A rapid genotyping method for sheep fecb mutation site based on sfa tnpb nuclease and kit thereof

CN122648554APending Publication Date: 2026-08-28YAZHOUWAN NATIONAL LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611086342.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-21
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

该附加突变的存在会对现有分型方法的检测准确性产生干扰,从而降低基于荧光定量PCR或CRISPR/Cas12a等技术的分型可靠性

Benefits of technology

1.本发明结合RAA恒温扩增技术与SfaTnpB核酸酶检测体系,无需复杂热循环设备,可在较短时间内完成检测过程,显著缩短检测周期。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122648554A_ABST
    Figure CN122648554A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of sheep high multiplication mutant genotype distinguishing, and particularly relates to a rapid genotyping method of sheep FecB mutation site based on SfaTnpB nuclease and a kit thereof.The method can not only effectively identify the genotype of the 746th position (FecB mutation) of the BMPR1B gene exon of a sheep individual, but also accurately distinguish the genotype of an individual with additional mutation at the 743th position in addition to the mutation at the 746th position in the actual production and breeding process.Compared with the prior art, the present application has the advantages of simple operation, rapid detection result judgment (within 45 min) and the like, and can provide a rapid, sensitive and good specificity FecB mutation site genotyping technical means for on-site screening of target genotype individuals in the sheep breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of sheep high-proliferation mutant genotype differentiation technology, and in particular to a rapid typing method and kit for sheep FecB mutation sites based on SfaTnpB nuclease. Background Technology

[0002] Sheep reproductive performance is one of the important traits affecting the economic benefits of sheep farming. Among them, the FecB mutation site of the BMPR1B gene has been shown to be highly correlated with improving the ovulation rate and reproductive capacity of sheep. Therefore, accurate identification of the genotype of this mutation site is of great significance for screening superior germplasm resources and molecular-assisted breeding.

[0003] Currently, typing methods for the FecB mutation site in the sheep BMPR1B gene mainly include PCR-restriction fragment length polymorphism analysis (PCR-RFLP), sequencing analysis, and quantitative real-time PCR. While these methods offer high detection accuracy, they generally suffer from complex procedures, long testing cycles, and high dependence on experimental equipment, making them unsuitable for rapid on-site testing and widespread application at the grassroots level. Furthermore, in actual production breeding populations, in addition to the FecB mutation site (position 746) in the sheep BMPR1B gene, an additional mutation may have been found at position 743. The presence of this additional mutation can interfere with the detection accuracy of existing typing methods, thereby reducing the reliability of typing based on technologies such as quantitative real-time PCR or CRISPR / Cas12a.

[0004] In recent years, nucleic acid detection methods based on isothermal amplification technologies (such as RAA, Recombinase-Aided Amplification) have gradually attracted attention due to their advantages such as not requiring complex temperature control equipment and short reaction times. Meanwhile, novel RNA-guided endonuclease systems, represented by TnpB nuclease, especially the recently developed SfaTnpB nuclease, exhibit high trans-cleavage activity and strong targeted recognition specificity, demonstrating potential application value in the field of single-base discrimination.

[0005] Therefore, developing a new method for genotyping sheep FecB mutation sites that has independent intellectual property rights, is easy to operate, has rapid detection, provides intuitive results, and is suitable for field applications is of great significance for improving the efficiency of molecular breeding and promoting the precision development of animal husbandry. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a rapid typing method for sheep FecB mutation sites based on SfaTnpB nuclease and its kit. This method is simple to operate, fast in detection, highly specific, and enables visual interpretation of the detection results, thus meeting the needs of rapid on-site testing.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a set of ωRNA and RAA amplification primers, including a set of ωRNA and RAA amplification primers; The ωRNA has: (I) Nucleotide sequences as shown in any of SEQ ID No. 6~23; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two; The RAA amplification primer set has: (I) The upstream primer has a nucleotide sequence as shown in any of SEQ ID No. 1, 3-5; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 2; or (III) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to any of the nucleotide sequences shown in (I) to (II), and whose function is the same as that of any of the nucleotide sequences shown in (I) to (II); or (IV) A nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with any of the nucleotide sequences shown in (I) to (III). The plurality is at least two.

[0009] In some specific embodiments of the present invention, the ωRNA has: (I) Nucleotide sequences as shown in SEQ ID No. 14 and 22; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two; The RAA amplification primer set has: (I) The upstream primer has a nucleotide sequence as shown in any of SEQ ID No. 4; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 2; or (III) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to any of the nucleotide sequences shown in (I) to (II), and whose function is the same as that of any of the nucleotide sequences shown in (I) to (II); or (IV) A nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with any of the nucleotide sequences shown in (I) to (III). The plurality is at least two.

[0010] Secondly, the present invention also provides a reagent combination, including the aforementioned ωRNA and RAA amplification primer set; The reagent combination also includes SfaTnpB protein, Fast Digest Buffer and / or ssDNA fluorescent probe; Preferably, the ssDNA fluorescent probe is a single-stranded DNA molecule labeled with a fluorescent group at one end and a quenching group at the other end. In its intact state, the fluorescence is quenched, and after being cleaved, a fluorescent signal is released. Preferably, the ssDNA fluorescent probe has the following characteristics: (I) A nucleotide sequence as shown in SEQ ID No. 24; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two.

[0011] In some specific embodiments of the present invention, the reagent combination further includes a buffer system and / or auxiliary reagents for the RAA amplification reaction; More preferably, the reagent combination includes a RAA amplification reaction system and an SfaTnpB trans-cleavage system; Taking 25 μL as an example, the RAA amplification reaction system includes: Buffer V, 12.5 μL; 10 μM RAA-FecB-F1, 1 μL; 10 μM RAA-FecB-R1, 1 μL; Enzyme freeze-dried powder, half-pack of powder; Magnesium acetate solution, 2.5 μL; Genomic DNA, 10 ng; Taking 20 μL as an example, the SfaTnpB trans-cutting system includes: 10× Fast Digest Buffer, 2 μL; SfaTnpB, final protein concentration 200 nM; ωRNA, 500 ng; ssDNA fluorescent probe, final concentration 250 nM RAA amplification product, 2 μL.

[0012] Thirdly, the present invention also provides a reagent kit, characterized in that it includes any of the following: (I) The aforementioned ωRNA and RAA amplification primer set; and / or (II) The reagent combination described above.

[0013] Fourthly, the present invention also provides the following applications of SfaTnpB protein in rapid visual typing of FecB mutation sites in sheep BMPR1B genes: (I) The aforementioned ωRNA and RAA amplification primer set; (II) The aforementioned reagent combination; and / or (III) The kit described above.

[0014] In some specific embodiments of the present invention, any of the following items are included: (I) Identify the genotype of exon 746 (FecB mutation) of the BMPR1B gene in ordinary sheep individuals; and / or (II) Differentiate the genotypes that have an additional mutation at position 743 on the basis of the mutation at position 746 of the BMPR1B gene exon.

[0015] In some specific embodiments of the present invention, the SfaTnpB protein is used to specifically recognize and cleave the target sequence under the guidance of ωRNA, triggering the cleavage of the ssDNA fluorescent probe, thereby generating a change in fluorescence signal; based on the changes in fluorescence signal in different reaction systems, the sheep FecB mutation site is determined, and visual typing is achieved; Preferably, the criteria for the visual classification include: When the reaction tube containing the A allele ωRNA shows obvious fluorescence and the reaction tube containing the G allele ωRNA shows no fluorescence, the genotype is AA; When both the reaction tube containing the A allele ωRNA and the reaction tube containing the G allele ωRNA show obvious fluorescence, the genotype is AG. When the reaction tube containing the A allele ωRNA shows no fluorescence and the reaction tube containing the G allele ωRNA shows obvious fluorescence, the genotype is GG.

[0016] Fifthly, the present invention also provides a method for rapid visual typing of FecB mutations in the sheep BMPR1B gene based on the SfaTnpB protein, comprising the following steps: Step 1: Process the sheep samples to be tested, perform coarse extraction, and obtain genomic DNA; Step 2: The FecB mutation site in the genomic DNA is amplified at an isothermal temperature using the RAA amplification primer set from the ωRNA and RAA amplification primer set described above to obtain the amplification product; Step 3: The amplification product is reacted with SfaTnpB protein, ωRNA and RAA amplification primers targeting different alleles respectively, and ssDNA fluorescent probe in the reagent combination in a Fast Digest Buffer reaction system. Step 4: Based on the changes in fluorescence signal of ssDNA fluorescent probes in reaction systems containing ωRNAs corresponding to different alleles, the genotype of the FecB mutation site is determined, thereby achieving visual typing. Preferably, the sheep sample includes, but is not limited to, one or more of blood, saliva, tissue, cells, or hair.

[0017] In some specific embodiments of the present invention, the isothermal amplification in step 2 is at a temperature of 37°C and a time of 30 min; The reaction in step 3 is carried out at a temperature of 37–42°C for 5 min; the reaction is then terminated by heating at 95°C for 2 min.

[0018] The present invention has the following beneficial effects: 1. This invention combines RAA isothermal amplification technology with the SfaTnpB nuclease detection system, eliminating the need for complex thermal cycling equipment and enabling the detection process to be completed in a shorter time, significantly shortening the detection cycle.

[0019] 2. This invention has low requirements for instruments and equipment, and does not require complicated sample processing and testing procedures, making it suitable for rapid testing at the grassroots level and on-site.

[0020] 3. By designing ωRNAs targeting different alleles, highly specific identification of target mutation sites can be achieved, effectively distinguishing different genotypes and reducing non-specific interference.

[0021] 4. This invention can not only detect mutations at position 746, but also avoid the influence of some additional mutations at position 743, thus improving the precision of typing and its application value. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0023] Figure 1 The image shows the screening of highly efficient SfaTnpB ωRNAs for genotyping. A shows the Sanger sequencing peaks of the amplified fragments of the FecB mutation sites in individuals with AA and GG genotypes, as well as the enzyme digestion results of the amplified products of the two genotypes using the original WT-ωRNA and MT-ωRNA. B shows the fluorescence results of enzyme digestion after adding mutations at positions 1-4 and 13-16 of WT-ωRNA and MT-ωRNA. Figure 2 The results show the rapid and accurate typing of 12 sheep samples using the SfaTnpB nuclease system; where A shows the visualized typing results of 12 sheep samples using the identified highly efficient SfaTnpB ωRNAs; B shows the Sanger sequencing peak diagram of the amplified fragments of the FecB mutation sites in the 12 sheep samples. Figure 3The results show the screening of highly efficient RAA amplification primers compatible with the 743rd additional mutation; A shows the Sanger sequencing peak diagrams of individuals with the 743AG / 746AA and 743AG / 746AG genotypes, and the visualization results of the enzyme digestion reaction of the amplification products of three different individuals of the above two genotypes by SfaTnpB nuclease under the guidance of WT-m15-ωRNA and MT-m15-ωRNA; B shows the amplification of the target sequence using three different sets of RAA primers, and the comparison of the fluorescence signal differences of the enzyme digestion products in individuals with different genotypes, thereby screening out amplification primers with excellent performance; Figure 4 The SfaTnpB nuclease system can rapidly and accurately genotype 16 different mutant samples containing a single mutation at position 746 and an additional mutation at position 743. A shows the results of visual genotyping of 16 sheep samples using the screened, highly efficient SfaTnpB ωRNA and RAA primers compatible with the additional mutation at position 743. B shows the Sanger sequencing peaks of the amplified fragments of the FecB mutation sites in 16 sheep samples with different genotypes. Detailed Implementation

[0024] This invention discloses a rapid typing method and kit for sheep FecB mutation sites based on SfaTnpB nuclease. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the same result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0025] The present invention adopts the following technical solution: This invention provides a rapid visualization and typing method for the FecB mutation site of the sheep BMPR1B gene based on the SfaTnpB protein, comprising the following steps: (1) Process the sheep samples to be tested and extract genomic DNA crudely; sheep samples include but are not limited to blood, saliva, tissue, cells, hair, etc.

[0026] (2) The genomic DNA was amplified at an isothermal temperature using a set of RAA amplification primers designed for the FecB mutation site to obtain an amplification product containing the target mutation site; (3) The amplification product, SfaTnpB protein, ωRNA targeting different alleles, and ssDNA fluorescent probes were reacted at an isothermal temperature in a Fast Digest Buffer reaction system. (4) The SfaTnpB protein is used to specifically recognize and cleave the target sequence under the guidance of ωRNA, triggering the cleavage of the ssDNA fluorescent probe, thereby generating a change in fluorescence signal; based on the changes in fluorescence signal in different reaction systems, the sheep FecB mutation site is determined, and a visual typing is achieved.

[0027] Furthermore, the RAA amplification primer set is used to amplify the target fragment containing the mutation site at position 746, and can simultaneously cover the potential mutation site at position 743.

[0028] Furthermore, the RAA amplification primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.5.

[0029] Furthermore, the ωRNA is a guide RNA specifically designed for different alleles, and its nucleotide sequence is shown in SEQ ID NO.6~SEQ ID NO.23.

[0030] Furthermore, the ssDNA fluorescent probe is a single-stranded DNA molecule with a fluorescent group labeled at one end and a quenching group labeled at the other end. In its intact state, the fluorescence is quenched, and after being cleaved, a fluorescent signal is released.

[0031] Furthermore, the reaction in step (3) is carried out under constant temperature conditions of 37–42°C.

[0032] Furthermore, the method can distinguish different genotypes at position 746 and can identify complex genotypes with an additional mutation at position 743 on top of the mutation at that position.

[0033] The present invention also provides a kit for implementing the above method, comprising: SfaTnpB protein, ωRNA, RAA amplification primer set, Fast Digest Buffer, and ssDNA fluorescent probe.

[0034] Furthermore, the kit also includes a buffer system and auxiliary reagents for the RAA amplification reaction.

[0035] Furthermore, the kit is suitable for rapid on-site detection and visual typing of the FecB mutation site in the sheep BMPR1B gene.

[0036] The present invention provides a rapid typing method for the FecB mutation site of the sheep BMPR1B gene based on SfaTnpB nuclease and a kit in which the raw materials and reagents used are commercially available.

[0037] The present invention will be further illustrated below with reference to the embodiments: Example 1. Screening for ωRNAs that can mediate the specific recognition of FecB mutation sites by SfaTnpB. This embodiment first designed a set of RAA amplification primers (RAA-FecB-F1 / R1) targeting the FecB mutation site in sheep. Their specific sequences are as follows: RAA-FecB-F1: 5'-AAACATTAAACAATCTGTAGTGCCGTGAACGC-3' (SEQ ID NO. 1); RAA-FecB-R1: 5'-CCAAGATGTTTTCATGCCTCATC T ACACCGTC-3' (SEQ ID NO. 2).

[0038] Specifically, a base mismatch (underlined) is introduced between RAA-FecB-R1 and the target sequence to construct the "NTAC" TAM sequence required for SfaTnpB recognition. Furthermore, ωRNAs targeting wild-type and mutant fecB mutations, namely WT-ωRNA and MT-ωRNA, were designed respectively, with the sequences shown below: WT-ωRNA: 5'-GUAAAAGUCAAUCAGCAUAGGAACUAUAUGUUCUGCCCUAUGAGGGGUAAUGAGAUACCCUAAUCUUGAGGAUCACUCAAGAAUCCCACCCGUAAUUUAGGGUGGGAGUCUCAAAAAUAUAUCAGACGGUGUUGACCGUCUGAUAUAUUU-3' (SEQ ID NO.6); MT-ωRNA: 5'-GUAAAAGUCAAUCAGCAUAGGAACUAUAUGUUCUGCCCUAUGAGGGGUAAUGAGAUACCCUAAUCUUGAGGAUCACUCAAGAAUCCCACCCGUAAUUUAGGGUGGGAGUCUCAAAAAUAUAUCAGACGGUGUUGACCGUCCGAUAUAUUU-3' (SEQ ID NO.7); The bolded portion represents the spacer region of ωRNA, which is the key functional region used for targeted recognition of target sequences.

[0039] Note: Since the sequence list created by WIPO software cannot display "U", please replace "U" with "T" when creating the sequence list. Please refer to the sequence described in the instruction manual for the correct sequence.

[0040] The aforementioned RAA primers were used to amplify AA and GG genomic DNA, respectively. The amplification reagents were purchased from Jiangsu Qitian Biotechnology Co., Ltd. as RAA isothermal amplification reagents (catalog number B00000). The reaction volume was 25 μL, including: 12.5 μL buffer V, 1 μL 10 μM RAA-FecB-F1, 1 μL 10 μM RAA-FecB-R1, half a branch of lyophilized enzyme powder, 2.5 μL magnesium acetate solution, and approximately 10 ng of genomic DNA. The reaction was carried out at 37℃ for 30 min.

[0041] Simultaneously, WT-ωRNA and MT-ωRNA were prepared using in vitro transcription. Subsequently, a 20 μL SfaTnpB trans-cleavage system was constructed, comprising: 2 μL of 10× Fast Digest Buffer, SfaTnpB protein (final concentration 200 nM), 500 ng of ωRNA, an ssDNA fluorescent probe (final concentration 250 nM, sequence 5'-ROX / GTATCCAGTGCG / 3'BHQ2, as shown in SEQ ID NO.24), and 2 μL of RAA amplification product. The reaction was carried out at 37 °C for 5 min, followed by heating at 95 °C for 2 min to terminate the reaction, and fluorescence signals were read using a blue light detector.

[0042] Experimental results are as follows Figure 1 As shown in Figure A: WT-ωRNA designed for wild type can produce a significant fluorescent signal when detecting AA genotype and has no obvious cross-reactivity with GG genotype; while MT-ωRNA designed for mutant type can produce a significant fluorescent signal when detecting GG genotype, but still has a certain degree of non-specific fluorescent signal for AA genotype.

[0043] Based on the applicant's previous research on the target recognition mechanism of SfaTnpB, it was found that the region from 5 to 12 nt, where the ωRNA and target sequence are complementary, exhibits high sensitivity to mismatched bases. To further reduce the cross-reactivity background between WT-ωRNA and MT-ωRNA, similar mismatched bases (Aw) were introduced into the regions from positions 1 to 4 and from positions 13 to 16 of the ωRNA, respectively. T, C Eight ωRNAs were designed and prepared for wild-type and mutant genotypes, respectively, and their sequences are shown in Table 1. Each ωRNA was used for trans-cleavage detection of AA and GG genotype amplification products. The results showed that when the mismatch was introduced at positions 1-3, it still produced a weak fluorescent signal for the AA genotype; when the mismatch was located at position 4, it reduced the detection signal for the target GG genotype (see Table 1). Figure 1 (B)

[0044] Table 1 ωRNA-spacer mismatch sequences

[0045] Note: Since the sequence list created by WIPO software cannot display "U", please replace "U" with "T" when creating the sequence list. Please refer to the sequence described in the instruction manual for the correct sequence.

[0046] Analysis of the detection results for AA and GG genotypes revealed that the ωRNA designated m15 performed best, significantly reducing the background signal of non-target alleles while maintaining the fluorescence signal intensity of the target allele. Therefore, WT-m15-ωRNA and MT-m15-ωRNA were ultimately selected as the optimal genotyping combination.

[0047] Example 2. Rapid and accurate typing verification of sheep samples using the SfaTnpB nuclease system. In this embodiment, 12 sheep (Hu sheep) samples were used as the test subjects, and genomic DNA was extracted from each sample using the crude DNA extraction method. The specific method is as follows: 30 μL of QuickExtract DNA Extraction Solution (Lucigen) was mixed with 10 μL of blood sample, and reacted in a metal bath at 65°C for 6 min, followed by a reaction at 95°C for 2 min. The resulting solution was used directly as the DNA template for subsequent detection.

[0048] The WT-m15-ωRNA and MT-m15-ωRNA obtained in Example 1 were used as the ωRNA combination for genotyping. The reaction was performed according to the RAA amplification system and SfaTnpB trans-cleavage system described in Example 1. Genotyping of the samples was then performed using the SfaTnpB nuclease system. To verify the accuracy of the method, samples from the same batch were simultaneously analyzed using PCR amplification combined with Sanger sequencing as a control.

[0049] Test results as follows Figure 2As shown in Figure A: Visualized detection results based on the SfaTnpB nuclease system indicate that samples 1, 4, 6, 9, and 12 were identified as AA genotype; samples 5, 8, and 11 as AG genotype; and samples 2, 3, 7, and 10 as GG genotype. The Sanger sequencing results of the above 12 samples (as shown in Figure A) are also included. Figure 2 The results (shown in Figure B) are completely consistent with those of the SfaTnpB nuclease system, with a detection accuracy of 100%, indicating that the method of the present invention has high accuracy and reliability.

[0050] Example 3. Screening of efficient RAA amplification primers compatible with the 743rd additional mutation. In this embodiment, for the case of an additional A / G mutation at position 743 found in some sheep (Hu sheep) populations, the RAA primers described in Example 1 were first used to amplify the sample, and the WT-m15-ωRNA and MT-m15-ωRNA obtained from Example 1 were used as ωRNAs for typing, and the SfaTnpB nuclease was used for trans-cleavage detection.

[0051] Currently known related additional mutant genotypes mainly include two types: AG at position 743 - AA at position 746 (743AG / 746AA) and AG at position 743 - AG at position 746 (743AG / 746AG) (see Figure 3 (A) For the two genotypes mentioned above, three samples were randomly selected for genotyping.

[0052] Experimental results show that: Figure 3 As shown in Figure A, MT-m15-ωRNA can produce a significant fluorescent signal when recognizing the target allele G at position 746, while producing no significant background signal for the non-target allele A, and its detection results are not affected by the additional mutation at position 743. In contrast, WT-m15-ωRNA can produce a significant fluorescent signal for the target allele A at position 746 in 743AG / 746AA genotype samples, but in some samples of the 743AG / 746AG genotype, the interference of the AG mutation at position 743 affects its specific recognition of the target allele A at position 746, resulting in some samples being misclassified as GG genotype.

[0053] To reduce the impact of the additional mutation at position 743 on the accuracy of WT-m15-ωRNA genotyping, three pairs of RAA amplification primers were redesigned for this region (see Table 2). The core of the primer design was to ensure that the amplified fragment covered the mutation site at position 743, and to uniformly convert the AG mutation at this site to AA through primer sequence design, thus eliminating its interference with subsequent detection.

[0054] Different genotype samples (including 3 cases of 743AG / 746AG, 1 case of 743AG / 746AA, and 1 case of GG genotype) were selected to screen the above primers. After amplification according to the RAA amplification system described in Example 1, genotyping was performed using WT-m15-ωRNA and MT-m15-ωRNA, respectively.

[0055] Table 2. RAA amplification primer pairs

[0056] Test results as follows Figure 3 As shown in Figure B: Primer set 1 failed to effectively cover the mutation site at position 743. The presence of the G allele at this site interfered with the typing results of WT-m15-ωRNA. Primer set 3 mitigated the impact of the G mutation at position 743 to some extent, but the fluorescence signal of WT-m15-ωRNA was significantly reduced when the G allele was present at this site, affecting result interpretation. In contrast, primer set 2 effectively converted the G allele at position 743 to A, thus completely eliminating its interference with detection. The typing results for all test samples were consistent with the Sanger sequencing results.

[0057] In summary, primer set 2 is the optimal primer combination for RAA amplification. It is not only suitable for genotype detection containing only the mutation at position 746, but also compatible with the interference of the additional mutation at position 743, thus achieving accurate genotyping.

[0058] Example 4. Accurate typing verification of the SfaTnpB nuclease system for samples with mutation at position 746 and those containing an additional mutation at position 743. In this embodiment, 16 sheep (Sahu sheep) samples were used as the testing subjects, and genomic DNA was extracted from each sample using a crude DNA extraction method. The specific method is the same as that described in Example 2.

[0059] The WT-m15-ωRNA and MT-m15-ωRNA obtained in Example 1 were used as the ωRNA combination for genotyping, and primer 2 obtained in Example 3 was selected as the RAA amplification primer. The RAA amplification system and SfaTnpB trans-cutting system described in Example 1 were used to perform genotyping detection on the above samples.

[0060] To verify the detection accuracy of the method of the present invention, a control analysis was performed on samples from the same batch using a combination of PCR amplification and Sanger sequencing.

[0061] Test results as follows Figure 4As shown in Figure A: Visualized detection results based on the SfaTnpB nuclease system show that samples 1-6, 8, 10, and 15 are identified as GG genotype; samples 9, 11, 12, and 16 are identified as AA genotype; and samples 7, 13, and 14 are identified as AG genotype.

[0062] Combined with Sanger sequencing peak diagrams (e.g.) Figure 4 Analysis (as shown in Figure B) revealed that samples 7, 11, and 13 all had an additional AG mutation at position 743. Comparison of the genotype at position 746 of these 16 samples showed that the detection results from the SfaTnpB nuclease system were completely consistent with the Sanger sequencing results.

[0063] The above results show that the method of the present invention can effectively eliminate the interference of the 743rd additional mutation on the detection and achieve accurate typing of the 746th mutation site, with high accuracy and reliability.

[0064] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A set of primers for ωRNA and RAA amplification, characterized in that, Includes ωRNA and RAA amplification primer sets; The ωRNA has: (I) Nucleotide sequences as shown in any of SEQ ID No. 6~23; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two; The RAA amplification primer set has: (I) The upstream primer has a nucleotide sequence as shown in any of SEQ ID No. 1, 3-5; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 2; or (III) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to any of the nucleotide sequences shown in (I) to (II), and whose function is the same as that of any of the nucleotide sequences shown in (I) to (II); or (IV) A nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with any of the nucleotide sequences shown in (I) to (III). The plurality is at least two.

2. The ωRNA and RAA amplification primer set as described in claim 1, characterized in that, The ωRNA has: (I) Nucleotide sequences as shown in SEQ ID No. 14 and 22; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two.

3. The ωRNA and RAA amplification primer set as described in claim 1 or 2, characterized in that, The RAA amplification primer set has: (I) The upstream primer has a nucleotide sequence as shown in any of SEQ ID No. 4; and (II) The downstream primer has the nucleotide sequence shown in SEQ ID No. 2; or (III) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to any of the nucleotide sequences shown in (I) to (II), and whose function is the same as that of any of the nucleotide sequences shown in (I) to (II); or (IV) A nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with any of the nucleotide sequences shown in (I) to (III). The plurality is at least two.

4. A reagent combination, characterized in that, Includes the ωRNA and RAA amplification primer set as described in any one of claims 1 to 3.

5. The reagent combination as described in claim 4, characterized in that, The reagent combination also includes SfaTnpB protein, FastDigest Buffer, and / or ssDNA fluorescent probe.

6. The reagent combination as described in claim 5, characterized in that, The ssDNA fluorescent probe is a single-stranded DNA molecule with a fluorescent group labeled at one end and a quenching group labeled at the other end. In its intact state, the fluorescence is quenched, and after being cleaved, it releases a fluorescent signal.

7. The reagent combination as described in claim 5 or 6, characterized in that, The ssDNA fluorescent probe has the following characteristics: (I) A nucleotide sequence as shown in SEQ ID No. 24; and / or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (I), and having the same function as the nucleotide sequence shown in (I); and / or (III) A nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in (I) or (II). The plurality is at least two.

8. The reagent combination according to any one of claims 4 to 7, characterized in that, The reagent combination also includes a buffer system and / or auxiliary reagents for the RAA amplification reaction.

9. The reagent combination according to any one of claims 4 to 8, characterized in that, The reagent combination includes the RAA amplification reaction system and the SfaTnpB trans-cutting system.

10. The reagent combination as described in claim 9, characterized in that, Taking 25 μL as an example, the RAA amplification reaction system includes: Buffer V, 12.5 μL; 10 μM RAA-FecB-F1, 1 μL; 10 μM RAA-FecB-R1, 1 μL; Enzyme freeze-dried powder, half a tube of powder; Magnesium acetate solution, 2.5 μL; Genomic DNA, 10 ng.

11. The reagent combination as described in claim 9, characterized in that, Taking 20 μL as an example, the SfaTnpB trans-cutting system includes: 10× Fast Digest Buffer, 2 μL; SfaTnpB, final protein concentration 200 nM; ωRNA, 500 ng; ssDNA fluorescent probe, final concentration 250 nM RAA amplification product, 2 μL.

12. A reagent kit, characterized in that, Includes any of the following: (I) The ωRNA and RAA amplification primer set as described in any one of claims 1 to 3; and / or (II) The reagent combination as described in any one of claims 4 to 11.

13. Any of the following applications of SfaTnpB protein in rapid visual typing of FecB mutation sites in the sheep BMPR1B gene; (I) The ωRNA and RAA amplification primer set as described in any one of claims 1 to 3; (II) The reagent combination as described in any one of claims 4 to 11; and / or (III) The kit as described in claim 12.

14. The application as described in claim 13, characterized in that, Includes any of the following: (I) Identify the genotype of exon 746 (FecB mutation) of the BMPR1B gene in ordinary sheep individuals; and / or (II) Differentiate the genotypes that have an additional mutation at position 743 on the basis of the mutation at position 746 of the BMPR1B gene exon.

15. The application as described in claim 13 or 14, characterized in that, By utilizing the specific recognition and cleavage of target sequences by the SfaTnpB protein under the guidance of ωRNA, the cleavage of ssDNA fluorescent probes is triggered, thereby generating changes in fluorescence signals. Based on the changes in fluorescence signals in different reaction systems, the FecB mutation sites in sheep are identified, achieving visualized typing.

16. The application as described in claim 15, characterized in that, The criteria for the visual classification include: When the reaction tube containing the A allele ωRNA shows obvious fluorescence and the reaction tube containing the G allele ωRNA shows no fluorescence, the genotype is AA; When both the reaction tube containing the A allele ωRNA and the reaction tube containing the G allele ωRNA show obvious fluorescence, the genotype is AG. When the reaction tube containing the A allele ωRNA shows no fluorescence and the reaction tube containing the G allele ωRNA shows obvious fluorescence, the genotype is GG.

17. A method for rapid visual typing of FecB mutations in the sheep BMPR1B gene based on SfaTnpB protein, characterized in that, Includes the following steps: Step 1: Process the sheep samples to be tested, perform coarse extraction, and obtain genomic DNA; Step 2: Using the RAA amplification primer set from the ωRNA and RAA amplification primer set as described in claim 1 or 2, the FecB mutation site in the genomic DNA is amplified at an isothermal temperature to obtain the amplification product; Step 3: The amplification product is reacted with SfaTnpB protein, ωRNA and RAA amplification primers as described in claim 1 or 2 that target different alleles respectively, and ssDNA fluorescent probes in the reagent combination as described in claim 3 or 4 in a Fast Digest Buffer reaction system. Step 4: Based on the changes in fluorescence signal of ssDNA fluorescent probes in reaction systems containing ωRNAs of different alleles, the genotype of the FecB mutation site is determined, thereby achieving visual typing.

18. The method as described in claim 17, characterized in that, The sheep sample includes, but is not limited to, one or more of the following: blood, saliva, tissue, cells, or hair.

19. The method as described in claim 17 or 18, characterized in that, The isothermal amplification in step 2 is performed at a temperature of 37°C for 30 minutes.

20. The method according to any one of claims 17 to 19, characterized in that, The reaction in step 3 is carried out at a temperature of 37–42°C for 5 minutes. The reaction was then terminated by heating at 95°C for 2 minutes.