Recombinant herpesvirus of turkeys co-expressing classical and variant strains of ibdv vp2 and construction method and application thereof

Abstract

The application discloses a recombinant herpesvirus of turkeys co-expressing classic strains and variant strains of IBDV VP2 and a construction method and application thereof, and belongs to the field of veterinary biological technology. The recombinant virus has good genetic stability, and has a consistent replication rate with HVT vaccine viruses in vitro. When used as a vaccine, 1-day-old chicks can be clinically protected against vvIBDV and nVarIBDV at 100% after single immunization, can induce the body to produce high-titer specific antibodies, protect the immune organs of chickens from virus invasion, and has a broad industrial application prospect in the preparation of IBDV multivalent vaccines.

Description

Technical Field

[0001] This invention belongs to the field of veterinary biotechnology and vaccine research and development, specifically involving recombinant turkey herpesviruses co-expressing classical and variant strains of IBDV VP2, their construction methods, and applications. Background Technology

[0002] Infectious bursal disease (IBD) is an acute, highly contagious infectious disease of chickens caused by IBDV. The virus is highly infectious and immunosuppressive, damaging immune organs such as the bursa of Fabricius in chicks, leading to weakened immune function and secondary infections, causing significant economic losses to the global poultry industry. Vaccination is the core method for controlling IBDV, but mutations at key amino acid sites of the IBDV VP2 antigen have resulted in different strains, including the classic hypervirulent strain (vvIBDV) and novel variants (nVarIBDV). Furthermore, these strains do not provide effective cross-protection, and the protective effect of traditional vaccines against the novel variants is significantly reduced. Currently, many live and inactivated vaccines against the classic hypervirulent IBDV strain are available on the market; combined immunization is necessary to address the insufficient protection offered by traditional vaccines.

[0003] Turkey herpesvirus (HVT), as the core vector of live vector vaccines, has advantages such as resistance to maternal antibodies, strong immune persistence, and the ability to insert multiple exogenous genes to achieve "one injection for multiple protections". However, existing HVT vector vaccines only express the VP2 protein of a single classic IBDV strain and cannot simultaneously control vvIBDV and nVarIBDV. At the same time, nVarIBDV is difficult to culture efficiently in vitro, which further limits the development of multivalent vaccines.

[0004] Because different strains of VP2 share common antigenic epitopes, they are difficult to distinguish using conventional serum antibodies. How to effectively screen recombinant viruses that can simultaneously express both classical and novel variant VP2 strains has always been a problem that has troubled researchers. This patent utilizes specific monoclonal antibodies against classical and novel variant VP2 strains of IBDV to effectively identify the correctly expressed recombinant virus, simplifying the immunization procedure, avoiding the mutual interference caused by simultaneous immunization with multiple vaccines, and overcoming the problem of insufficient protection from current traditional vaccines.

[0005] Therefore, developing a multivalent HVT vector vaccine that can target both vvIBDV and nVarIBDV has become an urgent need for disease prevention and control in the poultry industry. Summary of the Invention

[0006] Purpose of the invention: This invention aims to overcome the shortcomings of existing IBDV vaccines, such as the inability to simultaneously control classic super-virulent strains and novel variant strains, and poor cross-protection. It provides a recombinant turkey herpesvirus that co-expresses the VP2 protein of vvIBDV JS strain and nVarIBDV FJ strain, and also provides a method for constructing this recombinant virus and its application in the preparation of IBDV vaccines, achieving highly efficient control against two mainstream circulating IBDV strains.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a recombinant turkey herpesvirus co-expressing the classical strain and the variant strain of IBDV VP2. The recombinant turkey herpesvirus is formed by inserting the nVarIBDV FJ strain VP2 gene expression cassette into the 005 / 006 non-essential region of the recombinant turkey herpesvirus rHVT-US2-JSVP2.

[0008] The insertion method is CRISPR / Cas9 gene editing technology.

[0009] This invention also provides a method for constructing recombinant turkey herpesviruses co-expressing IBDV VP2 from classical and variant strains, comprising the following steps:

[0010] (1) Construction of donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2: Using pCAGGS-FJVP2 plasmid as template, primers with SfiI restriction sites at both ends were designed, and the FJVP2 gene expression cassette SfiI-Pec-FJVP2-SfiI containing Pec promoter was amplified by PCR; the amplification product was ligated with pUC19-Lox2272-sgC3-eGFP vector digested with SfiI, transformed into DH5α competent cells, and obtained donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2 by restriction enzyme digestion and IFA identification;

[0011] (2) Construction of recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2: donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2, CRISPR / Cas9 editing plasmids pX459-sgC3 and pX330-HVT005 / 006-2 were co-transfected into chicken embryo primary fibroblasts and simultaneously infected with parental virus rHVT-US2-JSVP2. Recombinant fluorescent virus was obtained through non-homologous end ligation repair mechanism. The recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 was purified by multiple plaque purifications on CEF cells using the limiting dilution method.

[0012] (3) Construction of recombinant virus rHVT-JSVP2-FJVP2: CEF cells were transfected with Cre recombinase expression plasmid pcDNA3.1-Cre and infected with recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2. The eGFP tag was knocked out by Cre / Lox2272 enzyme system. After plaque purification, the viral genome was extracted and identified by PCR, sequencing and IFA to confirm the correct insertion of JSVP2 and FJVP2 genes and stable protein expression, thus obtaining recombinant turkey herpesvirus rHVT-JSVP2-FJVP2.

[0013] The construction method of the pCAGGS-FJVP2 plasmid in step (1) involves ligating the VP2 gene fragment of the FJ strain with the enzyme-digested pCAGGS vector, transforming it into DH5α competent cells, and then extracting and verifying the pCAGGS-FJVP2 plasmid. The primer sequences for amplifying the VP2 gene fragment of the FJ strain are as follows: EcoRI-FJVP2-F: GGAATTCATGACAAACCTGCAAGAT; NotRI-FJVP2-R: ATTTGCGGCCGCTTACCTCCTTAGGGCCCGGATTATG.

[0014] Among them, the primers with SfiI restriction sites at both ends mentioned in step (1) are: Sfi I-pec-F: GACCGGCggccgcctaggccTTCCGCGCACATTTCCCCGA; Sfi I-pec-R: GACCGGCggccataatggccTGGCAGCCAGCATATGGGCA.

[0015] The PCR amplification reaction program in step (1) is as follows: 30 cycles of pre-denaturation at 98℃ for 30s, followed by 10s at 98℃, 5s at 58℃, and 10s at 72℃, and an extension at 72℃ for 1 min. The reaction system consists of 2.5 μL (5 μmol) each of upstream and downstream primers, 2.5 μL of template, 25 μL of 2×Phanta Flash Master Mix, 10 μL of PCR enhancer, and 7.5 μL of ddH2O. The method also includes step (4) for genetic stability verification. Specifically, the recombinant virus is passaged continuously in primary chicken embryo fibroblasts for 15 generations, and the presence and protein expression of the exogenous gene are identified every 5 generations by PCR and indirect immunofluorescence assay. The in vitro growth characteristics are verified by using Taqman qPCR to detect the replication kinetics of the recombinant virus and the turkey herpesvirus vaccine virus in primary chicken embryo fibroblasts. The in vitro replication rate of the recombinant virus is not significantly different from that of the HVT vaccine virus.

[0016] The present invention also includes the use of the recombinant turkey herpesvirus in the preparation of a vaccine to prevent infection with infectious bursal disease virus in chickens.

[0017] The vaccine is used to simultaneously prevent and control both the classic super-virulent strain of infectious bursal disease virus (vvIBDV) and the novel variant strain (nVarIBDV).

[0018] The vaccine is administered via subcutaneous immunization of the neck of 1-day-old chicks at a dose of 2000-6000 PFU / 0.2 mL.

[0019] The recombinant turkey herpesvirus rHVT-JSVP2-FJVP2 of this invention uses recombinant turkey herpesvirus rHVT-US2-JSVP2 as the basic vector (Master's thesis, Yangzhou University, "Construction and Immunoefficacy Evaluation of Recombinant Turkey Herpesvirus Expressing Infectious Bursal Disease Virus VP2 Protein", June 2023, by Li Minglei). Using CRISPR / Cas9 gene editing technology, the VP2 gene expression cassette of the nVarIBDV FJ strain is inserted into the 005 / 006 non-essential region of HVT (preserved by Jiangsu Provincial Key Laboratory of Animal Preventive Medicine; US Patent (US 12,516,353 B2)), while retaining vvIBDV. The VP2 gene of the JS strain is stably co-expressed at the US2 site of HVT, achieving stable co-expression of the VP2 protein from both strains. Specifically, the VP2 gene expression cassette of the FJ strain is SfiI-Pec-FJVP2-SfiI, with a Pec promoter to avoid expression interference with the mCMV promoter of the JS strain VP2 gene. The FJ strain VP2 protein possesses the characteristic amino acid sites 221K, 252I, and 299S of the novel variant and the characteristic amino acids 222T, 249K, 286I, and 318D of the variant. This recombinant turkey herpesvirus rHVT-JSVP2-FJVP2 is used in the preparation of a vaccine to prevent infectious bursal disease virus (IBDV) infection in chickens. The vaccine can simultaneously control both the classical super-virulent IBDV strain (vvIBDV) and the novel variant strain (nVarIBDV), achieving a 100% clinical protection rate against both strains.

[0020] Beneficial effects: Compared with existing detection technologies, the present invention has the following significant advantages:

[0021] 1. The recombinant turkey herpesvirus rHVT-JSVP2-FJVP2 constructed in this invention has achieved stable co-expression of VP2 protein of vvIBDV JS strain and nVarIBDV FJ strain for the first time, filling the gap in existing vaccines that cannot simultaneously prevent and control two mainstream IBDV epidemic strains, and solving the technical problem of poor cross-protection between strains.

[0022] 2. This invention employs CRISPR / Cas9 gene editing technology combined with the NHEJ repair mechanism to insert the FJ strain VP2 gene into the 005 / 006 non-essential region of HVT. The Pec promoter is selected to drive expression, avoiding expression interference with the mCMV promoter of the JS strain VP2 gene at the US2 site, thus ensuring the efficient and stable expression of the two exogenous proteins. After 15 consecutive passages in CEF cells, the exogenous gene can still be stably inherited, the protein expression does not decay, the in vitro replication rate is not significantly different from that of the HVT vaccine virus, and the biological characteristics are stable.

[0023] 3. When the recombinant virus of the present invention is used as a vaccine, after subcutaneous immunization of the neck of 1-day-old SPF chickens for 28 days, the clinical protection rate against vvIBDV JS strain and nVarIBDV FJ strain both reach 100%; the immunized chickens can produce high-titer specific antibodies, there is no pathological damage to the core immune organs such as the bursa of Fabricius and spleen, the virus detection rate in the bursa of Fabricius is significantly reduced, and the virus clearance rate against FJ strain reaches 100%.

[0024] 4. The recombinant virus of this invention uses HVT as a vector, inheriting the advantages of HVT vector vaccines such as anti-maternal antibody interference, strong immune persistence, and "one injection for multiple protections". One-day-old chicks can obtain long-term protection with a single immunization, which is suitable for the immunization needs of intensive poultry farming and has broad prospects for industrial application. Attached Figure Description

[0025] Figure 1 Schematic diagram of plasmid co-transfection;

[0026] Figure 2 Diagram illustrating the construction of a recombinant virus;

[0027] Figure 3 shows the PCR amplification results of the expression cassette SfiI-Pec-FJVP2-SfiI. In Figure 3, A represents the amplification results of different PCR amplification systems; M: DL5000 Marker; Lane 1: Increased amount of template pCAGGS-FJVP2; Lane 2: Decreased primer concentration; Lane 3: Reduced cycle number; Lane 4: Added appropriate amount of DMSO to the system; Lane 5: Used previous PCR product as template; All results failed to correctly amplify the expression cassette SfiI-Pec-FJVP2-SfiI fragment (incorrect bands); Lane 1 of Figure 3 shows the amplification results after adding PCR Enhancer to the PCR system, and the PCR amplification results of the expression cassette SfiI-Pec-FJVP2-SfiI are correct (correct bands).

[0028] Figure 4 Figure showing the SfiI restriction enzyme digestion identification results of pUC19-Lox2272-sgC3-eGFP-FJVP2;

[0029] Figure 5 The image shows the IFA identification results of pUC19-Lox2272-sgC3-eGFP-FJVP2.

[0030] Figure 6 Recombinant fluorescent virus plaques (100×) of recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 under a fluorescence microscope. Figure 6 In the diagram, A represents the first round of fluorescent plaque purification; Figure 6 B in the text: Second round of fluorescent plaque purification; Figure 6 C in the text refers to the third round of fluorescent plaque purification. Figure 6 D in the image: fourth-round fluorescent etching spot;

[0031] Figure 7 shows the PCR identification results of different recombinant fluorescent viruses rHVT-JSVP2-eGFP-FJVP2. In Figure 7A, the PCR identification results of different recombinant fluorescent viruses rHVT-JSVP2-eGFP-FJVP2 are shown (the bands are incorrect; different primers did not yield the expected bands of different sizes). Lane M1: DL5000 Marker; Lane M2: DL8000 Marker; Lanes 1-4: Recombinant fluorescent virus No. 1 (reverse); Lanes 5-8: Recombinant fluorescent virus No. 2 (forward); Lanes 9-12: Recombinant fluorescent virus No. 3 (reverse); Lanes 13-16: Recombinant fluorescent virus No. 4 (reverse); Lanes 17-20: Recombinant fluorescent virus No. 5 (reverse). Figure 7-B shows the PCR identification results of the recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 (the bands are incorrect; different primers did not yield the expected bands of different sizes). Lane M: DL10000 Marker. Marker; Lanes 21-25: Recombinant fluorescent spot 5; Lanes 26-30: Recombinant fluorescent spot 6; Lanes 31-35: Recombinant fluorescent spot 7; Lanes 36-40: Recombinant fluorescent spot 8; C in Figure 7 represents the PCR identification of the recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 (the bands are correct, and the corresponding bands are amplified by different primers), where lane M: DL80000 Marker; Lanes 1, 2, 3: FJVP2 gene reverse insertion; Lanes 4, 5, 6: FJVP2 gene forward insertion; Lane 7: HVT vaccine control.

[0032] Figure 8 The image shows the fluorescence and IFA identification results of rHVT-JSVP2-eGFP-FJVP2; A and B represent reverse insertion of the FJVP2 gene; C and D represent forward insertion of the FJVP2 gene.

[0033] Figure 9Image showing PCR identification results of rHVT-JSVP2-FJVP2; Lane M: DL5000 Marker; Lanes 1, 3, 5, 6, 7, 8: template is rHVT-JSVP2-FJVP2; Lanes 2, 4: template is HVT;

[0034] Figure 10 The image shows the IFA identification results for rHVT-JSVP2-FJVP2.

[0035] Figure 11 This is a graph showing the neutralizing antibody titers in serum of different groups after immunization; Note: rHVT-JSVP2-FJVP2 refers to immunization with the recombinant virus rHVT-JSVP2-FJVP2.

[0036] Figure 12 Figure 1 shows the neutralizing antibody titers in serum of different groups after challenge; Note: rHVT-JSVP2-FJVP2 +vvIBDV represents the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the classic high-virulence JS strain; rHVT-JSVP2-FJVP2 +nVarIBDV represents the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the novel variant FJ strain; vvIBDV represents the classic high-virulence JS strain; nVarIBDV represents the novel variant FJ strain.

[0037] Figure 13 The graph shows the results of the Bursal Disease Index (BBIX) in chickens of each group after immunization and challenge; Note: rHVT-JSVP2-FJVP2+vvIBDV is the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the classic super-virulent JS strain; rHVT-JSVP2-FJVP2+nVarIBDV is the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the novel mutant FJ strain; vvIBDV is the classic super-virulent JS strain; nVarIBDV is the novel mutant FJ strain.

[0038] Figure 14 The graph shows the lesion index results of infectious bursal disease in chickens in each group after immunization and challenge; Note: rHVT-JSVP2-FJVP2+vvIBDV is the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the classic super-virulent JS strain; rHVT-JSVP2-FJVP2+nVarIBDV is the recombinant virus rHVT-JSVP2-FJVP2 followed by challenge with the novel mutant FJ strain; vvIBDV is the classic super-virulent JS strain; nVarIBDV is the novel mutant FJ strain; Control is the blank control. Detailed Implementation

[0039] Experimental materials:

[0040] Plasmids and Viruses: Plasmid pUC19-Lox2272-sgC3-eGFP (Shen Ke, Construction of Recombinant Turkey Herpesvirus Co-expressing Genotype VII NDV F Protein and Novel IBDV Variant VP2 Protein [D]. Yangzhou University, 2023:58-60), plasmid pX459-sgC3 (Shen Ke, Construction of Recombinant Turkey Herpesvirus Co-expressing Genotype VII NDV F Protein and Novel IBDV Variant VP2 Protein [D]. Yangzhou University, 2023:61.), plasmid pcDNA3.1-Cre, plasmid pX330 and pX459 were purchased from the website of Hunan Keai Medical Device Co., Ltd. (Youbao Biotechnology), plasmid pX330-005 / 006-2 (Shi B, Yang G, Xiao Y, et al. Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of The plasmids *Recombinant Turkey Herpesvirus Expressing NDV F Protein* (Solarbio, catalog number VT000109) were all preserved in the Key Laboratory of Poultry Preventive Medicine, Ministry of Education, Yangzhou University. The recombinant virus rHVT-US2-JSVP2 (Li Minglei, Construction and Immunogenicity Evaluation of Recombinant Turkey Herpesvirus Expressing NDV F Protein* (Yangzhou University, 2023), the novel IBDV variant FJ strain (Zhang Xiaoyu, Isolation and Identification of Novel IBDV Variant and its VP2 Protein Expression and Immunogenicity Analysis* (Yangzhou University, 2023), and the HVT Fc-126 vaccine strain were constructed and preserved in the Key Laboratory of Poultry Preventive Medicine, Ministry of Education, Yangzhou University.) The VP2 protein of the novel IBDV variant strain FJ of the present invention has the characteristic amino acid sites 221K, 252I, and 299S of the novel variant strain, as well as the characteristic amino acids 222T, 249K, 286I, and 318D of the variant strain.

[0041] Classic super-virulent strain (vvIBDV) and novel variant strain (nVarIBDV); derived from (Zhang Xiaoyu, Isolation and identification of novel IBDV variant strain and its VP2 protein expression and immunogenicity analysis [D]. Yangzhou University, 2023).

[0042] 2. Cells and experimental animals: Chicken embryo primary fibroblasts (CEF) and DF-1 cells were prepared and preserved in the laboratory; 1-day-old SPF chicken embryos and SPF chicks were purchased from Beijing Boehringer Ingelheim Viton Biotechnology Co., Ltd.; 8-week-old BALB / c mice were purchased from the Comparative Medicine Center of Yangzhou University.

[0043] 3. Antibodies and Reagents: 5B5 monoclonal antibody against nVarIBDV VP2 protein (5B5 monoclonal antibody is derived from the article Xiong H, Wu J, Xie Q, et al. Q221K mutation in VP2 drives antigenic shift of infectious bursal disease virus[J]. Frontiers in immunology. 2025,16:1600371.), and 1B5 monoclonal antibody against vvIBDV VP2 protein (1B5 monoclonal antibody has been published in the article Shao Hongxia, Qin Aijian, Gu Linlin et al. Screening of anti-IBDV vp2 protein-specific monoclonal antibodies using recombinant gene expression products[C]. Poultry Health Branch, Chinese Association of Animal and Veterinary Science. Proceedings of the 14th Academic Symposium of Poultry Health Branch, Chinese Association of Animal and Veterinary Science. Jiangsu Provincial Key Laboratory of Animal Preventive Medicine, Yangzhou University. 2008:162.). All the monoclonal antibodies were developed and preserved by the Key Laboratory of Poultry Preventive Medicine of the Ministry of Education at Yangzhou University; DMEM medium, M199 medium, and fetal bovine serum were purchased from Gibco; CRISPR / Cas9 related transfection reagents, restriction endonucleases, DNA polymerases, etc. were purchased from NEB, Novizan, and other companies.

[0044] The identification primers and primer combinations and their expected PCR amplification products in the embodiments of the present invention are shown in Tables 1 and 2.

[0045] Table 1 Primers for PCR identification of rHVT-JSVP2-FJVP2 recombinant virus

[0046] Table 2 Primer combinations and expected PCR product size

[0047] Table 3 Primer combinations and expected PCR product size

[0048] Example 1: Construction and identification of plasmid pCAGGS-FJVP2

[0049] 1. Primer design: Primers for amplifying the FJVP2 gene were designed, with EcoRI and NotI restriction sites introduced at both ends. The sequences are as follows:

[0050] Upstream primer EcoR I-FJVP2-F:

[0051] GGAATTCATGACAAACCTGCAAGAT

[0052] Downstream primer Not I-FJVP2-R: ATTTGCGGCCGCTTACCTCCTTAGGGCCCGGATTATG

[0053] 2. PCR amplification: Using the novel mutant strain IBDV FJ as a template, PCR amplification was performed using Phanta Super-Fidelity DNA Polymerase [2×Phanta Flash Master Mix (Dye Plus), Novizan Biotechnology Co., Ltd., catalog number P520-03-AA]. The reaction system was 20 μL: 1 μL each of primers, 1 μL of template, 10 μL of 2×PhantaFlash Master Mix, and 7 μL of ddH2O. The reaction program was: 98℃ pre-denaturation for 30 s, 98℃ for 10 s, 58℃ for 5 s, 72℃ for 10 s, for 30 cycles, followed by extension at 72℃ for 1 min.

[0054] 3. Vector ligation and transformation: After recovering the PCR amplification product by 1% agarose gel electrophoresis, it was digested with pCAGGS vector by EcoRI and NotI at 37℃ for 30 min. The digestion system was as follows: PCR amplification product or pCAGGS vector 2.5 μL, EcoRI enzyme 2.5 μL, NotI enzyme 2.5 μL, FastCut Buffer 25 μL, ddH2O 17.5 μL. After the digestion product was recovered from the gel, it was ligated with T4 DNA ligase overnight at 4℃. The ligation product was heat-shocked and transformed into DH5α competent cells, plated on LB agar plates containing ampicillin, and cultured at 37℃ for 12-16 h.

[0055] 4. Identification: Single colonies were picked and cultured, and plasmids were extracted and subjected to double enzyme digestion for identification, yielding a 4758 bp pCAGGS vector fragment and a 1371 bp FJVP2 gene fragment. The positive plasmid was sent for sequencing, and the results showed that the FJVP2 gene had characteristic amino acid sites of the novel mutant strain (the three characteristic amino acid sites of the novel mutant strain: 221K, 252I, 299S). The plasmid was transfected into DF-1 cells, and after 48 hours, IFA identification showed specific red fluorescence, indicating that the FJVP2 protein could be correctly expressed, and the plasmid pCAGGS-FJVP2 was successfully constructed.

[0056] Example 2: Construction and identification of donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2

[0057] 1. Primer Design: Primers for amplifying the FJVP2 gene expression cassette were designed, with SfiI restriction sites introduced at both ends. The sequences are as follows:

[0058] Upstream primer Sfi I-pec-F: GACCGGCggccgcctaggccTTCCGCGCACATTTCCCCGA

[0059] Downstream primer Sfi I-pec-R: GACCGGCggccataatggccTGGCAGCCAGCATATGGGCA

[0060] 2. PCR amplification: Using plasmid pCAGGS-FJVP2 as a template, amplification was performed using PCR.

[0061] For lane 1, adjust the template volume to a 50 μL reaction system: 2.5 μL (5 μmol) each of primers, 1 μL template, 25 μL 2×PhantaFlash Master Mix, and 19 μL ddH2O. The reaction procedure is the same as in Example 1.

[0062] Lane 2 was used to adjust the primer concentration. The reaction system was 50 μL: 2.5 μL (1 μmol) of each primer, 2.5 μL of template, 25 μL of 2×Phanta Flash Master Mix, and 17.5 μL of ddH2O. The reaction procedure was the same as in Example 1.

[0063] Lane 3, reaction system of 50 μL: 2.5 μL each of primers (5 μmol), 2.5 μL template, 25 μL 2×Phanta FlashMaster Mix, 17.5 μL ddH2O, reaction program: 98℃ pre-denaturation for 30 s, 98℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, 25 cycles, 72℃ extension for 1 min.

[0064] Lane 4, add an appropriate amount of DMSO to the system, the reaction system is 50 μL: 2.5 μL each of primers (5 μmol), 2.5 μL template, 25 μL 2×Phanta Flash Master Mix, 17.5 μL ddH2O, the reaction procedure is the same as in Example 1.

[0065] Lane 5 uses the PCR product from lane 1 as a template, and the remaining lanes are amplified under the same conditions as lane 2.

[0066] The PCR amplification results are shown in Figure 3A. All of the above amplification results are not ideal and show non-specific amplification.

[0067] Similarly, using plasmid pCAGGS-FJVP2 as a template, PCR amplification was performed. The reaction procedure was the same as in Example 1: 2.5 μL (5 μmol) each of primers, 2.5 μL of template, 25 μL of 2×Phanta Flash Master Mix, 10 μL of PCR Enhancer (Novizan, catalog number P021-01), and 7.5 μL of ddH2O. The PCR amplification result is shown in Figure 3B, with the band size correct and consistent with the expected size (3425 bp).

[0068] 3. Vector ligation and transformation: The amplified product of the FJVP2 gene in Figure 3 (B) and the pUC19-Lox2272-sgC3-eGFP vector were digested with SfiI at 50℃ for 45 min (DNA 1 μg, SfiI enzyme 2.5 μL, CutSmart® Buffer 25 μL, ddH2O added to 50 μL). After gel recovery, the DNA was ligated overnight at 4℃ with T4 DNA ligase, transformed into DH5α competent cells, and plated on LB agar plates containing ampicillin.

[0069] 4. Identification: Plasmids were extracted from single colonies, and identified by SfiI digestion, yielding a vector fragment of approximately 5114 bp and an FJVP2 expression cassette fragment of approximately 3398 bp. Figure 4 ); plasmid was transfected into CEF cells, and IFA analysis showed green eGFP fluorescence and red FJVP2 protein fluorescence ( ); Figure 5 The results indicate that the donor plasmid was successfully constructed, and the donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2 was identified.

[0070] Example 3 Construction and purification of recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2

[0071] 1. Plasmid co-transfection and viral infection: CEF cells were cultured and seeded in 24-well plates. When the cells reached 90-100% confluence, donor plasmids pUC19-Lox2272-sgC3-eGFP-FJVP2 (250 ng), pX459-sgC3 (250 ng), and pX330-005 / 006-2 (250 ng) were mixed with TransIT-X2 transfection reagent (Mirus, MIR6000, 1.5 μL). After incubation at room temperature for 30 min, CEF cells were transfected. 12 h later, the cells were infected with recombinant virus rHVT-US2-JSVP2 at MOI=0.01. After 6 h, the medium was replaced with 2% M199 maintenance medium (Gibco, C11150500BT). The cells were cultured at 38.5℃ and 5% CO2 for 48-72 h.

[0072] 2. Plaque Purification: Infected cells were digested and dispersed, then seeded into 6-well CEF cells. After culturing for 72 hours, green fluorescent plaques were selected under a fluorescence microscope. The plaques were then digested with trypsin and passaged using a limiting dilution method. This purification process was repeated four times until all fields of view were filled with fluorescent plaques, yielding the recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2. Results are as follows: Figure 6 The fluorescent spots in the field of view are brighter and farther away from the non-fluorescent parental virus spots.

[0073] 3. Identification: The recombinant fluorescent virus genome was extracted and identified by PCR using primers for the HVT-005 / 006 locus (HVT-005 / 006-F and HVT-005 / 006-R) and primers for the FJVP2 gene (EcoRI-FJVP2-F and NotI-FJVP2-R) according to different primer combinations (Table 2). Fragments of the expected size were amplified (C in Figure 7). Lanes 1 and 4 were amplification products of primers HVT-005 / 006-F and HVT-005 / 006-R, with a band size of 8859 bp; lane 2 was amplification product of primers HVT-005 / 006-F and EcoRI-FJVP2-F, with a band size of 1760 bp; and lane 3 was amplification product of primers HVT-005 / 006-R and NotI-FJVP2-R, with a band size of 8480 bp. Lane 5 shows the amplification product of primers HVT-005 / 006-F and NotI-FJVP2-R, with a band size of 8343 bp; lane 6 shows the amplification product of primers HVT-005 / 006-R and EcoRI-FJVP2-F, with a band size of 1897 bp; lane 7 is the negative control for the HVT wild-type virus at the 005 / 006 site, with a band size of 347 bp. This suggests that the exogenous gene in some recombinant fluorescent viruses is inserted in the forward direction, while in others it is inserted in the reverse direction. IFA analysis showed green eGFP fluorescence and red FJVP2 protein fluorescence, indicating that the recombinant fluorescent virus was successfully constructed. Figure 8 ).

[0074] Example 4: PCR identification of different amplification product sizes

[0075] Multiple single fluorescent spots of the recombinant fluorescent virus prepared in Example 3 were selected for genomic DNA extraction and PCR identification (Figure 7A and Table 2). Lanes 1, 5, 9, 13, and 17 were amplification products of primers HVT-005 / 006-F and EcoRI-FJVP2-F, with an ideal band size of 1760 bp; lanes 2, 6, 10, 14, and 18 were amplification products of primers HVT-005 / 006-R and NotI-FJVP2-R, with an ideal band size of 8480 bp; lanes 3, 7, 11, 15, and 19 were amplification products of primers HVT-005 / 006-R and EcoRI-FJVP2-F. The ideal band size for the amplification product of I-FJVP2-F should be 1897bp; the ideal band size for the amplification products of primers HVT-005 / 006-F and NotI-FJVP2-R in lanes 4, 8, 12, 16, and 20 should be 8343bp. Multiple amplification failures were observed with the 8343bp band of primers HVT005 / 006-F and NotI-FJVP2-R and the 8480bp band of primers HVT005 / 006-R and NotI-FJVP2-R. The analysis suggests that the GC content of the primers was too high, and an appropriate amount of PCR enhancer should be added to the PCR system.

[0076] After purification by spot picking, the recombinant fluorescent virus was extracted from eight different fluorescent plaques for PCR identification (Figure 7B and Table 2). Lanes 21, 26, 31, and 36 were amplification products of primers HVT-005 / 006-F and NotI-FJVP2-R, with an ideal band size of 8343 bp; lanes 22, 27, 32, and 37 were amplification products of primers HVT-005 / 006-R and EcoRI-FJVP2-R. The amplification product of primer 2-F should ideally have a band size of 1897 bp; lanes 23, 28, 33, and 38 are the amplification products of primers HVT-005 / 006-F and EcoRI-FJVP2-F, with an ideal band size of 1760 bp; lanes 24, 29, 34, and 39 are the amplification products of primers HVT-005 / 006-R and NotI-FJVP2-R, with an ideal band size of 8480 bp. Lanes 25, 30, 35, and 40 are amplification products of primers HVT-005 / 006-F and HVT-005 / 006-R, with an ideal band size of 8859 bp. Only the combination of upstream and downstream primers HVT-005 / 006-F and HVT-005 / 006-R amplified a band (5453 bp), but not the correct size (8859 bp). This indicates that the recombinant virus does not contain the target gene expression cassette SfiI-Pec-FJVP2-SfiI (3425 bp). The reason for this is that the donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2 constructed earlier was impure and contained the empty vector plasmid pUC19-Lox2272-sgC3-eGFP. As a result, although the recombinant fluorescent spot selected after co-transfection fluoresces green under the microscope, it does not carry the exogenous gene FJVP2.

[0077] Example 5: Construction and Identification of Recombinant Virus rHVT-JSVP2-FJVP2

[0078] 1. Cre / Lox2272 knockout of eGFP tag: CEF cells were cultured and seeded in 24-well plates, transfected with 500 ng pcDNA3.1-Cre plasmid, and infected with recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 with MOI=0.01 after 12 h. The cells were cultured at 38.5℃ and 5% CO2 for 48~72 h.

[0079] 2. Plaque purification: Under a fluorescence microscope, plaques without green fluorescence were selected and purified repeatedly using the limiting dilution method until all plaques in the field of view were without fluorescence, thus obtaining the recombinant virus rHVT-JSVP2-FJVP2.

[0080] 3. Molecular Identification: The rHVT-JSVP2-FJVP2 viral genome was extracted and identified by PCR using primers specific to the US2 locus (HVT-US2-F and HVT-US2-R), the 005 / 006 locus (HVT-005 / 006-F and HVT-005 / 006-R), and the JSVP2 (JSVP2-F and JSVP2-R) and FJVP2 genes (EcoRI-FJVP2-F and NotI-FJVP2-R). Primer combinations are shown in Table 3. A 3804 bp fragment was amplified at the US2 locus, a 3781 bp fragment at the 005 / 006 locus, and the expected sizes of the JSVP2 and FJVP2 gene fragments. These fragments showed significant differences from the HVT vaccine virus. The results are as follows: Figure 9 Lanes 1 and 2 contain the amplification products of primers HVT-US2-F and HVT-US2-R, with band sizes of 3804 bp and 709 bp, respectively; the latter serves as a negative control. Lanes 3 and 4 contain the amplification products of primers HVT-005 / 006-F and HVT-005 / 006-R, with band sizes of 3781 bp and 347 bp, respectively; the latter serves as a negative control. Lane 5 contains the amplification product of primers HVT-005 / 006-F and NotI-FJVP2-R, with a band size of 2612 bp. Lane 6 contains the amplification product of primer HVT-005... The amplification products of primers / 006-R and EcoRI-FJVP2-F were 1892 bp in length; lane 7 contained the amplification product of primers HVT-US2-F mixed with JSVP2-R, with a band size of 3300 bp; lane 8 contained the amplification product of primers HVT-US2-R and JSVP2-F, with a band size of 1840 bp. The 005 / 006 site fragment was cloned into the pMD19-T vector and sequenced. The results were as expected, and the FJVP2 gene expression cassette was correctly inserted. The 1B5 monoclonal antibody was identified using FITC-labeled IFA. Figure 10 The visible green fluorescence of JSVP2 protein and the red fluorescence of FJVP2 protein indicate that the two proteins are co-expressed.

[0081] 4. Genetic stability verification: The recombinant virus was passaged continuously in CEF cells for 15 generations, and the genome was extracted every 5 generations for PCR identification. The size of the exogenous gene fragments was consistent with expectations. IFA identification showed specific fluorescence of the two proteins, indicating that the recombinant virus has good genetic stability.

[0082] 5. Validation of in vitro growth characteristics: Recombinant viruses rHVT-JSVP2-FJVP2 and HVT Fc-126 were seeded into CEF cells at 100 PFU / well, respectively. Cells were collected at 24h, 48h, 72h, 96h, and 120h, and the genome was extracted for Taqman qPCR detection. The results showed that the viral copy number of the recombinant virus was not significantly different from that of HVT Fc-126, and the in vitro replication kinetics were consistent.

[0083] Example 6: Conventional anti-IBDV serum and anti-IBDV VP2 monoclonal antibody cannot distinguish recombinant virus rHVT-JSVP2-FJVP2 co-expression.

[0084] When using conventional anti-IBDV serum for IFA testing to determine whether the novel variant rHVT-JSVP2-FJVP2 is correctly expressed, the anti-IBDV serum shows a positive fluorescence due to the presence of common epitopes against different strains. However, this does not confirm whether the novel variant is correctly expressed, as the classic strain can also show a positive reaction for VP2 expression.

[0085] When using conventional anti-IBDV VP2 monoclonal antibody for IFA testing to determine whether the novel variant rHVT-JSVP2-FJVP2 is correctly expressed, the anti-IBDV monoclonal antibody shows a positive fluorescence result because it targets a common epitope across all different strains. This does not confirm whether the novel variant is correctly expressed, as the classic strain can also show a positive reaction for VP2 expression. Therefore, it is necessary to use monoclonal antibodies targeting the two strain-specific epitopes described in Example 4.

[0086] Example 7: Evaluation of the immunogenicity of recombinant virus rHVT-JSVP2-FJVP2

[0087] 1. Experimental Groups: One-day-old SPF chicks were divided into 5 groups: G1: rHVT-JSVP2-FJVP2 immunization + JS strain (vvIBDV) challenge group (n=18); G2: rHVT-JSVP2-FJVP2 immunization + FJ strain challenge group (n=18); G3: JS strain challenge control group (n=11); G4: FJ strain (nVarIBDV) challenge control group (n=11); G5: Blank control group (n=20). G1 and G2 were subcutaneously immunized with 2000 PFU / 0.2 mL of recombinant virus rHVT-JSVP2-FJVP2 in the neck, while G3 and G4 were injected with an equal volume of M199 culture medium. At 28 days of age, G1 and G3 were challenged with 100 LD50 JS strain, and G2 and G4 were challenged with 10 LD50 FJ strain.

[0088] 2. Antibody level detection: Serum was collected at 7, 14, 21, and 28 days post-immunization and at 3, 5, and 7 days post-challenge. A virus neutralization test was performed to detect neutralizing antibodies against the JS strain. Figure 11 and Figure 12 IFA detection of anti-FJ strain antibodies showed that antibody titers increased significantly after challenge in immunized chickens, with neutralizing antibody titers reaching 1:8 or higher and FJ strain-specific antibody titers reaching 1:1000 or higher, indicating that the recombinant virus can induce a highly efficient and specific immune response in the body.

[0089] 3. Protective effect on immune organs: The spleen weight ratio, bursal weight ratio, and bursal body index (BBIX) of chickens in each group were measured. The results showed that ( Figure 13 In the immune challenge group, there were no significant differences in spleen weight ratio and bursal weight ratio compared to the blank control group; both groups had a BBIX greater than 0.7, and the bursa of Fabricius showed no atrophy. In the challenge control group, the BBIX was less than 0.7, and the bursa of Fabricius showed significant atrophy. (Bursal bursa of Fabricius lesion index...) Figure 14 Autopsy and histopathological observation showed that the bursa of Fabricius and spleen in the immune challenge group had no obvious pathological damage and the lymphoid follicle structure was intact; while the bursa of Fabricius in the challenge control group showed serious lesions such as hemorrhage, necrosis and lymphocyte loss.

[0090] 4. The results of clinical protection rate and virus detection rate are shown in Table 4.

[0091] Table 4. Mortality and disease incidence in chickens of each group after viral challenge.

[0092] Note: rHVT / JS is a recombinant virus rHVT-JSVP2-FJVP2 followed by immunization with the classic super-virulent JS strain; rHVT / FJ is a recombinant virus rHVT-JSVP2-FJVP2 followed by immunization with the novel mutant FJ strain.

[0093] As shown in Table 4, after 7 consecutive days of observation following the challenge, G1 and G2 chickens showed no clinical symptoms, with a survival rate of 100% and a clinical protection rate of 100%; G3 had a mortality rate of 87.5% and a morbidity rate of 100%, while G4 had a morbidity rate of 18.2%. PCR detection of infectious bursal virus showed that the detection rate of the JS strain in the G1 group was 22%, and the detection rate of the FJ strain in the G2 group was 0%, indicating that the recombinant virus could effectively inhibit viral replication and shedding.

Claims

1. A recombinant turkey herpesvirus co-expressing a classical strain and a variant strain of IBDV VP2, characterized in that, The recombinant turkey herpesvirus was obtained by inserting the nVarIBDV FJ strain VP2 gene expression cassette into the 005 / 006 non-essential region of the recombinant turkey herpesvirus rHVT-US2-JSVP2.

2. The recombinant turkey herpesvirus co-expressing the classical and variant strains of IBDV VP2 according to claim 1, characterized in that, The insertion method employs CRISPR / Cas9 gene editing technology.

3. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 as described in claim 1 or 2, characterized in that, Includes the following steps: (1) Construction of donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2: Using pCAGGS-FJVP2 plasmid as template, primers with SfiI restriction sites at both ends were designed, and the FJVP2 gene expression cassette SfiI-Pec-FJVP2-SfiI containing Pec promoter was amplified by PCR; the amplification product was ligated with pUC19-Lox2272-sgC3-eGFP vector digested with SfiI, transformed into DH5α competent cells, and obtained donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2 by restriction enzyme digestion and IFA identification; (2) Construction of recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2: donor plasmid pUC19-Lox2272-sgC3-eGFP-FJVP2, CRISPR / Cas9 editing plasmids pX459-sgC3 and pX330-HVT005 / 006-2 were co-transfected into chicken embryo primary fibroblasts and simultaneously infected with parental virus rHVT-US2-JSVP2. Recombinant fluorescent virus was obtained through non-homologous end ligation repair mechanism. The recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2 was purified by multiple plaque purifications on CEF cells using the limiting dilution method. (3) Construction of recombinant virus rHVT-JSVP2-FJVP2: CEF cells were transfected with Cre recombinase expression plasmid pcDNA3.1-Cre and infected with recombinant fluorescent virus rHVT-JSVP2-eGFP-FJVP2. The eGFP tag was knocked out by Cre / Lox2272 enzyme system. After plaque purification, the viral genome was extracted and identified by PCR, sequencing and IFA to confirm the correct insertion of JSVP2 and FJVP2 genes and stable protein expression, thus obtaining recombinant turkey herpesvirus rHVT-JSVP2-FJVP2.

4. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 according to claim 3, characterized in that, The method for constructing the pCAGGS-FJVP2 plasmid in step (1) is to ligate the VP2 gene fragment of the FJ strain with the enzyme-digested pCAGGS vector, then transform DH5α competent cells, extract and verify the pCAGGS-FJVP2 plasmid.

5. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 according to claim 4, characterized in that, The primer sequences for amplifying the VP2 gene fragment of the FJ strain are as follows: EcoR I-FJVP2-F: GGAATTCATGACAAACCTGCAAGAT; Not I-FJVP2-R: ATTTGCGGCCGCTTACCTCCTTAGGGCCCGGATTATG.

6. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 according to claim 3, characterized in that, The primers with SfiI restriction sites at both ends mentioned in step (1) are: Sfi I-pec-F: GACCGGCggccgcctaggccTTCCGCGCACATTTCCCCGA; Sfi I-pec-R: GACCGGCggccataatggccTGGCAGCCAGCATATGGGCA.

7. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 according to claim 3, characterized in that, The PCR amplification reaction program in step (1) is as follows: 30 cycles of 98℃ pre-denaturation for 30s, 98℃ for 10s, 58℃ for 5s, 72℃ for 10s, and extension at 72℃ for 1min. The reaction system consists of 2.5μL each of upstream and downstream primers, 2.5μL of template, 25μL of 2×Phanta Flash Master Mix, 10μL of PCR enhancer, and 7.5μL of ddH2O.

8. The method for constructing recombinant turkey herpesvirus co-expressing classical and variant strains of IBDV VP2 according to claim 3, characterized in that, The method also includes step (4) genetic stability verification; the specific steps are to passage the recombinant virus in chicken embryo primary fibroblasts for at least 15 generations, and identify the presence and protein expression of the exogenous gene by PCR and indirect immunofluorescence assay every 5 generations; the in vitro growth characteristics verification is to use Taqman qPCR to detect the replication kinetics of the recombinant virus and turkey herpesvirus vaccine virus in chicken embryo primary fibroblasts, and the in vitro replication rate of the recombinant virus is not significantly different from that of HVT.

9. The use of the recombinant turkey herpesvirus according to claim 1 or 2 in the preparation of a vaccine for the prevention of infectious bursal disease virus infection in chickens.

10. The application according to claim 9, characterized in that, The vaccine is used to simultaneously control both the classic super-virulent strain vvIBDV and the novel variant nVarIBDV of infectious bursal disease virus.

Images