Oligonucleotides conjugated to oleic acid and uses thereof

Abstract

The present invention provides oligonucleotide and / or oligonucleotide analogue molecules which are antagonists of microRNAs, preferably of human microRNAs hsa-miR-23b-3p and hsa-miR-218-5p, which comprise a mixture of phosphorothioate and phosphodiester linkages, and which are conjugated to at least one oleic acid molecule. Inhibition of these microRNAs can increase the endogenous levels of the corresponding proteins MBNL1 and / or MBNL2. The present invention further provides compositions comprising said oligonucleotide and / or oligonucleotide analogue molecules and their use for the treatment and prevention of diabetes in a subject in need thereof.

Description

Technical Field

[0001] This invention relates to the pharmaceutical field. More specifically, this invention relates to oligonucleotide antagonists of endogenous microRNAs conjugated with oleic acid (especially hsa-miR-218-5p and hsa-miR-23b-3p), and their uses. Background Technology

[0002] Myotonic dystrophy type 1 (DM1) is a rare genetic disorder for which there is currently no effective treatment. DM1 is associated with a severe disease burden, causing damage to many different systems and tissues in patients. Muscle weakness and fatigue are the two most common manifestations, reported in 93% and 90% of patients, respectively, followed by muscle stiffness (73%). Other phenotypes include cardiac dysfunction, cataracts, insulin resistance, and cognitive impairment. DM1 disease is based on CTG repeat amplification in the DM1 protein kinase (DMPK) gene, which is transcribed into pathogenic mRNA. It is now known that CTG amplification binds with high affinity to the myoblinoid protein family (MBNL1, 2, and 3), thereby inhibiting their normal function, but other alterations may lead to depletion of MBNL1 and MBNL2. MBNL1 and MBNL2 are preferentially expressed in skeletal muscle and the brain, respectively, while MBNL3 is primarily expressed during embryonic development and adult tissue regeneration.

[0003] MBNL1 and MBNL2 proteins control alternative splicing and polyadenylation of several transcripts, specifically leading to a transition from fetal to adult patterns. MBNL1 and MBNL2 proteins antagonize the CUGBP Elav-like family member 1 (CELF) protein, which is found to be upregulated and mislocalized in DM1, in splicing regulation. Furthermore, genetic redundancy has been demonstrated between the MBNL1 and MBNL2 genes, as deletion of only one gene leads to upregulation of the other and its occupation of its binding site on target RNA (see Lee 2013. Compound loss of muscleblind-like function in myotonic dystrophy. EMBO Mol Med 5:1887-900). The depletion of MBNL1 protein function has been shown to be a key factor in disease progression. In fact, loss of MBNL1 function can lead to more than 80% of missplicing events and nearly 70% of expression defects. Upregulation of the MBNL gene and / or MBNL protein was well-tolerated in DM1 mice and patient-derived fibroblasts, alleviating various symptoms such as myotonia and missplicing events, and reducing lesion formation, paving the way for the development of therapeutic pathways aimed at increasing the expression of these genes. MBNL1 and MBNL2 depletion also affects several other gene expression processes, such as impairing membrane-associated mRNA transport or miRNA biosynthesis.

[0004] MicroRNAs (also referred to as “miRNAs” or “miRs” in this paper) are a class of small non-coding RNAs that play an important role in regulating gene expression, particularly gene silencing. In human cells, luciferase reporter gene assays have shown that the expression of hsa-miR-23b-3p and hsa-miR-218-5p directly regulates MBNL1 and MBNL2 transcripts (Cerro-Herreros et al., 2018 Nat. Commun. 9, 2482). In mammalian models, silencing hsa-miR-23b-3p and hsa-miR-218-5p increases blind-like protein expression and alleviates the myotonic dystrophy phenotype. On the other hand, anti-miRs are oligonucleotides that prevent other molecules (such as microRNAs) from binding to target sites on RNA molecules, especially messenger RNA (mRNA). Using conventional anti-miRs as therapeutic molecules has limitations in their development as drug candidates, including short lifespans due to degradation in the cellular environment, poor cellular uptake from extracellular culture media, and a limited therapeutic window, expressed as the concentration ratio of median toxicity to median efficacy (TC50 / EC50), where a higher ratio generally indicates better efficacy. Therefore, further development of methods aimed at improving pharmacological parameters such as stability, potency, tissue-specific uptake, and therapeutic window of anti-miRs is needed to fully realize their potential in inhibiting their targets hsa-miR-218-5p and hsa-miR-23b-3p.

[0005] On the one hand, albumin is one of the most abundant proteins in blood plasma, responsible for the transport of fatty acids, drugs, ions, and other metabolites. The conjugation of oligonucleotides to fatty acids can increase the binding affinity of oligonucleotides to albumin, enhance their ability to cross the endothelial barrier, and improve their functional uptake in muscle, thereby increasing the potency of oligonucleotides in vivo. However, there are many types of saturated and unsaturated fatty acids with diverse structures, which in turn can affect protein binding or the activity of fatty acid conjugates. Therefore, it remains unclear which fatty acid is best suited to enhance the potency of oligonucleotides.

[0006] On the other hand, oligonucleotides can be further chemically modified to enhance their pharmacological parameters. Among these modifications, phosphate thioester (PS) bonds have consistently shown promising effects as first-generation antisense oligonucleotides, although some significant limitations still hinder the development of fully modified (all-PS) therapeutic oligonucleotides. These limitations include the toxicity of PS-oligonucleotides reported in some studies in mice, rats, monkeys, and humans. In mice and rats, these side effects included thrombocytopenia, elevated liver transaminases, reticuloendothelial cell proliferation in various organs, and renal tubular changes (UMSarmiento et al. In vivo toxicological effects of rel A antisense phosphorothioates in CD-1 mice. Antisense Res Dev. 1994 Summer;4(2):99-107. doi: 10.1089 / ard.1994.4.99. PMID: 7950306; S Agrawal et al. Mixed-backboneoligonucleotides as second generation antisense oligonucleotides: In vitro and in vivo studies. Proceedings of the National Academy of Sciences Mar1997, 94 (6) 2620-2625; DOI: 10.1073 / pnas.94.6.2620). The side effects observed in monkeys were complement activation (Agrawal, Sudhir et al. "Novel enzymatic and immunological responses tooligonucleotides." Toxicology letters 82 (1995): 431-434) and prolonged activated partial thromboplastin time (aPTT). Since similar side effects were observed after administration of dextran sulfate, it is inferred that these side effects are caused by the polyanionic nature of PS-oligonucleotides and are not nucleotide sequence specific. Therefore, there is a need to develop oligonucleotides with reduced toxicity but improved stability.

[0007] This invention overcomes these limitations by providing improved oleic acid-conjugated antimiR. Attached Figure Description

[0008] Figure 1Evaluation of toxicity and efficacy against DM1 cells. Following lipid transfection with (A) MD23b-2, (B) 5'-23b-oleic acid, (C) unconjugated-23b, or (D) 218-D / LNA2 at five different concentrations (for MD23b-2, 5'-23b-oleic acid, and unconjugated-23b: 10 nM, 50 nM, 200 nM, 1 µM, and 5 µM; for 218-D / LNA2: 0.08 nM, 0.4 nM, 2 nM, 10 nM, and 50 nM), toxicity (percentage of cell growth inhibition, black) and efficacy (percentage increase in MBNL1 expression compared to simulated transfected cells, gray) against DM1 myotubes are presented. Dashed lines represent TC50 and EC50 levels. Each concentration was tested in triplicate. Error bars = standard error of the mean (SEM). The Graphpad equation “bell-shaped dose-response” was used to fit the dose-response curves.

[0009] Figure 2 5 days after the specified treatment, HSA LR Functional efficacy was assessed in mice. Five days after a single injection (AI) of 3 mg / kg of different antimiRs, (A) strength / body weight and (B) myotonia grade were analyzed. Data in A were analyzed by unpaired Student's t-test and compared with HSA treated with PBS (PBS). LR Mice were compared. p-values: ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0010] Figure 3 miRNA levels in muscle tissue. The expression levels of (A) miR-23b-3p and (B) miR-218-5p relative to the U1 and U6 snRNA endogenous controls were quantified by qRT-PCR in the gastrocnemius (gt) and quadriceps (qd) muscles. HSA LR Mice were intravenously injected via the tail vein with either PBS or different anti-miRs at the same concentration (3 mg / kg). Five days post-injection, mice were sacrificed, and their muscles were dissected and processed to extract RNA. Student's t-test was used to analyze the HSA levels based on PBS treatment. LR All statistical comparisons were performed. p-values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0011] Figure 4 Treated HSA LRExpression of Mbnl1 and Mbnl2 in mouse skeletal muscle. (A) Mbnl1 transcriptional levels and (B) Mbnl2 transcriptional levels in the gastrocnemius (gt) and quadriceps femoris (qd) muscles relative to the Gapdh endogenous control were quantified by qRT-PCR; (C) Mbnl1 protein levels relative to the endogenous tubulin control were determined using quantitative Western blot. HSA LR Mice were intravenously injected via the tail vein with either PBS or different anti-miRs at the same dose (3 mg / kg). Five days post-injection, the gastrocnemius and quadriceps muscles were dissected, and the tissues were processed for RNA and protein analysis. Student's t-test was used to analyze HSA based on PBS treatment. LR All statistical comparisons were performed. p-values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0012] Figure 5 Anti-miR improved Mbnl-dependent transcript missplicing. HSA LR Mice were intravenously injected with PBS or different anti-miRs via the tail vein at the same dose (3 mg / kg). Five days after injection, the gastrocnemius and quadriceps muscles were dissected, and the tissues were processed to extract RNA. (A) Semi-quantitative RT-PCR analysis of splicing of (A) Atp2a1 exon 22, (B) Nfix exon 7, (C) Mbnl1 exon 5, and (D) Clcn1 exon 7a in the gastrocnemius (gt) and quadriceps (qd) muscles was performed. Exon inclusion levels in healthy control mice (FVB) were also included for comparison. Student's t-test was used to analyze HSA based on PBS treatment. LR All statistical comparisons were performed. p-values: ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data points represent individual mouse values. Error bars = standard error of the mean (SEM).

[0013] Figure 6 . Figure 5 This paper summarizes representative agarose gels used for quantifying Atp2a1, Clcn1, Nfix, and Mbnl1 transcripts in the gastrocnemius and quadriceps muscles. The effects of oligonucleotide treatments targeting miR-23b-3p (A, B) and miR-218-5p (C, D) are shown. HSA treatments in wild-type mice (FVB) and PBS are also presented. LR The splicing patterns in mice are shown for comparison.

[0014] Figure 7 The spider diagram illustrates the processing of HSA. LREffects of several DM1-related molecules or functional phenotypes in mice. Values ​​represented are recovery indices (RI), which measure the HSA levels after treatment. LR The different values ​​in mice are shown to be close to the FVB control parameter, which is represented by 1 (solid black line). Inset (A) summarizes the RI of anti-miR against miR-23b-3p, while (B) focuses on the RI of anti-miR against miR-218-5p. For more detailed representation, see "Radar Plots" in the Materials and Methods section.

[0015] Figure 8 Chemical structures of the different linkers used to connect the MD23b-2 V2 oligonucleotide and oleic acid. Drawings of the entire resulting molecule, except for the oligonucleotide components, were generated using ChemDraw software.

[0016] Figure 9 Used Figure 8 The different linkers drawn in the figure were 3'-conjugated oligonucleotides MD23b-2 V2 with oleic acid, and the MBNL1 protein in DM1 cells was quantified by treatment at a specified concentration.

[0017] Protein levels were quantified using quantitative spot blot analysis (QDB) and normalized based on endogenous GAPDH. Protein levels from DM1 cells treated only with the transfection reagent (DM1) were assigned a value of 1, and all other data were normalized accordingly. Statistical comparisons shown were performed using Student's t-tests based on DM1 cells treated with the transfection reagent. p-values: ns = not significant, *p < 0.05, **p < 0.01, and ***p < 0.001. Error bars = standard error of the mean (SEM).

[0018] Figure 10 A) Chemical structure of MD23b-2V2 3'Ol oligonucleotide. The complete molecule drawing was generated using ChemDraw software. B) Chemical structure of MD23b-2-PS / PO 3'Ol oligonucleotide. The complete molecule drawing was generated using ChemDraw software. C) Chemical structure of 218MOE oleic acid 3' oligonucleotide. The complete molecule drawing was generated using ChemDraw software.

[0019] Figure 11 MD23b-2 V2 3'Ol and MD23b-2 V2 (ng / g) in the brain, gastrocnemius muscle, quadriceps femoris muscle, kidney, and liver were measured by ELISA. Student's t-test was used for statistical comparison of MD23b-2 V2 3'Ol and MD23b-2 V2 in specific tissues. Statistical significance was set at p<0.05 (**p<0.01, ***p<0.001). Error bar = SEM.

[0020] Figure 12 MBNL1 relative levels. Phase I and Phase II. MBNL1 levels in protein extracts from NHP brains were quantified by Western blotting. MBNL1 protein levels in NHP brains were compared between Phase I (two weeks after the last administration) and Phase II (three weeks after the last administration). In Western blotting, GAPDH levels were used as an internal standard, and data were normalized based on MBNL1 protein levels in PBS-treated NHP (Group 2) (where levels were assigned a value of 1). Data are mean ± SEM.

[0021] Figure 13 Changes in muscle strength relative to body weight after repeated intravenous administration of MD23b-2 V2 3'Ol (0, 6, 9, 12, and 24 mg / kg) to HSALR mice. A) Muscle strength levels (red bars) after repeated administration (every two weeks for 6 weeks) of MD23b-2 V2 3'Ol at 0, 6, 9, 12, and 24 mg / kg in HSALR mice were compared (normalized) to the strength levels of untreated mice (PBS, shown as the level red bars at discontinuation). Strength is shown on days 0, 7, 14, 21, 28, 35, and 42. Statistical significance was set at p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001). Analysis was performed by one-way ANOVA followed by Dunnett's test. B) Graph showing muscle strength levels over time after treatment and comparison with strength levels in untreated mice. Values ​​are mean ± SEM. PBS: Phosphate-buffered saline.

[0022] Figure 14 MBNL1 protein levels in different organs following repeated intravenous administration of MD23b-2 V2 3'Ol (0, 6, 9, 12, and 24 mg / kg) to HSALR mice. MBNL1 protein levels in muscle (quadriceps, gastrocnemius, and diaphragm), kidney, liver, brain, and heart were determined after repeated administration (every two weeks for 6 weeks) of MD23b-2 V2 3'Ol at 0, 6, 9, 12, and 24 mg / kg to HSALR mice. MBNL1 levels in MD23b-2 V2 3'Ol-treated mice (red column) were compared with those in PBS-treated HSALR mice (PBS, gray column). Statistical analysis was performed using the Kruskal-Wallis test (α = 0.05) followed by the Dunn test. Statistical significance was set at p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Values ​​are mean ± SEM. PBS: phosphate-buffered saline.

[0023] Figure 15 Relative levels and PSR values ​​of miR-23b in HSALR mice following repeated intravenous administration of MD23b-2 V2 3'Ol (0, 6, 9, 12, and 24 mg / kg). A) Relative expression of miR-23b in the muscles of QD and GT mice 14 days after the last administration of MD23b-2 V2 3'Ol at 6, 9, 12, and 24 mg / kg (red bars). miR-23b was quantified relative to the U1 and U6 snRNA endogenous controls. Statistical comparisons shown were performed by one-way ANOVA followed by Dunnett's test, relative to normalized PBS values ​​(grey bars, gray level line) of mice treated with MD23b-2 V2 3'Ol at 6, 9, 12, and 24 mg / kg (red bars). Statistical significance was set at p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). B) Graphical representation of overall PSR splicing, calculated as the mean percentage of splicing recovery of MBNL1 exon 5, NFIX exon 7, CLCN1 exon 7a, BIN1 exon 11, CACNA1S exon 29, and ATP2A1 exon 22 in the GT and QD muscles of treated HSALR mice. All statistical comparisons were performed by one-way ANOVA / Kruskal-Wallis followed by Dunnett or Dunn tests, and compared with data obtained from PBS treatment. Statistical significance was set at p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Values ​​are mean ± SEM. Statistical significance was set at p<0.05. PBS: phosphate-buffered saline; PSR: percentage of splicing recovery; WT: wild-type.

[0024] Figure 16The level of MBNL1 in rat quadriceps femoris muscle protein extract was quantified by Western blotting. MBNL1 protein levels in rat muscle from different experimental groups (groups 1, 2, 3, 4, and 5) at the major stage were compared. In Western blotting, GAPDH levels were used as an internal standard, and data were normalized based on MBNL1 protein levels in PBS-treated rats (group 1), where levels were assigned a value of 1. Data are presented as mean ± SEM. Statistical significance was assessed using the Kruskal-Wallis test (α = 0.05) followed by the Dunn test. Statistical significance was defined as p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Error bar = SEM.

[0025] Figure 17 The level of MBNL1 in rat quadriceps femoris muscle protein extract was quantified by Western blotting. MBNL1 protein levels in rat muscle from different experimental groups (group 1 and group 5) during the recovery phase were compared. In Western blotting, GAPDH levels were used as an internal standard, and data were normalized based on MBNL1 protein levels in PBS-treated rats (group 1), where levels were assigned a value of 1. Data are presented as mean ± SEM. Statistical significance was assessed using an unpaired t-test. Statistical significance was defined as p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Error bar = SEM.

[0026] Figure 18 The levels of MBNL1 in the protein extract of miniature pig quadriceps femoris muscle were quantified by Western blotting. MBNL1 protein levels in the muscle of miniature pigs from different experimental groups (groups 1, 2, 3, and 4) from the primary stage of animal development were compared. In Western blotting, GAPDH levels were used as an internal standard, and data were normalized based on MBNL1 protein levels in PBS-treated miniature pigs (group 1), where levels were assigned a value of 1. Data are presented as mean ± SEM. Statistical significance was assessed using the Welch ANOVA test (α = 0.05) followed by the Dunn test. Statistical significance was defined as p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Error bar = SEM.

[0027] Figure 19The level of MBNL1 in the protein extract of miniature pig quadriceps femoris muscle was quantified by Western blotting. MBNL1 protein levels in the muscle of miniature pigs from different experimental groups (groups 1 and 4) during the recovery phase were compared. In Western blotting, GAPDH levels were used as an internal standard, and data were normalized based on MBNL1 protein levels in PBS-treated miniature pigs (group 1), where levels were assigned a value of 1. Data are presented as mean ± SEM. Statistical significance was assessed using an unpaired t-test. Statistical significance was defined as p < 0.05 (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). Error bar = SEM.

[0028] Figure 20 A) Plasma Test Item 1 (X82108) IV vs. Time. B) CSF Test Item 1 (X82108) IV vs. Time. C) Plasma Test Item 1 (X82108) IT vs. Time. D) CSF Test Item 1 (X82108) IT vs. Time. E) Plasma Test Item 2 (X82102) IT vs. Time. F) CSF Test Item 2 (X82102) IT vs. Time. G) Plasma Test Item 3 (X85204) IT vs. Time. H) CSF Test Item 3 (X85204) IT vs. Time. Summary of the Invention

[0029] In one aspect, the present invention relates to oligonucleotide molecules, or mixtures of two or more said oligonucleotide molecules, wherein the oligonucleotide molecule is 10 to 30 nucleotides in length, wherein the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphate thioester bond, and wherein the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. Preferably, said molecule is a microRNA antagonist, more preferably wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0030] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 to 30 nucleotides and contains at least two nucleotides linked by phosphodiester bonds, wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0031] In one embodiment, the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides in length, and said oligonucleotide molecule further comprises a segment of at least 15 consecutive nitrogen bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0032] In one embodiment, the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides in length, and said oligonucleotide molecule further comprises a segment consisting of a sequence of at least 15 consecutive nitrogen bases of nucleotides that are identical in sequence to the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p).

[0033] In one embodiment, the oligonucleotide molecule according to the first aspect comprises at least one chemical modification, wherein the chemical modification is selected from the group consisting of:

[0034] i) 2'-O-methyl (2'OMe),

[0035] ii) 2'-O-methoxyethyl (2'MOE), and / or

[0036] iii) Additional bridge (LNA) connecting 2' oxygen and 4' carbon.

[0037] In one embodiment, the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides in length, and said oligonucleotide molecule further comprises a segment of at least 15 consecutive nitrogenous bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0038] In one embodiment, the length of the oligonucleotide molecule according to the first aspect is 15 to 30 nucleotides, wherein the nucleotide sequence of said oligonucleotide consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonists of hsa-miR-218-5p).

[0039] In another aspect, the present invention relates to compositions, preferably pharmaceutical compositions, comprising at least one oligonucleotide molecule as defined in the first aspect or any embodiment thereof, or a mixture of two or more of the said oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0040] In another aspect, the present invention relates to the composition defined in the second aspect or any embodiment thereof, for use in treatment.

[0041] In another aspect, the present invention relates to the composition defined in the second aspect or any embodiment thereof, for use in targeting muscle cells of a subject with such need.

[0042] In another aspect, the present invention relates to the composition defined in the second aspect or any embodiment thereof for use in the prevention or treatment of muscle diseases or in the prevention or treatment of RNA diseases.

[0043] Preferably, the disease is myotonic dystrophy, and more preferably, the myotonic dystrophy is type 1 myotonic dystrophy. Detailed Implementation

[0044] General definition

[0045] It should be noted that, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” used herein include plural references. Furthermore, unless otherwise stated, the term “at least” preceding a series of elements should be understood to refer to each element in the series. Those skilled in the art will recognize or be able to determine many equivalents of specific embodiments of the invention described herein using only conventional experimentation. This invention is intended to cover such equivalents.

[0046] Throughout the specification and claims, the term "about" used in conjunction with numerical values ​​indicates an accuracy range familiar and acceptable to those skilled in the art. For example, the term "about" may indicate a value shown ± 1% of its value, or a value shown ± 2% of its value, or a value shown ± 5% of its value, or a value shown ± 10% of its value, or a value shown ± 20% of its value, or a value shown ± 30% of its value. Preferably, the term "about" indicates the exact value shown (±0%).

[0047] As used herein, the conjunction “and / or” connecting multiple listed elements should be understood to encompass both individual options and combined options. For example, when two elements are connected by “and / or”, the first option refers to the applicability of the first element without the second element, the second option refers to the applicability of the second element without the first element, and the third option refers to the applicability of the first and second elements together. Any one of these options should be understood to fall within the scope of the stated meaning and thus satisfy the requirement of the term “and / or” as used herein. The simultaneous applicability of multiple options should also be understood to fall within the scope of the stated meaning and thus satisfy the requirement of the term “and / or”.

[0048] Throughout this specification and the following claims, unless the context otherwise requires, the word “comprising” and its variations (e.g., “including” and “containing”) should be understood to imply inclusion of the specified whole or step or group of whole or steps, but not to exclude any other whole or step or group of whole or steps. When used herein, the term “comprising” may be replaced by the terms “containing” or “including,” and sometimes by the term “having.” When used in the context of aspects or embodiments of the invention, any of the foregoing terms (comprising, containing, including, having) may be replaced by the term “consisting of,” although less preferred.

[0049] The phrase “composed of…” as used herein excludes any element, step, or component not specified in the elements of the claim. The phrase “consistently composed of…” as used herein does not exclude materials or steps that do not materially affect the essential and novel features of the claim.

[0050] As used herein, names of mouse genes are entered in italics, with lowercase letters following capital letters. Mouse protein names follow the same rules as mouse gene symbols, but are not displayed in italics. When referring to human genes or proteins, capital letters are always used, and genes are displayed in italics. However, those skilled in the art will be able to infer the exact nature of the biomolecules (proteins, genes, transcripts) and species from the technical context of this specification.

[0051] As used herein, “oligonucleotide” refers to any short fragment of DNA, RNA, or DNA / RNA, including both natural and synthetic nucleotides. As used herein, the term “oligonucleotide molecule” includes both the oligonucleotide itself and “oligonucleotide analogs.” An “oligonucleotide analog” is a molecule derived from an oligonucleotide that introduces some chemical modification into at least one of the nucleotide units forming the oligonucleotide, whether in a phosphate group, a pentose sugar, or a nitrogenous base; it also includes modifications such as the addition of non-nucleotide groups at the 5' and / or 3' ends, as well as phosphodiesteromorpholino oligomers, peptide nucleic acids (PNAs; a DNA mimic in which the deoxyribose phosphate backbone is replaced by a pseudopeptide polymer linked to a nucleobase), etc. Furthermore, for the purposes of this invention and as used herein, the terms “oligonucleotide molecule” and “oligonucleotide analog” or “oligonucleotide analog molecule” also include microRNA sponges or microRNA sponges, as their main components can be considered to be tandem repeat units of oligonucleotides, characterized in that each of these oligonucleotides is itself or contains a binding site for the microRNA of interest. For clarity, it is mentioned that the oligonucleotide sequences disclosed herein and numbered with “SEQ ID NO” include nucleobase sequences with chemical modifications and / or fatty acid conjugations (if any). For example, SEQ ID NO: 3 refers to the nucleobase sequence “ATCCCTGGCAATGTGA” with LNA, phosphate thioester bonds, and 5-methyl-2'-O-methylcytidine modifications. Therefore, the sequence is represented herein as SEQ ID NO: 3: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCms-AbAmTbGbTmsGbsAb(NHC6) (oleic acid).

[0052] The term "antagonist oligonucleotide" as used herein refers to an oligonucleotide capable of blocking or inhibiting the natural function of a molecule (microRNA in this context). Therefore, the antagonist oligonucleotide of this invention is an inhibitory molecule that inhibits the activation, stability, or function of an antimiR bound to it. In the context of this invention, "antagonist" and "inhibitor" are synonymous and can therefore be used interchangeably. For example, "antagonist oligonucleotide of hsa-miR-23b-3p" refers to an oligonucleotide molecule that inhibits the function of hsa-miR-23b-3p.

[0053] The “sequence identity percentage” of polynucleotides and peptides is determined by comparing two best-aligned sequences within a comparison window, where the portion of the polynucleotide or peptide sequence within the comparison window may contain additions or deletions (i.e., vacancies) to achieve optimal alignment. The percentage is calculated as follows: the number of positions in both sequences containing the same nucleobase or amino acid residue is determined to obtain the number of matching positions; this number is divided by the total number of positions within the comparison window; and the result is multiplied by 100 to obtain the sequence identity percentage. Optimal alignment of sequences used for comparison can be performed using computerized implementations of known algorithms (BLAST from the National Center for Biotechnology Information, CLUSTAL from the European Institute of Bioinformatics, GAP, BESTFIT, FASTA, and TFASTA from the Wisconsin Genetics Package, Genetic Computing Group (GCG), 575 Science Dr., Madison, Wisconsin) or by inspection. It is important to note that the "identity percentage" used herein is determined in the context of local alignment, i.e., it is based on the comparison of locally similar regions between nucleobase sequences, as opposed to a global alignment that aims to compare two sequences across their entire span. Therefore, in the context of this invention, the identity percentage is preferably calculated based solely on local alignment comparison algorithms.

[0054] Typically, especially in the case of miR resistance, chemical modifications are incorporated into the corresponding nucleotide units, primarily affecting the ribose and / or phosphate groups. These modifications are difficult to describe in conventional nucleotide sequence representations, where nucleotides present at a given position are identified by abbreviations of nitrogenous bases belonging to that part. Therefore, in this invention, the molecules of microRNA antagonists are compared by the percentage of identity between the nitrogenous or nucleobase sequences of the nucleotide or nucleotide analog units present in these units, as this indicates whether two molecules or sequence fragments were designed from the same original basic nucleotide sequence, regardless of the different chemical modifications that may be included in the nucleotides in each case.

[0055] As used in the specification, it should be understood that when one of the nucleotide or nucleotide analog sequences (read in the 5'-3' direction) is a nucleotide or nucleotide analog sequence that pairs a nitrogenous base with the nitrogenous base of another nucleotide or nucleotide analog sequence (read in the 3'-5' direction), the two nucleotide chains are 100% complementary. That is, sequence 5'-UAGC-3' is complementary to sequence 3'-AUCG-5' or 3'-ATCG-5', which, when read in the 5'-3' direction, are sequences 5'-GCUA-3' and 5'-GCTA-3', respectively. In one embodiment, it is preferred that the antagonist molecule contains a fragment in its sequence that is identical to the complementary sequence of the seed region of the microRNA to be antagonized, at least in terms of nitrogenous base complementarity.

[0056] As used herein, "antimiR" refers to oligonucleotides, preferably oligoribonucleotides, that are complementary to microRNAs (preferably mature microRNAs) that are targets of antimiRs, binding with high affinity and inhibiting the microRNAs. Therefore, antimiRs generally refer to chemically modified oligonucleotides relative to corresponding oligomers consisting only of nucleotide units, and that are complementary to and thus inhibitors of the target microRNA. In the specific context of this invention, the antimiRs described herein are preferably at least partially complementary to human microRNAs hsa-miR-23b-3p or hsa-miR-218-5p.

[0057] As used in this article, “microRNA sponges” are typically designed to inhibit microRNAs with complementary heptamers or octamers (seed regions), so that a single sponge structure can be used to block an entire family of microRNAs with the same motif, although they may also contain the entire target sequence for a specific microRNA or only contain miRNA-specific regions without seed regions to make them specific.

[0058] The terms "pharmaceuticalally acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce any adverse, allergic, or other reactions when administered to animals or humans. As used herein, "pharmaceuticalally acceptable media" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption delayers, fatty acids such as oleic acid, and similar acceptable agents used to formulate pharmaceutical products (e.g., pharmaceutical products suitable for human administration).

[0059] "Prevention includes, but is not limited to, reducing, lessening, or improving the risk of symptoms, ailments, conditions, or diseases, and protecting animals from symptoms, ailments, conditions, or diseases. Prevention can be applied or administered preventively."

[0060] "Treatment" includes, but is not limited to, suppressing, slowing down, stopping, reducing, improving, or reversing existing symptoms, clinical signs, conditions, illnesses, or the progression or severity of disease. Treatment may be applied or administered therapeutically.

[0061] The “TC50” or “half-maximum inhibitory concentration” mentioned in this article refers to the concentration at which an inhibitor, when applied to a test organism or test cell line, produces a toxic effect on 50% of the exposed organism or cell line population within a given time period.

[0062] The “EC50” or “half-maximum effective concentration” mentioned in this article refers to the concentration required for an antagonist or inhibitor to achieve half of the response between baseline and maximum within a given time period. In other words, EC50 is the concentration required to achieve 50% of the treatment-induced effect.

[0063] As used in this article, “Emax” refers to the maximum response achievable by the applied or administered agent (in this article, the antagonist molecule). Emax is measured as the maximum fold change in the target protein (e.g., MBNL1 protein) obtained after transfection with a specific anti-miR-23b-3p or anti-miR-218-5p compared to a simulation (transfected with or without a vector).

[0064] The "T-index" or "therapeutic index / ratio" is a quantitative measure of the relative safety of a drug. In this invention, the T-index is defined as the ratio of the amount of therapeutic agent causing 50% toxicity (TC50) to the amount causing 50% therapeutic effect (EC50) multiplied by the maximum achievable response.

[0065] T-index = (TC50 / EC50) * Emax

[0066] As used herein, the term "3' end" refers to the nucleotide chain terminus where the third carbon on the terminal sugar ring has a hydroxyl group. As used herein, the term "5' end" refers to the nucleotide chain terminus where the fifth carbon on the terminal sugar ring has a phosphate group.

[0067] Detailed description

[0068] As mentioned above, there is a need to develop improved chemically modified oligonucleotides that are less toxic but have enhanced therapeutic effects. Therefore, this invention covers two main objectives. On the one hand, the objective of this invention is to evaluate optimal fatty acids conjugated with oligonucleotides and to design oligonucleotides having a maximum permissible amount of PS bonds that provide beneficial effects to the molecule but are not highly toxic for in vivo administration. On the other hand, this invention also provides specific microRNA inhibitors, particularly oligonucleotide molecules or analogues thereof, designed to correct the functional deficiency of MBNL (myofibrillar-like) proteins, which are partly derived from the overexpression of hsa-miR-23b-3p and hsa-miR-218-5p in patients with myotonic dystrophy (DM), preferably type 1 myotonic dystrophy (DM1).

[0069] First, the inventors tested the effects of previously published miR-23b and miR-218 antagonist oligonucleotides (Cerro-Herreros et al., 2018 Nat. Commun. 9, 2482) conjugated with different hydrophobic moieties (including lipids and fatty acids) in vitro on toxicity, efficacy (MBNL1 protein levels), and therapeutic index (T-index) (Table 1). All miR antagonist sequences used in this study contained 2'OME-modified nucleotides and a mixture of phosphate thioester (PS) and phosphate diester (PO) bonds. Surprisingly, conjugation with oleic acid was found to produce significant improvements in the T-index for both miR-23b and miR-218 antagonist oligonucleotides.

[0070] Next, the inventors tested the ability of oleic acid as a carrier. Figure 11 The experiments shown in Example 9 demonstrate that oleic acid is an excellent carrier or medium for delivering oligonucleotides to tissues such as muscle and the central nervous system (CNS). Indeed, Example 19 shows that oleic acid is an excellent carrier for delivering oligonucleotides to cerebrospinal fluid (CSF). Furthermore, Figure 12 and 13 Furthermore, Example 10 demonstrates that the mediating of oligonucleotide molecules by oleic acid occurs not only in animal models with the DM1 phenotype but also in healthy animals (monkeys in this paper). These results pave the way for the therapeutic use of oleic acid as a carrier when conjugated to oligonucleotide molecules, particularly in cases of diseases affecting muscle and / or CNS or CSF (two major tissues for oleic acid-enhanced oligonucleotide delivery).

[0071] DM1 is a neuromuscular disease affecting muscle tissue and the central nervous system. Therefore, the inventors screened for anti-miR sequences with the best T-index in DM1 cells from a pool of anti-miR sequences ranging from 15 to 22 nucleotides in length (including nucleotides carrying different chemical modifications such as LNA, 2'OME, and 2'MOE). In this study, the best-performing antagonist against human hsa-miR-23b-3p was MD23b-2; for the human hsa-miR-218-5p antagonist, the oligonucleotide with the best T-index was 218-D / LNA2 (see Tables 2 and 3). Figure 1 Each of these two modified versions of the molecule was combined with oleic acid, and in the DM1 mouse model (HSA) LR The molecules were tested in mice and DM1 cells (specifically, the modified version of MD23-b2). These results revealed that oleic acid conjugation to oligonucleotides containing a PS / PO mixture enhanced the therapeutic efficacy of the oligonucleotides (see Tables 4, 5, and 6). Overall, the results of this study lead the applicant to conclude that oleic acid is the optimal fatty acid for conjugation to oligonucleotide molecules to enhance MBNL1 levels in DM1 cells and mouse disease models, and that this conjugation enhances the therapeutic index of oligonucleotides when a PS / PO mixture is present in the molecule.

[0072] In view of these results, in a first aspect, the present invention relates to oligonucleotides and / or oligonucleotide analogs, or mixtures of two or more of said molecules, wherein the oligonucleotides and / or oligonucleotide analogs are conjugated to at least one oleic acid molecule at the 3' and / or 5' ends of said oligonucleotides and / or oligonucleotide analogs. Preferably, the oligonucleotides and / or oligonucleotide analogs are antagonists of microRNAs. Preferably, the oligonucleotides and / or oligonucleotide analogs are antagonists of microRNAs selected from human hsa-miR-23b-3p or human hsa-miR-218-5p. In the context of the present invention, "conjugation" or "conjugation to the 3' and / or 5' end of an oligonucleotide molecule or its analog" means adding at least one oleic acid molecule to the 5' and / or 3' end of the oligonucleotide and / or its analog. Conjugation can be performed directly, for example by covalently linking at least one oleic acid molecule to the 5' and / or 3' end of the oligonucleotide and / or its analog, or by a spacer molecule, as will be explained in detail below.

[0073] MicroRNAs hsa-miR-23b-3p and hsa-miR-218-5p are repressors of MBNL gene expression and other gene transcripts; therefore, their repressive ability is diminished in the presence of their antagonists. In the context of this invention, an inhibitor, silencer, or blocker is a compound capable of reducing the endogenous activity of said hsa-miR-23b-3p and hsa-miR-218-5p, and thus these three terms are categorized under the term "antagonist." While strictly speaking, the term "silence" can be interpreted as an absolute elimination of such activity, the difference between such elimination and non-absolute reduction of inhibitory activity can depend on the concentration of the compound used; any compound that causes a reduction in the inhibitory activity of microRNA is sufficient to be considered an inhibitor, silencer, blocker, or, in short, its antagonist. Furthermore, considering the possibility of inhibiting microRNA function by targeting mature microRNA, precursor microRNA (pre-microRNA or precursor miRNA), or primary microRNA (pri-microRNA or primary miRNA), if a compound targets mature microRNA, or if the compound targets precursor microRNA or primary microRNA transcripts, it can be considered a microRNA inhibitor, silencer, blocker, or antagonist of the present invention, provided that it can reduce the endogenous activity of said microRNA. Therefore, as used herein, these four terms (inhibitor, silencer, blocker, or antagonist) are used as synonyms in the specification.

[0074] Regarding the nucleotide sequences of the antagonists of this invention, it is important to note that they should have sufficient complementarity with the endogenous molecule that must bind. The endogenous molecule is preferably a microRNA molecule, more preferably hsa-miR-23b-3p or hsa-miR-218-5p. Human hsa-miR-218-5p and hsa-miR-23b-3p differ in their nucleotide sequences, and this must be taken into account when designing the antagonist sequence and its microRNA binding site. A “microRNA binding site” is a nucleotide sequence contained in the antagonist that is at least partially or entirely complementary to its target microRNA. Preferably, the microRNA binding site of the antagonist, as defined herein, is at least partially or entirely complementary to hsa-miR-23b-3p or hsa-miR-218-5p. The sequence of the binding site can be perfectly matched, meaning it is perfectly complementary to the microRNA. Alternatively, the sequence can be partially complementary, meaning that one or more mismatches may occur when the microRNA pairs with the bases of the antagonist's binding site. Importantly, if the antagonist is partially complementary to the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p), its binding site preferably has complete or near-complete complementarity (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or preferably 100%) with the seed region of the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p). The “seed region” of the microRNA typically comprises, or consists of, nucleotides 2 through 7 from the 5' end of the microRNA.

[0075] Therefore, when designing the anti-miR approach of this invention, the mature versions of the target microRNAs and their seed regions can be considered. The mature versions of these sequences and their access codes (Mimat) in the miRbase database (www.mirbase.org) are shown below, with the seed region of each indicated in bold:

[0076] Hsa (Homo sapiens)-miR-218-5p (MIMAT0000275):5'-UUGUGCUUGAUCUAACCAUGU-3' (SEQ ID NO: 10); Seed region:UGUGCU (SEQ ID NO: 12);

[0077] hsa-miR-23b-3p(MIMAT0000418):5'-AUCACAUUGCCAGGGAUUACCAC-3'(SEQ ID NO: 11); Seed region:UCACAU(SEQ ID NO: 13).

[0078] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule is an inhibitor, blocker, or antagonist of the type known as antimiR and microRNA sponge. Preferably, according to the first aspect or any embodiment thereof, the oligonucleotide and / or its analog is antimiR, more preferably antimiR of hsa-miR-218-5p or hsa-miR-23b-3p.

[0079] In one embodiment, the oligonucleotide and / or its analogues are at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In another embodiment, the oligonucleotide and / or its analogues are from 10 to 50 nucleotides in length, more preferably from 10 to 30 or 15 to 25 nucleotides in length. Preferably, the oligonucleotide molecule and / or its analogues are anti-miR, the sequence of which comprises, consists of, or is substantially composed of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the complementary sequence of the region present in SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p). More preferably, the sequence of the nitrogen bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identity with the complementary sequence of SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p).

[0080] In one embodiment, the antagonist is an antimiR whose sequence comprises a fragment consisting of a series of at least 5 to 8 nucleotide or nucleotide analog units, wherein the nitrogenous base sequence of said nucleotide or nucleotide analog unit has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence of the seed region of hsa-miR-23b-3p shown in SEQ ID NO: 13. Preferably, the antimiR comprises a fragment consisting of a series of at least 5 to 8 nucleotide or nucleotide analog units that are 100% complementary to the seed region shown in SEQ ID NO: 13. In one embodiment, the antagonist is an antimiR, the sequence of which comprises a first fragment and a second fragment, wherein the first fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units, wherein the nitrogenous base sequence of the first fragment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence of the seed region of hsa-miR-23b-3p as shown in SEQ ID NO: 13, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and / or downstream of the first fragment), and the second fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units, the nitrogenous base sequence of which ... the first fragment has at least 90%, 91%, 92%, The complementary sequence of the region present in NO: 11 consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases of at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity of nucleotides or nucleotide analogs. As used herein, “adjacent” means immediately adjacent to the first fragment, i.e., there are no nucleotides between the first and second fragments. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and / or downstream of the first fragment. More preferably, the second fragment is located 1, 2, 3, 4, or 5 nucleotides upstream and / or downstream of the first fragment.

[0081] In one embodiment, the antagonist is an antimiR whose sequence comprises a fragment consisting of a series of at least 5 to 8 nucleotide or nucleotide analog units, wherein the nitrogenous base sequence of said nucleotide or nucleotide analog unit has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence of the seed region of hsa-miR-218-5p shown in SEQ ID NO: 12. Preferably, the antimiR comprises a fragment consisting of a series of at least 5 to 8 nucleotide or nucleotide analog units that are 100% complementary to the seed region shown in SEQ ID NO: 12. In one embodiment, the antagonist is an antimiR, the sequence of which comprises a first fragment and a second fragment, wherein the first fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units, wherein the nitrogenous base sequence of the first fragment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence of the seed region of hsa-miR-218-5p as shown in SEQ ID NO: 12, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and / or downstream of the first fragment), and the second fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units, the nitrogenous base sequence of which ... the first fragment has at least 90%, 91%, 92%, The complementary sequence of the region present in NO: 10 consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases of at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity of nucleotides or nucleotide analogs. As used herein, “adjacent” means immediately following the first fragment, i.e., there are no nucleotides between the first and second fragments. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and / or downstream of the first fragment. More preferably, the second fragment is located 1, 2, 3, 4, or 5 nucleotides upstream and / or downstream of the first fragment.

[0082] The concept of oligonucleotides and / or oligonucleotide analogs that can be used for the purposes of this invention and are included within the scope of this invention also includes those microRNA inhibitors, blockers, or antagonists that act on primary microRNAs or precursor microRNAs, which typically alter microRNA biosynthesis and negatively impact microRNA activity, primarily due to a reduction in available active microRNA. In animal cells, immature primary miRNAs are processed into precursor miRNAs by microprocessor complexes in the cell nucleus, and then the precursor miRNAs are transported to the cytoplasm for further processing into mature miRNAs. Therefore, it must be understood that targeting primary and / or precursor microRNAs of hsa-miR-23b-3p or hsa-miR-218-5p and altering their biosynthesis, thereby reducing the levels of said microRNAs, should also be able to reduce their activity. Therefore, for the purposes of this invention, hsa-miR-23b-3p antagonists or hsa-miR-218-5p antagonists must be understood to include not only molecules capable of acting on mature forms, but also those molecules capable of acting on primary or precursor microRNAs and reducing the levels of mature forms of hsa-miR-23b-3p or hsa-miR-218-5p. In designing them, the following must be taken into consideration:

[0083] The primary microRNA (pri-microRNA) of -hsa-miR-23b-3p is a transcript of the gene AOPEP (ENSG00000148120;chr9:97488983-97849441).

[0084] The microRNA precursor (pre-microRNA) of -hsa-miR-23b-3p corresponds to the genomic location hg19 chr9:97847490-97847586[+] and the sequence: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC (SEQ ID NO: 19). Because this sequence is longer than hsa-miR-23b-3p, it makes it possible to design antagonists specifically targeting the pre-microRNA.

[0085] -hsa-miR-218-5p has two genomic locations encoding it and two pre-microRNA precursors, Pre-hsa-mir-218-1 (chr4:20529898-20530007): GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA (SEQ ID NO: 20), and Pre-mir-218-2 (chr5:1681951SI-168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA (SEQ ID NO: 21). Both of these precursors can be used in the design of antagonists.

[0086] Pre-hsa-mir-218-1 originates from an intramolecular hairpin structure located within the transcript of the gene SLIT2 (ENSG00000145147: chr4:20254883-20621284), while hsa-miR-218-5p-2 originates from the gene SLIT3 (ENSG00000184347, chr5:168088745-168728133, targeting hsa-miR-218-5p-2). They can be considered as their respective primary miRNAs. No other mature microRNAs are part of the same cluster. Therefore, in the case of hsa-miR-218-5p, the precursor miRNA or primary miRNA can be envisioned as a target for antagonists to reduce mature miRNA levels and increase MBNL protein levels.

[0087] As shown in the examples below, particularly Tables 1 and 4, the inventors of this application have developed and optimized various anti-miRs targeting hsa-miR-23b-3p and hsa-miR-218-5p, whose T-index significantly increases with the addition of oleic acid. In particular, specific sequences containing SEQ ID NO: 1 (antagonist of human hsa-miR-218-5p) and SEQ ID NO: 2 (antagonist of human hsa-miR-23b-3p) are mentioned because they exhibit optimal properties and efficiency in DM1 cells, as shown in the Examples section.

[0088] Furthermore, this article also considers functional equivalents of SEQ ID NO: 1 or SEQ ID NO: 2, wherein specific changes in specific nucleobases do not significantly disrupt the stability of the molecule, thus maintaining its therapeutic effect. The functional equivalent sequences are shown in SEQ ID NO: 52-79 (functional equivalents of SEQ ID NO: 2 against miR-23b-3p) and SEQ ID NO: 80-110 (functional equivalents of SEQ ID NO: 1 against miR-218-5p). The term "functional equivalent" as used herein refers to other oligonucleotides whose nucleobase sequence differs from that of SEQ ID NO: 1 or SEQ ID NO: 2 but perform the same function and provide the same utility or technical effect as SEQ ID NO: 1 or SEQ ID NO: 2.

[0089] Therefore, in one embodiment, the oligonucleotide molecule and / or its analogues are antagonists of human hsa-miR-218-5p, and it comprises, consists of, or is substantially composed of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 1 (TTAGATCAAGCACAA) or SEQ ID NO: 80-110. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 1 or SEQ ID NO: 80-110.

[0090] In a further embodiment, the oligonucleotide molecule and / or its analogues are antagonists of human hsa-miR-23b-3p, and it comprises, consists of, or is substantially composed of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 2 (ATCCCTGGCAATGTGA) or SEQ ID NO: 52-79. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 2 or SEQ ID NO: 52-79.

[0091] It is noteworthy that in the oligonucleotide molecule and / or its analogues according to the invention, each uracil and thymine base throughout the entire length of the oligonucleotide molecule and / or its analogue, and preferably each uracil and thymine base in the seed region, may be optionally replaced by a thymine or uracil base, respectively. This applies to all “T” nucleobases contained in all oligonucleotides disclosed herein, except for SEQ ID NO: 52-110, where at certain positions, “U” is preferred instead of “T”. Therefore, at these positions, U is included, rather than T.

[0092] Similarly, each guanosine base throughout the full length of the oligonucleotide molecule and / or analogue, and preferably each guanosine base within the seed region, may be optionally replaced by a hypoxanthine base. This applies to all oligonucleotides disclosed herein.

[0093] In one embodiment, oligonucleotides and / or oligonucleotide analogs that act as antagonists of human hsa-miR-23b-3p or human hsa-miR-218-5p are capable of increasing the endogenous levels of MBNL protein, preferably MBNL1 and / or MBNL2 protein. Preferably, the oligonucleotides and / or oligonucleotide analogs have at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or 100% identity with the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110, and are capable of increasing the endogenous levels of MBNL protein, preferably MBNL1 and / or MBNL2 protein. Preferably, the increase in endogenous MBNL protein levels compared to untreated cells or untreated tissues is statistically significant, wherein a Student's t-test is preferably used for statistical comparison, see, for example... Figure 4 Most preferably, the increase in the endogenous level of MBNL protein, and more preferably a statistically significant increase, is a change of at least 1.2-fold, 1.3-fold, 1.4-fold, or 1.5-fold in the treated muscle tissue cells (more preferably the quadriceps and gastrocnemius muscles) relative to untreated muscle tissue cells. Preferably, the increase in the endogenous level of MBNL protein in the treated cells or tissues is an increase of at least 15%, 20%, 30%, 40%, 50%, or more compared to untreated cells or tissues. "Untreated cells or tissues" as used herein refers to one or more such cells or tissues, including all animals such as mice, that are healthy or exhibit the DM1 phenotype and have not yet been treated with oligonucleotides and / or oligonucleotide analogs of the first aspect or any embodiment thereof. Preferably, the untreated cells are muscle cells, and the untreated tissues are muscle tissue.

[0094] The antimiRs of the present invention, including those defined as in SEQ ID NO: 1 or SEQ ID NO: 2, can be further optimized to improve their in vivo stability and efficacy. Several modifications to their chemical structure have been described for this purpose (for a review, see McKenzie et al., Recent progress in non-native nucleic acid modifications. Chem. Soc. Rev., 2021, 50, 5126-5164). These modifications can be made in the pentose (in a preferred embodiment where the oligonucleotide is an oligoribonucleotide, the modification will be made in the ribose), in the internucleotide linkage, or in the nucleobases, or combinations thereof. When the oligonucleotides or oligoribonucleotides of the present invention undergo chemical modification, they are referred to as oligonucleotide analogs or oligoribonucleotide analogs, respectively, in the context of the present invention. In one embodiment, the antimiR is an oligonucleotide analog containing at least six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or sixteen chemical modifications throughout the molecule. In one embodiment, the antimiR is an oligoribonucleotide analog in which all nucleotides are chemically modified.

[0095] Modification of nucleotide interbonds Among the possible modifications that produce the oligonucleotide analogs of the present invention are modifications that generate thiophosphate bonds. These modifications affect the phosphate groups that are part of the "backbone" of the polynucleotide chain, resulting in the introduction of sulfur atoms to replace oxygen atoms in phosphate groups that do not act as bridges between nucleotides. These modifications enable the bonds between nucleotides to resist degradation by nucleases in addition to having other desired pharmacological properties. Therefore, they are typically inserted between the last three to five nucleotides at the 5' or 3' end of the oligonucleotide to inhibit exonuclease degradation, thereby increasing its stability.

[0096] In a preferred embodiment, the oligonucleotide or oligonucleotide analog molecule according to the first aspect or any embodiment thereof contains at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or more than fifteen nucleotides chemically linked by phosphate thioester bonds. Preferably, the oligonucleotide and / or oligonucleotide analog according to the first aspect or any embodiment thereof is 10 to 30 nucleotides in length and contains at least two nucleotides chemically linked by phosphate thioester bonds, wherein the oligonucleotide and / or oligonucleotide analog is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. In an even more preferred embodiment, the oligonucleotide or oligonucleotide analog molecule comprises a mixture of PS bonds and phosphodiester (PO) bonds, wherein at least two nucleotides in the molecule are chemically linked by phosphate thioester bonds, and the at least two nucleotides in the molecule are linked by phosphodiester bonds. In a further preferred embodiment, the number of nucleotides chemically linked by phosphate thioester (PS) bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds. In one embodiment, the oligonucleotide molecule and / or its analogues are between 13 and 17 nucleotides in length and contain at least 7, 8, 9, or 10 nucleotides chemically linked by phosphate thioester (PS) bonds. In one embodiment, the PS:PO ratio in the oligonucleotide molecule and / or its analogues is 1.2:1, 1.5:1, 1.7:1, 2:1, 2.2:1, 2.5:1, 2.7:1, or 3:1. Preferably, the PS:PO ratio in the oligonucleotide molecule and / or its analogues is between 1.2:1 and 2.7:1, more preferably 1.5:1 or 2.5:1. The term "PS:PO ratio" as used herein refers to the number of PS bonds corresponding to each PO bond. For example, when an oligonucleotide molecule consists of 15 nucleotides and has 10 PS bonds and 4 PO bonds (see, for example, SEQ ID NO: 7), the molecule is said to have a PS:PO ratio of 2.5:1. In one embodiment, more than 50%, 55%, preferably 60%, 70%, or 75% of the bonds between nucleotides are PS bonds.

[0097] In one embodiment, all nucleotides contained in the oligonucleotide or oligonucleotide analog molecule are chemically linked by phosphate thioester bonds. Preferably, as described above, the oligonucleotide or oligonucleotide analog molecule is a microRNA antagonist (i.e., an antimiR).

[0098] Modifications in pentoses and preferred ribose:The most widely used sugar modification is the modification of the OH group at the 2' position. Among these, the most important in the context of this invention are 2' fluorination (2'F: introducing a fluorine atom at the 2' position of the ribose), 2'-O-methoxyethyl (MOE) modification, or 2'-O-methyl (OMe) modification. Therefore, in one embodiment, the oligonucleotide or oligonucleotide analog molecule according to the invention, preferably antimiR, is chemically modified to comprise at least one pentose sugar having one of the following modifications: 2' fluorination (2'F: introducing a fluorine atom at the 2' position of the ribose), 2'-O-methoxyethyl (MOE), and / or 2'-O-methyl (OMe). In one embodiment, all nucleotides in the oligonucleotide molecule are 2'OME-modified nucleotides.

[0099] Another modification that can be performed on the oligonucleotide or oligonucleotide analog molecule (preferably anti-miR) of the present invention is the formation of a bicyclic 2'-4' modification. Various ribose derivatives exist that lock the carbohydrate ring to a 3'-internal conformation by forming a bicyclic structure using a bridge between the 2' oxygen and 4' positions. In one embodiment, a bridge is formed between the 2' oxygen and 4' carbon to lock the ribose to a 3'-internal conformation, resulting in a modification called locked nucleic acid (or LNA). The introduction of LNA modification significantly improves the stability of the anti-miR target miRNA hybrid, making it significantly more thermodynamically stable and more resistant to degradation, especially when the modification is located at the molecule's end. In one embodiment, the first nucleotide starting from the 3' region contains an LNA modification. In another embodiment, each of the first two oligonucleotides starting from the 5' region contains an LNA modification. Further modifications to bicyclic nucleotides include bridging nucleic acids, ethyl-bridging (ENA) nucleic acids, restricted ethyl (cEt) nucleic acids, bicyclic (bicyclic DNA) and tricyclic (tricyclic DNA) structures, as well as conformation-restricting nucleotides (CRNs), which have different affinities for target sequences.

[0100] More common modifications include so-called PMO (where the ribose has been replaced by a morpholino group). A "morpholino" refers to a base linked to the methylene morpholino ring backbone via a phosphodiamid group. Another backbone modification is so-called PNA ("peptide nucleic acid": a peptide nucleic acid where the ribose-phosphate group is partially replaced by an amino acid, thus the backbone of the nucleotide analog is a structure of N-(2-aminoethyl)-glycine repeating units linked by peptide bonds).

[0101] In one embodiment, the oligonucleotide or oligonucleotide analog molecule according to the invention, preferably an antimiR, is chemically modified to include at least one pentose in the nucleotide that forms the antimiR, said antimiR comprising morpholinonucleotide (PMO) or peptide nucleotide (PNA).

[0102] Modification of nucleobases:Due to their high frequency of use, the chemical modifications used to produce the oligonucleotides (preferably oligonucleotide analogs, preferably anti-miR) of the present invention also include 5-methylation of the nitrogenous base cytosine (C), a modification that reduces the detection of oligonucleotide analogs by the immune system. Therefore, in one embodiment, the oligonucleotide and / or oligonucleotide analog molecule (preferably anti-miR) according to the first aspect or any embodiment thereof contains at least one, two, three, four, five, or more than five nucleotides comprising methylated cytosine. In a preferred embodiment, all cytosines in the oligonucleotide or oligonucleotide analog molecule (preferably anti-miR) according to the first aspect or any embodiment thereof are methylated.

[0103] Another possible modification is 2,6-diaminopurine, which is capable of forming a base pair with thymidine or uridine having an additional H bond (3 H bonds instead of the 2 H bonds in the natural A:T base pair). Therefore, in one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof contains at least one, two, three, four, five, or more than five nucleotides comprising 2,6-diaminopurine.

[0104] Based on the definitions of "oligonucleotide molecule" and "oligonucleotide analog," it can be inferred that the definition of oligonucleotide analog also includes hybrid molecules in which some units are modified while others are not, hybrid molecules between nucleic acid and peptide analogs, or even hybrid molecules in which some nucleotide units are nucleotides (or their analogs) and others are deoxynucleotides (nucleotides in which the sugar is a deoxyribose), and analogs of the latter, namely RNA-DNA hybrid molecules and their analogs. Other chemical modifications are also possible and known, and they are also included among the possible modifications that produce oligonucleotide analogs.

[0105] The terminology refers particularly to chemical modifications that may be contained in oligonucleotides and / or oligonucleotide analogs, and is especially relevant to cases of one or more common modifications known to those skilled in the art of molecular biology in basic research and, particularly, in the search for therapeutic applications of these molecules. Information about such modifications can be found in general knowledge.

[0106] Modification of oligonucleotides and / or oligonucleotide analogs with other non-nucleotide molecules

[0107] As described above, a first aspect of the present invention provides oligonucleotides and / or oligonucleotide analog molecules, preferably anti-miR, more preferably antagonists of human hsa-miR-23b-3p or human hsa-miR-218-5p, or mixtures of two or more of the aforementioned molecules, wherein the oligonucleotides and / or oligonucleotide analog molecules are conjugated to at least one oleic acid molecule at their 3' and / or 5' ends. Therefore, all oligonucleotides included in the present invention are conjugated to at least one oleic acid molecule at their 3' and / or 5' ends.

[0108] In some embodiments, other non-nucleotide molecules (e.g., organic compounds) may also be conjugated to the 3' and / or 5' ends of oligonucleotides and / or oligonucleotide analogs. This conjugation can be direct or via spacer molecules. The term "spacer molecule" as used herein refers to any molecule that connects an oligonucleotide or oligonucleotide analog to a non-nucleotide molecule (preferably oleic acid). The spacer molecule may be coupled at the 3' or 5' end of the oligonucleotide or oligonucleotide analog. Preferably, the spacer molecule is covalently bound to the oligonucleotide and oleic acid. Preferably, one end of one or more spacer molecules is bonded via a bond between the terminal carbon of the spacer molecule and the oxygen group in the 3' phosphate ester of the oligonucleotide, and the other end is bonded via an amide bond formed between the terminal nitrogen group on the linker and the carboxyl group of oleic acid, for example... Figure 8 As shown.

[0109] In a preferred embodiment, the spacer molecule is selected from the group consisting of 3-aminopropyl (NHC3), 5-aminopentyl (NHC5), 6-aminohexyl (NHC6), threonine, or derivatives thereof. In other embodiments, one or more spacer molecules may include the thiol modifier C6SS (C6SSC6). In a further embodiment, the spacer molecule may include the thiol modifier C6SS (C6SSC6) that binds directly to the oligonucleotide, followed by 3-aminopropyl (NHC3), 6-aminohexyl (NHC6), threonine, or derivatives thereof (see [link to previous embodiment]). Figure 8 ).

[0110] In some embodiments, the oligonucleotide may be provided as a prodrug and may comprise a spacer molecule containing or composed of a self-immolative group. As used herein, a "self-immolative" group is a molecule that spontaneously and irreversibly detaches from the molecule it is conjugated to (in this context, the oligonucleotide). In one embodiment, the self-immolative group is a disulfide bond that will be reduced intracellularly by a naturally occurring thiol (e.g., glutathione), resulting in the release of the oligonucleotide.

[0111] Spacer molecules can be aliphatic linear or branched hydrocarbon chains, cyclohexylphenyl and other aromatic spacer molecules, as well as polar spacer molecules based on one or more ethylene glycol, glycerol, amino acid, peptide or carbohydrate units. In some cases, oleylene derivatives can be covalently linked to amino groups via amide bonds, directly linked to nucleobases via amine bonds, or linked to phosphate bonds to function as oleylene phosphate esters.

[0112] Preferably, oleic acid is conjugated to the 3' end of the oligonucleotide. More preferably, oleic acid is conjugated via a spacer molecule (preferably NHC6, threonine, or NHC3, such as...). Figure 8 (as shown) conjugation is performed. Note that the addition of a spacer molecule as a linker between the oligonucleotide and oleic acid is not mandatory, see, for example, SEQ ID NO: 51, in which oleic acid is conjugated to the 5' end of the oligonucleotide and / or oligonucleotide analog molecule by direct conjugation.

[0113] Preferably, all oligonucleotide molecules disclosed in this invention are conjugated to at least one oleic acid molecule at their 3' and / or 5' ends, wherein the oligonucleotide molecule further comprises at least two nucleotides chemically linked by phosphate thioester bonds. Preferably, the oligonucleotide molecule further comprises at least two nucleotides chemically linked by phosphate thioester bonds, and at least two nucleotides in the molecule are linked by phosphodiester bonds. More preferably, the number of nucleotides chemically linked by phosphate thioester (PS) bonds is greater than the number of nucleotides chemically linked by phosphodiester (PO) bonds.

[0114] The oligonucleotides of the present invention can be prepared using various methods known in the art. Specifically, the oligonucleotides can be synthesized by solid-phase or liquid-phase methods. Solid-phase oligonucleotide synthesis schemes can be used to prepare spacer-functionalized oligonucleotides and oleyl-oligonucleotide conjugates. In this method, a solid support, such as a pore-controlled glass (CPG), is functionalized with the first nucleotide at the 3' end of the oligonucleotide sequence, and the oligonucleotide is typically synthesized in a 3' to 5' orientation. The introduction of the spacer molecule at the 5' position is done by using a phosphorusamide derivative of the spacer molecule, which introduces the spacer molecule into the 5' position of the oligonucleotide via a phosphate bond. The introduction of the spacer molecule at the 3' position requires the preparation of a solid support functionalized with a linker molecule, which is a molecule used to bind the nucleotide to the support. Examples of linkers are unstable compounds, such as phthalimide linkers or succinyl linkers. It is worth noting that while the spacer molecule remains conjugated with the oligonucleotide molecule, the linker is a temporary conjugation intended to immobilize the oligonucleotide during solid-phase synthesis. In liquid-phase preparation methods, protecting groups (such as benzoyl or acetyl groups) can be used instead of the connector types defined in solid-phase methods.

[0115] Of all the oligonucleotides disclosed in the context of this invention, the following embodiments (including modifications and combinations of modifications) are considered preferred:

[0116] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof is 10 to 30 nucleotides in length and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphate thioester bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphate thioester bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0117] a. The sequence of nitrogenous bases in the monomeric unit of the nucleotide or nucleotide analog is at least 85%, 90%, 93%, 95%, 98%, or 100% complementary to the endogenous molecule it must bind to (preferably a microRNA molecule, more preferably hsa-miR-23b-3p of SEQ ID NO: 11 or hsa-miR-218-5p of SEQ ID NO: 10), and

[0118] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably by spacer molecule conjugation.

[0119] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof is 10 to 30 nucleotides in length and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphate thioester bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphate thioester bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0120] a. The oligonucleotide sequence comprises a first fragment and a second fragment, wherein the first fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units, the first fragment having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence of the hsa-miR-23b-3p seed region shown in SEQ ID NO: 13, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and / or downstream of the first fragment), and the second fragment consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units having at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identity with the complementary sequence of the region present in SEQ ID NO: 11.

[0121] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably by spacer molecule conjugation.

[0122] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof is 10 to 30 nucleotides in length and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphate thioester bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphate thioester bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0123] a. The oligonucleotide sequence comprises a first fragment and a second fragment, wherein the first fragment consists of a sequence of at least 5 to 8 nucleotide or nucleotide analog units having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the complementary sequence to the hsa-miR-218-5p seed region shown in SEQ ID NO: 12, and wherein the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment), and the second fragment consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases having at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identity with the complementary sequence to the region present in SEQ ID NO: 10, and

[0124] b. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably by spacer molecule conjugation.

[0125] In one embodiment, the length of the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof is 10 to 30 nucleotides, wherein:

[0126] a. At least two nucleotides in the molecule are chemically linked by phosphate thioester bonds, and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphate thioester bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0127] b. Its sequence comprises, consists of, or is substantially composed of the following: a sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical nucleotide or nucleotide analog units to the region present in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 52-110, consisting of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases, and

[0128] c. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably by spacer molecule conjugation.

[0129] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to the first aspect or any embodiment thereof is 10 to 30 nucleotides in length and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides in the molecule are chemically linked by phosphate thioester bonds and at least two nucleotides in the molecule are linked by phosphodiester bonds, preferably wherein the number of nucleotides chemically linked by phosphate thioester bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein:

[0130] a. At least one monomeric unit is a nucleotide analogue, which has one or more chemical modifications in the pentose moiety, preferably in the ribose, in the internucleotide bond, in the nitrogenous base, or in all of these moieties.

[0131] b. The sequence of the nitrogenous bases of the monomeric unit of the nucleotide or nucleotide analog has at least 85%, 90%, 93%, 95%, 98%, or 100% identity with the sequence of the nitrogenous bases of the monomeric unit of the oligonucleotide SEQ ID NO: 1 or oligonucleotide SEQ ID NO: 2 or its functional equivalent SEQ ID NO: 52-110, and

[0132] c. It is conjugated to at least one oleic acid molecule at the 5' end and / or the 3' end, preferably by spacer molecule conjugation.

[0133] In a preferred embodiment, the oligonucleotide or oligonucleotide analog molecule according to the first aspect or any embodiment thereof contains at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or more fifteen nucleotides comprising at least one modification selected from the group consisting of: locked nucleic acid, 2'-methoxy, 2'-O-methoxyethyl-, 2'-fluorine, BNA, PMO, PNA, CRN, 2,6-diaminopurine, methylated cytosine and / or any combination thereof.

[0134] In a preferred embodiment, the oligonucleotide and / or oligonucleotide analog molecule is 10 to 30 nucleotides in length and is an antagonist of human hsa-miR-23b-3p or hsa-miR-218-5p, comprising at least two nucleotides chemically linked by thiophosphate bonds and at least two nucleotides chemically linked by phosphodiester bonds, wherein preferably the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds, and wherein the oligonucleotide is conjugated to at least one oleic acid molecule, wherein the oleic acid molecule is conjugated to the 3' end and / or 5' end of the oligonucleotide and / or its analog. Preferably, the oligonucleotide and / or oligonucleotide analogue is conjugated to at least one oleic acid molecule at its 3' and / or 5' ends and contains more PS bonds than PO bonds. The oligonucleotide and / or oligonucleotide analogue comprises, consists of, or is substantially composed of: a fragment consisting of at least 15 consecutive nitrogen bases of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in any of the functional equivalents of SEQ ID NO: 1 (anti-miR-218-5p), SEQ ID NO: 2 (anti-miR-23b-3p), or SEQ ID NO: 52-110.

[0135] In a preferred embodiment, at least three, four, five, six, seven, eight, or more than eight of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule are chemically modified, wherein the chemical modification is selected from the group consisting of: i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) additional bridges (LNAs) connecting the 2' oxygen and 4' carbon, and / or any combination thereof. In a further embodiment, the nucleotides contained in the oligonucleotide analog molecule are chemically modified to include additional bridges (LNAs) connecting the 2' oxygen and 4' carbon of at least the nucleotides located at the 3' and 5' ends of the oligonucleotide. More preferably, the LNA modification is introduced at least into the fourth, third, preferably second, or last nucleotide located at the 3' and 5' ends of the oligonucleotide. Furthermore, preferably, at least one of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule is 2,6-diaminopurine and / or at least methylated cytosine.

[0136] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or substantially consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3´ Ol) and wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 3 or SEQ ID NO: 22, wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 3 or SEQ ID NO: 22.

[0137] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or substantially consists of a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS / PO 3´ OI), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS / PO 3´ OI), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 4 or SEQ ID NO: 23.

[0138] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p, and comprises, consists of, or substantially consists of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2 PS / PO 5' OI), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 5' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 5, SEQ ID NO: 24, or SEQ ID NO: 51 (MD23b-2 PS / PO 5' OI), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 5' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 5, SEQ ID NO: 24, or SEQ ID NO: 51.

[0139] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or substantially consists of a sequence of at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity nucleotide or nucleotide analogue units having at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases, wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3' OI containing C6SSC6). The oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 5' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3' OI containing C6SSC6).

[0140] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of, or substantially consists of the following: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 7 or SEQ ID NO: 25.

[0141] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p, and comprises, consists of, or substantially consists of the following: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 8 or SEQ ID NO: 26.

[0142] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of, or substantially consists of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE oleic acid 3'), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 9 or SEQ ID NO: 27.

[0143] In a further embodiment, the oligonucleotide molecule and / or its analogue is an antagonist of human hsa-miR-218-5p and comprises, consists of, or substantially consists of: a sequence of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogen bases consisting of a sequence of nucleotide or nucleotide analogue units having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the region present in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), wherein the oligonucleotide molecule and / or its analogue comprises at least oleic acid conjugated to its 3' end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit contained in the oligonucleotide molecule and / or its analogue has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE oleic acid 3'2), wherein the oligonucleotide molecule and / or its analogue contains at least oleic acid conjugated to its 3' end. In one embodiment, the oligonucleotide is composed of SEQ ID NO: 14 or SEQ ID NO: 28.

[0144] Preferably, the oligonucleotide molecule and / or its analogues of the first aspect comprise or consist of: SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p), or a sequence having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28.

[0145] Preferably, the oligonucleotide and / or oligonucleotide analogue has at least 80%, 85%, 90%, 91%, 92%, 50%, 51, 7, 8, 9, 14, 25, 26, 27 or 28 identity with SEQ ID NO: 3, 4, 5, 22, 23 or 25, preferably with SEQ ID NO: 3, 4, 7, 22, 23 or 25, or 100% identity, and is capable of increasing, preferably statistically increasing, the endogenous level of MBNL protein (preferably MBNL1 and / or MBNL2 protein) compared to untreated cells or tissues. Most preferably, the oligonucleotide molecule and / or its analogue of the first aspect consists of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50, 51, 7, 8, 9, 14, 25, 26, 27 or 28. It should be noted that, in the context of this invention, when an oligonucleotide molecule and / or its analogue is described as specifically composed of a particular SEQ ID NO, it should be understood that the oligonucleotide molecule and / or its analogue also comprises the chemical modifications, spacer molecules, and oleic acid conjugates shown in the SEQ ID NO. For example, when an oligonucleotide molecule and / or its analogue is composed of SEQ ID NO: 3, 4, or 7, it should be interpreted that the oligonucleotide molecule and / or its analogue comprises the nucleotide sequence defined in SEQ ID NO: 3, 4, or 7, as well as the chemical modifications, spacer molecules, and oleic acid conjugates defined in SEQ ID NO: 3, 4, or 7. A detailed description of the chemical modifications included in each SEQ ID NO is contained in the "Sequence Listing" section.

[0146] Furthermore, the present invention also includes compounds in the form of precursor drugs, such as oligonucleotide molecules and / or their analogues, i.e., those that are not fully active in form or nature, but are converted or metabolized in vivo after administration to produce oligonucleotide molecules and / or their analogues with full pharmacological activity as described herein.

[0147] The cellular expression of the microRNA to be suppressed should also be considered. According to miRGator v3.0 (miRGator v3.0: a microRNA portal for deep sequencing, expression profiling and mRNA targeting. Sooyoung Cho et al., Nucleic Acids Research, Vol. 41, No. D1, January 1, 2013, pp. D252-D257, https: / / doi.org / 10.1093 / nar / gks1168), hsa-miR-218-5p is expressed in adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testes, uterus and joints. On the other hand, hsa-miR-23b-3p is expressed in the following tissues: central nervous system, gastrointestinal tract, adipose tissue, mammary gland, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphocytes, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testes, thyroid and uterus. Therefore, one possible implementation of the present invention is that the oligonucleotide and / or oligonucleotide analog molecules are preferably anti-miR, more preferably antagonists of hsa-miR-218-5p or hsa-miR-23b-3p, or mixtures of two or more of the molecules, and the target miRNA is expressed in at least one or more organs selected from the group consisting of: brain, cerebellum, hippocampus or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, mammary gland, bladder, prostate, skin, keratinocytes and lymphocytes; or the target miRNA is expressed in primary cultures of any of these organs or in one or more cells (including induced pluripotent stem cells, abbreviated as IPSC, or stem cells derived from one of these organs) of established cell lines derived from any of these organs. The choice of the specific microRNA to be antagonized, particularly the choice between human hsa-miR-218-5p and human hsa-miR-23b-3pp, will also determine the range of tissues in which the antagonistic effect can be exerted.

[0148] Examples 2-6 show that 3 mg / kg is an effective dose for increasing MBNL1 protein levels in HSALR mice. Next, the inventors of this invention aimed to find the optimal dose for human administration. First, different doses were tested in several animal models: Example 11 shows that a dose of 6 mg / kg (administered every two weeks for 6 weeks) was also an effective dose in HSALR mice, achieving overexpression of MBNL1 protein in various tissues, including muscle, heart, and brain. Furthermore, Example 12 shows that 16 mg / kg was the maximum no adverse effect elution (NOAEL) in Wistar rats, and Example 15 shows that 22.5 mg / kg was the maximum no adverse effect elution (NOAEL) in miniature pigs. Example 16 was performed to confirm that all tested doses had a therapeutic effect in increasing MBNL1 protein levels. Quantitative results showed that MBNL1 protein levels increased in all treatment groups two weeks after the last intravenous administration of MD23B-2V2 3'OL. The increased MBNL1 levels persisted at the end of the recovery period (10 weeks after the last administration). Example 14 confirmed that the applied oligonucleotides increased MBNL1 levels in the quadriceps femoris muscle of the hind limb. Importantly, the increase in MBNL1 levels persisted at the end of the recovery period (10 weeks after the last application).

[0149] Secondly, studies were conducted to provide information on dosage safety: Example 13 provides information on the safety of the tested dosages because it shows that administration of the oligonucleotides of the present invention at 2.5 mg / kg, 7.5 mg / kg, and 22.5 mg / kg (in miniature pigs) or at 8 mg / kg, 16 mg / kg, or 40 mg / kg (in Wistar rats) does not affect the major biological parameters of the central nervous system, cardiovascular system, and respiratory system in miniature pigs and Wistar rats.

[0150] Third, the dose is converted to a human dose. Preferably, the dose conversion is performed according to the "Industry Guidance—Estimation of the Maximum Safe Starting Dose of a Drug in a First Clinical Trial in Healthy Adult Volunteers" (Center for Drug Evaluation and Research, FDA. July 2005, Pharmacology and Toxicology), which is also available at https: / / www.fda.gov / media / 72309 / download. In allometric scaling, dose data from non-clinical studies from one or more animal species are used to predict human drug exposure at a range of drug doses. This is a rapid method that can inform dosage decisions or determine whether it is worthwhile to advance a particular therapeutic compound. Preferably, in the context of this invention, the dose in the animal model is converted to a human dose by applying the following allometric factor (FA):

[0151]

[0152] For example, a dose of 6 mg / kg of a certain oligonucleotide tested in HSALR mice corresponds to 0.49 mg / kg in humans (6 mg / kg divided by 12.3), meaning that a person with an average weight of 70 kg would need to receive 34.14 mg (0.49 mg / kg multiplied by 70) of the oligonucleotide. It is noteworthy that a safety factor may be preferably applied to provide a safety margin for human subjects receiving an initial clinical dose. This safety factor takes into account variability when extrapolating from animal toxicity studies to human studies, due to reasons including: (1) uncertainty regarding increased sensitivity to pharmacological activity in humans compared to animals; (2) difficulty in detecting certain toxicities (e.g., headache, myalgia, mental disorders) in animals; (3) differences in receptor density or affinity; (4) unexpected toxicities; and (5) interspecies differences in the therapeutic ADME. These differences can be accommodated by reducing the initial human dose from the human equivalent dose (HED) of the NOAEL in the selected species. The default safety factor that should generally be used is 10. For the calculation of the starting dose in the first human trial, a safety factor of less than 10 can be applied, as has been done for other antisense oligonucleotides, which have not produced any adverse clinical consequences.

[0153] In view of the above results, in one embodiment, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to a human subject. Of course, the oligonucleotide and / or oligonucleotide analogue is administered together with oleic acid, since oleic acid is conjugated to the oligonucleotide, and the oleic acid-conjugated oligonucleotide is formulated for administration to a human subject. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose between 10 mg and 1125 mg per person per dose, preferably between 10 mg and 300 mg, more preferably between 15 mg and 290 mg, even more preferably between 18 mg and 288 mg, most preferably between 33 mg and 144 mg, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intravenously. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated for human administration at a dose of about 10 to about 1125 mg per person per dose (preferably via intravenous administration), preferably about 10 to about 300 mg, more preferably about 15 to about 290 mg, even more preferably about 18 to about 288 mg, and most preferably about 34 to about 144 mg. Preferably, the human dose is selected from a list of 18 mg, 36 mg, 72 mg, 144 mg, 288 mg, and 576 mg per person per dose, wherein administration is preferably via intravenous administration. Most preferably, the human dose is selected from a list of 36 mg, 72 mg, and 144 mg per person per dose, wherein administration is preferably via intravenous administration. In one embodiment, the human dose is 188 mg or less per person per dose, wherein administration is preferably via intravenous administration. In one embodiment, the human dose is 18 mg or more per person per dose, wherein administration is preferably via intravenous administration. In one embodiment, the human dose is 36 mg or about 36 mg per person per dose, wherein administration is preferably via intravenous route. In one embodiment, the human dose is 10 mg or about 10 mg per person per dose, wherein administration is preferably via intravenous route. In one embodiment, the human dose is 64 mg or about 64 mg per person per dose, wherein administration is preferably via intravenous route.

[0154] In one embodiment, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose between 0.142 mg and 16.07 mg (mg / kg) per kg of body weight, preferably between 0.142 mg / kg and 4.285 mg / kg, more preferably between 0.214 mg / kg and 4.142 mg / kg, even more preferably between 0.257 mg / kg and 4.114 mg / kg, and most preferably between 0.4878 mg / kg and 2.057 mg / kg, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intravenously. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated to be administered to humans at a dose of about 0.142 mg to about 16.07 mg (mg / kg) per kg of body weight, preferably about 0.142 mg / kg to about 4.285 mg / kg, more preferably about 0.214 mg / kg to about 4.142 mg / kg, even more preferably about 0.257 mg / kg to about 4.114 mg / kg, and most preferably about 0.4878 mg / kg to about 2.057 mg / kg, preferably via intravenous administration. Preferably, the human dose is selected from a list consisting of 0.257 mg / kg, 0.514 mg / kg, 1.028 mg / kg, 2.057 mg / kg, 4.114 mg / kg, and 8.228 mg / kg, wherein administration is preferably via intravenous administration. Most preferably, the human dose is selected from a list consisting of 0.514 mg / kg, 1.028 mg / kg and 2.057 mg / kg, wherein administration is preferably by intravenous route.

[0155] In one embodiment, the human dose is 2.68 mg / kg or less, preferably administered intravenously. In one embodiment, the human dose is 0.257 mg / kg or more, preferably administered intravenously. In one embodiment, the human dose is 0.51 mg / kg or about 0.51 mg / kg, preferably administered intravenously. In one embodiment, the human dose is 0.14 mg / kg or about 0.14 mg / kg per dose, preferably administered intravenously. In one embodiment, the human dose is 0.91 mg / kg or about 0.91 mg / kg per dose, preferably administered intravenously.

[0156] In one embodiment, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose between 0.142 mg and 16.07 mg per kg body weight per day (mg / kg / day), preferably between 0.142 mg / kg / day and 4.285 mg / kg / day, more preferably between 0.214 mg / kg / day and 4.142 mg / kg / day, even more preferably between 0.257 mg / kg / day and 4.114 mg / kg / day, and most preferably between 0.4878 mg / kg / day and 2.057 mg / kg / day, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intravenously. Preferably, the human dose is selected from the list of 0.257 mg / kg / day, 0.514 mg / kg / day, 1.028 mg / kg / day, 2.057 mg / kg / day, 4.114 mg / kg / day, and 8.228 mg / kg / day, wherein administration is preferably via intravenous route. Most preferably, the human dose is selected from the list of 0.514 mg / kg / day, 1.028 mg / kg / day, and 2.057 mg / kg / day, wherein administration is preferably via intravenous route.

[0157] In one embodiment, the human dose is 2.68 mg / kg / day or less, preferably administered intravenously. In one embodiment, the human dose is 0.257 mg / kg / day or more, preferably administered intravenously. In one embodiment, the human dose is 0.51 mg / kg / day or about 0.51 mg / kg / day, preferably administered intravenously. In one embodiment, the human dose is 0.14 mg / kg / day or about 0.14 mg / kg / day, preferably administered intravenously. In one embodiment, the human dose is 0.91 mg / kg / day or about 0.91 mg / kg / day, preferably administered intravenously.

[0158] Regarding intrathecal administration, Examples 19-20 show that this route of administration provides a more sustained retention of the oligonucleotide (i.e., the active ingredient) in the CNS, particularly the CSF, and the therapeutic dose via the intrathecal route will be between 22.75 and 196.46 mg (considering a 10-fold safety factor), or between 22.5 and 392.92 mg (if we consider a 5-fold safety factor). Table 37 shows the preferred human HED based on efficacy (and therefore after a 1-fold safety factor) and the highest dose based on toxicity (after application of a 10-fold safety factor).

[0159] In view of the above results, oligonucleotides and / or oligonucleotide analogs are formulated for administration to humans at doses of 10 to 400 mg per person per dose, or 10 to 230 mg per person per dose, preferably between 15 mg and 210 mg, more preferably between 18 mg and 200 mg, even more preferably between 22 mg and 200 mg, most preferably between 22.75 mg and 196.46 mg or between 45.50 mg and 181.51 mg per person per dose, and wherein, preferably, the oligonucleotides and / or oligonucleotide analogs are administered intrathecally. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose of about 10 to about 230 mg per person (preferably via intrathecal administration), preferably about 15 to about 210 mg, more preferably about 18 to about 200 mg, even more preferably about 22 to about 200 mg, and most preferably about 22.75 to about 196.46 mg or 45.50 mg to 181.51 mg. In one embodiment, the human dose is 22.5 to 392.92 mg per person per dose, wherein administration is preferably via intrathecal administration.

[0160] Preferably, the human dosage is selected from a list of 10 mg, 15 mg, 18 mg, 20 mg, 22 mg, 22.75 mg, 45.50 mg, 181.51 mg, 196.46 mg, and 200 mg per person per dose, wherein administration is preferably via intrathecal route. Most preferably, the human dosage is selected from a list of 22.75 mg, 45.50 mg, 181.51 mg, and 196.46 mg per person per dose, wherein administration is preferably via intrathecal route.

[0161] In one embodiment, the human dose is 200 mg or less per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 18 mg or more per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 36 mg or about 36 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 10 mg or about 10 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 64 mg or about 64 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 22.75 mg or about 22.75 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 45.50 mg or about 45.50 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 181.51 mg or about 181.51 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 196.46 mg or about 196.46 mg per person per dose, wherein administration is preferably via an intrathecal route.

[0162] In one embodiment, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose between 0.14 and 5.71 mg (mg / kg) or between 0.142 mg and 3.28 mg / kg of body weight, preferably between 0.214 mg / kg and 3 mg / kg, more preferably between 0.25 mg / kg and 2.85 mg / kg, even more preferably between 0.31 mg / kg and 2.85 mg / kg, most preferably between 0.325 mg / kg and 2.808 mg / kg or between 0.65 mg / kg and 2.59 mg / kg, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intrathecally. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose of about 0.142 mg to about 3.28 mg (mg / kg) per kg body weight (preferably via intrathecal administration), preferably about 0.214 mg / kg to about 3 mg / kg, more preferably about 0.25 mg / kg to about 2.85 mg / kg, even more preferably about 0.31 mg / kg to about 2.85 mg / kg, most preferably about 0.325 mg / kg to about 2.8087 mg / kg or about 0.65 mg / kg to about 2.59 mg / kg.

[0163] In one embodiment, the human dose is between 0.32 mg / kg and 5.91 mg / kg, wherein administration is preferably via an intrathecal route.

[0164] Preferably, the human dose is selected from a list consisting of 0.14 mg / kg, 0.21 mg / kg, 0.25 mg / kg, 0.28 mg / kg, 0.31 mg / kg, 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg, 2.80 mg / kg, and 2.85 mg / kg, wherein administration is preferably via an intrathecal route. Most preferably, the human dose is selected from a list consisting of 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg, and 2.80 mg / kg, wherein administration is preferably via an intrathecal route.

[0165] In one embodiment, the human dose is 2.85 mg / kg or less, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.325 mg / kg or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.514 mg / kg or about 0.514 mg / kg, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.14 mg / kg or about 0.14 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.91 mg / kg or about 0.91 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.32 mg / kg or about 0.32 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg or about 0.65 mg / kg per person per dose, wherein administration is preferably via intrathecal route. In one embodiment, the human dose is 2.59 mg / kg or about 2.59 mg / kg per person per dose, wherein administration is preferably via intrathecal route. In one embodiment, the human dose is 2.80 mg / kg or about 2.80 mg / kg per person per dose, wherein administration is preferably via intrathecal route.

[0166] In one embodiment, the oligonucleotide and / or oligonucleotide analogue is formulated for human administration at a dose between 0.14 and 5.71 mg / kg / day, or between 0.142 mg / kg / day and 3.28 mg / kg / day, preferably between 0.214 mg / kg / day and 3 mg / kg / day, more preferably between 0.25 mg / kg / day and 2.85 mg / kg / day, even more preferably between 0.31 mg / kg / day and 2.85 mg / kg / day, most preferably between 0.325 mg / kg / day and 2.808 mg / kg / day, or between 0.65 mg / kg / day and 2.59 mg / kg / day, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intrathecally. In one embodiment, the human dose is between 0.32 mg / kg / day and 5.91 mg / kg / day, wherein administration is preferably via an intrathecal route.

[0167] Preferably, the human dose is selected from the list consisting of 0.14 mg / kg / day, 0.21 mg / kg / day, 0.25 mg / kg / day, 0.28 mg / kg / day, 0.31 mg / kg / day, 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, 2.80 mg / kg / day, and 2.85 mg / kg / day, wherein administration is preferably via an intrathecal route. Most preferably, the human dose is selected from the list consisting of 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, and 2.80 mg / kg / day, wherein administration is preferably via an intrathecal route.

[0168] In one embodiment, the human dose is 2.85 mg / kg / day or less, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.325 mg / kg / day or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg / day or more than 0.56 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.514 mg / kg / day or about 0.514 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.14 mg / kg / day or about 0.14 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.91 mg / kg / day or about 0.91 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.32 mg / kg / day or about 0.32 mg / kg / day per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg / day or about 0.65 mg / kg / day per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.59 mg / kg / day or about 2.59 mg / kg / day per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.80 mg / kg / day or about 2.80 mg / kg / day per person per dose, preferably administered via an intrathecal route.

[0169] Dosage administration can be accomplished by a single administration (e.g., by bolus injection), by administration in several divided doses over a period of time, or by continuous infusion over an appropriate period of time. Preferably, the dose is administered in a single administration step, preferably intravenously or intrathecally. Preferably, the dose is administered once every two weeks, once a month, or once every eight weeks. Preferably, the dose is administered once every two weeks or once a month.

[0170] In a second aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide as defined in the first aspect or any embodiment thereof, or a mixture of two or more said oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients. Preferably, the composition comprises an antimiR as defined in the first aspect or any embodiment thereof, more preferably comprising an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3p. In one embodiment, the composition comprises one or a mixture of these antimicroRNAs, and any other antimicroRNA or mixture thereof against human hsa-miR-218-5p or human hsa-miR-23b-3p, or generally, the composition comprises any oligonucleotide and / or oligonucleotide analog molecule that is an inhibitor of one of these microRNAs or other microRNAs that downregulate the expression of human genes MBNL1 and / or MBNL2, including compositions further comprising pharmaceutically acceptable carriers and / or excipients.

[0171] In one possible implementation, the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist as defined in the first aspect or any of its embodiments, preferably an antimiR, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3pp, or a mixture thereof. Preferably, the human hsa-miR-218-5p inhibitor / antagonist present in the composition is an antimiR inhibitor represented by SEQ ID NO: 1 or its functional equivalent SEQ ID NO: 80-110 used in the embodiments of the invention; the human hsa-miR-23b-3p inhibitor / antagonist present in the composition is an antimiR inhibitor represented by SEQ ID NO: 2 or its functional equivalent SEQ ID NO: 52-79, wherein the inhibitor is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. More preferably, the concentration of the inhibitor / antagonist contained in the composition allows for the administration of a therapeutically effective dose.

[0172] The “effective dose” or “therapeutic effective dose” is the amount sufficient to achieve a beneficial or desired clinical outcome. Based on previous results obtained against other microRNA molecules, the effective dose of a microRNA inhibitor / antagonist can be from about 0.5 mg / kg to about 100 mg / kg in mice, preferably from about 1.5 mg / kg to 100 mg / kg in mice or from about 0.75 mg / kg to 50 mg / kg in rats. However, precisely determining the effective dose in humans can be based on individual factors for each patient, including size, age, and the nature of the inhibitor or antagonist (e.g., whether it is an expression construct, an anti-miR, or an oligonucleotide analog, etc.).

[0173] In one embodiment, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is between 10 mg and 1125 mg per dose, preferably between 10 mg and 300 mg, more preferably between 15 mg and 290 mg, even more preferably between 18 mg and 288 mg, and most preferably between 33 mg and 144 mg. Preferably, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is between about 10 and about 1125 mg per dose, preferably between about 10 and about 300 mg, more preferably between about 15 and about 290 mg, even more preferably between about 18 and about 288 mg, and most preferably between about 34 and about 144 mg. Preferably, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is selected from a list consisting of 18 mg, 36 mg, 72 mg, 144 mg, 288 mg, and 576 mg per dose. Most preferably, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is selected from a list consisting of 36 mg, 72 mg, and 144 mg per dose. Also preferably, the therapeutically effective doses of oligonucleotides and / or analogs in humans are selected from a list consisting of 10, 36, or 68 mg per dose per person. Preferably, the doses disclosed in this paragraph are administered intravenously in humans.

[0174] In one embodiment, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is 10 to 400 mg per dose, or 10 to 230 mg per dose, preferably between 15 mg and 210 mg, more preferably between 18 mg and 200 mg, even more preferably between 22 mg and 200 mg, most preferably between 22.75 mg and 196.46 mg per dose, or between 45.50 mg and 181.51 mg per dose. Preferably, the therapeutically effective dose of the oligonucleotide and / or analogue in humans is about 10 to about 230 mg per dose, preferably about 15 to about 210 mg, more preferably about 18 to about 200 mg, even more preferably about 22 to about 200 mg, most preferably about 22.75 to about 196.46 mg per dose, or between 45.50 mg and 181.51 mg per dose. Preferably, the therapeutically effective dose of oligonucleotides and / or analogs in humans is selected from a list consisting of 10 mg, 15 mg, 18 mg, 20 mg, 22 mg, 22.75 mg, 45.50 mg, 181.51 mg, 196.46 mg, and 200 mg per dose per person. In one embodiment, the human dose is from 22.5 to 392.92 mg per dose per person. Also preferably, the therapeutically effective dose of oligonucleotides and / or analogs in humans is selected from a list consisting of 10, 36, or 68 mg per dose per person. Most preferably, the therapeutically effective dose of oligonucleotides and / or analogs in humans is selected from a list consisting of 22.75, 45.50, 181.51, and 196.46 mg per dose per person. Most preferably, the therapeutically effective dose of oligonucleotides and / or analogs in humans is selected from between 45.50 mg and 181.51 mg per dose per person. Preferably, the doses disclosed in this paragraph are administered intrathecally in humans.

[0175] In one embodiment, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is between 0.142 mg and 16.07 mg (mg / kg) per kg of body weight, preferably between 0.142 mg / kg and 4.285 mg / kg, more preferably between 0.214 mg / kg and 4.142 mg / kg, more preferably between 0.257 mg / kg and 4.114 mg / kg, and most preferably between 0.4878 mg / kg and 2.057 mg / kg. Preferably, the therapeutically effective dose of the oligonucleotide and / or its analogues in humans is from about 0.142 mg to about 16.07 mg (mg / kg) per kg of body weight, more preferably from about 0.142 mg / kg to about 4.285 mg / kg, more preferably from about 0.214 mg / kg to about 4.142 mg / kg, even more preferably from about 0.257 mg / kg to about 4.114 mg / kg, and most preferably from about 0.4878 mg / kg to about 2.057 mg / kg. Most preferably, the therapeutically effective dose in humans is selected from the list consisting of 0.257 mg / kg, 0.514 mg / kg, 1.028 mg / kg, 2.057 mg / kg, 4.114 mg / kg, and 8.228 mg / kg. Most preferably, the therapeutically effective dose in humans is selected from the list consisting of 0.514 mg / kg, 1.028 mg / kg, and 2.057 mg / kg. Also preferably, the therapeutically effective doses of oligonucleotides and / or analogs in humans are selected from a list consisting of 0.14, 0.51, or 0.91 mg / kg. Preferably, the doses disclosed in this paragraph are administered intravenously in humans.

[0176] In one embodiment, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is between 0.14 and 5.71 mg / kg body weight, or between 0.142 mg and 3.28 mg / kg, preferably between 0.214 mg / kg and 3 mg / kg, more preferably between 0.25 mg / kg and 2.85 mg / kg, more preferably between 0.31 mg / kg and 2.85 mg / kg, and most preferably between 0.325 mg / kg and 2.808 mg / kg or between 0.65 mg / kg and 2.59 mg / kg. In one embodiment, the human dose is between 0.32 mg / kg and 5.91 mg / kg. Preferably, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is from about 0.14 to about 5.71 mg / kg body weight, or from about 0.142 mg to about 3.28 mg / kg, preferably from about 0.214 mg / kg to about 3 mg / kg, more preferably from about 0.25 mg / kg to about 2.85 mg / kg, even more preferably from about 0.31 mg / kg to about 2.85 mg / kg, most preferably from about 0.325 mg / kg to about 2.808 mg / kg or from about 0.65 mg / kg to about 2.59 mg / kg. Most preferably, the therapeutically effective dose in humans is selected from the list consisting of 0.14 mg / kg, 0.21 mg / kg, 0.25 mg / kg, 0.28 mg / kg, 0.31 mg / kg, 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg, 2.80 mg / kg, and 2.85 mg / kg. Most preferably, the therapeutically effective dose in humans is selected from a list consisting of 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg, and 2.80 mg / kg. Also preferably, the therapeutically effective dose in humans of oligonucleotides and / or analogs is selected from a list consisting of 0.14, 0.51, or 0.91 mg / kg. Preferably, the doses disclosed in this paragraph are administered intrathecally in humans.

[0177] In one embodiment, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is a dose between 0.142 mg / kg body weight per day and 16.07 mg (mg / kg / day), preferably between 0.142 mg / kg / day and 4.285 mg / kg / day, more preferably between 0.214 mg / kg / day and 4.142 mg / kg / day, more preferably between 0.257 mg / kg / day and 4.114 mg / kg / day, and most preferably between 0.4878 mg / kg / day and 2.057 mg / kg / day. Most preferably, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is selected from the list consisting of 0.257 mg / kg / day, 0.514 mg / kg / day, 1.028 mg / kg / day, 2.057 mg / kg / day, 4.114 mg / kg / day, and 8.228 mg / kg / day. Most preferably, the therapeutically effective doses of oligonucleotides and / or analogs in humans are selected from a list consisting of 0.514 mg / kg / day, 1.028 mg / kg, and 2.057 mg / kg / day. Also preferably, the therapeutically effective doses of oligonucleotides and / or analogs in humans are selected from a list consisting of 0.14, 0.51, or 0.91 mg / kg / day. Preferably, the doses disclosed in this paragraph are administered intravenously in humans.

[0178] In one embodiment, the therapeutically effective dose of oligonucleotides and / or their analogues in humans is between 0.14 and 5.71 mg per kg body weight per day (mg / kg / day), or between 0.142 mg and 3.28 mg / kg / day, preferably between 0.214 mg / kg / day and 3 mg / kg / day, more preferably between 0.25 mg / kg / day and 2.85 mg / kg / day, more preferably between 0.31 mg / kg / day and 2.85 mg / kg / day, and most preferably between 0.325 mg / kg / day and 2.808 mg / kg / day or between 0.65 mg / kg / day and 2.59 mg / kg / day. Preferably, the therapeutically effective dose of the oligonucleotide and / or its analogue in humans is from about 0.142 mg to about 3.28 mg per kg body weight per day (mg / kg / day), more preferably from about 0.214 mg / kg / day to about 3 mg / kg / day, more preferably from about 0.25 mg / kg / day to about 2.85 mg / kg / day, even more preferably from about 0.31 mg / kg / day to about 2.85 mg / kg / day, and most preferably from about 0.325 mg / kg / day to about 2.808 mg / kg / day or from about 0.65 mg / kg / day to about 2.59 mg / kg / day. In one embodiment, the human dose is between 0.32 mg / kg / day and 5.91 mg / kg / day. Most preferably, the therapeutically effective dose in humans is selected from a list consisting of 0.14 mg / kg / day, 0.21 mg / kg / day, 0.25 mg / kg / day, 0.28 mg / kg / day, 0.31 mg / kg / day, 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, 2.80 mg / kg / day, and 2.85 mg / kg / day. Most preferably, the therapeutically effective dose in humans is selected from a list consisting of 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, and 2.80 mg / kg / day. Also preferably, the therapeutically effective dose in humans of oligonucleotides and / or analogues is selected from a list consisting of 0.14, 0.51, or 0.91 mg / kg / day. Preferably, the doses disclosed in this paragraph are administered intrathecally in humans.

[0179] The therapeutically effective dose can be administered via a single dose (e.g., by bolus injection), multiple doses over a period of time, or continuous infusion over an appropriate time period. Preferably, the therapeutically effective dose is administered in a single dose, preferably intravenously or intrathecally. Preferably, the therapeutically effective dose of oligonucleotides and / or their analogues is administered intravenously, preferably by bolus injection, or intrathecally. Preferably, the dose is administered every two weeks, monthly, or every eight weeks. Preferably, the dose is administered every two weeks or monthly.

[0180] Preferably, the therapeutically effective dose is administered once every two weeks, or once every three or four weeks, or once every eight weeks. Preferably, the therapeutically effective dose is administered once every two weeks or once a month.

[0181] For their clinical application, compositions according to the present invention will be considered pharmaceutical compositions of the present invention, and they can be prepared in a suitable form for the desired application. During a particular treatment period, it may be necessary or convenient to administer multiple doses to the subject, administered daily, weekly, monthly, every two months, every three months, or every six months. In some embodiments, the subject receives an initial dose at the start that is greater than one or more subsequent doses or maintenance doses. In some embodiments, the subject receives doses periodically or long-term, particularly in the case of treating chronic diseases (e.g., DM1).

[0182] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, pearl, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, other oligonucleotide-based delivery media, and liposomes, can be used as administration media for the inhibitors / antagonists of the present invention, utilizing these media to form the pharmaceutical compositions of the present invention. Another possibility is to use appropriate salts and buffers to prepare the pharmaceutical compositions of the present invention to stabilize the administration media and facilitate target cell capture. The compositions of the present invention can be aqueous compositions containing an effective amount of the administration media, comprising the oligonucleotide molecules of the present invention (independently or forming liposomes or other complexes) dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium, or expression carriers of the oligonucleotide molecules of the present invention.

[0183] Additional active ingredients may be added to the composition, as long as they do not inactivate the molecules of the present invention or their expression vectors.

[0184] Solutions of active compounds as free bases or pharmacologically acceptable salts can be prepared in water appropriately mixed with a surfactant (e.g., hydroxypropyl cellulose). Dispersions can also be prepared in glycerol, polyethylene glycol liquids and mixtures thereof, and oils. Under normal storage and use conditions, these formulations typically contain preservatives to prevent microbial growth. Oligonucleotides can also be prepared in solutions of phosphate-buffered saline and sodium chloride. For example, oligonucleotides can be prepared in a phosphate-buffered saline solution with a pH of 6.5 to 8 (preferably about 6.8-7) and sodium chloride at a concentration of about 150 mM.

[0185] The compositions of the present invention can typically be formulated in a neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (salts formed with the free amino group of a protein) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid). Salts formed with the free carboxyl group of a protein can also be derived from inorganic bases (e.g., hydroxides of sodium, potassium, ammonium, calcium, or iron) or organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0186] In a third aspect, the present invention provides oligonucleotides as defined in the first aspect or any embodiment thereof for therapeutic use, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof. Preferably, oleic acid conjugated to the oligonucleotide molecule and / or its analogues acts as a medium for delivering the oligonucleotide molecule and / or its analogues to the relevant tissue, such as muscle, CSF, and / or CNS. Thus, an oligonucleotide molecule or its analogue conjugated to at least one oleic acid molecule at its 3' end and / or 5' end according to the first aspect can be used for a method of treating human subjects in need by therapy, wherein the oligonucleotide molecule and / or its analogues are the active ingredient of the therapy, and wherein the oleic acid molecule serves as a pharmaceutically acceptable medium or carrier for the oligonucleotide molecule and / or its analogues. The term "active ingredient" as used herein refers to a substance having pharmaceutical activity and responsible for the therapeutic effect. In the case of antimiR antagonists, the active ingredient is a molecule, preferably an oligonucleotide molecule, that targets endogenous miRs. Most preferably, the term "active ingredient" as used herein refers to an oligonucleotide molecule and / or its analogues as defined in the first aspect of the invention or any embodiment thereof. It also includes the dosage disclosed above for therapeutic purposes, preferably for treating muscle, CSF, or CNS diseases.

[0187] In a fourth aspect, the present invention provides oligonucleotides as defined in the first aspect or any embodiment thereof, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof, for use in the prevention or treatment of muscle and / or nervous system diseases, preferably relating to muscle diseases involving weakness and atrophy of muscle tissue, particularly muscle diseases involving loss of muscle strength, inability to increase muscle strength, and deformities, and / or preferably nervous system diseases involving structural and / or functional changes in the brain and / or other tissues of the CNS (e.g., CSF). Preferably, the muscle disease is a muscular dystrophy. Preferably, the muscular dystrophy is selected from Becker's muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emory-Dreyfus muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, and oculopharyngeal muscular dystrophy. Preferably, the muscle disease is myotonic dystrophy, preferably myotonic dystrophy type 1 and / or myotonic dystrophy type 2. Preferably, the use according to the fourth aspect includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to the relevant tissue (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to an oligonucleotide molecule and / or its analogue.

[0188] In an optional fourth aspect, the invention provides the use of oligonucleotides as defined in the first aspect or any embodiment thereof, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof, for the prevention or treatment of a disease characterized by a deficiency in the amount or function of the MBNL gene and / or protein in a subject with such a need. Preferably, the use includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to the relevant tissue (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue. "Deficiency in the amount or function of the MBNL gene and / or protein" as used herein refers to a statistically significant decrease in the amount or function of the MBNL gene and / or protein compared to a healthy subject. In yet another optional fourth aspect, the invention provides the use of oligonucleotides as defined in the first aspect or any embodiment thereof, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof, for targeting muscle, CSF, and / or CNS cells of a subject with such a need, preferably muscle cells of a subject suffering from DM or DM1. In this document, "targeting muscle, CSF, and / or CNS cells" refers to increasing insufficient amounts of MBNL protein and / or gene in said cells or tissues. CNS cells preferably include neurons, but also include glial cells (astrocytes, oligodendrocytes, ependymal cells, and microglia), choroid plexus cells, and cells associated with blood vessels and coverings. Muscle cells include smooth muscle cells, preferably skeletal muscle cells, and cardiomyocytes. Preferably, the increase is statistically significant, preferably compared to control cells or untreated cells.

[0189] In yet another optional fourth aspect, the invention provides the use of oligonucleotides, as defined in the first aspect or any embodiment thereof, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof, for the prevention or treatment of diseases characterized by toxic RNA expression (also known as RNA diseases or RNA-mediated / RNA-dominant diseases). Preferably, the use includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to relevant tissues (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue. The diseases are typically characterized by unstable microsatellite repeat amplification caused by unusual mutational mechanisms, wherein the expression of amplified repeat elements creates convergence sites for RNA-binding proteins through mechanisms such as increasing the mass of target RNA in each cell nucleus and increasing the affinity of RNA-protein interactions (due to the high local concentration of binding sites in each mutant transcript). Preferably, the RNA disease or RNA-mediated / RNA-dominant disease is a neuromuscular disease or a neurodegenerative disease, more preferably selected from type 1 diabetes (ORPHA:273) or type 2 diabetes (ORPHA:606); fragile X-related tremor / ataxia syndrome (ORPHA:93256; FXTAS); C9ORF72 amyotrophic lateral sclerosis and / or frontotemporal dementia (ORPHA:275872; ALS / FTD); spinocerebellar ataxia (SCA) or benign adult familial myoclonic epilepsy (BAFME).

[0190] In yet another optional fourth aspect, the invention provides the use of oligonucleotides as defined in the first aspect or any embodiment thereof, or compositions, preferably pharmaceutical compositions, as defined in the second aspect or any embodiment thereof, for the prevention or treatment of a disease characterized by an excess of miR-23b-3p and / or miR-218-5p in quantity or function. "Excess of miR-23b-3p and / or miR-218-5p in quantity or function" as used herein refers to a statistically significantly higher level of miR-23b-3p and / or miR-218-5p in quantity or function compared to a healthy subject. Preferably, the disease characterized by an excess of miR-23b-3p and / or miR-218-5p in quantity or function is myotonic dystrophy, preferably type 1 and / or type 2 myotonic dystrophy. Preferably, the use includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to the relevant tissue (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to an oligonucleotide molecule and / or its analogue.

[0191] Preferably, the oligonucleotide or oligonucleotide analog molecule, as defined in the first aspect or any embodiment thereof, which is used alone or included in the pharmaceutical composition according to the third or fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having a sequence having SEQ ID NO: 1 or SEQ ID NO: 2, or having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the oligonucleotide or oligonucleotide analog molecule, as defined in the first aspect or any embodiment thereof, which is used alone or included in the pharmaceutical composition according to the third or fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 80-110 or SEQ ID NO: 52-79.

[0192] More preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof for use according to the third or fourth aspect is an antagonist comprising or consisting of the following: SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p). More preferably, the oligonucleotide or oligonucleotide analog molecule as defined in the first aspect or any embodiment thereof for use according to the third or fourth aspect is an antagonist comprising or consisting of the following: SEQ ID NO: 22, 23, 24, 49, 50 or 51 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 25, 26, 27 or 28 (anti-miR against hsa-miR-218-5p), or a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4 or 5 (anti-miR against hsa-miR-23b-3p) or SEQ ID NO: 7, 8, 9 or 14 (anti-miR against hsa-miR-218-5p). As described in the first aspect above, the oligonucleotide or analogues thereof used according to the third and fourth aspects further comprise at least one oleic acid molecule conjugated to its 3' end and / or 5' end.

[0193] In one embodiment of the fourth aspect, the treatment is palliative care for one or more symptoms of type 1 and / or type 2 myotonic dystrophy, or palliative care for one or more muscle disorders that are part of a symptom of type 1 and / or type 2 myotonic dystrophy. In a preferred embodiment of the fourth aspect, the treatment is for chronic type 1 and / or type 2 myotonic dystrophy. In a preferred embodiment, the treatment is therapeutic. Preferably, the use includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to the relevant tissue (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to an oligonucleotide molecule and / or its analogue.

[0194] In the third or fourth aspect of the implementation, the object of this need is a mammal, preferably a human, more preferably a human suffering from DM, preferably DM1.

[0195] Administering antagonists via their potential expression vectors allows expression to be directed to a specific tissue or tissue group based on the tropism of the underlying vector itself and / or by selecting control elements that elicit expression of the associated coding sequence only in a specific tissue. Furthermore, certain dosage forms may facilitate better entry into one organ or another. Therefore, possible embodiments of the third or fourth aspect of the invention, which may be combined with any other aspect, relate more directly to its therapeutic application, and can also be defined as: the use of one of the oligonucleotides and / or oligonucleotide analog molecules of the invention, a mixture of two or more of the molecules, or a composition containing at least one of the molecules in the preparation of a medicament for treating type 1 myotonic dystrophy by inhibiting or antagonizing the effects of human hsa-miR-218-5p or hsa-miR-23b-3p in one or more organs selected from the group consisting of or stem cells from one or more of these organs: brain, cerebellum, hippocampus or other central nervous system organs, skeletal muscle, heart, adipose tissue, kidneys, liver and biliary system, lungs, pharynx, nasopharynx, nose, placenta, spleen, testes, uterus, gastrointestinal tract, mammary glands, bladder, prostate, skin, keratinocytes and lymphoid cells. As needed or suitably, the oligonucleotides of the present invention may also target other organs selected from the group consisting of: brain, cerebellum, hippocampus or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testes and uterus, gastrointestinal tract, mammary gland, bladder, prostate, skin, keratinocytes and lymphoid cells, or stem cells from one or more of these organs, or combinations thereof.

[0196] Considering the stability of anti-miR drugs, direct administration to mammals, preferably humans, can be considered, for example, via subcutaneous or systemic routes, preferably intravenous or intrathecal, for example, dissolved or suspended in a pharmaceutically acceptable carrier (e.g., water or an aqueous solution such as saline or phosphate buffer), or intra-articular delivery. Compositions for administration may contain pharmaceutically acceptable excipients.

[0197] The active compositions of the present invention can be administered via any common route, as long as the target tissue can be reached. Routes include oral, nasal, intrathecal, or oral administration, and preferably, administration can be via intradermal, transdermal, subcutaneous, intramuscular, intraperitoneal, or intravenous routes. As previously mentioned, compositions containing anti-miRs are typically formulated for intravenous or subcutaneous administration. However, because oleic acid enhances the delivery of oligonucleotide molecules and / or their analogues to muscle, CSF, and / or CNS cells when administered intravenously (see Examples 9, 10, and 19), intravenous, intra-arterial, intrathecal, or subcutaneous administration is preferred. Furthermore, it is also preferred that the intravenous, intra-arterial, intrathecal, or subcutaneous administration be chronic, meaning that it is performed periodically (throughout the life of the patient for whom administration is needed).

[0198] After preparation, the solution is preferably administered in a form compatible with the dosage form and at a therapeutically effective amount. The formulation can be easily administered in various dosage forms, such as injections, drug-release capsules, etc.

[0199] In one embodiment of the third and any fourth aspect, the oligonucleotide and / or its analogues are used to treat humans in need. Preferably, the use comprises administering the oligonucleotide as defined in the first aspect or any embodiment thereof, or the composition, preferably the pharmaceutical composition, as defined in the second aspect or any embodiment thereof, at a dose between 10 mg and 1125 mg per person per dose, preferably between 10 mg and 300 mg, more preferably between 15 mg and 290 mg, even more preferably between 18 mg and 288 mg, and most preferably between 36 mg and 144 mg, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogues are administered intravenously. Preferably, the use comprises administering the oligonucleotide as defined in the first aspect or any embodiment thereof, or the composition, preferably the pharmaceutical composition, as defined in the second aspect or any embodiment thereof, at a dose between about 10 and about 1125 mg per person per dose, preferably between about 10 and about 300 mg, more preferably between about 15 and about 290 mg, even more preferably between about 18 and about 288 mg, and most preferably between about 34 and about 144 mg per person per dose. Preferably, the use involves administering oligonucleotides and / or their analogues or compositions to humans (preferably intravenously) at a dose selected from a list of 18 mg, 36 mg, 72 mg, 144 mg, 288 mg, and 576 mg per person per dose. Most preferably, the use involves administering oligonucleotides and / or their analogues or compositions to humans (preferably intravenously) at a dose selected from a list of 36 mg, 72 mg, and 144 mg per person per dose.

[0200] In one embodiment, the human dose is 188 mg or less per dose, preferably administered intravenously. In one embodiment, the human dose is 18 mg or more per dose, preferably administered intravenously. In one embodiment, the human dose is 36 mg or about 36 mg per dose, preferably administered intravenously. In one embodiment, the human dose is 10 mg or about 10 mg per dose, preferably administered intravenously. In one embodiment, the human dose is 64 mg or about 64 mg per dose, preferably administered intravenously.

[0201] Preferably, the use comprises administering an oligonucleotide, or a composition, preferably a pharmaceutical composition, as defined in the first aspect or any embodiment thereof, at a dose of 10 to 400 mg per person per dose, or 10 mg to 230 mg per person per dose, preferably between 15 mg and 210 mg, more preferably between 18 mg and 200 mg, even more preferably between 22 mg and 200 mg, most preferably between 22.75 mg and 196.46 mg or 45.50 mg and 181.51 mg per person per dose, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intrathecally. In one embodiment, the human dose is 22.5 to 392.92 mg per person per dose, wherein administration is preferably via an intrathecal route. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated to be administered to humans at a dose of about 10 to about 230 mg per person, preferably about 15 to about 210 mg, more preferably about 18 to about 200 mg, even more preferably about 22 to about 200 mg, most preferably about 22.75 to about 196.46 mg or 45.50 mg to 181.51 mg, preferably via intrathecal administration. Preferably, the human dose is selected from a list of 10 mg, 15 mg, 18 mg, 20 mg, 22 mg, 22.75, 45.50, 181.51, or 192 mg per person per dose, wherein administration is preferably via intrathecal administration. Most preferably, the human dose is selected from a list of 230 mg, 210 mg, and 200 mg per person per dose, wherein administration is preferably via intrathecal administration.

[0202] In one embodiment, the human dose is 200 mg or less per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 18 mg or more per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 36 mg or about 36 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 10 mg or about 10 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 64 mg or about 64 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 22.75 mg or about 22.75 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 45.50 mg or about 45.50 mg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 181.51 mg or about 181.51 mg per person per dose, wherein administration is preferably via an intrathecal route. In another embodiment, the human dose is 196.46 mg or about 196.46 mg per person per dose, wherein administration is preferably via an intrathecal route.

[0203] Preferably, the use comprises administering an oligonucleotide, as defined in the first aspect or any embodiment thereof, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any embodiment thereof, at a dose between 0.142 mg / kg and 16.07 mg / kg body weight, preferably between 0.142 mg / kg and 4.285 mg / kg, more preferably between 0.214 mg / kg and 4.142 mg / kg, even more preferably between 0.257 mg / kg and 4.114 mg / kg, and most preferably between 0.4878 mg / kg and 2.057 mg / kg, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue or composition is administered intravenously. Preferably, the use comprises administering oligonucleotides, or compositions, preferably pharmaceutical compositions, as defined in the first aspect or any embodiment thereof, at a dose of about 0.142 mg / kg to about 16.07 mg / kg, preferably about 0.142 mg / kg to about 4.285 mg / kg, more preferably about 0.214 mg / kg to about 4.142 mg / kg, even more preferably about 0.257 mg / kg to about 4.114 mg / kg, and most preferably about 0.4878 mg / kg to about 2.057 mg / kg. Preferably, the use relates to administering oligonucleotides and / or their analogues to humans (preferably intravenously) at a dose selected from the list consisting of 0.257 mg / kg, 0.514 mg / kg, 1.028 mg / kg, 2.057 mg / kg, 4.114 mg / kg, and 8.228 mg / kg. Preferably, the use involves administering oligonucleotides and / or their analogues to humans (preferably intravenously) at doses selected from a list consisting of 0.514 mg / kg, 1.028 mg / kg, and 2.057 mg / kg.

[0204] In one embodiment, the human dose is 2.68 mg / kg or less, preferably administered intravenously. In one embodiment, the human dose is 0.257 mg / kg or more, preferably administered intravenously. In one embodiment, the human dose is 0.51 mg / kg or about 0.51 mg / kg, preferably administered intravenously. In one embodiment, the human dose is 0.14 mg / kg or about 0.14 mg / kg per dose, preferably administered intravenously. In one embodiment, the human dose is 0.91 mg / kg or about 0.91 mg / kg per dose, preferably administered intravenously.

[0205] Preferably, the use includes administering an oligonucleotide, or a composition, preferably a pharmaceutical composition, as defined in the first aspect or any embodiment thereof, at a dose between 0.14 and 5.71 mg (mg / kg) per kg body weight, or between 0.142 mg and 3.28 mg / kg, preferably between 0.214 mg / kg and 3 mg / kg, more preferably between 0.25 mg / kg and 2.85 mg / kg, even more preferably between 0.31 mg / kg and 2.85 mg / kg, most preferably between 0.325 mg / kg and 2.808 mg / kg, or between 0.65 mg / kg and 2.59 mg / kg, to the oligonucleotide as defined in the first aspect or any embodiment thereof, or a composition as defined in the second aspect or any embodiment thereof, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue is administered intrathecally. Preferably, the oligonucleotide and / or oligonucleotide analogue is formulated for administration to humans at a dose of about 0.142 mg to about 3.28 mg / kg body weight, preferably about 0.214 mg / kg to about 3 mg / kg, more preferably about 0.25 mg / kg to about 2.85 mg / kg, even more preferably about 0.31 mg / kg to about 2.85 mg / kg, most preferably about 0.325 mg / kg to about 2.808 mg / kg or about 0.65 mg / kg to about 2.59 mg / kg (preferably via intrathecal administration). In one embodiment, the human dose is between 0.32 mg / kg and 5.91 mg / kg, wherein administration is preferably via intrathecal administration. Preferably, the human dose is selected from the list consisting of 0.142, 0.214, 0.25, 0.28, 0.31, 0.325 and 0.65, 2.59, 2.80 and 2.85 mg / kg, wherein administration is preferably via intrathecal administration. Most preferably, the human dose is selected from a list of 0.32, 0.65, 2.59 and 2.80 mg / kg, wherein administration is preferably via an intrathecal route.

[0206] In one embodiment, the human dose is 2.85 mg / kg or less, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.325 mg / kg or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.514 mg / kg or about 0.514 mg / kg, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.14 mg / kg or about 0.14 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.91 mg / kg or about 0.91 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.32 mg / kg or about 0.32 mg / kg per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg or about 0.65 mg / kg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.59 mg / kg or about 2.59 mg / kg per person per dose, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.80 mg / kg or about 2.80 mg / kg per person per dose, preferably administered via an intrathecal route.

[0207] Preferably, the use includes administering an oligonucleotide, or a composition, preferably a pharmaceutical composition, as defined in the first aspect or any embodiment thereof, at a dose between 0.142 mg / kg body weight per day, preferably between 0.142 mg / kg / day and 4.285 mg / kg / day, more preferably between 0.214 mg / kg / day and 4.142 mg / kg / day, even more preferably between 0.257 mg / kg / day and 4.114 mg / kg / day, and most preferably between 0.4878 mg / kg / day and 2.057 mg / kg / day, as defined in the first aspect or any embodiment thereof, and wherein, preferably, the oligonucleotide and / or oligonucleotide analogue or composition is administered intravenously. Preferably, the use involves administering oligonucleotides and / or their analogues to humans (preferably intravenously) at doses selected from the list of administration doses consisting of 0.257 mg / kg / day, 0.514 mg / kg / day, 1.028 mg / kg / day, 2.057 mg / kg / day, 4.114 mg / kg / day, and 8.228 mg / kg / day. Preferably, the use involves administering oligonucleotides and / or their analogues to humans (preferably intravenously) at doses selected from the list of administration doses consisting of 0.514 mg / kg / day, 1.028 mg / kg / day, and 2.057 mg / kg / day.

[0208] In one embodiment, the human dose is 2.68 mg / kg / day or less, preferably administered intravenously. In one embodiment, the human dose is 0.257 mg / kg / day or more, preferably administered intravenously. In one embodiment, the human dose is 0.51 mg / kg / day or about 0.51 mg / kg / day, preferably administered intravenously. In one embodiment, the human dose is 0.14 mg / kg / day or about 0.14 mg / kg / day, preferably administered intravenously. In one embodiment, the human dose is 0.91 mg / kg / day or about 0.91 mg / kg / day, preferably administered intravenously.

[0209] Preferably, the use comprises administering an oligonucleotide, or a composition, preferably a pharmaceutical composition, as defined in the first aspect or any embodiment thereof, at a dose between 0.14 and 5.71 mg / kg / day, or between 0.142 mg / kg / day and 3.28 mg / kg / day, preferably between 0.214 mg / kg / day and 3 mg / kg / day, more preferably between 0.25 mg / kg / day and 2.85 mg / kg / day, even more preferably between 0.31 mg / kg / day and 2.85 mg / kg / day, most preferably between 0.325 mg / kg / day and 2.808 mg / kg / day, or between 0.65 mg / kg / day and 2.59 mg / kg / day, at a dose between 0.65 mg / kg / day and 2.59 mg / kg / day. Preferably, the oligonucleotide and / or oligonucleotide analogue is administered intrathecally. In one embodiment, the human dose is between 0.32 mg / kg / day and 5.91 mg / kg / day, wherein administration is preferably via an intrathecal route. Preferably, the human dose is selected from a list consisting of 0.142 mg / kg / day, 0.214 mg / kg / day, 0.25 mg / kg / day, 0.28 mg / kg / day, 0.31 mg / kg / day, 0.325 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, 2.80 mg / kg / day, and 2.85 mg / kg / day, wherein administration is preferably via intrathecal route. Preferably, the human dose is selected from a list consisting of 3.28 mg / kg / day, 3 mg / kg / day, and 2.85 mg / kg / day, wherein administration is preferably via intrathecal route. Most preferably, the human dose is selected from a list consisting of 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, and 2.80 mg / kg / day, wherein administration is preferably via intrathecal route.

[0210] In one embodiment, the human dose is 2.85 mg / kg / day or less, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.325 mg / kg / day or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg / day or more, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.514 mg / kg / day or about 0.514 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.14 mg / kg / day or about 0.14 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.91 mg / kg / day or about 0.91 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.32 mg / kg / day or about 0.32 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 0.65 mg / kg / day or about 0.65 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.59 mg / kg / day or about 2.59 mg / kg / day, preferably administered via an intrathecal route. In one embodiment, the human dose is 2.80 mg / kg / day or about 2.80 mg / kg / day, preferably administered via an intrathecal route.

[0211] Dosage administration can be accomplished by a single administration (e.g., by bolus injection), by administration in several divided doses over a period of time, or by continuous infusion over an appropriate time period. Preferably, the use includes administration of the dose in a single administration step, preferably intravenously or intrathecally. Preferably, the use includes administration of the dose every two weeks, once a month, or once every eight weeks. Preferably, the use includes administration of the dose every two weeks or once a month.

[0212] On the other hand, a method is provided for treating diabetes (preferably type 1 diabetes) in a subject with this need, the method comprising administering the oligonucleotide or pharmaceutical composition of the present invention to the patient with this need. In some embodiments, the oligonucleotide will be present at a concentration that allows for the administration of a therapeutically effective dose. Preferably, the treatment method includes the use of at least one oleic acid molecule as a medium for delivering the oligonucleotide molecule and / or its analogue to relevant tissues (e.g., muscle, CSF, and / or CNS) when the oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue.

[0213] As described above, the examples provide evidence of how oleic acid can enhance delivery to target tissues such as muscle and brain. This leads to the conclusion that oleic acid not only reduces toxicity when the amount of PS in the molecule is higher than the amount of PO, but also that oleic acid is an effective medium for delivering oligonucleotide molecules and / or their analogues to target tissues such as muscle, CSF, and / or CNS. In view of this, a fifth aspect of the invention relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable medium or carrier when said oleic acid is conjugated with an oligonucleotide molecule and / or its analogue, preferably with the 3' or 5' conjugation of said oligonucleotide molecule and / or its analogue. Importantly, the use of at least one oleic acid molecule as a pharmaceutically acceptable medium or carrier refers to the use of the oleic acid molecule to transport, deliver, or carry the conjugated oligonucleotide molecule and / or its analogue to a specific target tissue (preferably muscle, CSF, and / or CNS tissue). In this context, "medium" and "carrier" are considered synonyms and are therefore used interchangeably. Preferably, when the oligonucleotide molecule and / or analogue (conjugated oleic acid) is administered intrathecally or intravenously, oleic acid is responsible for transporting, delivering, and carrying the oligonucleotide molecule and / or analogue conjugated thereto at the 3' and / or 5' ends. All amounts disclosed in the first aspect are applicable to the fifth aspect.

[0214] Those skilled in the art know how to test whether oleic acid is acting as a medium for oligonucleotide molecules and / or their analogues conjugated thereto. For example, one method to assess whether at least one oleic acid is being used as a medium is to measure the amount of oligonucleotide molecules and / or their analogues reaching the target tissue (preferably CNS, CSF, and / or muscle tissue) after intravenous, intrathecal, intra-arterial, or subcutaneous administration, and to compare that amount with the amount present in the tissue when the oligonucleotide molecules and / or their analogues are not conjugated to at least one oleic acid and are administered.

[0215] Preferably, the oligonucleotide molecule and / or its analogues conjugated with oleic acid are oligonucleotide molecule and / or their analogues as defined in the first aspect of the invention or any embodiment thereof. Therefore, a preferred embodiment of the fifth aspect relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable medium or carrier when said oleic acid is conjugated to the 3' or 5' end of the oligonucleotide molecule and / or its analogue as defined in the first aspect, preferably wherein said oligonucleotide molecule and / or its analogues are active ingredients of a method of treatment by therapy as defined in the third or fourth aspect of the invention or any embodiment thereof. It is noteworthy that the conjugation with the oligonucleotide molecule and / or its analogues can be direct conjugation or conjugation via a spacer molecule, as described in the first aspect of the invention. Preferably, the oleic acid used as a medium is conjugated to the oligonucleotide molecule and / or its analogue via a spacer molecule selected from NHC3, NHC5, NHC6, threonine, and their derivatives.

[0216] In an embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the 5' or 3' end of the oligonucleotide molecule and / or its analogue in the first aspect or any embodiment thereof, such that the single oleic acid molecule acts as a mediator of the oligonucleotide molecule and / or its analogue. In an embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analogue in the first aspect or any embodiment thereof, such that the single oleic acid molecule acts as a mediator of the oligonucleotide molecule and / or its analogue, and the oligonucleotide molecule and / or its analogue as defined in the first aspect acts as an active ingredient in a method of treatment by therapy as defined in the third or fourth aspect.

[0217] In a preferred embodiment, at least one oleic acid molecule conjugated to an oligonucleotide molecule and / or its analogue as defined in the first aspect of the invention or any embodiment thereof is more effective in delivering the oligonucleotide molecule and / or its analogue to the tissue of interest (or target tissue), such as muscle, CSF, and / or CNS, than when the oligonucleotide molecule and / or its analogue are not conjugated to oleic acid, as shown in Examples 9 or 10. Therefore, oleic acid molecules serve as a delivery medium for the active ingredient, wherein the active ingredient component is an oligonucleotide molecule and / or its analogue, preferably an oligonucleotide or its analogue as defined in the first aspect or any embodiment thereof.

[0218] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable medium or carrier when conjugated to the 3' or 5' end of an oligonucleotide or its analogue, preferably the oligonucleotide molecule and / or analogue of the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or its analogue comprises a mixture of thiophosphate bonds and phosphodiester bonds that chemically link nucleotides, preferably wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0219] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable medium or carrier when conjugated to the 3' or 5' end of an oligonucleotide molecule and / or analogue of the first aspect or any embodiment thereof, wherein the oligonucleotide molecule and / or analogue is a microRNA antagonist, preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0220] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable medium or carrier when conjugated to the 3' or 5' end of an oligonucleotide or analogue, preferably the oligonucleotide molecule and / or analogue of the first aspect or any embodiment thereof, wherein when the oligonucleotide molecule and / or analogue is administered via an intravenous, intrathecal, intra-arterial or subcutaneous route, the oleic acid used as a medium delivers the oligonucleotide molecule and / or analogue to the muscle, CSF and / or CNS cells of the subject in need.

[0221] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable medium or carrier when conjugated to the 3' or 5' end of an oligonucleotide or analogue, preferably as defined in the first aspect or any embodiment thereof, wherein the oligonucleotide or analogue is an active ingredient in a method of treatment by therapy, the method of treatment by therapy including the prevention or treatment of muscle diseases, nervous system diseases and / or RNA diseases.

[0222] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable medium or carrier when conjugated to an oligonucleotide or analogue, preferably as defined in the first aspect or any embodiment thereof, and / or the 3' or 5' end of the oligonucleotide molecule and / or analogue thereof, wherein the oligonucleotide molecule and / or analogue thereof is an active ingredient in a method of treatment by therapy, the method of treatment by therapy including prevention or treatment of myotonic dystrophy, preferably myotonic dystrophy type 1.

[0223] In one embodiment of the fifth aspect, when the oleic acid is conjugated to an oligonucleotide molecule and / or its analogue, the oleic acid molecule, used as a pharmaceutically acceptable medium or carrier, is administered at any dose and via any route disclosed above.

[0224] Preferably, oleic acid is used as a medium or carrier to deliver oligonucleotide molecules or analogues to target tissues in humans, wherein the oleic acid molecule is conjugated to the 3' end and / or 5' end of the oligonucleotide molecule or analogue, wherein the oligonucleotide molecule or analogue is an active ingredient of a treatment method, and wherein the oligonucleotide molecule or analogue is administered to humans at a dose between 18 mg and 288 mg per person, and wherein the administration is intravenous or intrathecal.

[0225] Preferably, oleic acid is used as a medium or carrier to deliver oligonucleotide molecules or their analogues to target tissues in humans, wherein the dose is between 33 mg and 144 mg per person, and the administration is intravenous. Preferably, oleic acid is used as a medium or carrier to deliver oligonucleotide molecules or their analogues to target tissues in humans, wherein the dose is between 22.75 mg and 196.46 mg per person, and the administration is intrathecal. Preferably, the target tissue is the central nervous system (CNS), muscle tissue, and / or cerebrospinal fluid (CSF). Preferably, the oligonucleotide molecule or its analogue is the active ingredient in a method for treating or preventing muscle and / or nervous system diseases.

[0226] Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, preferably the oligonucleotide molecules and / or their analogues of the first aspect or any embodiment thereof, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 10 mg and 1125 mg per person per dose, preferably between 10 mg and 300 mg, more preferably between 15 mg and 290 mg, even more preferably between 18 mg and 288 mg, and most preferably between 33 mg and 144 mg, and wherein, preferably, the oligonucleotides and / or their analogues are administered intravenously. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of about 10 to about 1125 mg per person per dose, preferably about 10 to about 300 mg, more preferably about 15 to about 290 mg, even more preferably about 18 to about 288 mg, and most preferably about 34 to about 144 mg, wherein administration is preferably intravenous. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 18 mg, 36 mg, 72 mg, 144 mg, 288 mg, and 576 mg per person per dose, wherein administration is preferably via intravenous route. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 36 mg, 72 mg, and 144 mg per person per dose, wherein administration is preferably via intravenous route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 188 mg or less per person per dose, wherein administration is preferably via intravenous route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 18 mg or more per person per dose, wherein administration is preferably via intravenous route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 36 mg or about 36 mg per person per dose, wherein administration is preferably via intravenous route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 10 mg or about 10 mg per person per dose, wherein administration is preferably via intravenous route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 64 mg or about 64 mg per person per dose, wherein administration is preferably via intravenous route.

[0227] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.142 mg and 16.07 mg (mg / kg) per kg body weight, preferably between 0.142 mg / kg and 4.285 mg / kg, more preferably between 0.214 mg / kg and 4.142 mg / kg, even more preferably between 0.257 mg / kg and 4.114 mg / kg, and most preferably between 0.4878 mg / kg and 2.057 mg / kg, and wherein, preferably, the oleic acid-conjugated oligonucleotides and / or oligonucleotide analogues are administered intravenously. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of about 0.142 mg to about 16.07 mg (mg / kg) of body weight, preferably about 0.142 mg / kg to about 4.285 mg / kg, more preferably about 0.214 mg / kg to about 4.142 mg / kg, even more preferably about 0.257 mg / kg to about 4.114 mg / kg, and most preferably about 0.4878 mg / kg to about 2.057 mg / kg, preferably via intravenous administration. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.257 mg / kg, 0.514 mg / kg, 1.028 mg / kg, 2.057 mg / kg, 4.114 mg / kg, and 8.228 mg / kg, wherein administration is preferably via intravenous administration. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.514 mg / kg, 1.028 mg / kg and 2.057 mg / kg, wherein administration is preferably via an intravenous route.

[0228] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.68 mg / kg or less, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.257 mg / kg or more, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.51 mg / kg or about 0.51 mg / kg, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.14 mg / kg or about 0.14 mg / kg per person per dose, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.91 mg / kg or about 0.91 mg / kg per person per dose, wherein administration is preferably via an intravenous route.

[0229] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.142 mg and 16.07 mg per kg body weight per day (mg / kg / day), preferably between 0.142 mg / kg / day and 4.285 mg / kg / day, more preferably between 0.214 mg / kg / day and 4.142 mg / kg / day, even more preferably between 0.257 mg / kg / day and 4.114 mg / kg / day, most preferably between 0.4878 mg / kg / day and 2.057 mg / kg / day, and wherein, preferably, the oligonucleotides and / or oligonucleotide analogues are administered intravenously. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.257 mg / kg / day, 0.514 mg / kg / day, 1.028 mg / kg / day, 2.057 mg / kg / day, 4.114 mg / kg / day, and 8.228 mg / kg / day, wherein administration is preferably via an intravenous route. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at doses of 0.514 mg / kg / day, 1.028 mg / kg / day, and 2.057 mg / kg / day (day), wherein administration is preferably via an intravenous route.

[0230] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.68 mg / kg / day or less, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.257 mg / kg / day or more, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.51 mg / kg / day or about 0.51 mg / kg / day, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.14 mg / kg / day or about 0.14 mg / kg / day, preferably via intravenous administration. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.91 mg / kg / day or about 0.91 mg / kg / day, wherein administration is preferably via an intravenous route.

[0231] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 10 to 400 mg per person per dose, or 10 to 230 mg per person per dose, preferably between 15 mg and 210 mg, more preferably between 18 mg and 200 mg, even more preferably between 22 mg and 200 mg, most preferably between 22.75 mg and 196.46 mg or between 45.50 mg and 181.51 mg per person per dose, and wherein, preferably, the oligonucleotides and / or oligonucleotide analogues are administered intrathecally. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of about 10 to about 230 mg per person per dose, preferably about 15 to about 210 mg, more preferably about 18 to about 200 mg, even more preferably about 22 to about 200 mg, most preferably about 22.75 to about 196.46 mg or 45.50 mg to 181.51 mg (preferably via intrathecal administration). In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 22.5 to 392.92 mg per person per dose, wherein administration is preferably via an intrathecal route.

[0232] Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 10 mg, 15 mg, 18 mg, 20 mg, 22 mg, 22.75 mg, 45.50 mg, 181.51 mg, 196.46 mg, and 200 mg per person per dose, wherein administration is preferably via an intrathecal route. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 22.75 mg, 45.50 mg, 181.51 mg, and 196.46 mg per person per dose, wherein administration is preferably via an intrathecal route.

[0233] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 200 mg or less per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 18 mg or more per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 36 mg or about 36 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 10 mg or about 10 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 64 mg or about 64 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 22.75 mg or about 22.75 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 45.50 mg or about 45.50 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 181.51 mg or about 181.51 mg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 196.46 mg per person per dose, or about 196.46 mg, wherein administration is preferably via an intrathecal route.

[0234] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.14 and 5.71 mg (mg / kg) per kg body weight, or between 0.142 mg and 3.28 mg / kg, preferably between 0.214 mg / kg and 3 mg / kg, more preferably between 0.25 mg / kg and 2.85 mg / kg, even more preferably between 0.31 mg / kg and 2.85 mg / kg, most preferably between 0.325 mg / kg and 2.808 mg / kg or between 0.65 mg / kg and 2.59 mg / kg, and wherein, preferably, the oligonucleotides and / or oligonucleotide analogues are administered intrathecally. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose (preferably intrathecally) of about 0.142 mg to about 3.28 mg / kg body weight, preferably about 0.214 mg / kg to about 3 mg / kg, more preferably about 0.25 mg / kg to about 2.85 mg / kg, even more preferably about 0.31 mg / kg to about 2.85 mg / kg, most preferably about 0.325 mg / kg to about 2.8087 mg / kg or about 0.65 mg / kg to about 2.59 mg / kg.

[0235] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.32 mg / kg and 5.91 mg / kg, wherein administration is preferably via an intrathecal route. Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.14 mg / kg, 0.21 mg / kg, 0.25 mg / kg, 0.28 mg / kg, 0.31 mg / kg, 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg, 2.80 mg / kg, and 2.85 mg / kg, wherein administration is preferably via an intrathecal route. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.32 mg / kg, 0.65 mg / kg, 2.59 mg / kg and 2.80 mg / kg, wherein administration is preferably via an intrathecal route.

[0236] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.85 mg / kg or less, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.325 mg / kg or more, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.65 mg / kg or more, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.514 mg / kg or about 0.514 mg / kg, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.14 mg / kg or about 0.14 mg / kg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.91 mg / kg or about 0.91 mg / kg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.32 mg / kg or about 0.32 mg / kg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.65 mg / kg or about 0.65 mg / kg per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.59 mg / kg or about 2.59 mg / kg per person per dose, wherein administration is preferably via an intrathecal route. In another embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.80 mg / kg or about 2.80 mg / kg per person per dose, wherein administration is preferably via an intrathecal route.

[0237] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.14 and 5.71 mg (mg / kg / day) per kg body weight per day, or between 0.142 mg / kg / day and 3.28 mg / kg / day, preferably between 0.214 mg / kg / day and 3 mg / kg / day, more preferably between 0.25 mg / kg / day and 2.85 mg / kg / day, even more preferably between 0.31 mg / kg / day and 2.85 mg / kg / day, most preferably between 0.325 mg / kg / day and 2.808 mg / kg / day or between 0.65 mg / kg / day and 2.59 mg / kg / day, and wherein, preferably, the oligonucleotides and / or oligonucleotide analogues are administered intrathecally. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose between 0.32 mg / kg / day and 5.91 mg / kg / day, wherein administration is preferably via an intrathecal route.

[0238] Preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.14 mg / kg / day, 0.21 mg / kg / day, 0.25 mg / kg / day, 0.28 mg / kg / day, 0.31 mg / kg / day, 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, 2.80 mg / kg / day, and 2.85 mg / kg / day, wherein administration is preferably via an intrathecal route. Most preferably, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose selected from a list consisting of 0.32 mg / kg / day, 0.65 mg / kg / day, 2.59 mg / kg / day, and 2.80 mg / kg / day, wherein administration is preferably via an intrathecal route.

[0239] In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.85 mg / kg / day or less, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.325 mg / kg / day or more, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.65 mg / kg / day or more than 0.56 mg / kg / day, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.514 mg / kg / day or about 0.514 mg / kg / day, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.14 mg / kg / day or about 0.14 mg / kg / day, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.91 mg / kg / day or about 0.91 mg / kg / day, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.32 mg / kg / day or about 0.32 mg / kg / day per person per dose, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 0.65 mg / kg / day or about 0.65 mg / kg / day per person, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.59 mg / kg / day or about 2.59 mg / kg / day per person, wherein administration is preferably via an intrathecal route. In one embodiment, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are administered at a dose of 2.80 mg / kg / day or about 2.80 mg / kg / day per person, wherein administration is preferably via an intrathecal route.

[0240] In one embodiment of the fifth aspect, oleic acid molecules are used as a medium to deliver oligonucleotide molecules and / or their analogues, wherein the oligonucleotide molecules and / or their analogues are selected from the list consisting of SEQ ID NO: 22 (MD23b-2 V2 3' Ol), 23 (MD23b-2-PS / PO 3'OI), or 25 (218 MOE Oleic 3'), and wherein the spacer molecules defined in SEQ ID NO: 22, 23, or 25 are selected from the group consisting of NHC3, NHC5, NHC6, and threonine, and wherein the oligonucleotide molecules are formulated for administration to humans at a dose between 18 mg and 288 mg per person. Preferably, the oleic acid used as a medium is conjugated to the 5' and / or 3' of the oligonucleotide molecules and / or their analogues selected from the list consisting of SEQ ID NO: 3, 4, or 7, wherein the oligonucleotide molecules are formulated for administration to humans at a dose between 18 mg and 288 mg per person.

[0241] Preferably, the oleic acid used as a medium is conjugated to the 5' and / or 3' of an oligonucleotide molecule and / or its analogue selected from the list consisting of SEQ ID NO: 22, 23, 24, 3, 4 or 7, wherein the oligonucleotide molecule is formulated for administration to humans at a dose between 33 mg and 144 mg per person (assuming an average body weight of 70 kg), and wherein administration is preferably intravenous.

[0242] Preferably, the oleic acid used as a medium is conjugated to the 5' and / or 3' of an oligonucleotide molecule and / or its analogue selected from the list consisting of SEQ ID NO: 22, 23, 24, 3, 4 or 7, wherein the oligonucleotide molecule is formulated for administration to humans at a dose between 22.5 mg and 196.46 mg per person (assuming an average body weight of 70 kg), and wherein administration is preferably intrathecal.

[0243] Preferably, oleic acid, used as a medium according to the fifth aspect, is used to deliver the oligonucleotide molecule and / or its analogues to the muscle, CSF, and / or CNS cells of the recipient, preferably via intravenous or intrathecal administration.

[0244] In a fifth aspect, the invention also provides a conjugate comprising at least one oleic acid conjugated to the 3' or 5' end of an oligonucleotide molecule or analogue as defined in the first aspect or any embodiment thereof, wherein the oligonucleotide molecule or analogue is used as an active ingredient in a method of treatment by therapy as defined in the third or fourth aspect or any embodiment thereof, and wherein the at least one oleic acid is used as a pharmaceutically acceptable medium for delivering the oligonucleotide molecule or analogue to a target tissue, such as the CNS, CSF, and / or muscle tissue, as explained in the fifth aspect or any embodiment thereof. The above-described dosage also applies to this aspect.

[0245] This invention also includes the following provisions:

[0246] 1. An oligonucleotide molecule, or a mixture of two or more said oligonucleotide molecules, wherein the oligonucleotide molecule is 10 to 30 nucleotides in length, wherein the oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphate thioester bond, and wherein the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end.

[0247] 2. The oligonucleotide molecule of Clause 1, wherein the molecule is a microRNA antagonist.

[0248] 3. The oligonucleotide molecule of Clause 2, wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0249] 4. An oligonucleotide molecule according to any one of clauses 1 to 3, wherein the length of said oligonucleotide molecule is 15 to 30 nucleotides, wherein at least two nucleotides in said molecule are linked by phosphodiester bonds, and wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0250] 5. An oligonucleotide molecule according to any one of claims 1 to 4, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, and wherein the oligonucleotide molecule comprises a segment of at least 15 consecutive nitrogenous bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0251] 6. An oligonucleotide molecule according to any one of claims 1 to 5, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, and wherein the oligonucleotide molecule comprises a segment of at least 15 consecutive nitrogen bases consisting of a sequence of nucleotides that are identical to the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p).

[0252] 7. An oligonucleotide molecule according to any one of clauses 1 to 6, comprising at least one chemical modification, wherein said chemical modification is selected from the group consisting of:

[0253] i) 2'-O-methyl (2'OMe),

[0254] ii) 2'-O-methoxyethyl (2'MOE), and / or

[0255] iii) Additional bridge (LNA) connecting 2' oxygen and 4' carbon.

[0256] 8. An oligonucleotide molecule according to any one of claims 1 to 7, wherein the oligonucleotide molecule is 15 to 30 nucleotides in length, and wherein the oligonucleotide molecule comprises a segment of at least 15 consecutive nitrogenous bases consisting of a sequence having at least 80% identity with the sequence of a region present in SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0257] 9. An oligonucleotide molecule according to any one of claims 1 to 8, wherein the length of said oligonucleotide molecule is 15 to 30 nucleotides, and wherein the nucleotide sequence of said oligonucleotide is composed of SEQ ID NO: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p).

[0258] 10. A composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in any one of clauses 1 to 9 or a mixture of two or more of the said oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0259] 11. A composition for therapeutic use, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in any one of clauses 1 to 9 or a mixture of two or more of the said oligonucleotide molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0260] 12. A composition, preferably a pharmaceutical composition, for use in targeting muscle cells of a subject in need, comprising at least one oligonucleotide as defined in any one of Clauses 1 to 9 or a mixture of two or more of the oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0261] 13. A composition, preferably a pharmaceutical composition, for the purpose of preventing or treating muscle diseases or RNA diseases, comprising at least one oligonucleotide as defined in any one of clauses 1 to 9 or a mixture of two or more of the oligonucleotides, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0262] 14. A composition, preferably a pharmaceutical composition, for the use described in Clause 13, wherein the disease is myotonic dystrophy.

[0263] 15. The composition, preferably the pharmaceutical composition, for the use described in Clause 14, wherein the myotonic dystrophy is type 1 myotonic dystrophy.

[0264] The project of this invention

[0265] 1. An oligonucleotide molecule comprising SEQ ID NO: 22 (MD23b-2 V2 3' O1), 23 (MD23b-2-PS / PO 3' OI), or 25 (218 MOE Oleic 3'), wherein the oligonucleotide molecule is conjugated to at least one oleic acid at its 3' end, and wherein the spacer molecule defined in SEQ ID NO: 22, 23, or 25 is selected from the group consisting of NHC3, NHC5, NHC6, and threonine, and wherein the oligonucleotide molecule is formulated for administration to humans at a dose between 18 mg and 288 mg per person.

[0266] 2. Based on the oligonucleotide molecule of Project 1, wherein the oligonucleotide molecule is formulated for administration to humans at a dose between 33 mg and 144 mg per person.

[0267] 3. An oligonucleotide molecule according to Project 1 or 2, wherein the oligonucleotide molecule is formulated for intravenous administration to humans.

[0268] 4. An oligonucleotide molecule according to any one of items 1 to 3, which is composed of SEQ ID NO: 3 (MD23b-2 V2 3´Ol).

[0269] 5. An oligonucleotide molecule according to any one of items 1 to 3, which is composed of SEQ ID NO: 4 (MD23b-2-PS / PO3'OI).

[0270] 6. An oligonucleotide molecule according to any one of items 1 to 3, which is composed of SEQ ID NO: 7 (218 MOE Oleic3').

[0271] 7. A composition, preferably a pharmaceutical composition, comprising at least one oligonucleotide molecule as defined in any one of items 1 to 6 or a mixture of two or more of the molecules, optionally further comprising a carrier and / or one or more pharmaceutically acceptable excipients.

[0272] 8. An oligonucleotide molecule according to any one of items 1 to 6 or a composition as defined in item 7, used for treatment.

[0273] 9. An oligonucleotide molecule of any one of items 1 to 6 or a composition as defined in item 7, used for the prevention or treatment of RNA diseases.

[0274] 10. An oligonucleotide molecule of any one of items 1 to 6 or a composition as defined in item 7, for the prevention or treatment of muscle diseases and / or nervous system diseases.

[0275] 11. An oligonucleotide or composition according to the use of item 10, wherein the disease is myotonic dystrophy.

[0276] 12. An oligonucleotide or composition according to the use of item 11, wherein the myotonic dystrophy is type 1 myotonic dystrophy.

[0277] 13. An oligonucleotide or composition for use according to any one of items 9 to 13, wherein said use includes administering said oligonucleotide or composition at a dose between 18 mg and 288 mg per person.

[0278] 14. The oligonucleotide or composition for use according to item 13, wherein said use includes administration of said oligonucleotide or composition at a dose between 36 mg and 144 mg per person.

[0279] 15. An oligonucleotide or composition for use according to any one of items 9 to 14, wherein said use includes intravenous administration of said oligonucleotide or composition.

[0280] More items of this invention

[0281] This invention also relates to:

[0282] 1. An oleic acid molecule used as a medium or carrier for delivering oligonucleotide molecules or their analogues to target tissues in humans.

[0283] The oleic acid molecule is conjugated to the 3' and / or 5' end of the oligonucleotide molecule or its analogue.

[0284] The oligonucleotide molecule or its analogue is an active ingredient in a therapeutic method, and

[0285] The oligonucleotide molecule or its analogues are administered to humans at a dose between 18 mg and 288 mg per person.

[0286] 2. Oleic acid molecules according to the use described in Item 1, wherein the administration is intravenous or intrathecal.

[0287] 3. Oleic acid molecules according to the use described in item 1 or 2, wherein the dosage is between 33 mg and 144 mg per person, and the administration is intravenous.

[0288] 4. Oleic acid molecules for the use described in Item 3, wherein the target tissue is the central nervous system (CNS), muscle tissue and / or cerebrospinal fluid (CSF), preferably muscle tissue.

[0289] 5. Oleic acid molecules for use according to item 1 or 2, wherein the dosage is between 22.75 mg and 196.46 mg per person, and the administration is intrathecal.

[0290] 6. Oleic acid molecules for the use described in Item 5, wherein the target tissue is the central nervous system (CNS), muscle tissue, and / or cerebrospinal fluid (CSF), preferably CSF.

[0291] 7. An oleic acid molecule for use according to any one of items 1 to 6, wherein the oligonucleotide molecule or its analogue comprises a mixture of thiophosphate bonds and phosphodiester bonds that chemically link nucleotides.

[0292] 8. The oleic acid molecule for the use described in Item 7, wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0293] 9. The oleic acid molecule for use according to any one of items 1 to 8, wherein the oligonucleotide molecule or its analogue is an active ingredient in a method of treating or preventing muscle and / or nervous system diseases.

[0294] 10. An oleic acid molecule conjugated to the 3' and / or 5' end of an oligonucleotide molecule or its analogue, for the prevention or treatment of central nervous system (CNS) diseases.

[0295] The oleic acid molecule is a pharmaceutically acceptable medium or carrier for delivering the oligonucleotide molecule or its analogue to the CNS.

[0296] The oligonucleotide molecule or its analogue is the active ingredient and comprises a mixture of phosphate thioester bonds and phosphodiester bonds that chemically link nucleotides.

[0297] The oligonucleotide molecule or its analogues are administered to humans via the intrathecal route at doses ranging from 18 mg to 288 mg per person.

[0298] 11. Oleic acid for the use described in item 10, wherein the dosage is between 22 and 200 mg per person per dose, preferably between 22.75 and 196.46 mg.

[0299] 12. Oleic acid for use according to any one of items 1 to 11, wherein the oligonucleotide molecule or its analogue is a microRNA antagonist, preferably human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0300] 13. Oleic acid for use according to any one of items 1 to 12, wherein the oligonucleotide molecule or analogue thereof is an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, having a length of 10 to 30 nucleotides, and comprising a fragment of at least 15 consecutive nitrogenous bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0301] 14. Oleic acid for use according to any one of items 1 to 13, wherein the oligonucleotide molecule or analogue thereof has at least 80% identity with SEQ ID NO: 22, 23 or 25, and wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives.

[0302] 15. Oleic acid for use according to any one of items 1 to 14, wherein the oligonucleotide molecule or analogue thereof has at least 80% identity with SEQ ID NO: 22, 23 or 25, wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives, and wherein the oligonucleotide molecule is capable of increasing the endogenous level of MBNL1 and / or MBNL2 proteins.

[0303] 16. Oleic acid for use according to any one of items 1 to 15, wherein the oligonucleotide molecule or analogue thereof is composed of SEQ ID NO: 3, 4 or 7.

[0304] More items of this invention

[0305] This invention also relates to:

[0306] 1. An oleic acid molecule used as a medium or carrier for delivering oligonucleotide molecules or their analogues to human target tissues.

[0307] The oleic acid molecule is conjugated to the 3' and / or 5' end of the oligonucleotide molecule or its analogue.

[0308] The oligonucleotide molecule or its analogue is an active ingredient in a therapeutic method, and

[0309] The administration described herein is intravenous or intrathecal.

[0310] 2. Oleic acid molecules for the use described in Item 1, wherein the target tissue is the central nervous system (CNS), muscle tissue, and / or cerebrospinal fluid (CSF), preferably muscle tissue.

[0311] 3. Oleic acid molecules for the purposes described in Item 1 or 2, wherein the dosage is between 22.75 mg and 196.46 mg per person.

[0312] 4. An oleic acid molecule for use according to any one of items 1 to 3, wherein the oligonucleotide molecule or its analogue comprises a mixture of thiophosphate bonds and phosphodiester bonds that chemically link nucleotides.

[0313] 5. The oleic acid molecule according to the use described in Project 4, wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

[0314] 6. The oleic acid molecule for use according to any one of items 1 to 5, wherein the oligonucleotide molecule or its analogue is an active ingredient in a method of treating or preventing muscle and / or nervous system diseases.

[0315] 7. An oleic acid molecule conjugated to the 3' and / or 5' end of an oligonucleotide molecule or its analogue, for the prevention or treatment of central nervous system (CNS) diseases.

[0316] The oleic acid molecule is a pharmaceutically acceptable medium or carrier for delivering the oligonucleotide molecule or its analogue to the CNS.

[0317] The oligonucleotide molecule or its analogue is the active ingredient and comprises a mixture of phosphate thioester bonds and phosphodiester bonds that chemically link nucleotides.

[0318] The oligonucleotide molecule or its analogues are administered to humans via the intrathecal route at doses ranging from 18 mg to 288 mg per person.

[0319] 8. Oleic acid for use according to the purpose described in item 7, wherein the dosage is between 22 and 200 mg per person per dose, preferably between 22.75 and 196.46 mg.

[0320] 9. Oleic acid for use according to any one of items 1 to 8, wherein the oligonucleotide molecule or its analogue is a microRNA antagonist, preferably human hsa-miR-23b-3p or human hsa-miR-218-5p.

[0321] 10. Oleic acid for use according to any one of items 1 to 9, wherein the oligonucleotide molecule or analogue thereof is an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, having a length of 10 to 30 nucleotides, and comprising a fragment of at least 15 consecutive nitrogen bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

[0322] 11. Oleic acid for use according to any one of items 1 to 10, wherein the oligonucleotide molecule or analogue thereof has at least 80% identity with SEQ ID NO: 22, 23 or 25, and wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives.

[0323] 12. Oleic acid for use according to any one of items 1 to 11, wherein the oligonucleotide molecule or analogue thereof has at least 80% identity with SEQ ID NO: 22, 23 or 25, wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives, and wherein the oligonucleotide molecule is capable of increasing the endogenous level of MBNL1 and / or MBNL2 proteins.

[0324] 13. Oleic acid for use according to any one of items 1 to 12, wherein the oligonucleotide molecule or analogue thereof is composed of SEQ ID NO: 3, 4 or 7.

[0325] Sequence list (5' to 3' direction)

[0326] As stated above, the SEQ ID NOs listed below and mentioned throughout this application include nucleobase sequences, and for oligonucleotides that deviate from their native chemical properties, also include their chemical modifications and / or fatty acid conjugations. Throughout this specification, the following nomenclature is used to define the chemical modifications included in the SEQ ID NOs disclosed herein:

[0327] -LNA nucleotides are represented by combinations of uppercase and lowercase letters: Ab, Gb, Tb, Cb,

[0328] - Thiophosphate bonds are represented by the lowercase letter "s".

[0329] -2'-O-MOE RNA nucleotides are represented by combinations of uppercase and lowercase letters: Am, Cm, Gm, Tm.

[0330] -2'-O-methylnucleotides are represented by lowercase letters: a, g, c, u.

[0331] -2'-fluorinated RNA nucleotides are represented by combinations of uppercase and lowercase letters: Af, Cf, Gf, Tf.

[0332] -2'-O-methyl-2,6-diaminopurine modification is represented by expression (dap).

[0333] - Deoxynucleotides are represented by combinations of lowercase and uppercase letters: dA, dC, dG, dT.

[0334] -2'-OMe-5-methyluridine or 2'-OMe-ribothymidine is represented by the lowercase letter "t".

[0335] -5-methyl-2'-O-methylcytidine is represented by expression (5Mc).

[0336] - Expression (oleic acid) indicates that the oligonucleotide is conjugated with oleic acid.

[0337] - Expression (palmitic acid) indicates that the oligonucleotide is conjugated with palmitic acid.

[0338] The spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or their derivatives. Preferably, the spacer molecule is NHC6 or NHC3.

[0339] - "Y" indicates any pyrimidine (C or U / T)

[0340] - "I" indicates hypoxanthine because hypoxanthine is the nucleobase of inosine.

[0341] SEQ ID NO 1: Antagonist of human hsa-miR-218-5p: TTAGATCAAGCACAA

[0342] SEQ ID NO 2: Antagonist of human hsa-miR-23b-3p: ATCCCTGGCAATGTGA

[0343] SEQ ID NO 3: MD23b-2 V2 3' OI (X82108):

[0344] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(Oleic Acid)

[0345] SEQ ID NO 4: MD23b-2-PS / PO 3'OI:

[0346] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(NHC6)(Oleic Acid)

[0347] SEQ ID NO 5: MD23b-2-PS / PO 5'OI:

[0348] (Oleic acid)(NHC6)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb

[0349] SEQ ID NO: 6: MD23b-2-PS / PO:

[0350] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb

[0351] SEQ ID NO 7:218 MOE oleic acid 3':

[0352] TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(NHC6)(Oleic Acid)

[0353] SEQ ID NO: 8:

[0354] 218 MOE DD Oleic Acid 3': TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(NHC6)(Oleic Acid)

[0355] SEQ ID NO: 9:

[0356] 218 OME / MOE Oleic Acid 3': TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(Oleic Acid)

[0357] SEQ ID NO: 10: hsa-miR-218-5p: UUGUGCUUGAUCUAACCAUGU

[0358] SEQ ID NO: 11: hsa-miR-23b-3p: AUCACAUUGCCAGGGAUUACCAC

[0359] Seed region of SEQ ID NO: 12: hsa-miR-218-5p: UGUGCU

[0360] Seed region of SEQ ID NO: 13: hsa-miR-23b-3p: UCACAU

[0361] SEQ ID NO: 14:

[0362] 218 OME / MOE Oleic Acid 3'2: TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(Oleic Acid)

[0363] SEQ ID NO: 15:

[0364] 218 MOE:TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb

[0365] SEQ ID NO: 16:

[0366] MD23b-2 V2 3’Pal (X85204): AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(palmitic acid)

[0367] SEQ ID NO: 17: MD23b-2 V2: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb

[0368] SEQ ID NO: 18: MD23 MOE: AbsTbsCmsCmCmsTmsGmGmsCmAmAmsTbGmsTmGbsAb

[0369] SEQ ID NO: 19: microRNA precursor (pre-microRNA) of hsa-miR-23b-3p:

[0370] CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC

[0371] SEQ ID NO: 20: Pre-hsa-miR-218-5p-1(chr4:20529898-20530007):

[0372] GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA

[0373] SEQ ID NO: 21: Pre-miR-218-2(chr5:1681951SI-168195260):

[0374] GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA

[0375] SEQ ID NO 22: MD23b-2 V2 3' OI without specific spacer molecule:

[0376] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0377] SEQ ID NO 23: MD23b-2-PS / PO 3'OI without specific spacer molecules:

[0378] AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0379] SEQ ID NO 24: MD23b-2-PS / PO 5'OI without specific spacer molecules:

[0380] (Oleic acid) (spacer molecule)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb, wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0381] SEQ ID NO 25: 218 MOE oleic acid 3' without specific spacer molecules:

[0382] TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(spacer molecule) (oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0383] SEQ ID NO: 26: 218 MOEDD oleic acid 3' without specific spacer molecules:

[0384] TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(spacer molecule)(oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0385] SEQ ID NO: 27: 218 OME / MOE oleic acid 3' without specific spacer molecules:

[0386] TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb (spacer molecule) (oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0387] SEQ ID NO: 28: 218 OME / MOE oleic acid 3'2 without specific spacer molecules:

[0388] TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb (spacer molecule) (oleic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0389] SEQ ID NO: 29: MD23b-2 V2 3'Pal without specific spacer molecules:

[0390] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(spacer molecule)(palmitic acid), wherein the spacer molecule is preferably selected from NHC3, NHC5, NHC6, threonine, or derivatives thereof.

[0391] SEQ ID NO 49: MD23b-2 V2 3' OI containing C6SSC6 and NHC6

[0392] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC6)(oleic acid)

[0393] SEQ ID NO: 50: MD23b-2 V2 3' OI containing C6SSC6 and NHC3

[0394] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC3)(Oleic Acid)

[0395] SEQ ID NO 51: MD23b-2-PS / PO 5'OI without spacer molecules:

[0396] (Oleic acid)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb.

[0397] SEQ ID NO 52: Functional equivalent sequence against miR-23b-3p:

[0398] YTCCCTGGCAATGTGA

[0399] SEQ ID NO 53: Functional equivalent sequence against miR-23b-3p:

[0400] ATCCCTYGCAATGTGA

[0401] SEQ ID NO 54: Functional equivalent sequence against miR-23b-3p:

[0402] ATCCCTGYCAATGTGA

[0403] SEQ ID NO 55: Functional equivalent sequence against miR-23b-3p:

[0404] ATCCCTGGCYATGTGA

[0405] SEQ ID NO 56: Functional equivalent sequence against miR-23b-3p:

[0406] ATCCCTGGCAYTGTGA

[0407] SEQ ID NO 57: Functional equivalent sequence against miR-23b-3p:

[0408] ATCCCTGGCAATYTGA

[0409] SEQ ID NO 58: Functional equivalent sequence against miR-23b-3p:

[0410] ATCCCTGGCAATGTYA

[0411] SEQ ID NO 59: Functional equivalent sequence against miR-23b-3p:

[0412] ATCCCTGGCAATGTGY

[0413] SEQ ID NO 60: Functional equivalent sequence against miR-23b-3p:

[0414] GTCCCTGGCAATGTGA

[0415] SEQ ID NO 61: Functional equivalent sequence against miR-23b-3p:

[0416] ATUCCTGGCAATGTGA

[0417] SEQ ID NO 62: Functional equivalent sequence against miR-23b-3p:

[0418] ATCUCTGGCAATGTGA

[0419] The functional equivalent sequence of SEQ ID NO 63 against miR-23b-3p:

[0420] ATCCUTGGCAATGTGA

[0421] SEQ ID NO 64: Functional equivalent sequence against miR-23b-3p:

[0422] ATCCCTGGUAATGTGA

[0423] SEQ ID NO 65: Functional equivalent sequence against miR-23b-3p:

[0424] ATCCCTGGCGATGTGA

[0425] SEQ ID NO 66: Functional equivalent sequence against miR-23b-3p:

[0426] ATCCCTGGCAGTGTGA

[0427] SEQ ID NO 67: Functional equivalent sequence against miR-23b-3p:

[0428] ATCCCTGGCAATGTGG

[0429] SEQ ID NO 68: Functional equivalent sequence against miR-23b-3p:

[0430] ITCCCTGGCAATGTGA

[0431] SEQ ID NO 69: Functional equivalent sequence against miR-23b-3p:

[0432] ATCCCTGGCIATGTGA

[0433] SEQ ID NO 70: Functional equivalent sequence against miR-23b-3p:

[0434] ATCCCTGGCAITGTGA

[0435] SEQ ID NO 71: Functional equivalent sequence against miR-23b-3p:

[0436] ATCCCTGGCAATGTGI

[0437] SEQ ID NO 72: Functional equivalent sequence against miR-23b-3p:

[0438] AICCCTGGCAATGTGA

[0439] SEQ ID NO 73: Functional equivalent sequence against miR-23b-3p:

[0440] ATCCCIGGCAATGTGA

[0441] SEQ ID NO 74: Functional equivalent sequence against miR-23b-3p:

[0442] ATCCCTGGCAAIGTGA

[0443] SEQ ID NO 75: Functional equivalent sequence against miR-23b-3p:

[0444] ATCCCTGGCAATGIGA

[0445] SEQ ID NO 76: Functional equivalent sequence against miR-23b-3p:

[0446] ATCCCTIGCAATGTGA

[0447] SEQ ID NO 77: Functional equivalent sequence against miR-23b-3p:

[0448] ATCCCTGICAATGTGA

[0449] SEQ ID NO 78: Functional equivalent sequence against miR-23b-3p:

[0450] ATCCCTGGCAATITGA

[0451] SEQ ID NO 79: Functional equivalent sequence against miR-23b-3p:

[0452] ATCCCTGGCAATGTIA

[0453] SEQ ID NO 80: Functional equivalent sequence against miR-218-5p:

[0454] TTYGATCAAGCACAA

[0455] SEQ ID NO 81: Functional equivalent sequence against miR-218-5p:

[0456] TTAYATCAAGCACAA

[0457] SEQ ID NO 82: Functional equivalent sequence against miR-218-5p:

[0458] TTAGYTCAAGCACAA

[0459] SEQ ID NO 83: Functional equivalent sequence against miR-218-5p:

[0460] TTAGATCYAGCACAA

[0461] SEQ ID NO 84: Functional equivalent sequence against miR-218-5p:

[0462] TTAGATCAYGCACAA

[0463] SEQ ID NO 85: Functional equivalent sequence against miR-218-5p:

[0464] TTAGATCAAYCACAA

[0465] SEQ ID NO 86: Functional equivalent sequence against miR-218-5p:

[0466] TTAGATCAAGCYCAA

[0467] SEQ ID NO 87: Functional equivalent sequence against miR-218-5p:

[0468] TTAGATCAAGCACYA

[0469] SEQ ID NO 88: Functional equivalent sequence against miR-218-5p:

[0470] TTAGATCAAGCACAY

[0471] SEQ ID NO 89: Functional equivalent sequence against miR-218-5p:

[0472] TTGGATCAAGCACAA

[0473] SEQ ID NO 90: Functional equivalent sequence against miR-218-5p:

[0474] TTAGGTCAAGCACAA

[0475] SEQ ID NO 91: Functional equivalent sequence against miR-218-5p:

[0476] TTAGATUAAGCACAA

[0477] SEQ ID NO 92: Functional equivalent sequence against miR-218-5p:

[0478] TTAGATCGAGCACAA

[0479] SEQ ID NO 93: Functional equivalent sequence against miR-218-5p:

[0480] TTAGATCAGGCACAA

[0481] SEQ ID NO 94: Functional equivalent sequence against miR-218-5p:

[0482] TTAGATCAAGUACAA

[0483] SEQ ID NO 95: Functional equivalent sequence against miR-218-5p:

[0484] TTAGATCAAGCGCAA

[0485] SEQ ID NO 96: Functional equivalent sequence against miR-218-5p:

[0486] TTAGATCAAGCAUAA

[0487] SEQ ID NO 97: Functional equivalent sequence against miR-218-5p:

[0488] TTAGATCAAGCACGA

[0489] SEQ ID NO 98: Functional equivalent sequence against miR-218-5p:

[0490] TTAGATCAAGCACAG

[0491] SEQ ID NO 99: Functional equivalent sequence against miR-218-5p:

[0492] TTIGATCAAGCACAA

[0493] SEQ ID NO 100: Functional equivalent sequence against miR-218-5p:

[0494] TTAGITCAAGCACAA

[0495] SEQ ID NO 101: Functional equivalent sequence against miR-218-5p:

[0496] TTAGATCIAGCACAA

[0497] SEQ ID NO 102: Functional equivalent sequence against miR-218-5p:

[0498] TTAGATCAIGCACAA

[0499] SEQ ID NO 103: Functional equivalent sequence against miR-218-5p:

[0500] TTAGATCAAGCICAA

[0501] SEQ ID NO 104: Functional equivalent sequence against miR-218-5p:

[0502] TTAGATCAAGCACIA

[0503] SEQ ID NO 105: Functional equivalent sequence against miR-218-5p:

[0504] TTAGATCAAGCACAI

[0505] SEQ ID NO 106: Functional equivalent sequence against miR-218-5p:

[0506] ITAGATCAAGCACAA

[0507] SEQ ID NO 107: Functional equivalent sequence against miR-218-5p:

[0508] TIAGATCAAGCACAA

[0509] SEQ ID NO 108: Functional equivalent sequence against miR-218-5p:

[0510] TTAGAICAAGCACAA

[0511] SEQ ID NO 109: Functional equivalent sequence against miR-218-5p:

[0512] TTAIATCAAGCACAA

[0513] SEQ ID NO 110: Functional equivalent sequence against miR-218-5p:

[0514] TTAGATCAAICACAA

[0515] SEQ ID NO 111: TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digooctyl NHS ester

[0516] SEQ ID NO 161: MD23b-2 V2 (X82102):

[0517] AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NH2C6).

[0518] The following examples are merely illustrative of the invention.

[0519] Example

[0520] Materials and methods

[0521] Cell culture experiment

[0522] Immortalized MyoD-induced (doxycycline) DM1 and control fibroblasts (Arandel L. et al. (2017). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4): 487-497) were grown in DMEM containing 4.5 g / L glucose, 1% P / S and 10% FBS (Sigma, St. Louis, Missouri). Fibroblast transdifferentiation into myotubes was based on (Cerro-Herreros et al. (2018). "miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models". Nat. Commun. 9, 2482).Transdifferentiation was induced on day 0, and different concentrations of the test compounds (for MD23b-2, MD23b-8, MD23b-4, MD23b-13, MD23b-7, MD23b-14, MD-23b-1, 23-LNA4, MD23b-10, MD23b-3, anti-miR-23b, MD23b-6, MD23b-12, MD23b-) were added to the cell culture medium. 9. MD23b-5, MD23b-11, 23-LNA6, Unconjugated -23b, 5'-23b-oleic acid, 5'-23b-linoleic acid, 5'-23b-MeToc, 5'-23b-MeChol, 5'-23b-MePal, 5'-23b-transoleic acid, 5'-23b-stearic acid, OL-MD23b-2, MD23b-2-PS / PO, MD23b-2- PS / PO 5'Ol, unconjugated-218, Ax-218, 5'-218-oleic acid, 5'-218-MeChol, 5'-218-linoleic acid, 5'-218-MePal, 5'-218-MeToc, Sc-oleic acid, MD218-12, MD218-6, MD218-11, unconjugated-218, MD218-13, MD218-5, MD218-4, MD218-15, MD218-10, MD218-3: 10 nM, 50 nM, 200 nM, 1 µM and 5 µM; for 23-LNA8, AX-23b, MD23b-2 V2 3'Ol, MD23b-2 V2 3'Ol(C6SSC6)(NHC6), MD23b-2 V2 Cells were transfected with lipids using X-tremeGENE™ HP (Roche, Basel, Switzerland) at 3'Ol(C6SSC6)(NHC3) and MD23b-2 V2 at 3'Ol(threonine): 2 nM, 10 nM, 50 nM, 200 nM, and 1 µM; 23-D / LNA1, 23-D / LNA2, and 218-2F / LNA1: 0.4 nM, 2 nM, 10 nM, 50 nM, and 200 nM; and for 218-D / LNA2, 218-2F / MOE: 0.08 nM, 0.4 nM, 2 nM, 10 nM, and 50 nM, and replaced with fresh differentiation medium after 4 hours. On day 4, cells were collected from differentiation medium and subjected to protein extraction.

[0523] Cell proliferation assay

[0524] As mentioned earlier, with 10 5Cells seeded at 100 cells / ml in 96-well plates were transfected with anti-miR after 24 hours; after 96 hours, cell proliferation was measured using the CellTiter 96® aqueous non-radioactive cell proliferation assay (Promega, Madison, Wisconsin). TC50 was calculated using nonlinear least squares regression, and absorbance levels were measured using an Infinite M200 PRO plate reader (Tecan, Mennedorf, Switzerland).

[0525] Quantitative dot blot (QDB) assay

[0526] For the activity assay, cells were packed at 8 x 10⁸ cells per well. 4Cells were seeded at a density of 1,000 cells per well in 6-well plates and transfected with anti-miR after 24 hours, as previously described. For total protein extraction, human muscle cells were sonicated while mouse muscle (gastrocnemius and quadriceps) was homogenized in Pierce® RIPA buffer (Thermo Fisher Scientific, Waltham, MA) supplemented with a cocktail of protease and phosphatase inhibitors (Roche Applied Sciences, Penzberg, Germany). Total protein was quantified using the Pierce® BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA) using bovine serum albumin as a standard. For immunoassay, 1 μg / well of cell sample and 2 μg / well of mouse sample were denatured (100°C, 5 min) and loaded onto QDB plates (Quanticision Diagnostics Inc, Research Triangle Park, NATO). Each cell sample was quadrupled and loaded onto two different plates; one for detecting MBNL1 and the other for detecting GAPDH, which served as an endogenous control. In the case of mouse samples, each sample was quadrupled and loaded onto three different plates: one for detecting MBNL1, one for detecting tubulin (serving as an endogenous control), and one for detecting anti-mouse IgG secondary antibody (serving as a negative control to subtract background). For the QDB protocol, protein was prepared at 2 μg / well. Each sample was quadrupled and loaded onto two different plates, one for detecting MBNL1 and the other for detecting GAPDH (serving as an endogenous control). To prepare a sample mixture (enough for 10 samples to account for pipetting error), the protein extract was placed at the specified concentration, 10.4 µl of loading buffer 4X was added, and finally 50 µl of ddH2O was added. After sample preparation, the samples were boiled in water for 5 minutes to denature the proteins, and then placed on ice. To load the samples, the QDB plate (Quanticision Diagnostics, Inc.) was inverted. Place 5 μl of the previously prepared protein mixture onto each membrane loop. Allow the loaded QDB plate to dry completely at room temperature in a well-ventilated area for 30 minutes. After drying, immerse the QDB plate in transfer buffer (0.039 M glycine, 0.048 M Tris, 0.37% SDS, 20% methanol) and gently shake for 1 minute. Wash the plate three times with TBST (137 mM NaCl, 2.7 mM KCl, 20 mM Tris, pH 7.4, plus 0.1% Tween-20) and shield it in a container with blocking buffer (TBST with 5% skim milk added).Incubate the plate overnight at 4°C with mouse anti-MBNL1 (1:1000, ab77017, Abcam) or mouse anti-GAPDH (1:500, clone G-9, Santa Cruz) primary antibody in 96-well plates. Wash the plate three times with TBST and incubate for 2 hours with anti-mouse POD secondary antibody (1:200, Sigma-Aldrich), then wash the plate three more times with TBST. Insert the plate into a 96-well plate containing 100 μL / well ECL substrate (Pierce) solution for 1 minute, then insert it into a white 96-well plate. Quantify the chemiluminescent signal using a TecanInfiniti 200 pro microplate reader by selecting the "Lid Plate" option in the user interface.

[0527] The plates were incubated overnight at 4°C with mouse anti-MBNL1 (1:200, MB1a(4A8) (DSHB, Iowa, WA) and rabbit anti-α-tubulin (1:1000, PA5-16891, Thermo Fisher Scientific) primary antibodies. The primary antibodies were detected using goat horseradish peroxidase (HRP) conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies (1:3500, Sigma-Aldrich, St. Louis, Missouri), respectively. Immunological responses were detected using Pierce™ ECL Western blotting reagent (Thermo Fisher Scientific, Waltham, MA), and luminescence was obtained using an Infinite M200 PRO plate reader (Tecan, Mennedorf, Switzerland).

[0528] RNA extraction, reverse transcription PCR (RT-PCR), and real-time quantitative reverse transcription PCR (qRT-PCR)

[0529] Total RNA was isolated from mouse gastrocnemius and quadriceps muscles using the miRNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One microgram of RNA was digested with DNase I (Invitrogen, Carlsbad, California) and reverse transcribed using random hexanucleotides with SuperScript II (Invitrogen, Carlsbad, California). For subsequent PCR reactions, 20 ng of cDNA was used with GoTaq polymerase (Promega, Madison, Wisconsin). Alternative splicing of Atp2a1, Nfix, Mbnl1, and Clcn1 in mouse samples (both muscle types) was analyzed using specific primers. An endogenous reference level for Gapdh was established using 0.2 ng of cDNA. PCR products were separated on 2% agarose gels and quantified using ImageJ software (NIH, North Bethesda, Maryland). The percentage of splice recovery index (PSR) was defined as %. SI Value minus X̄% DSIThen divide by (X̄%) DSI Subtract X% HIS (SI: Splice inclusion rate for each sample; DSI: Splice inclusion rate under disease; HSI: Splice inclusion rate under healthy conditions; in all cases, splicing refers to the inclusion of a specified selective exon). This ratio was calculated for ATP2A1, NFIX, MBNL1, and CLCN1. The primer sequences and exons analyzed can be obtained and reproduced below in (Cerro-Herreros et al. 2018 2018 Jun 26;9(1):2482. doi: 10.1038 / s41467-018-04892-4.):

[0530] SEQ ID NO: 30: Gapdh Fwd: ATCAACGGGAAGCCCATCAC

[0531] SEQ ID NO: 31: Gapdh Rv: CTTCCACAATGCCAAAGTTGT

[0532] SEQ ID NO: 32: Atp2a Fwd: GCTCATGGTCCTCAAGATCTCAC

[0533] SEQ ID NO: 33: Atp2a Rv: GGGTCAGTGCCTCAGCTTTG

[0534] SEQ ID NO: 34: Clcn1 Fwd: GTCCTCAGCAAGTTTATGTCC

[0535] SEQ ID NO: 35: Clcn1 Rv: GAATCCTCGCCAGTAATTCC

[0536] SEQ ID NO: 36: Nfix Fwd: TCGACGACAGTGAGATGGAG

[0537] SEQ ID NO: 37: Nfix Rv: CAAACTCCTTCAGCGAGTCC

[0538] SEQ ID NO: 38: Mbnl1 ex5 F:

[0539] AGGGGAGATGCTCTCGGGAAAAGTG

[0540] SEQ ID NO: 39: Mbnl1 ex5 R:

[0541] GTTGGCTAGAGCCTGTTGGTATTGGAAAATAC

[0542] Multiplex qRT-PCR was performed using 1 ng of mouse tissue cDNA as a template and QuantiFast Probe PCR Kit reagents. Commercial TaqMan probes (Qiagen, Hilden, Germany) were used for mouse genes (MBNL1 and MBNL2; FAM-labeled probes) and reference genes (GAPDH, MAX-labeled probes). Results were normalized based on Gapdh endogenous gene expression. Primers used are as follows:

[0543] SEQ ID NO: 40: Probe Mbnl1: / 56-FAM / TCGCAAATCAGCTGTGAGGAGATTCCCT / 3IAbRQSp /

[0544] SEQ ID NO: 41: Mbnl1 F: TACCGATTGCACCACCAAAC

[0545] SEQ ID NO: 42: Mbnl1 R: GCTGCTTCAGCAAAGTTGTC

[0546] SEQ ID NO: 43: Mbnl2 probe: / 56-FAM / CCCGGCAGACAGCACCATGATCGA / 3IAbRQSp /

[0547] SEQ ID NO: 44: Mbnl2 F: GAGACAGACTGCCCTTTG

[0548] SEQ ID NO: 45: Mbnl2 R: GGTTACGGTGTTGTTCGTTTGT

[0549] SEQ ID NO: 46: Gapdh probe: / 5MAXN / -CGCCTGGTCACCAGGGCTGCT- / 3BHQ_1 /

[0550] SEQ ID NO: 47: Gapdh_F: CAACGGATTTGGTCGTATTGG

[0551] SEQ ID NO: 48: Gapdh _R: TGATGGCAACAAATATCCACTTTACC

[0552] According to the manufacturer's instructions, miRNA expression in muscle tissue was quantified using specific miRCURY™-locked nucleic acid microRNA PCR primers (Qiagen, Hilden, Germany). Relative gene expression was normalized based on U1 (YP00203909) and U6 (YP00203907) snRNAs.

[0553] Expression levels were measured using a QuantStudio 5 real-time PCR system (Applied Biosystems, Foster City, California). 2 −ΔΔCt Methods: Expression relative to endogenous genes and control groups was calculated. Two-tailed t-tests (α = 0.05) were used to compare sample pairs, with Welch correction applied where necessary. Statistical differences were estimated using Student's t-tests on normalized data (p < 0.05).

[0554] Animal experiments and administration of oligonucleotides

[0555] Mouse handling and experimental procedures followed European law on the care and experimentation of laboratory animals (2003 / 65 / CE) and were approved by the Valencia Agricultural Council. Homozygous transgenic HSALR (line 20b) mice (Mankodi et al. 2000 Science: 289(5485):1769-73. doi: 10.1126 / science.289.5485.1769) were provided by Professor C. Thornton (University of Rochester Medical Center, Rochester, NY, USA). Experimental groups consisted of FVB as a normal control and HSALR treated with PBS as a negative control, as well as HSALR mice treated with all experimental oligonucleotides. Sample size was 4 mice per treatment group, 12 mice in the PBS group, and 18 mice in the FVB group. All groups were administered a single dose of 3 mg / kg intravenously (tail vein) 150 µl of 1×PBS (solvent) or a specific oligonucleotide (see [link to relevant documentation]). Figure 2-5 Four days after injection, the mice were sacrificed, and the tissues of interest were frozen in liquid nitrogen for molecular assays.

[0556] Electromyography study

[0557] As previously described, electromyography was performed under general anesthesia before treatment and at the time of animal euthanasia (Kanadia et al. 2006 Proc Natl Acad Sci USA. 2006 Aug 1;103(31):11748-53. doi: 10.1073 / pnas.0604970103). To eliminate bias, the measurements were performed blinded. Five needle pricks were made in each quadriceps femoris muscle of both hind limbs, and myotonic discharges were graded on a five-point scale: 0, no myotonic discharge; 1, ≤50% of needle pricks resulted in occasional myotonic discharges; 2, >50% of needle pricks resulted in myotonic discharges; 3, almost all needle pricks resulted in myotonic discharges; and 4, all needle pricks resulted in myotonic discharges.

[0558] Forelimb grip strength test

[0559] Forelimb gripping force was measured using a gripping force meter (BIO-GS3; Bioseb, Pinellas Park, Florida). Peak pull force (in grams) was recorded on a digital force sensor when the mouse gripped the stick. After each measurement, the force sensor reading was reset to 0 g. Tension was recorded by the reading when the mouse released its forepaw from the stick. We performed three consecutive measurements at 30-second intervals. Body weight measurements were performed in parallel. The final value was obtained by dividing the average gripping force by the body weight of each mouse. Body weight measurements were performed in parallel, and the experiment was conducted with coded animals to eliminate experimental bias.

[0560] radar chart

[0561] The obtained value is represented as the Recovery Index (RI), which measures the HSA after treatment. LR How closely the different parameter values ​​obtained in mice were similar to those in the FVB control group? The Individual Reference Indicators (RIs) for each mouse after treatment (Mbnl1 protein, Mbnl1 / 2 expression level, splicing recovery, Mbnl1 ex5 inclusion recovery, and functional recovery) were obtained. The RI was calculated using the following formula: %MT value minus X% MNT, then divided by (X% MH minus X% MNT), where MT is the value of each treated mouse (PBS or oligonucleotide), and MNT is the HSA value obtained from PBS treatment. LR The values ​​for mice are PBS (Physical Substances Per Scale) and MH (Functional Body Scale) for healthy mice. These values ​​range from 0 to 1, where 0 represents untreated mice (HSA). LR 1 was a healthy mouse (FVB) and 1 was a PBS (-PBS).

[0562] Mbnl1 protein refers to the average value obtained from quantitative dot blots of two muscles (quadriceps and gastrocnemius) in each treatment group.

[0563] The Mbnl1 / 2 expression level refers to the average mRNA values ​​of genes Mbnl1 and Mbnl2 obtained by real-time PCR in two muscles (quadriceps and gastrocnemius), as well as the average value of each treatment group using the aforementioned formula.

[0564] Splice recovery refers to the average percentage of Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in the two types of muscles treated in each group.

[0565] Mbnl1 ex5 inclusion recovery refers to the percentage of Mbnl1 exon 5 inclusion in the two types of muscles treated in each group.

[0566] Functional recovery refers to the average force / body weight value obtained by each mouse after treatment and the grade of myotonic discharge in each treatment group. Forelimb grip strength test is used to obtain force, and electromyography is used to obtain the grade of myotonic discharge.

[0567] Example 1

[0568] We have previously shown that inhibition of miR-23b-3p or miR-218-5p can be used to treat myotonic dystrophy by using commercially available anti-miRs with miR antagonist structures targeting miR-23b-3p (Ax-23b) or miR-218-5p (Ax-218) (Cerro-Herreros et al. 2018 Nat. Commun. 26;9(1):2482. doi: 10.1038 / s41467-018-04892-4.). Transfection of human DM1 cells with these antagonists and injection into a mouse model of the disease resulted in downregulation of the expression of the target miRNAs, accompanied by upregulation of MBNL1 (its direct target). The antagonists used were long (22 nt), contained almost the entire complementary sequence of the miRNA, and each consisted of 2 OME nucleotides. They carry phosphate-thioester bonds between the nucleotides at the 3' and 5' ends to enhance the stability of the nucleotide moiety of the molecule, and bind to cholesterol as a carrier at the 3' end to enhance drug metabolism and internalization. To find the most effective and safest carriers, we bound the polynucleotide moiety of Ax-23b (sequence name: unconjugated-23b in Table 1) to different lipid carriers at the 3' or 5' end of the molecule, including sterol cholesterol and tocopherol; and fatty acids palmitoyl acid, stearic acid, transoleic acid, linoleic acid, and oleic acid (list of molecules in Table 1). We screened human DM1 cells transfected with these conjugated antagonists (Arandel L. et al. (2017). Dis Model Mech 10(4): 487-497.). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." DisModel Mech 10(4): 487-497.) to investigate their effects on toxicity (cell viability studies) and MBNL1 protein levels.

[0569] Each of these molecules was transfected into DM1 human myotubes at a series of five different concentrations, and cell viability percentage and MBNL1 protein levels were quantified. We ranked them according to the anti-miR therapeutic index (TI), defined as follows:

[0570] TI = (TC50 / EC50) * Emax

[0571] in:

[0572] TC50 is a compound that reduces cell viability to 50% of its simulated concentration.

[0573] EC50 is the concentration at which a compound produces 50% of its maximum efficiency (Emax).

[0574] Emax is the maximum fold change in MBNL1 protein obtained after transfection with a specific anti-miR, compared to a simulation (transfection with solvent).

[0575] From these experiments, we conclude that:

[0576] - The conjugation with oleic acid (a cis-monounsaturated fatty acid with 18 carbon atoms) is the conjugation that produces the highest T index (see Table 1). Toxicity and efficacy (MBNL1 protein level) curves for molecules named "unconjugated-23b" and "5-23 β-oleic acid" are shown in the figure. Figure 1 C and Figure 1 In section B, direct comparisons are used. Importantly, the low T-index of the scrambled oligonucleotide conjugated with oleic acid (“Sc-oleic acid”) indicates that oleic acid itself has no effect on the T-index.

[0577] Linoleic acid (a cis-polyunsaturated fatty acid with 18 carbon atoms) was the second most effective carrier. Surprisingly, the T-index results obtained with trans-oleic acid (the trans isomer of oleic acid), palmitic acid (a saturated non-esterified fatty acid with 16 carbon atoms), and stearic acid (a saturated fatty acid with an 18-carbon chain) were significantly lower. Therefore, our data suggest that cis-unsaturated fatty acids are better carriers for anti-miR in our DM1 cells.

[0578] Cholesterol was the only carrier we tested that was conjugated at two different locations (3' and 5'). Based on our data, the 3' conjugation appears to be more effective than the 5' conjugation. Using cholesterol derivatives such as tocopherol did not improve the T index.

[0579] We performed the same experiments, conjugating the nucleotide moiety of Ax-218 (sequence name: unconjugated-218 in Table 1) to different lipid carriers (Table 1). Of all the fatty acids tested, oleic acid was identified as the best carrier, with cholesterol at the 3' end being more effective than at the 5' end. However, it is noteworthy that cholesterol was associated with toxicity in mouse liver, even though the liver changes could become reversible after the recovery period (see the Cholesterol Registry of ECHA, April 4, 2017, available at https: / / echa.europa.eu / es / registration-dossier / - / registered-dossier / 11031 / 7 / 6 / 1#). However, since the therapeutic dosing of oligonucleotides is designed for long-term treatment, cholesterol as a linker can increase the risk of liver toxicity. Conversely, oleic acid has good safety properties and has been used as a food additive that is beneficial to human health (see the FDA's response to the petition for a health claim regarding oleic acid, November 19, 2018, available at https: / / www.fda.gov / food / cfsan-constituent-updates / fda-completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease).

[0580] Once we found a suitable vector, our next step was to optimize the sequence and chemical modifications contained in the anti-miR molecule to conjugate with the vector. Therefore, we also performed the same in vitro screening to find the most effective sequences and chemical modifications to enhance the T-index of unconjugated (non-conjugated) anti-miR in DM1 cells. We generated a group of different single-stranded molecules (between 16 and 22 nucleotides in length) that were complementary to different portions of human miR-23b-3p or miR-218-5p. The molecules included in this screening carried different chemical modifications, including LNA, 2'OME, and 2'OME oligonucleotides, and all linkages between nucleotides were phosphate thioesters (PS) (list of molecules tested in Tables 2 and 3).

[0581] The molecule with the best T-index score against miR-23b-3p was MD23b-2, while 218-D / LNA2 was the best-scoring molecule among those designed to inhibit miR-218-5p (see Tables 2 and 3). Importantly, MD23b-2 had a significantly higher effect on MBNL1 levels (Emax) and the T-index compared to 218-D / LNA2. The toxicity and efficacy (MBNL1 protein levels) curves for these molecules are shown in... Figure 1A and Figure 1 D.

[0582] Next, we tested the effect of oleic acid conjugation on the optimal-scoring anti-miR sequence MD23b-2 (Table 4). Surprisingly, the conjugated molecule (Ol-MD23b-2) exhibited a reduced T-index compared to MD23b-2. On the other hand, we observed that conjugation of oleic acid with oligonucleotides containing a PS / PO mixture increased their T-index (Table 4). This data confirms that the role of oleic acid in the T-index is surprisingly significant in mixed PS / PO oligonucleotides.

[0583] Table 1

[0584]

[0585] Note: (Pro)(Chol) represents hydroxyproline C5-alkyl cholesterol. (Teg)(Chol) represents 15-atom triethylene glycol cholesterol, depending on the spacer molecule used.

[0586] Table 2

[0587]

[0588] Table 3

[0589]

[0590] Table 4

[0591]

[0592] Example 2

[0593] Next, we selected the best-performing oligonucleotides targeting miR-23b-3p (MD23b-2) and miR-218-5p (218-D / LNA2) in vitro, and modified these molecules to improve their ADMET (absorption, distribution, metabolism, excretion, and toxicity) properties in order to evaluate their performance in DM1 (HSA2). LR The in vivo therapeutic potential in mouse models. The rationale for the modification is as follows:

[0594] (1) Cytosine methylation is a well-known method to suppress immune system activation through in vivo treatment with antisense oligonucleotides (Joseph J. Senn et al., Non-CpG-Containing Antisense 2′-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88. Journal of Pharmacology and Experimental Therapeutics September 1, 2005, 314 (3) 972-979; DOI: https: / / doi.org / 10.1124 / jpet.105.084004).

[0595] (2) It is known that chemically modified nucleotides of the LNA and 2' MOE types are more stable than standard RNA, DNA or 2' OME modified oligonucleotides (W. Brad Wan and Punit P. Seth. 2016. The Medicinal Chemistry of Therapeutic Oligonucleotides).

[0596] (3) In all molecules tested in vitro, the phosphodiester (PO) bonds between nucleotides were replaced with phosphate thioester (PS) bonds to increase their stability and potency. Fully modified PS oligonucleotides are widely used in in vitro studies. However, previous reports have indicated some in vivo toxicities associated with an excess of PS bonds in a single molecule (e.g., Smith and Zain. 2019. Therapeutic oligonucleotides: State of the Art. Annual Review of Pharmacology and Toxicology, and Hu et al., 2020. Therapeutic siRNA: state of the art. Signaltransduction and targeted therapy) and mixed oligonucleotides PS / PO have been shown to be more stable in vivo (Zhang et al., In vivo stability, disposition and metabolism of a “hybrid” oligonucleotide phosphorothioate in rats. Biochemical Pharmacology. Volume 50, Issue 4, 1995, Pages 545-556, ISSN 0006-2952, https: / / doi.org / 10.1016 / 0006-2952(95)00159-W). Therefore, in order to design antisense oligonucleotides that can be tested in in vivo models, we decided to reduce the amount of PS bonds in subsequent in vivo studies.

[0597] Taking these three criteria into account, we generated four antisense oligonucleotides:

[0598] -MD23b-2 PS / PO retains the same chemical modifications found in MD23b-2, but with a lower PS content and all cytosine is methylated.

[0599] -MD23b-2 V2 has the same sequence as MD23b-2, but it has some OME modifications at 2' replaced by MOE, lower PS content, and all cytosine is methylated.

[0600] -218 MOE, with the sequence 218-D / LNA2, has all its natural DNA nucleotides replaced by 2'MOE, all cytosines are methylated, and PS content is lower.

[0601] -218 OME / MOE, with the sequence 218-D / LNA2, has all its natural DNA nucleotides replaced by 2'MOE or 2'MOE, all cytosines are methylated, and the PS content is lower.

[0602] The molecules used were both unconjugated (except for 218 OME / mol) and conjugated with oleic acid in order to evaluate their performance in HSA. LR Therapeutic potential in mice (DM1 model, see Mankodi, A., et al. (2000). "Myotonicdystrophy in transgenic mice expressing an expanded CUG repeat." Science 289(5485): 1769-1773.). Specifically, unconjugated MD23b-2 PS / PO, MD23b-2 PS / PO conjugated to oleic acid at the 3' end (MD23b 2 PS / PO 3'Ol), and MD23b-2 PS / PO conjugated to oleic acid at the 5' end (MD23b-2PS / PO 5'Ol) were used to assess the effect of oleic acid conjugation site on therapeutic efficacy. Unconjugated MD23b-2 V2, MD23b-2 V2 conjugated to oleic acid at the 3' end (MD23b-2 V2 3'Ol), and MD23b-2 V2 conjugated to palmitic acid at the 3' end (MD23b-2 V2 3'Palm) were used to demonstrate whether conjugation with oleic acid produced a stronger anti-miR effect than conjugation with palmitic acid, and these were also evaluated in vivo. Both anti-miRs targeting miR-218-5p are conjugated to oleic acid at the 3' end.

[0603] All these molecules were administered intravenously at a concentration of 3 mg / kg to HSA infants aged 3-5 months. LR In the tail vein of mice. The strength and muscle rigidity of these mice were assessed before injection and before sacrifice 5 days after a single injection. Figure 2 The results show the results of grip strength (A) and myotonia (B) levels measured relative to body weight before mouse sacrifice. In all mice treated with anti-miR, grip strength was increased compared to mice injected with PBS, but this difference was statistically significant only in certain anti-miRs. Similarly, myotonia was reduced in anti-miR treated mice. The most significant reduction in myotonia was achieved by the molecules MD23b-2 V2 3'Ol and 218 MOE oleic acid 3'. For both molecules, the oleic acid-conjugated molecule produced a stronger rescue effect than the unconjugated version, and the effect was even stronger when 3' conjugated.

[0604] Example 3

[0605] At the time of sacrifice, the quadriceps femoris and gastrocnemius muscles of the hind limbs of the mice were dissected and processed to extract proteins and RNA. The extracted RNA was reverse transcribed and then subjected to qPCR, and miR-23b-3p was detected using a specific probe. Figure 3 A) or miR-218-5p Figure 3 (b) shows that all anti-miRs effectively reduced the levels of their corresponding miRNAs. Importantly, unconjugated versions of anti-miRs were generally less effective than conjugated versions. Among anti-miRs targeting miR-218-5p, the 218 MOE was the least effective.

[0606] Example 4

[0607] qRT-PCR is used to quantify Mbnl1 ( Figure 4 A) and Mbnl2 ( Figure 4 B) Expression levels of transcripts in the quadriceps femoris and gastrocnemius muscles; total protein extracted from these muscles was detected by quantitative dot blot analysis for protein Mbnl1. Figure 4 C). Although there were minor differences between anti-miR-23b-3p and anti-miR-218-5p at the Mbnl1 transcript level, the miR-23b-3b anti-miR had a stronger effect on the Mbnl protein. Importantly, we observed no difference in placing the oleic acid carrier at the 3' or 5' position in the MD23b-2 PS / PO molecule, and in the case of the MD23b-2 V2 molecule, the unconjugated version was significantly less effective than the conjugated version with oleic acid or palmitoyl acid, with oleic acid having a stronger effect, particularly at the Mbnl2 transcript and Mbnl1 protein levels.

[0608] Example 5

[0609] Total RNA was also used to analyze splicing errors in transcripts regulated by the Mbnl1 protein, such as exon 22 of Atp2a1, exon 7 of Nfix, exon 5 of Mbnl1, and exon 7a of the chloride channel (Clcn1). Figure 5 and Figure 6 ).

[0610] In HSA LR In mice, Nfix, Clcn1, Atp2a1 and Mbnl1 transcripts showed abnormally increased inclusion of exons 7, 7a, 22 and 5, respectively, but their content in muscle recovered to 30% to 50% of normal after treatment with 3 mg / kg MD23-b V2 3'Ol and other similar molecules.

[0611] Example 6

[0612] To analyze all DM1-related functional and molecular phenotypes measured in model mice, we generated a spider diagram ( Figure 7 The recovery index (RIm) for each individual mouse was calculated using the following formula, based on different parameters (Mbnl1 protein, Mbnl1 / 2 expression level, splicing recovery, Mbnl1 ex5 inclusion recovery, and functional recovery) after treatment:

[0613]

[0614] Wherein value MT This is the individual value for each treated mouse (injected with PBS or oligonucleotides). MNT This is the average value of untreated diseased mice (injected with PBS), and MH This is the average value from the healthy mouse group (FVB). Next, the individual RI values ​​(RIm) are averaged to generate... Figure 7 The global RI value is shown.

[0615] These values ​​range from 0 to 1, where 0 represents untreated mice (HSA). LR PBS), and 1 is a healthy mouse (FVB). Mbnl1 protein refers to the average value obtained by quantitative dot blot analysis of the two muscles (quadriceps and gastrocnemius) in each treatment group. Mbnl1 / 2 expression level refers to the average value obtained by real-time PCR of the muscles (quadriceps and gastrocnemius) and genes (Mbnl1 and Mbnl2) in each treatment group using the aforementioned formula. Splice recovery refers to the average percentage of inclusion of Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in the two muscles in each treatment group. Mbnl1 ex5 inclusion recovery refers to the percentage of inclusion of Mbnl1 exon 5 in the two muscles in each treatment group. Functional recovery refers to the average force / body weight gain value obtained by each mouse after treatment and the myotonic discharge grade of each treatment group.

[0616] These diagrams are in Figure 7As shown in Tables 5 and 6, MD23b-2 V2 3'Ol was the antimiR molecule that produced the strongest rescue across all studied phenotypes. Notably, the difference in potency when the same antimiR sequence was unconjugated or conjugated with palmitic acid supports our surprising results in in vitro studies and confirms that the molecule has a significantly stronger therapeutic effect when conjugated with oleic acid. The second best performing molecule was MD23b-2 PS / PO 3'Ol, slightly better than MD23b-2 PS / PO 5'Ol. These data also support the results obtained from in vitro conjugation of cholesterol, confirming the benefit of conjugating the vector at the 3' position. As observed in vitro, antimiR targeting miR-218-5p produced a lower phenotypic rescue. The data support inhibition of miR-23b-3p ( Figure 7 B and Table 5) compared to inhibiting miR-218-5p ( Figure 7 B and Table 6) have stronger therapeutic effects. In the case of molecule 218MOE ( Figure 7 B) The conjugation with oleic acid also enhances its in vivo activity. Therefore, it is confirmed that the effect of oleic acid conjugation on in vivo therapeutic efficacy is not limited to specific nitrogenous base sequences, but has a wider range of applications.

[0617] Table 5

[0618]

[0619] Table 6

[0620]

[0621] Example 7

[0622] In all the anti-miR tests, we consistently used amino-containing spacer molecules to form an amide bond between oleic acid and the oligonucleotide, thus conjugating oleic acid at either the 3' or 5' end. The first type of spacer molecule was a 6-aminohexyl group introduced at both the 3' and 5' ends (NHC6 spacer molecule). Next, we tested other types of spacer molecules (NHC6, NHC3, or threonine) and spacers of different sizes (3 or 6 carbon atoms) added between the oligomeric sequence MD23b-2 V2 and oleic acid. Figure 8 Whether the conjugated molecules can improve the effect on MBNL1 protein levels. We observed all the anti-miRs generated (Tables 7, 8, and 9). Figure 9 Of the four molecules (a total of four), all were able to upregulate the MBNL1 protein. Notably, the threonol-conjugated molecule was the most active, as it achieved an EC50 at the lowest concentration, but the six-carbon spacer molecule (NHC6) exhibited the strongest upregulation of the protein. This data suggests that modification of the spacer molecule can also modulate the antimiR efficacy and pharmacodynamics of the conjugated oleic acid of this invention.

[0623] Table 7

[0624]

[0625] Table 8

[0626]

[0627] Example 8

[0628] Although methods for synthesizing oligonucleotides are well known in the art, we hereby provide an example of synthesizing MD23b-2V2 3'Ol, a 16 nt long oligonucleotide composed of LNA, 2'-O-MOE, and 2'-O-Me modified nucleotides linked by phosphodiester bonds or thiophosphate bonds. Its 3' end is partially modified with oleic acid. Figure 10 The oleic acid was introduced by conjugating an activated carboxylic acid to the hexylamino spacer molecule at the 3' end of the precursor oligonucleotide. The synthesis of MD23b-2 V2 3'Ol was based on solid-phase synthesis using nucleotides and spacer molecules—GPG. This process involved two main steps.

[0629] First, an unconjugated oligonucleotide (precursor) of the sequence AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NH2C6) is synthesized. The first phosphoramidite, considered a structural unit in the chain, is attached to the solid surface via a catalytic condensation reaction. This step is repeated as many times as the nucleotide length of the final sequence. In this case, it is 16 times. After solid-phase synthesis is complete, the production process includes the following steps: cleavage and deprotection, purification, and desalting.

[0630] Secondly, oleic acid is conjugated. After the unconjugated oligonucleotides that have been desalted in the previous step are conjugated with oleic acid, they are purified, desalted, and lyophilized.

[0631] Example 9

[0632] 1.1 Quantification of MD23b-2 V2 3'Ol by ELISA

[0633] MD23b-2 V2 and MD23b-2 V2 3'Ol were used. For HSA LRMice were administered the compound intravenously at a dose of 12 mg / kg. Fourteen days later, all mice were euthanized, and their brains, kidneys, livers, gastrocnemius muscles, and quadriceps femoris muscles were removed, weighed, and frozen for further processing. The experiment was conducted blinded by the researchers. During the necropsy procedure, samples of the brain, muscles (quadriceps femoris and gastrocnemius), kidneys, and liver were collected from all experimental groups. Samples were weighed after collection, accurate to three decimal places in grams. Each sample was placed in an RNase-free tube and rapidly frozen (e.g., a 2 ml RNase-free Eppendorf tube).

[0634] 1.1.1 Sample Preparation

[0635] 1) Remove the tissue and wash it in phosphate-buffered saline.

[0636] 2) Dry the tissue on absorbent paper and weigh it (20 mg per tissue; 30 mg per tissue in the case of the brain).

[0637] 3) Add 100 µL of RIPA buffer containing PhosSTOP EASYpack and Complete ULTRATablets, Mini, EASYpack to every 10 mg of tissue (one tablet of each RIPA buffer per 10 mL).

[0638] 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue homogenizer for 20 seconds, repeating 4 times at 5000 RPM, or until the tissue is completely homogenized.

[0639] 5) Incubate the homogenate at 55°C overnight.

[0640] 6) Centrifuge the homogenate at 15,000 rpm for 15 minutes, divide the supernatant into equal portions, and store the equal portions at -20°C for analysis.

[0641] For muscle lysates, dilute the actual homogenate at a 1:10 ratio in oligonucleotide dilution buffer. If the sample is above the limit of quantitation, use a 1:40 dilution.

[0642] For the brain, use a 1:5 dilution; for the liver and kidneys, use a 1:400 dilution.

[0643] 1.1.2 Preparation of stock solutions for standard curves

[0644] In the preparation of the stock solution for the standard curve, a 20 µM stock solution of MD23b-2 V2 3'Ol was first prepared. For the preparation of the standard curve, a 1 µM concentration was used. Therefore, the 20 µM stock solution was diluted in water to a final volume of 1 µM and stored in different aliquots. For each experiment, a fresh standard curve was prepared, for which it was necessary to heat the 1 µM stock solution at 65°C for 15 minutes each time. On the other hand, after preparing the tissue homogenate, 55 µL of the homogenate was added to 5445 µL of compound dilution buffer to obtain the control tissue homogenate.

[0645] 1.1.3 Preparation of Standard Curve

[0646] For this purpose, a control tissue homogenate is needed to prepare standard dilutions. Then, to prepare sequential dilutions, 1 µM of the desired compound is denatured at 65°C for 15 minutes and vortexed for at least 30 seconds. 32 µL of this denatured compound is then diluted in 968 µL of the control homogenate. This is the first point of the standard curve (32000 pM). For the next point, 500 µL of the 32000 pM is diluted in 500 µL of the compound dilution buffer (16000 pM). Similar methods are used to prepare 8000 pM, 4000 pM, 2000 pM, and 1000 pM.

[0647] Table 9: ELISA Design

[0648]

[0649] 1.1.4 QC

[0650] Each run involves three QC levels (L, M, H), and three copies are made.

[0651] Acceptance criteria:

[0652] A QC of ≥ 67% should be ±30% of the nominal (theoretical) value.

[0653] 1.1.5 ELISA Scheme

[0654] -Probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digooxin NHS ester (100 µM in water stock solution and 1 µM prepared in water stock solution) needs to be heated at 65°C for 15 minutes and vortexed for 30 seconds.

[0655] - Before starting the experiment, prepare sample homogenate and oligonucleotide serial dilution solution.

[0656] - Dilute the probe (1 µM) in hybridization buffer at a concentration of 0.5 nM.

[0657] Add 70 µL of each dilution of the desired compound, in triplicate; or in duplicate if it is a sample homogenate. Then add 70 µL of the probe at a concentration of 0.5 nM.

[0658] - Seal the plate with a PCR membrane and incubate at 37°C for 30 minutes (this is an important step in probe-compound hybridization!) - Before this step, we can perform the experiment in a regular clear 96-well plate.

[0659] Then immediately transfer 100 µL of hybridization solution to a black neutral streptavidin-coated plate.

[0660] -Then seal the plate again with the PCR membrane and incubate at 37°C for 30 minutes (this is an important step to bind biotin to the plate coated with avidin).

[0661] - During the incubation step, micrococcal nuclease was prepared in micrococcal nuclease dilution buffer (1.6 µL nuclease + 16 ml buffer). This calculation was performed on the entire plate.

[0662] First, remove the liquid and wash the plate 6 times with 100 µL of washing buffer. Then, dry the plate by holding it upside down with absorbent paper and add 150 µL of micrococcal nuclease to each well (final amount 30 U / well).

[0663] - After adding micrococcal nuclease, seal the plate with a PCR membrane and incubate the plate at 37°C for 1 hour (this step is sufficient to lyse at least 99% of the single-stranded probe).

[0664] - Prepare a TBS buffer containing 0.25% Tween 20 and antibody (anti-digoxin antibody, Roche #11093274910), vortex thoroughly, and place at room temperature. Any unused remainder can be aliquoted and stored in a refrigerator.

[0665] First, remove the liquid, then wash the plate 6 times with 100 µL of washing buffer, dry the plate and add 150 µL of anti-digoxin antibody (conjugated with alkaline phosphatase) diluted 1 / 5,000 in TBS buffer (containing 0.25% v / v Tween 20).

[0666] - Seal the plate with a PCR membrane and incubate at 37°C for 30 minutes.

[0667] - To prepare the Attophos substrate, dilute 36 mg of powder (in a vial) by adding 60 ml of Attophos buffer and store in the refrigerator protected from light (preferably wrapped in aluminum foil).

[0668] Remove the liquid, wash the plate 6 times with 100 µL of wash buffer, dry the plate and add 150 µL of Attophos substrate (diluted 1:1 in Attophos buffer).

[0669] - Seal the plate with a PCR membrane, then wrap it with aluminum foil and incubate at room temperature (RT) for 40 minutes. Fluorescence intensity was then measured using a SynergyH1 (Biotek) analyzer. Excitation was performed at 444 nm and emission at 555 nm. Each well was delayed by 1 second, and continuous readings were taken at 60, 70, 80, and 90 minutes.

[0670] Table 10: Mean values ​​(ng / g) of MD23b-2 V2 3'Ol and MD23b-2 V2 in the brain, gastrocnemius muscle, quadriceps femoris muscle, kidney, and liver.

[0671]

[0672] Table 11: Variable order of delivery efficiency of MD23B-2 V2 3'OL compared to MD23b-2 V2

[0673]

[0674] *The multiple change was calculated based on the amount of compound MD23b-2 V2.

[0675] Results and Figure 11

[0676] We observed both compounds in muscles (gastrocnemius and quadriceps) as well as in the liver and kidneys 14 days after administration. In all tissues, the control group was below the limit of quantitation. Compound MD23b-2 V2 3'Ol was the only compound capable of reaching the brain. Regarding tissue delivery, MD23b-2 V2 3'Ol was superior to MD23b-2 V2 because it reached all tissues more efficiently, including the gastrocnemius, quadriceps, liver, kidneys, and brain. Although we detected higher amounts of MD23b-2 V2 3'Ol in all tissues, its delivery to the gastrocnemius and quadriceps was 9.5 times and 8.8 times that of MD23b-2V2, respectively. In contrast, delivery to the kidneys and liver was only 4 times and 4.5 times, respectively, indicating enhanced delivery to muscles compared to tissues less relevant to the disease. MD23b-2 V2 3'Ol was able to reach the brain, while MD 23b-2 V2 was not, suggesting that conjugation with oleic acid facilitates its delivery to this tissue. In conclusion, we find that oleic acid improves the delivery of compounds, and most importantly, it improves their delivery to tissues involved in pathology, such as muscle and the brain.

[0677] Example 10: Determination of MD23 b-2 V2 3'OL and MBNL1 protein levels in the brain of non-human primates

[0678] The aim of this study was to determine the exposure levels in the brains of animals treated with MD23b-2 V2 3'OL using enzyme-linked immunosorbent assay (ELISA). Furthermore, target binding in the brains of the treated animals was measured by quantifying the levels of myoblinoid type 1 (MBNL1) protein from the brains of non-human primates.

[0679] 1. Experimental Design

[0680] 1.1 Experimental group and drug administration

[0681] For this purpose, a total of eight cynomolgus macaques (four males and four females) aged approximately 24 to 50 months were divided into three experimental groups and further assigned to Phase 1 (Maximum Tolerated Dose [MTD] group allocation) and Phase 2 (Fixed Dose [FD] group allocation). In Phase 1 (Maximum Tolerated Dose [MTD] phase), one male and one female Asian cynomolgus macaque were assigned to Group 1 and, under non-fasting conditions, administered intravenously at doses of 5 mg / kg, 10 mg / kg, 15 mg / kg, and 20 mg / kg at doses of 5 mL / kg (slow bolus [10 minutes]) on days 1, 15, 29, and 43 of the MTD phase, in an ascending dose design.

[0682] After the MTD phase was completed, three male and three female cynomolgus monkeys of Asian origin were assigned to groups 2 and 3 of phase 2 (fixed dose phase). On days 1 and 22 of phase 2, the solvent (phosphate buffered solution [PBS, pH: 7.4]) or 20 mg / kg MD23 b-2 V2 3'Ol (slow bolus [10 minutes]) was administered intravenously at a dose volume of 5 mL / kg under non-fasting conditions.

[0683] Brain samples were collected during the autopsy procedure on the day of the execution.

[0684] Grouping and dosage levels

[0685] Table 12: Phase 1: Maximum Tolerated Dose (MTD) Grouping

[0686]

[0687] Table 13: Phase 2: Fixed-dose (FD) grouping

[0688]

[0689] 2. Experimental Data

[0690] 2.1 Experimental Procedure

[0691] 2.1.1 Sample Collection

[0692] Brains from all animals in groups 1 through 3 were collected for ELISA quantification, MBNL1 studies, and potential off-target assays. Phase 1 animals were collected two weeks after their last administration, and Phase 2 animals three weeks after the end of their treatment period. Each sample was placed in an individual ribonuclease-free Eppendorf tube, frozen in liquid nitrogen, and stored at -80±10°C. A total of eight brain samples were produced.

[0693] 2.1.2 ELISA Quantification

[0694] 2.1.2.1 Sample Preparation

[0695] 1) Remove the tissue and wash it in phosphate-buffered saline.

[0696] 2) Wipe the tissue dry on absorbent paper and weigh it (20mg per tissue).

[0697] 3) Add 100 µL of RIPA buffer containing PhosSTOP EASYpack and Complete ULTRATablets, Mini, EASYpack to every 10 mg of tissue (one tablet of each RIPA buffer per 10 mL).

[0698] 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissue homogenizer for 20 seconds, repeating 4 times at 5000 RPM, or until the tissue is completely homogenized.

[0699] 5) Incubate the homogenate at 55°C overnight.

[0700] 6) Centrifuge the homogenate at 15,000 rpm for 15 minutes, aliquot the supernatant, and store the aliquots at -20°C for analysis.

[0701] For brain lysates, the actual homogenate used was a 1 / 5 dilution (80 µL + 320 µL oligonucleotide dilution buffer).

[0702] 2.1.2.2 Preparation of stock solution for standard curve

[0703] In the preparation of the stock solution for the standard curve, firstly, a 20 µM stock solution of MD23b-2 V2 3'Ol is prepared. This can be stored at -20°C for a longer period. From this 20 µM stock solution, we can perform several dilutions as needed. For the preparation of the standard curve, we need 1 µM. Therefore, the 20 µM stock solution is diluted in water to a final volume of 1 µM and stored in different aliquots. For each experiment, we need to prepare a fresh standard curve, for which we need to heat the 1 µM stock solution at 65°C for 15 minutes each time. On the other hand, after preparing the tissue homogenate, 55 µL of the tissue homogenate is added to 5445 µL of compound dilution buffer as a control.

[0704] 2.1.2.3 Preparation of Standard Curve

[0705] For this purpose, we need to prepare standard dilutions using control tissue homogenates. Then, to prepare serial dilutions, first take 1 µM of the desired compound, denature it at 65°C for 15 minutes, and vortex for at least 30 seconds. Then take 16 µL of this denatured compound and dilute it in 984 µL of control homogenate. This is the first point of the standard curve (16000 pM). Then, for the next point, take 500 µL of 16000 pM and dilute it in 500 µL of PMO dilution buffer (8000 pM). Prepare 4000 pM, 2000 pM, 1000 pM, and 500 pM in a similar manner.

[0706] Table 14:

[0707]

[0708] 2.1.2.4 QC

[0709] Each run includes three QC levels (L, M, H), in triplicate. Acceptance criteria:

[0710] A QC of ≥ 67% should be ± 20% of the nominal (theoretical) value, and a QC of ≥ 50% at each level should be ± 20% of its nominal concentration.

[0711] 2.1.2.5 ELISA Scheme

[0712] -Probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digooxin NHS ester (100 µM in water stock solution and 1 µM prepared in water stock solution) needs to be heated at 65°C for 15 minutes and vortexed for 30 seconds.

[0713] - Before starting the experiment, prepare sample homogenates and serial dilutions of oligonucleotides.

[0714] - Dilute the probe (1 µM) in hybridization buffer at a concentration of 0.5 nM.

[0715] Add 70 µL of each dilution of the desired compound, in triplicate, or in duplicate if it is a sample homogenate. Then add 70 µL of the probe at a concentration of 0.5 nM.

[0716] - Seal the plate with a PCR membrane and incubate at 37°C for 30 minutes (this is an important step in probe-compound hybridization!) - Before this step, we can perform the experiment in a regular clear 96-well plate.

[0717] Then immediately transfer 100 µL of the hybridization solution to a black neutral streptavidin-coated plate.

[0718] -Then seal the plate again with the PCR membrane and incubate at 37°C for 30 minutes (this is an important step to bind biotin to the plate coated with avidin!).

[0719] - During the incubation step, prepare micrococcal nuclease (1.6 µL nuclease + 16 ml buffer) in micrococcal nuclease dilution buffer. This calculation is performed on the entire plate.

[0720] First, remove the liquid and wash the plate 6 times with 100 µL of washing buffer. Then, dry the plate by holding it upside down with absorbent paper and add 150 µL of micrococcal nuclease to each well (final amount 30 U / well).

[0721] - After adding micrococcal nuclease, seal the plate with a PCR membrane and incubate the plate at 37°C for 1 hour (this step is sufficient to lyse at least 99% of the single-stranded probe).

[0722] Prepare a TBS buffer containing 0.25% Tween 20 and antibody, vortex thoroughly, and place at room temperature. Any unwanted residue can be aliquoted and stored in a refrigerator.

[0723] First, remove the liquid, then wash the plate 6 times with 100 µL of washing buffer, dry the plate and add 150 µL of anti-digoxin antibody (conjugated with alkaline phosphatase) diluted 1 / 5,000 in TBS buffer (containing 0.25% v / v Tween 20).

[0724] - Seal the plate with a PCR membrane and incubate at 37°C for 30 minutes.

[0725] - To prepare the Attophos substrate, dilute 36 mg of powder (in a vial) by adding 60 ml of Attophos buffer and store it in the refrigerator protected from light (preferably wrapped in aluminum foil).

[0726] Remove the liquid, wash the plate 6 times with 100 µL of wash buffer, dry the plate and add 150 µL of Attophos substrate (diluted 1:1 in Attophos buffer).

[0727] - Seal the plate with a PCR membrane, then wrap it with aluminum foil and incubate at room temperature (RT) for 40 minutes. Fluorescence intensity was then measured using a SynergyH1 (Biotek) analyzer. Excitation was performed at 444 nm and emission at 555 nm. Each well was delayed by 1 second, with continuous readings taken at 40, 50, 60, 70, 80, and 90 minutes.

[0728] 2.1.2.6 Acceptance Criteria for ELISA Assay

[0729] The accuracy of an analytical method describes how closely the average of the test results obtained by that method approaches the true value (concentration) of the analysis. Precision is estimated by the relative error of the measurement (RE%). The true values ​​of the reference controls for both ELISA assays do not necessarily match the theoretical concentrations calculated only. Therefore, the nominal concentration of the controls is calculated as the average of the set of all reference samples at each concentration level across all analytical batches.

[0730]

[0731] The precision of an analytical method describes how closely approximate individual measurements of an analyte are obtained when the procedure is repeatedly applied to multiple aliquots of a single homogeneous volume of biological matrix. Precision is estimated by the coefficient of variation (CV%).

[0732]

[0733] Table 15:

[0734]

[0735] 2.1.3 MBNL Measurement

[0736] 2.1.3.1 Protein Extraction

[0737] NHP brain samples were mechanically decomposed using TissueLyser II (QIAGEN) and homogenized in RIPA buffer (Thermo Fisher Scientific, catalog number 89900) supplemented with protease and phosphatase inhibitors (Roche, catalog numbers 11873580001 and 4906845001). Total protein was quantified using the Pierce™ BCA Protein Assay Kit (catalog number 23225) with bovine serum albumin as a standard.

[0738] 2.1.3.2 Protein Blotting:

[0739] For the immunoassay of MBNL1 protein and GAPDH protein (internal control for normalization), 15 µg of total protein from each animal sample was denatured by heat treatment at 100 °C for 5 min, separated by electrophoresis on a 12% SDS-PAGE gel, and then transferred to a 0.45 µm nitrocellulose membrane (GE Healthcare).

[0740] The membrane was blocked for 1 hour with PBS-T (8 mM Na2HPO4, 150 mM NaCl, 2 mM KH2PO4, 3 mM KCl, 1% Tween 20, pH 7.4) supplemented with 5% skim milk. After blocking, the membrane was incubated overnight at 4°C with anti-MBNL1 mouse primary antibody (1:200, MB1a(4A8) (DSHB, Iowa City, Iowa). After incubation with the primary antibody, it was incubated for 1 hour at room temperature with anti-mouse secondary antibody conjugated with horseradish peroxidase (1:3500, (HRP)-conjugated anti-mouse IgG secondary antibody, Sigma-Aldrich, St. Louis, Missouri). Finally, visualization was performed using an enhanced chemiluminescent substrate (ECL, Pierce), and images were acquired using an ImageQuant 800 Amersham device (GE Healthcare).

[0741] After detecting the immunoreaction band corresponding to MBNL1, the membrane was peeled off to remove the currently used antibody, and a band corresponding to the GAPDH protein used as a normalizer was detected. Following blocking (as described above), the assay was performed using an HRP-conjugated anti-GAPDH antibody (1:3500, clone G-9, Santa Cruz). For the HRP-conjugated anti-GAPDH antibody, incubation was performed for 1 hour at room temperature. Analysis was performed in duplicate.

[0742] 2.1.3.3 Quantification:

[0743] All images were quantified using the analysis software ImageJ. First, the MBNL1 protein levels for each sample were normalized based on GAPDH, and then the ratio was normalized based on the ratio mean of untreated animals (relative protein level).

[0744] 3. Results

[0745] 3.1 Measurement of MD23b-2 V2 3'Ol from the NHP brain

[0746] Table 16: Concentrations (nM, ng / mg, ng / g) of MD23b-2V2 3'Ol in the brains of cynomolgus monkeys on day 14 (group 1) and day 21 (groups 2 and 3) after the last treatment.

[0747]

[0748] In one analytical run, eight samples from eight animals were analyzed on one plate for the determination of MD23 b-2 V2 3'Ol by ELISA. All samples were measured in triplicate. The analytical run met the acceptance criteria.

[0749] During the analysis, all treated animals in Phase I and Phase II exhibited certain levels of the tested items. No quantifiable levels of MD23b-2 V2 3'OL were observed in the brains of animals from the control group.

[0750] During the fixed-dose period, all animals treated with 20 mg / kg exhibited certain levels of the tested items in all tested brains. For animals from MTD, males (P0001) exhibited levels above the limit of quantitation.

[0751] 3.2 MBNL1 relative level

[0752] Table 17: Relative levels of MBNL1. Averages for Phase I and Phase II.

[0753]

[0754] MBNL1 protein levels in group 1 were quantified in samples collected two weeks after the last administration. Results showed significantly higher MBNL1 protein levels in the tested brains compared to samples from untreated animals (Table 18). Figure 12 The protein levels in the brain were twice that of the control group. When compared to untreated animals, the test item produced a pharmacological effect in the brain leading to increased MBNL protein levels, and this increase persisted at 2 and 3 weeks post-administration. Results were similar in males and females.

[0755] 4. Discussion and Conclusion

[0756] Quantitative results by ELISA showed that, 2 and 3 weeks after the last intravenous administration of MD23b-2 V2 3'OL, the treated groups (groups 1 and 3) had quantifiable levels of MD23b-2 V2 3'OL in the brain. Furthermore, at 2 and 3 weeks after the last administration, the treated animals had higher levels of MBNL1 protein in the brain compared to the untreated animals. These results confirm the presence and activity of the tested items in the brains of animals treated with MD23b-2 V2 3'OL.

[0757] Example 11

[0758] HSALR mouse efficacy study at 6 weeks (6, 9, 12, and 24 mg / kg)

[0759] The aim of this study was to evaluate the molecular and functional recovery and duration of effect of MD23b-2 V2 3'OL following three intravenous administrations of MD23b-2 V2 3'OL at doses of 0, 6, 9, 12, and 24 mg / kg every two weeks over a 6-week period. The study was conducted in HSALR mice (N=30) with an additional control group of FVB mice receiving a single intravenous administration of the solvent (PBS). All experimental groups contained at least 5 mice (at least 2 of each sex), except for PBS-treated HSALR mice (N=10) and PBS-treated FVB mice (males only, N=5). In all animal studies described herein, oligonucleotide assays were prepared in PBS. Detailed information on the materials and methods used in this study can be found in Example 17.

[0760] An autopsy was performed 14 days after the last administration, at which time tissue samples were collected from the brain, heart, kidneys, liver, and skeletal muscles of the gastrocnemius, quadriceps, and diaphragm.

[0761] The efficacy was assessed at each time point by measuring forelimb grip strength on day 0 (before the first administration), day 7, day 14 (before the second administration), day 21, day 28 (before the third administration), day 35, and day 42 (before autopsy). MBNL protein levels in GT and QD muscles, diaphragm, brain, heart, kidneys, and liver were assessed at the end of the study period, as described in Example 17. Furthermore, splicing events (ATP2A, CLCN1, NFIX, MBNL1, BIN1, and CACNA1S) were assessed only in GT and QD muscles, as described in Example 17.

[0762] At all evaluation time points, HSALR mice treated with MD23b-2 V2 3'Ol showed a statistically significant increase in strength (relative to body weight per mouse) at all tested doses compared to PBS-treated HSALR mice. Figure 13 A). Importantly, the strength of MD23B-2 V2 3'OL treated HSALR mice was comparable to that of PBS treated FVB mice (WT). Figure 13 B).

[0763] Molecular analysis and functional measurements of relative miR-23b expression, MBNL1 protein levels, and PSR were consistent: compared with PBS-treated HSALR mice, MBNL1 protein levels in QD and GT were statistically significantly increased in all tested doses after administration of MD23b-2 V2 3'OL to HSALR mice. The same statistically significant increase was also observed in the brain and heart at all tested doses, while in the diaphragm, the increase in MBNL1 protein levels was statistically significant only at doses of 9, 12, and 24 mg / kg, and in the kidney and liver, only at a dose of 24 mg / kg. Figure 14 Similarly, in GT and QD muscles, a statistically significant decrease in miR-23b expression was observed at all doses. Figure 15 A). Consistent with the results for MBNL1 and miR-23b, a statistically significant increase in overall PSR was found in both GT and QD muscles, whether in independent or co-analysis. Figure 15 B).

[0764] Repeated intravenous administration (once every two weeks for 6 weeks) produced statistically significant changes in functional and molecular parameters in muscle, which persisted for at least 14 days after the last administration. Under these experimental conditions, the minimum effective dose was 6 mg / kg.

[0765] Regarding MBNL1 protein levels, statistically significant increases were observed in the brain and heart at all tested doses, while statistically significant increases in MBNL1 protein levels were observed only at doses of 9, 12, and 24 mg / kg in the diaphragm, and only at a dose of 24 mg / kg in the kidneys and liver.

[0766] We can conclude that repeated administration of the test item MD23b-2 V2 3'OL at doses of 6, 9, 12, and 24 mg / kg had a strong effect on MBNL1 protein levels in muscle, normalizing strength throughout the analysis, downregulating miR-23b levels, and rescuing strength and missplicing defects associated with the DM1 phenotype. These effects persisted for 14 days after the last administration. At doses of 9, 12, and 24 mg / kg, we observed MBNL1 overexpression in muscle, heart, brain, and diaphragm. At a dose of 6 mg / kg, overexpression was observed in muscle, heart, and brain.

[0767] Under these experimental conditions, the MED was 6 mg / kg, and the corresponding human equivalent dose (HED) was 0.48 mg / kg. Assuming an average weight of 70 kg / person, the corresponding HED was 33.6 mg / person.

[0768] Example 12

[0769] A 6-week toxicity study was conducted on Wistar rats after intravenous (bolus) administration, followed by an 8-week recovery period (Study ID ART01-032A-22-003).

[0770] The aim of this study was to evaluate the toxicity of MD23B-2 V2 3'OL administered intravenously (by bolus) to Wistar rats. The study included 198 rats assigned to five treatment groups. For the primary toxicological analysis, all animals received three intravenous injections of either the solvent (group 1) or MD23B-2 V2 3'OL at 2-week intervals (days 1, 15, and 29) at doses of 8 mg / kg (group 2), 12 mg / kg (group 3), 16 mg / kg (group 4), or 40 mg / kg (group 5). In addition, a group of animals included in the control and 40 mg / kg groups were evaluated after an 8-week treatment-free recovery period following the primary 6-week treatment period to assess the reversibility or progression of any changes related to the test items. A summary of the different assessments of the animals included in each group is shown in the table below:

[0771] Table 19. Research ID ART01-032A-22-003

[0772]

[0773] F: Female; M: Male; N / A: Not applicable

[0774] Routine observations included survival / mortality (cage-side observation, daily), detailed observation of clinical signs (before administration, twice weekly, including the day of administration; examination of the injection site on these days), food consumption (once during pretreatment, and weekly during treatment and recovery), and body weight (once during pretreatment, weekly during treatment and recovery, and at termination under fasting conditions). Food consumption was not measured in these animals.

[0775] Specialty assessments included ophthalmological assessment (before treatment and at the end of all major and recovery periods in animals) and a functional observation combination (FOB) (at first administration, at the end of treatment, and at the end of the recovery period). Respiration was visually assessed by observing chest movements in rats. The FOB (neurological assessment) and respiratory assessment were part of a safety pharmacology assessment, the results of which are discussed in Example 13.

[0776] Blood was collected at the endpoint (week 7 for primary animals, and at the end of the recovery period for recovering animals) for routine hematological, clinical biochemistry, and coagulation assays. Urine samples were collected from all primary animals at week 6 and from all recovering animals at the end of the recovery period for overall analysis of routine urinalysis parameters. Additionally, blood samples were collected before the trial, at the end of treatment, and at the end of the recovery period for any future determination of anti-drug antibodies (ADA) in serum.

[0777] Finally, all animals underwent detailed necropsy, and organs were collected, weighed, and subjected to histopathological analysis in accordance with EMA guidelines (https: / / www.ema.europa.eu / en / documents / scientific-guideline / guideline-repeated-dose-toxicity-revision-1_en.pdf). Additionally, quadriceps femoris muscles from the hind limbs of all animals were collected for MBNL determination (the results of these analyses can be found in Example 14).

[0778] No deaths, local reactions at the application site, or treatment-related clinical signs were observed during the study. Some incidental signs, such as transient piloerection, wounds, crusting, and hair loss, were recorded in different treatment groups, but their incidence was higher in the control group and therefore considered unrelated to treatment.

[0779] Compared to the control group, a trend toward decreased food consumption was primarily observed in males treated with 40 mg / kg, reaching its peak at the end of the treatment period (approximately 18%). This observation was associated with lower body weight in males of the 40 mg / kg group during treatment. Although some statistically significant differences in the percentage of body weight change were observed between males in the control and highest-dose groups, these differences did not exceed 10%. During the recovery ...

Claims

1. An oleic acid molecule used as a medium or carrier for delivering oligonucleotide molecules or analogues to target tissues in humans. The oleic acid molecule is conjugated to the 3' and / or 5' end of the oligonucleotide molecule or its analogue. The oligonucleotide molecule or its analogue is an active ingredient in a therapeutic method, and The oligonucleotide molecule or its analogues are administered to humans at a dose between 18 mg and 288 mg per person.

2. The oleic acid molecule for the use of claim 1, wherein the administration is intravenous or intrathecal.

3. The oleic acid molecule for use according to claim 1 or 2, wherein the dose is between 33 mg and 144 mg per person, and the administration is intravenous.

4. The oleic acid molecule for the use according to claim 3, wherein the target tissue is the central nervous system (CNS), muscle tissue and / or cerebrospinal fluid (CSF), preferably muscle tissue.

5. The oleic acid molecule for use according to claim 1 or 2, wherein the dosage is between 22.75 mg and 196.46 mg per person, and the administration is intrathecal.

6. The oleic acid molecule for the use according to claim 5, wherein the target tissue is the central nervous system (CNS), muscle tissue and / or cerebrospinal fluid (CSF), preferably CSF.

7. The oleic acid molecule for use according to any one of claims 1 to 6, wherein the oligonucleotide molecule or the analogue thereof comprises a mixture of thiophosphate bonds and phosphodiester bonds that chemically link nucleotides.

8. The oleic acid molecule for the use of claim 7, wherein the number of nucleotides chemically linked by thiophosphate bonds is greater than the number of nucleotides chemically linked by phosphodiester bonds.

9. The oleic acid molecule for use according to any one of claims 1 to 8, wherein the oligonucleotide molecule or its analogue is an active ingredient in a method of treating or preventing muscle and / or nervous system diseases.

10. An oleic acid molecule conjugated to the 3' and / or 5' end of an oligonucleotide molecule or its analogue, for the prevention or treatment of central nervous system (CNS) diseases. The oleic acid molecule is a pharmaceutically acceptable medium or carrier for delivering the oligonucleotide molecule or its analogue to the CNS. The oligonucleotide molecule or its analogue is the active ingredient and comprises a mixture of phosphate thioester bonds and phosphodiester bonds that chemically link nucleotides. The oligonucleotide molecule or its analogues are administered to humans via the intrathecal route at doses ranging from 18 mg to 288 mg per person.

11. Oleic acid for the use according to claim 10, wherein the dosage is between 22 and 200 mg per person per dose, preferably between 22.75 and 196.46 mg.

12. Oleic acid for use according to any one of claims 1 to 11, wherein the oligonucleotide molecule or its analogue is a microRNA antagonist, preferably human hsa-miR-23b-3p or human hsa-miR-218-5p.

13. Oleic acid for use according to any one of claims 1 to 12, wherein the oligonucleotide molecule or its analogue is an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, has a length of 10 to 30 nucleotides, and comprises a fragment of at least 15 consecutive nitrogen bases consisting of a sequence of nucleotides having at least 80% identity with the sequence of the region present in SEQ ID NO: 1 (anti-miR-218-5p) or SEQ ID NO: 2 (anti-miR-23b-3p) or SEQ ID NO: 52-110.

14. Oleic acid for use according to any one of claims 1 to 13, wherein the oligonucleotide molecule or its analogue has at least 80% identity with SEQ ID NO: 22, 23 or 25, and wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives.

15. Oleic acid for use according to any one of claims 1 to 14, wherein the oligonucleotide molecule or its analogue has at least 80% identity with SEQ ID NO: 22, 23 or 25, wherein the spacer molecule defined in SEQ ID NO: 22, 23 or 25 is preferably selected from the group consisting of NHC3, NHC5, NHC6, threonine and its derivatives, and wherein the oligonucleotide molecule is capable of increasing the endogenous level of MBNL1 and / or MBNL2 proteins.

16. Oleic acid for use according to any one of claims 1 to 15, wherein the oligonucleotide molecule or its analogue is composed of SEQ ID NO: 3, 4 or 7.

Images