTR V50M mutation site.

[0050] In a preferred embodiment, the gRNA is preferably a single guide RNA (sgRNA).

[0051] SEQ ID NO: 2: Atgcatgtgttcagaaaggc (gRNA1);

[0052] SEQ ID NO: 3: cAtgcatgtgttcagaaagg (gRNA2);

[0053] SEQ ID NO: 4: ccAtgcatgtgttcagaaag (gRNA3);

[0054] SEQ ID NO: 5: gccAtgcatgtgttcagaaa (gRNA4);

[0055] SEQ ID NO: 6: ggccAtgcatgtgttcagaa (gRNA5);

[0056] SEQ ID NO: 7: tggccAtgcatgtgttcaga (gRNA6 / sgRNA1);

[0057] SEQ ID NO: 8: gtggccAtgcatgtgttcag (gRNA7 / sgRNA2);

[0058] SEQ ID NO: 9: tgtggccAtgcatgtgttca (gRNA8 / sgRNA3);

[0059] SEQ ID NO:10:atgtggccAtgcatgtgttc(gRNA9 / sgRNA4);

[0060] SEQ ID NO:11:aatgtggccAtgcatgtgtt(gRNA10);

[0061] SEQ ID NO:12:caatgtggccAtgcatgtgt(gRNA11);

[0062] SEQ ID NO:13:tcaatgtggccAtgcatgtg(gRNA12);

[0063] SEQ ID NO:14:atcaatgtggccAtgcatgt(gRNA13);

[0064] SEQ ID NO:15:catcaatgtggccAtgcatg(gRNA14);

[0065] SEQ ID NO:16:ccatcaatgtggccAtgcat(gRNA15);

[0066] SEQ ID NO:17:gccatcaatgtggccAtgca(gRNA16);

[0067] SEQ ID NO:18:tgccatcaatgtggccAtgc(gRNA17);

[0068] SEQ ID NO:19:ctgccatcaatgtggccAtg(gRNA18);

[0069] SEQ ID NO:20:cctgccatcaatgtggccAt(gRNA19);

[0070] SEQ ID NO:21:tcctgccatcaatgtggccA(gRNA20);

[0071] SEQ ID NO:22:gttttctgttctgcgccgtt(AAVS1-F);

[0072] SEQ ID NO:23:gtcagatgctcaaggggctt(AAVS1-R);

[0073] SEQ ID NO: 24: acgatacaaggctgttagag (hU6-Promoter-F);

[0074] SEQ ID NO: 25: tgtgtaattcttgtttcgctccag (hTTR-TG F);

[0075] SEQ ID NO: 26: agggcatacttgacctctgccta (hTTR-TG R).

[0076] Base editing technology is being developed as a method for treating hereditary diseases. In this invention, we designed a gene therapy strategy for treating hereditary transthyretin amyloidosis by using gRNA from any of the nucleotide sequences shown in SEQ ID NOs: 2-21 to correct the TTR V50M mutation gene using an ABE base editor. Editing the genome using an ABE base editor can permanently correct the TTR V50M mutation gene and overcome many limitations of existing treatments (including but not limited to the need for long-term medication, serious side effects such as glomerulonephritis and decreased platelet count, accuracy of the targeted gene sequence, and off-target effects). Notably, the treatment method in this application is gene correction. Compared with conventional gene knockout methods such as CRISPR / Cas9, the strategy in this application has higher accuracy, lower off-target effects, and higher safety. It can achieve a one-time editing of the TTR V50M mutation gene to achieve gene correction, providing a new gene therapy strategy with clinical translational potential for transthyretin amyloidosis.

[0077] In this application, the inventors have discovered that gRNAs having, but not limited to, any of the nucleotide sequences shown in SEQ ID NOs: 7-10 (including but not limited to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10) can be well combined with base editors (including but not limited to SpRYCas9-ABE8e or SpRYCas9-ABE9e), while gRNAs having, but not limited to, any of the nucleotide sequences shown in SEQ ID NOs: 2-6 and 11-21 (including but not limited to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21) have poor combination effects with the aforementioned base editors. Therefore, in this application, the inventors preferably use SEQ ID NOs: 7-10. The inventors prefer to combine gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-10 with the base editor described above. Furthermore, the inventors prefer to combine gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-8 (including but not limited to SEQ ID NO: 7 or SEQ ID NO: 8) with the base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e to perform the above gene correction work. The inventors have found that, compared with conventional gene knockout methods such as CRISPR / Cas9, combining gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-8 with the base editor can achieve higher precision, lower off-target effects, and higher safety, which helps to overcome the limitations of traditional treatment methods.

[0078] In a preferred embodiment, any one or more nucleotides in the above-mentioned gRNA contain chemical modifications that can enhance the stability of the gRNA and increase its in vivo efficiency. Chemical modifications include, but are not limited to, any type of modification of ribonucleotides that is available in the prior art, such as methylation, fluorination, acetylation, and inter-base thiophosphate modification.

[0079] In a preferred embodiment, the target region of the gRNA targeting the TTR V50M mutant gene is the sequence shown in SEQ ID NO: 1.

[0080] In a preferred embodiment, the target region of the gRNA targeting the TTR V50M mutant gene is the reverse complementary sequence of the sequence shown in SEQ ID NO: 1.

[0081] In a preferred embodiment, the target region of the gRNA targeting the TTR V50M mutant gene is an extended sequence that has ≥40% sequence identity with the sequence shown in SEQ ID NO: 1.

[0082] In a preferred embodiment, the sequence identity can be ≥90% (including but not limited to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). The extended sequence can be obtained by deleting, inserting, or substituting bases into the base sequence, while still retaining the function of the gRNA targeting the TTR V50M mutation site.

[0083] SEQ ID NO: 1: ggcaccggtgaatccaagtgtcctctgatggtcaaagttctagatgctgtccgaggcagtcctgccatcaatgtggccAtgcatgtgttcagaaaggctgctgatgacacctgggagccatttgcctctgg.

[0084] In this application, the inventors discovered that the gRNA having any of the nucleotide sequences shown in SEQ ID NOs: 2-21 can effectively target the exon 2 genomic sequence of the TTR V50M mutation, wherein the exon 2 genomic sequence is the sequence shown in SEQ ID NO: 1 or its reverse complementary sequence. After targeting the aforementioned target region, the gRNA can directly correct the TTR V50M mutation gene site at the gene level, achieving a durable and stable therapeutic effect through precise base editing, thereby reducing the risks associated with long-term administration and lowering treatment costs.

[0085] This application uses the second exon sequence of the above-mentioned TTR V50M mutant gene as the target region for ABE base editing, and provides gRNA with any of the nucleotide sequences shown in SEQ ID NOs: 2-21, which can specifically target the c.148G>A site corresponding to the V50M mutation in the second exon of the TTR gene, accurately edit the mutant base A into a wild-type G base, and has been experimentally verified to have good editing efficiency.

[0086] In a second typical embodiment of this application, a gRNA expression vector targeting the TTR V50M mutant gene is provided, wherein the gRNA expression vector contains a nucleotide sequence encoding the gRNA.

[0087] The aforementioned gRNA expression vector is a specially designed vector whose core function is to carry and express the nucleotide sequence encoding the gRNA. This vector not only carries a sequence matching the gRNA but also ensures efficient and stable expression of the gRNA in the target cell, thereby achieving precise targeted editing of the TTR V50M mutant gene.

[0088] The expression vector in this embodiment can be a plasmid, adeno-associated virus (AAV) vector, herpes simplex virus (HSV) vector, liposome nanoparticles (LNP), extracellular vesicles (EV), or mRNA vector, etc. Among them, AAV vectors are particularly suitable for in vivo gene editing due to their high transduction efficiency and long-term gene expression capability, and can directly deliver gRNA expression sequences to cardiomyocytes or hepatocytes to achieve continuous TTR V50M mutant gene editing.

[0089] Vector construction typically involves inserting a nucleotide sequence encoding gRNA into a plasmid or viral vector containing an appropriate promoter. For example, LNP vectors can be used to encapsulate gRNA, ensuring specific expression of the gRNA in heart or liver tissue. In this application, the inventors preferably use liposome nanoparticles (LNPs) to deliver ABE base editor mRNA and chemically modified gRNA for TTR correction editing in the liver of humanized TTR V50M mutant mice. LNPs can deliver gRNA and a base editor to the liver, enabling one-time editing of the TTR V50M mutant gene in the liver to achieve gene correction. Compared to conventional gene knockout methods such as CRISPR / Cas9, the delivery method in this application is more accurate, has lower off-target effects, and is safer. After vector construction, it undergoes strict quality control and purification steps to ensure high purity and activity, thereby improving in vivo editing efficiency.

[0090] In a third typical embodiment of this application, a CRISPR base editing system targeting the TTR V50M mutant gene is provided, wherein the CRISPR base editing system includes the aforementioned gRNA.

[0091] In a preferred embodiment, the CRISPR base editing system described above includes a base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e.

[0092] The aforementioned CRISPR base editing system can work in conjunction with gRNA to achieve precise modification of the TTR V50M mutant gene sequence through the combination of base editing enzymes (including but not limited to ABE8e adenosine deaminase or ABE9e adenosine deaminase) and Cas9 nuclease.

[0093] The CRISPR base editing system consists of a Cas9 nuclease, a base deaminase (such as adenosine deaminase), and gRNA. The Cas9 nuclease and the base deaminase are linked together as a fusion protein to form a base editor. The latter can recognize and bind to the target site of the TTR V50M mutant gene guided by the gRNA, allowing the base deaminase to edit specific bases near the target site, thereby achieving precise correction of the TTR V50M mutant gene (c.148G>A). It should be noted that the base editor in the above CRISPR base editing system can be flexibly selected from any existing base editor capable of achieving the following function: an adenine base editor that, under the mediation of the above gRNA, can specifically edit the mutant base A at position 148 of exon 2 of the TTR V50M mutant gene into a wild-type G base. The SpRYCas9-ABE8e base editor includes the Cas9 nuclease and the adenine single-base editor ABE8e; the SpRYCas9-ABE9e base editor includes the Cas9 nuclease and the adenine single-base editor ABE9e.

[0094] This CRISPR base editing system can be applied to various vectors, such as AAV, LNP, or mRNA vectors, to achieve targeted delivery to specific organs or cell types. In the treatment of cardiovascular and liver metabolic diseases, by designing specific gRNA combinations with base editors, precise editing of the TTR V50M mutant gene can be achieved in cardiomyocytes or hepatocytes. This editing capability provides an unprecedentedly precise means of disease treatment. In this application, the inventors preferably use the aforementioned CRISPR base editing system for gene correction work. Compared with conventional CRISPR / Cas9 and other gene knockout methods, this application offers higher accuracy, lower off-target effects, and higher safety, helping to overcome the limitations of traditional treatment methods. Preferably, the aforementioned CRISPR base editing system includes, but is not limited to, the existing base editors SpRYCas9-ABE8e or SpRYCas9-ABE9e.

[0095] In this application, the inventors have discovered that gRNAs having, but not limited to, any of the nucleotide sequences shown in SEQ ID NOs: 7-10 (including but not limited to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10) can be well combined with base editors (including but not limited to SpRYCas9-ABE8e or SpRYCas9-ABE9e), while gRNAs having, but not limited to, any of the nucleotide sequences shown in SEQ ID NOs: 2-6 and 11-21 (including but not limited to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21) have poor combination effects with the aforementioned base editors. Therefore, in this application, the inventors preferably use SEQ ID NOs: 7-10. The inventors prefer to combine gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-10 with the base editor described above. Furthermore, the inventors prefer to combine gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-8 (including but not limited to SEQ ID NO: 7 or SEQ ID NO: 8) with the base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e to perform the above gene correction work. The inventors have found that, compared with conventional gene knockout methods such as CRISPR / Cas9, combining gRNAs of any of the nucleotide sequences shown in SEQ ID NOs: 7-8 with the base editor can achieve higher precision, lower off-target effects, and higher safety, which helps to overcome the limitations of traditional treatment methods.

[0096] In a fourth typical embodiment of this application, a composition targeting the TTR V50M mutant gene is provided. The composition comprises a gRNA system and a CRISPR base editing system. The gRNA system is selected from any one or more of the following: the gRNA described above, the gRNA expression vector described above, or the CRISPR base editing system described above.

[0097] In a preferred embodiment, the CRISPR base editing system comprises: a) a Cas enzyme or a nucleic acid encoding the Cas enzyme, and b) a base deaminase or a nucleic acid encoding the base deaminase.

[0098] In a preferred embodiment, the base deaminase includes one or more of adenosine deaminase, cytidine deaminase, or uracil glycosyltransferase.

[0099] In a preferred embodiment, the CRISPR base editing system described above includes a base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e.

[0100] The mRNAs of the Cas9 nuclease and / or base deaminase in the aforementioned CRISPR base editing systems include, but are not limited to, chemically modified mRNAs that can reduce the immunogenicity of the mRNA during gene editing. These modifications include, but are not limited to, methyluracil modification.

[0101] In a fifth typical embodiment of this application, the use of the above-described gRNA, the above-described gRNA expression vector, the above-described CRISPR base editing system, or the above-described composition in the preparation of a medicament for treating transthyretin amyloidosis is provided.

[0102] In a preferred embodiment, the above-mentioned drug includes a formulation administered intravenously.

[0103] Intravenous administration is a method of drug delivery that involves directly injecting medication into a vein, allowing the drug to rapidly enter the bloodstream. Because of its rapid onset of action, intravenous administration is often used in emergency situations, critical care, and scenarios requiring a rapid achievement of effective blood drug concentrations. Intravenous formulations include, but are not limited to, intravenous injections, intravenous infusions, suspensions, emulsions, lyophilized powders for injection, liposomes, and nanoparticles. Each of these dosage forms has its own characteristics and is suitable for different clinical scenarios and drug properties.

[0104] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0105] Example 1

[0106] The TTR V50M mutant gene sequence in cells was edited using CRISPR gene editing methods (including but not limited to base editors such as SpRY Cas9-ABE8e or SpRY Cas9-ABE9e).

[0107] Carrier preparation:

[0108] (1) Determine the sequence of gRNA targeting the TTR V50M mutation site (the sequence is identical to the target sequence, as shown in SEQ ID NO: 1):

[0109] Based on the human TTR V50M mutant gene sequence, a gRNA with a target domain length of 17-24 nT was designed, as shown in SEQ ID NOs: 2-21.

[0110] In the design of gRNAs, sgRNAx corresponds to the subsequent construction of the SpRYCas9-ABE8e and SpRYCas9-ABE9e plasmids, where sgRNA 1 (corresponding to gRNA6 shown in SEQ ID NO: 7), sgRNA 2 (corresponding to gRNA7 shown in SEQ ID NO: 8), sgRNA 3 (corresponding to gRNA8 shown in SEQ ID NO: 9), and sgRNA 4 (corresponding to gRNA9 shown in SEQ ID NO: 10) are represented. A map of plasmids capable of expressing SpRYCas9-ABE8e is shown below. Figure 1 As shown: A map of plasmids capable of expressing SpRY Cas9-ABE9e is shown below. Figure 2 As shown. Those skilled in the art can flexibly replace the plasmids selected in this application with plasmids that have SpRYCas9-ABE8e or SpRYCas9-ABE9e base editor functions.

[0111] The DNA sequences corresponding to the gRNA targeting the TTR V50M mutation site were synthesized using conventional methods, including the sense and antisense strands (for SpRY Cas9-ABE8e and SpRY Cas9-ABE9e plasmids: add CACC to the 5' end of the sense strand and AAAC to the 5' end of the antisense strand, along with a BbsI restriction site). If the first nucleotide at the 5' end of the sense strand is not guanine G, then add G to the 5' end of the sense strand and C to the 3' end of the antisense strand.

[0112] The sense and antisense strands of the DNA sequence corresponding to the above gRNA target sequence were diluted and mixed, and incubated in a PCR instrument at 95°C for 5 minutes. Then, the mixture was immediately removed and incubated on ice for 5 minutes to anneal and form double-stranded DNA with sticky ends.

[0113] Take 2 μl of the annealed product and dilute it 500 times with deionized water.

[0114] (2) T4 connection reaction:

[0115] Using restriction endonucleases Bbs The plasmid was digested with enzymes, and the linearized plasmid was recovered by gel extraction and then ligated with annealed double-stranded DNA. The ligation reaction system is shown in Table 1 below. In Table 1, since the vector concentration varied each time, the amount of linearized backbone vector added corresponds to the volume of 5 ng of vector. In addition, since the total volume remained constant, the amount of ddH2O added varied with the amount of linearized backbone vector added, and is therefore presented in Table 1 as "x".

[0116] Table 1

[0117]

[0118] The annealed product was incubated at 25°C for 10 minutes in a PCR instrument to complete the ligation of the linearized backbone, thus obtaining the ligation plasmid.

[0119] Example 2

[0120] Plasmid transformation and ampicillin resistance solid culture plate coating:

[0121] (1) In a clean bench, all the reaction products of T4 ligation were quickly added into one tube (50 μL) of Escherichia coli DH5α competent cells and then incubated on ice for 30 minutes.

[0122] (2) Immerse competent cells in a 42°C water bath for 90 seconds, then place them back on ice for 2-5 minutes.

[0123] (3) In a clean bench, add 400 μL of antibiotic-free LB medium, then place the bacterial culture in a bacterial shaker and incubate at 37°C and 180 rpm for 45 minutes to recover. During recovery, turn on the biochemical incubator and place an LB agar plate containing an appropriate amount of ampicillin into it to dry it.

[0124] (4) Centrifuge the bacterial culture at 1000 rpm for 5 minutes at room temperature, remove most of the supernatant, retain about 50 μL and resuspend the precipitate thoroughly.

[0125] (5) Drip the bacterial culture onto an LB agar plate containing ampicillin and spread it evenly using a disposable sterile spreader. Then invert the plate and place it in a biochemical incubator and incubate at 37°C for 12-14 hours.

[0126] (6) In the clean bench, use a 10μl pipette tip to pick up 5-10 single clones into 1ml of LB medium containing ampicillin, pipette several times to mix the bacteria with the LB medium, and incubate at 37℃ and 220rpm for 12 hours.

[0127] (7) Take 500 μL of bacterial culture and send it directly for sequencing. Store the remaining bacterial culture at 4℃.

[0128] SpRYCas9-ABE8e and SpRYCas9-ABE9e used sequencing primers: hU6-Promoter-F (ACGATACAAGGCTGTTAGAG, SEQ ID NO: 24).

[0129] Figure 3 The following are exemplary sequencing results of gRNAs associated with some successfully constructed SpRYCas9-ABE8e and SpRYCas9-ABE9e plasmids. Figure 3Figure A shows the sequencing results of sgRNA 1. Figure 3 Figure B shows the sequencing results of sgRNA 2. Figure 3 The image in C represents the sequencing results of sgRNA 3. Figure 3 The image in the middle (D) shows the sequencing results of sgRNA 4.

[0130] The sequencing results shown in SpRYCas9-ABE8e and SpRYCas9-ABE9e are as follows:

[0131] SEQ ID NO: 27: CACCGTGGCCATGCATGTGTTCAGAGTTTA (sgRNA 1, corresponding to gRNA6 shown in SEQ ID NO: 7 above).

[0132] SEQ ID NO: 28: CACCGGTGGCCATGCATGTGTTCAGGTTTA (sgRNA 2, corresponding to gRNA7 shown in SEQ ID NO: 8 above).

[0133] SEQ ID NO: 29: CACCGTGTGGCCATGCATGTGTTCAGTTTA (sgRNA 3, corresponding to gRNA8 shown in SEQ ID NO: 9 above).

[0134] SEQ ID NO: 30: CACCGATGTGGCCATGCATGTGTTCGTTTA (sgRNA 4, corresponding to gRNA9 shown in SEQ ID NO: 10 above).

[0135] (8) In the clean bench, add all the positive clone bacterial solution temporarily stored at 4℃ to a 50ml centrifuge tube, add 30ml of LB medium containing ampicillin, cover the tube, loosen the cap, place the centrifuge tube in a bacterial shaker and fix it at an angle, and incubate at 37℃ and 220rpm for 12-16 hours.

[0136] (9) According to the manufacturer’s instructions, use the plasmid DNA extraction kit to re-extract the plasmid from the bacterial culture. When eluting, use 50 μl ddH2O to elute the plasmid.

[0137] (10) The concentration of plasmid DNA was determined by NanoDrop spectrophotometer.

[0138] Example 3

[0139] Transfect cells, extract genome, and identify genotypes:

[0140] TTR V50M mutant fragment was transfected into 239T cells using Lipofectamine 3000. Cells were seeded in 12-well plates at 5 x 10⁶ cells per well.5 For each cell, add 500 ng plasmid, 1.5 μL Lipofectamine 3000, and 1.5 μL p3000. Five days after transfection, extract the genome using a DNA extraction kit. Amplify the approximately 605 bp TTR V50M mutant fragment containing the gRNA binding site into the genome using the following specific primers.

[0141] The sequence information of AAVS1-F is shown in SEQ ID NO: 22, and the sequence information of AAVS1-R is shown in SEQ ID NO: 23.

[0142] The PCR reaction system is prepared as shown in Table 2 below. The total volume of the PCR reaction system is 20 μL.

[0143] Table 2

[0144]

[0145] The PCR program was: 95℃ for 5 min, (95℃, 30 s, 60℃ for 30 s, 34 cycles), 72℃ for 30 s, 4℃ forever. The "95℃, 30 s, 60℃ for 30 s, 34 cycles" means that one cycle consists of treating at 95℃ for 30 s and then at 60℃ for 30 s, and a total of 34 cycles were performed.

[0146] PCR products were subjected to 1% agarose gel electrophoresis for detection, followed by sequencing. The sequencing results were analyzed using EDITR (https: / / moriaritylab.shinyapps.io / editr_v10 / ), and the experimental results are as follows: Figures 4 to 11 As shown. In Figures 4 to 11 The horizontal column at the top of the table represents the original bases at each detection site in the reference and / or target sequences. The vertical axis on the left side of the table (T, G, C, A) indicates the percentage of T, G, C, and A bases detected at that site after sequencing. Each column shows "which base a particular original site ultimately became, and what percentage of that base." Darker colors and higher values ​​near the diagonal usually indicate that the site retained its original bases; high values ​​off-diagonally indicate base substitutions. For example... Figure 4-11 If a site originally containing A appears in a higher proportion in row G, it indicates that an A-to-G base substitution has occurred.

[0147] The results of the combined test of SpRY Cas9-ABE8e and sgRNA 1 are as follows: Figure 4 As shown, sgRNA 1 (corresponding to gRNA6 shown in SEQ ID NO: 7 above). Figure 2The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 19 / (19+76) = 20.00%.

[0148] The results of the combined test of SpRY Cas9-ABE9e and sgRNA 1 are as follows: Figure 5 As shown, sgRNA 1 (corresponding to gRNA6 shown in SEQ ID NO: 7 above). Figure 3 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 23 / (23+72) = 24.21%.

[0149] The results of the combined test of SpRY Cas9-ABE8e and sgRNA 2 are as follows: Figure 6 As shown, sgRNA 2 (corresponding to gRNA7 shown in SEQ ID NO: 8 above) Figure 4 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 22 / (22+72) = 23.16%.

[0150] The results of the combined test of SpRY Cas9-ABE9e and sgRNA 2 are as follows: Figure 7 As shown, sgRNA 2 (corresponding to gRNA7 shown in SEQ ID NO: 8 above) Figure 5 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 22 / (22+74) = 22.92%.

[0151] The results of the SpRY Cas9-ABE8e and sgRNA 3 combination test are as follows: Figure 8 As shown, sgRNA 3 (corresponding to gRNA8 shown in SEQ ID NO: 9 above). Figure 6 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 13 / (13+80) = 13.98%.

[0152] The results of the SpRY Cas9-ABE9e and sgRNA 3 combination test are as follows: Figure 9 As shown, sgRNA 3 (corresponding to gRNA8 shown in SEQ ID NO: 9 above). Figure 7 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 10 / (10+86) = 10.42%.

[0153] The results of the combined test of SpRY Cas9-ABE8e and sgRNA 4 are as follows: Figure 10As shown, sgRNA 4 (corresponding to gRNA9 shown in SEQ ID NO: 10 above). Figure 8 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 6 / (6+89) = 10.64%.

[0154] The results of the combined test of SpRY Cas9-ABE9e and sgRNA 4 are as follows: Figure 11 As shown, sgRNA 4 (corresponding to gRNA9 shown in SEQ ID NO: 10 above). Figure 9 The sites in the green box represent the correction status of the target sites, and the calculated percentage of gene correction is: 10 / (10+86) = 6.32%.

[0155] In this application, "SpRY-ABE9e" is also referred to as "SpRY Cas9-ABE9e"; "SpRY-ABE8e" is also referred to as "SpRY Cas9-ABE8e".

[0156] Experimental results show that the TTR V50M mutation can be corrected by targeting the TTR V50M mutation site using the carefully designed gRNAs. In particular, the combined editing of sgRNA1 or sgRNA2 with SpRY-ABE8e or SpRY-ABE9e achieves higher editing efficiency and can more effectively correct the TTR V50M mutation.

[0157] Example 4

[0158] The inventors chose the combination of gRNA2 and SpRY-ABE9e to target humanized TTR. V50M model (H11-Alb-hTTR) V50M, full strain name C57BL / 6NCya-Igs 2em1(Alb-hTTR TTR V50M mutant gene editing was performed on the liver of a mouse model. Genomic DNA from the mouse model was amplified by PCR using hTTR-TG F (SEQ ID NO: 25) and hTTR-TG R (SEQ ID NO: 26), and the amplification products were analyzed by Sanger sequencing to detect the editing status of the TTR V50M mutant site.

[0159] In this implementation, the inventors used commercially available liposome nanoparticles (LNPs) to package methyluracil-modified SpRY-ABE9e mRNA and chemically modified sgRNA2 (gRNA7, SEQ ID NO: 8) for experiments.

[0160] (1) SpRY-ABE8e mRNA or SpRY-ABE9e mRNA is modified with methyluracil, and conventional tailing and capping modifications are performed. Complete chemical modifications of gRNA2 are as follows: Figure 12 As shown.

[0161] (2) The LNP particles were loaded with SpRY-ABE9e mRNA and gRNA2 in a mass ratio of 1:1 (wt / wt). The molar ratio of lipids was SM-102:DSPC:cholesterol:DMG-PEG 2000 = 50:10:38.5:1.5, and the weight ratio of RNA to lipids was 0.05:1 (wt / wt).

[0162] a) Dissolve the lipids in ethanol to prepare a 10 mg / ml stock solution. Store the lipid stock solution at -20°C.

[0163] b) Prepare the lipid mixture solution as described. Add the following to each milliliter of lipid mixture: 572 µL of 10 mg / mL SM-102 (HY-134541), 240 µL of 10 mg / mL cholesterol (HY-N0322), 127 µL of 10 mg / mL DSPC (HY-W040193), and 61 µL of DMG-PEG 2000 (HY-112764). Mix the solution thoroughly to obtain a clear solution. This mixture contains 10 mg of total lipids.

[0164] c) Prepare a 166.7 µg / mL mRNA solution using 100 mM sodium acetate buffer at pH 5.

[0165] d) Mix 3 mL of mRNA buffer solution and 1 mL of lipid mixture solution in a microfluidic device at a total flow rate of 12 mL / min (typically using an alcohol-lipid mixture to aqueous buffer ratio of 1:3).

[0166] e) After mixing, dialyze the LNPs against PBS (pH 7.4) for 2 hours, then aseptically filter using a 0.2-micron filter and store at 4°C.

[0167] f) The particle size, zeta potential, and concentration of the loaded LNP particles were characterized.

[0168] (3) Through the tail vein to 4-5 week old ( Figure 13 ) and 12-13 weeks old ( Figure 14 Humanized TTR V50M model mice were injected with 3 mg / kg (per mouse body weight) of LNP particles. Seven days later, liver samples were harvested to assess the editing efficiency of the TTR V50M mutant gene. Results are as follows: Figure 13 and Figure 14 As shown, SpRY-ABE9e and sgRNA2 can successfully achieve corrective editing of the TTR V50M mutant gene in the liver. Figure 13 and Figure 14 The experimental results show that SpRY-ABE9e and sgRNA 2 can successfully edit the TTRV50M mutant gene in the liver. The sequencing peak diagram of liver TTR V50M mutant gene editing shows the corrected peaks at the mutation site within the green box. Figure 13 The green box marks the target site's correction status, calculated as: 57 / (40+57) = 58.76%; similarly, Figure 14 The green box marks the target site's correction status, calculated as: 59 / (38+59) = 60.82%. Figure 13 and 14 The horizontal column at the top of the table represents the original bases at each detection site in the reference and / or target sequences. The vertical axis on the left side of the table (T, G, C, A) indicates the percentage of T, G, C, and A bases detected at that site after sequencing. Each column shows "which base a particular original site ultimately became, and what percentage of that base." Darker colors and higher values ​​near the diagonal usually indicate that the site retained its original bases; high values ​​off-diagonally indicate base substitutions. For example... Figure 13 and 14 A high proportion of the A-origin site appearing in the G row indicates an A-to-G base substitution. Specifically, the 4-5W LNP indicates the introduction of humanized TTRs into 4-5 week old animals via the tail vein. V50M model mice were injected with 3 mg / kg (per mouse body weight) of LNP particles; 12-13W LNP refers to humanized TTRs administered via the tail vein to 12-13 week old mice. V50M model mice were injected with 3 mg / kg (per mouse body weight) of LNP particles.

[0169] (4) Experimental mice and mice were grouped as follows:

[0170] Model control group (CON): Humanized TTR V50M model mice were fed normally.

[0171] Young-aged group (4-5 weeks LNP): Humanized TTR V50M model mice were treated with LNP containing SpRY-ABE9e mRNA and sgRNA2 at 4-5 weeks of age (dose 3 mg / kg), with the sgRNA2 targeting sequence being: gtggccAtgcatgtgttcag (SEQ ID NO:8).

[0172] Older age group (12-13 weeks LNP): Humanized TTR V50M model mice were treated with the same LNP as the above group at 12-13 weeks of age.

[0173] (5) Immunohistochemical staining was used to detect the deposition of TTR protein in cardiac tissue, with wild-type mice (WT) used as a negative control. The results are as follows: Figures 15A to 15D As shown: Among them, Figure 15A The results of immunohistochemical staining of TTR protein in the WT group are as follows. Figure 15B The results of immunohistochemical staining of TTR protein in the CON group are as follows. Figure 15C The results of immunohistochemical staining of TTR protein in the 4-5W LNP group are as follows. Figure 15D The results of immunohistochemical staining of TTR protein in the 12-13W LNP group are shown. Brown staining indicates TTR protein positivity. WT represents the wild-type negative control group, CON represents the model control group, 4-5W LNP represents the 4-5 week old drug-treated group, and 12-13W LNP represents the 12-13 week old drug-treated group. Figures 15A to 15D The experimental results showed that LNP liver delivery of SpRY-ABE9e and sgRNA2 could successfully correct the TTR V50M mutant gene in the liver, correcting the mutant base A to wild-type G, thereby restoring the normal expression of wild-type TTR protein and reducing the deposition of TTR protein in tissues and organs such as myocardial interstitium.

[0174] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects:

[0175] This application presents a gene therapy strategy for treating hereditary transthyretin amyloidosis by correcting the TTR gene V50M mutation using an ABE base editor. This strategy achieves precise single-base correction of the TTR V50M mutation site without introducing DNA double-strand breaks. Genome editing using the ABE base editor permanently corrects the TTR gene V50M mutation and overcomes many limitations of existing treatments (including, but not limited to, the need for long-term medication, serious side effects such as glomerulonephritis and decreased platelet count, accuracy of targeted gene sequences, and off-target effects). The gene therapy strategy in this application achieves a durable and stable gene-level therapeutic effect through ABE base editing, effectively reducing the risk of adverse reactions from long-term drug treatment. It has the advantages of a simple treatment plan and relatively low long-term treatment costs. Furthermore, since the TTR gene is mostly expressed only in the liver, this invention selects specific gRNA and plans to deliver ABE base editor mRNA and chemically modified gRNA via liposome nanoparticles (LNPs) to correct and edit the liver TTR in humanized TTR V50M mutant mice, achieving an in vivo gene correction rate of approximately 60%. LNP enables liver-delivered gRNA and base editors, allowing for one-time editing of the TTR V50M mutant gene in the liver to achieve gene correction and thus long-term treatment of hereditary transthyretin amyloidosis. This provides a novel gene therapy strategy with clinical translational potential for transthyretin amyloidosis. Since the animal model is a humanized TTR V50M mutant mouse, it can be further extended to clinical applications in the treatment of human diseases.

[0176] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A gRNA targeting the TTR V50M mutant gene, characterized in that, The gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 2-21.

2. The gRNA according to claim 1, characterized in that, The gRNA is any of the nucleotide sequences shown in SEQ ID NOs: 7-10.

3. A gRNA expression vector targeting the TTR V50M mutant gene, characterized in that, The gRNA expression vector contains a nucleotide sequence encoding the gRNA of claim 1.

4. A CRISPR base editing system targeting the TTR V50M mutant gene, characterized in that, The CRISPR base editing system includes the gRNA described in claim 1.

5. A composition targeting the TTR V50M mutant gene, characterized in that, The composition comprises: a gRNA system and the CRISPR base editing system. The gRNA system is selected from any one or more of the following: The gRNA as described in claim 1 or 2, or The gRNA expression vector according to claim 3, or The CRISPR base editing system as described in claim 4.

6. The composition according to claim 5, characterized in that, The CRISPR base editing system includes: a) The Cas enzyme or the nucleic acid encoding the Cas enzyme, and b) Base deaminase or nucleic acid encoding the base deaminase.

7. The composition according to claim 6, characterized in that, The base deaminase includes one or more of adenosine deaminase, cytidine deaminase, or uracil glycosyltransferase.

8. The composition according to claim 6, characterized in that, The CRISPR base editing system includes the base editor SpRYCas9-ABE8e or SpRYCas9-ABE9e.

9. The use of the gRNA of claim 1 or 2, the gRNA expression vector of claim 3, the CRISPR base editing system of claim 4, or the composition of any one of claims 5-8 in the preparation of a medicament for treating transthyretin amyloidosis.

10. The application according to claim 9, characterized in that, The drug includes formulations administered intravenously.