Use of a biomaterial in the preparation of a preparation for treating African swine fever

Abstract

The application belongs to the field of pharmacy and relates to application of a biomaterial in preparation of a preparation for treating African swine fever. It is found that AZ1 can inhibit African swine fever virus by inhibiting ubiquitin-specific peptidase 25. The inhibition efficiency is high, the drug safety is good, and the application prospect is good.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical science and relates to the application of a biomaterial in the preparation of a formulation for the treatment of African swine fever. Background Technology

[0002] African swine fever virus (ASFV) infection has caused serious harm to my country's pig industry and resulted in significant economic losses. ASFV is characterized by its complex structure and diverse encoded proteins, and its infection and replication mechanisms are not yet fully understood, which to some extent limits the development and application of effective prevention and control strategies.

[0003] Currently, there are no reports on the application of the small molecule inhibitor AZ1 in ASFV infection. Summary of the Invention

[0004] In order to address the problems existing in the prior art, the first aspect of the present invention provides the application of a biomaterial in the preparation of a formulation for treating African swine fever or inhibiting African swine fever virus;

[0005] The biomaterials include:

[0006] Reagents for knocking out or editing the coding sequence of the ubiquitin-specific peptidase 25 gene;

[0007] Inhibitor of ubiquitin-specific peptidase 25 gene transcriptional activity;

[0008] Inhibitors of ubiquitin-specific peptidase 25 gene transcript activity; and

[0009] Ubiquitin-specific peptidase 25 inhibitor.

[0010] In some embodiments, the amino acid sequence of the ubiquitin-specific peptidase 25 is as shown in SEQ ID NO.3; or

[0011] The African swine fever mentioned is caused by the African swine fever virus strain Pig / HLJ / 2018; the African swine fever virus is the African swine fever virus strain Pig / HLJ / 2018.

[0012] The GenBank accession number for the genome of the African swine fever virus strain Pig / HLJ / 2018 is MK333180.1; the accession number for the African swine fever virus strain Pig / HLJ / 2018 is CCTCC NO: V 202403.

[0013] In some embodiments, the reagent for knocking out or editing the coding sequence of the ubiquitin-specific peptidase 25 gene includes sgRNA that targets the coding sequence of the ubiquitin-specific peptidase 25 gene.

[0014] The ubiquitin-specific peptidase 25 gene transcript activity inhibitor includes siRNA that targets the ubiquitin-specific peptidase 25 gene transcript; or

[0015] The ubiquitin-specific peptidase 25 inhibitors include monoclonal antibodies targeting ubiquitin-specific peptidase 25, polyclonal antibodies targeting ubiquitin-specific peptidase 25, and small molecule inhibitors of ubiquitin-specific peptidase 25.

[0016] In some embodiments, the target sequence of the sgRNA is the sequence shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0017] In some embodiments, the siRNA targeting the ubiquitin-specific peptidase 25 gene transcript is a first group of siRNAs, a second group of siRNAs, or a third group of siRNAs.

[0018] In the first group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.9, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.10;

[0019] In the second group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.11, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.12;

[0020] In the third group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.13, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.14.

[0021] In some embodiments, the small molecule inhibitor of ubiquitin-specific peptidase 25 includes:

[0022] AZ1;

[0023] AZ1 medicinal salt;

[0024] Compositions with AZ1 as the active ingredient; and

[0025] A composition using pharmaceutical salts of AZ1 as the active ingredient;

[0026] The molecular formula of AZ1 is as follows:

[0027] .

[0029] In some embodiments, the small molecule inhibitor of ubiquitin-specific peptidase 25 includes:

[0030] Compositions with AZ1 as the sole active ingredient; and

[0031] A composition in which the pharmaceutical salt of AZ1 is the sole active ingredient.

[0032] A second aspect of the present invention provides a siRNA, wherein the siRNA is a first siRNA pair, a second siRNA pair, or a third siRNA pair;

[0033] In the first siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.9, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.10;

[0034] In the second siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.11, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.12;

[0035] In the third siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.13, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.14.

[0036] The third aspect of the present invention provides a method for preparing a pig breed with reduced susceptibility to African swine fever virus, wherein the preparation method comprises: modifying the parent pigs by genetic engineering means to reduce or inactivate ubiquitin-specific peptidase 25 in the modified pig breed.

[0037] In some embodiments, the amino acid sequence of the ubiquitin-specific peptidase 25 is as shown in SEQ ID NO.3; or

[0038] The African swine fever mentioned is caused by the African swine fever virus strain Pig / HLJ / 2018; the GenBank accession number of the genome of the African swine fever virus strain Pig / HLJ / 2018 is MK333180.1; the preservation number of the African swine fever virus strain Pig / HLJ / 2018 is CCTCC NO: V 202403. Attached Figure Description

[0039] Figure 1 The results of the AZ1 cytotoxicity test on BK2258 cells are shown.

[0040] Figure 2 The result of AZ1 suppressing ASFV replication.

[0041] Figure 3 The test results show the effectiveness of AZ1 in inhibiting ASFV infection.

[0042] Figure 4 The growth curve of AZ1 inhibiting ASFV.

[0043] Figure 5 The results show the effects of AZ1 on the ASFV transcriptome.

[0044] Figure 6 The results show the expression levels of USP25 and USP28 in PAMs and BK2258 cells.

[0045] Figure 7 Results of the impact of USP25 knockout on ASFV infection rates.

[0046] Figure 8 The results show the effectiveness of targeting USP25.

[0047] Figure 9 Results of knocking down the effect of USP25 on ASFV infectivity.

[0048] Figure 10 The results show the effect of high expression of USP25 on ASFV infectivity.

[0049] Figure 11 The results show that AZ1 inhibits the replication of wild-type ASFV in PAMs cells. Detailed Implementation

[0050] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0051] The GenBank number of this invention lists the version number. If the serial version number is updated after the date of this patent application, the actual serial number shall be based on the corresponding version number recorded in the application documents.

[0052] Experimental drug information: AZ1, CAS number 2165322-94-9, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0053] The structure of AZ1 is shown in the molecular formula below.

[0054]

[0055] Gene: The porcine USP25 gene (GenBank number: XM_021070825.1) used in this invention was cloned from the cDNA of porcine primary alveolar macrophages.

[0056] Protein: The protein expressed by the USP25 gene is called ubiquitin-specific peptidase 25 (USP25).

[0057] The GenBank accession number for the wild-type African swine fever virus strain Pig / HLJ / 2018 (hereinafter referred to as HLJ / 18 strain) is MK333180.1. The isolated African swine fever virus strain Pig / HLJ / 2018 was deposited with a patent-approved depository. The depository is the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Wuhan, China; microbial accession number: CCTCC NO: V 202403; Chinese classification name: African Swine Fever Virus; English classification name: African Swine Fever Virus; deposit date: January 5, 2024; viability identification date: January 11, 2024. The culture name is: African swine fever virus ASFV HLJ / 18.

[0058] The African swine fever virus gene-deleted strain (ASFV HLJ / 18-7GD strain, abbreviated as HLJ / 18-7GD strain) was genetically engineered using Pig / HLJ / 2018 strain as the parent. It was modified by deleting the EP402R gene and six genes located in the MGF360 / 505 region, and carries both EGFP and mCherry dual fluorescent reporter genes. It is a weakened strain, prepared and preserved by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. The construction method of this strain is described in Chinese patent application document No. 201910348878.7. The accession number of HLJ / 18-7GD strain is CCTCC NO: V201924, the accession date is April 24, 2019; the identified viability date is April 24, 2019. The culture name is: African Swine Fever Virus rASFV△CD2V / 360-eGFP-mCherry; the Chinese classification name is: African Swine Fever Virus; the English classification name is: African Swine Fever Virus.

[0059] The African swine fever virus cell-adapted strain (ASFV HLJ18 / BK33 strain) is a genetically stable cell-adapted strain (attenuated strain) obtained by serially passaging the wild-type HLJ / 18 strain on wild boar kidney cells (Boar kidney cells, BK2258) up to the 33rd passage (F33), which was prepared and preserved by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The construction method of this strain is recorded in the patent application document of Chinese Patent Application No. CN202410268315.8. The passaged African swine fever virus HLJ18 / BK33 strain was submitted to a deposition institution recognized by the patent procedure for deposition. The deposition unit is China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial deposition number is CCTCC NO: V202404; the name of the culture is African swine fever virus ASFV HLJ18 / BK33; the Chinese taxonomic designation is African swine fever virus; the English taxonomic designation is African Swine Fever Virus; the deposition date is January 5, 2024; the survival confirmation date is January 11, 2024.

[0060] The BK2258 cell line is a cell line derived from wild boar kidney (Boar kidney cells), which was prepared and preserved by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The preparation method of this cell line is recorded in Chinese Patent Application No. CN202211137583.3. The isolated and cultured F20 passage cells of the BK2258 strain were submitted to a deposition institution recognized by the patent procedure for deposition. The deposition unit is China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial deposition number is CCTCC NO:C2022258; the name of the culture is wild boar kidney cell BK2258; the deposition date is August 10, 2022; the survival confirmation date is August 17, 2022.

[0061] Primary porcine alveolar macrophages (PAMs) were prepared and used by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences according to conventional methods.

[0062] Human embryonic kidney cell HEK293T was purchased from the Cell Bank of the Type Culture Collection Committee of the Chinese Academy of Sciences, and cultured and used according to conventional methods.

[0063] Example 1: AZ1 shows no obvious cytotoxicity to BK2258 cells

[0064] BK2258 cells were seeded in 96-well plates using DMEM medium, 100 µL per well, and cultured overnight. When the cell density reached 80%, cells were treated with different working concentrations (0 µM, 2.5 µM, 5 µM, 10 µM, and 15 µM) of AZ1 (DMSO solvent), 0.1 µL per well. After 96 hours of treatment, cell viability was determined using the CCK-8 assay, following the instructions for the Beyotime CCK-8 kit (#C0038). The 0 µM group served as a control, and the relative cell viability of each treatment group was calculated.

[0065] The results are as follows Figure 1 As shown, no decrease in BK2258 cell viability was observed even at concentrations as high as 15 µM with increasing AZ1 treatment concentrations. This result indicates that up to 15 µM AZ1 did not exhibit significant cytotoxicity to these cells.

[0066] Example 2: AZ1 exhibits a concentration-dependent inhibitory effect on the expression of ASFV viral proteins.

[0067] BK2258 cells were seeded in 12-well plates using DMEM medium, with 1 mL of medium per well. When the cell density reached 80%, the cells were infected with ASFV HLJ / 18-7GD strain at MOI = 0.5. Simultaneously, different working concentrations (0 µM, 2.5 µM, 5 µM, 10 µM, 15 µM) of AZ1 (DMSO solvent) were added to each well, with 1 µL added per well. After 96 hours, infected cells were collected to prepare immunoblot samples. Primary antibodies included mouse anti-African swine fever virus P72 protein monoclonal antibody IgG (self-made), mouse anti-African swine fever virus P30 protein monoclonal antibody IgG (self-made), and mouse anti-β-actin monoclonal antibody IgG (purchased from Nanjing Genscript Biotech Co., Ltd.). Secondary antibody was HRP-labeled goat anti-mouse IgG (purchased from Jackson ImmunoResearch). Immunoblotting analysis was performed using the ECL staining method. Meanwhile, DNA was extracted from the infection supernatant, and the relative content of the viral B646L gene fragment was detected by qPCR using primers F1 (SEQ ID NO.1) and R1 (SEQ ID NO.2).

[0068] The results are as follows Figure 2 As shown, treatment with 5 µM AZ1 significantly reduced the abundance of ASFV proteins (P72 and P30 proteins); increasing the AZ1 concentration to 10 µM further decreased viral protein levels; and at a AZ1 concentration of 15 µM, the signals of these two viral proteins were almost undetectable. Figure 2 A) indicates that AZ1 can inhibit viral protein expression. Furthermore, as the concentration of AZ1 treatment gradually increases, the viral genome copy number in the infection supernatant shows a significant gradient decreasing trend (A). Figure 2 B) indicates that AZ1 reduces viral genome replication in a dose-dependent manner.

[0069] Example 3: AZ1 significantly inhibits ASFV infection efficiency

[0070] BK2258 cells were seeded in 6-well plates using DMEM medium, with 2 mL of medium per well. When the cell density reached 80%, the cells were infected with ASFV HLJ / 18-7GD strain at an MOI of 0.5. Simultaneously, different working concentrations (0 µM, 2.5 µM, 5 µM, 10 µM, and 15 µM) of AZ1 (DMSO solvent) were added to each well, at a volume of 2 µL. After 96 hours, the cells were imaged using a fluorescence microscope. Furthermore, cells were trypsinized and collected, and EGFP-positive cells were quantitatively detected using flow cytometry. Data analysis was performed using FlowJo software.

[0071] The results are as follows Figure 3 As shown (scale bar is 200 µm). Fluorescence microscopy revealed that cells infected with the ASFV HLJ / 18-7GD strain expressed mCherry, and the number of mCherry-positive cells decreased significantly with prolonged exposure to AZ1. Figure 3 A). Further flow cytometry analysis revealed that the proportion of EGFP-positive cells in the untreated infection group (0 µM AZ1) reached 25%, while the infection positivity rates in the AZ1-treated groups (5 µM, 10 µM, and 15 µM) decreased significantly to 18%, 7.7%, and 4.2%, respectively. Figure 3 (B, 3C). The above results indicate that AZ1 can significantly reduce the infection efficiency of ASFV in cells.

[0072] Example 4: AZ1 inhibits the multi-step growth and replication of ASFV

[0073] BK2258 cells were seeded in 6-well plates using DMEM medium, with 2 mL of medium per well. When the cell density reached 80%, the cells were infected with the ASFV HLJ18 / BK33 strain at MOI = 0.5, and simultaneously treated with either DMSO or AZ1 (10 µM, DMSO solvent), at 2 µL per well. Supernatants were collected at different time points post-infection (12 h, 24 h, 36 h, 48 h, 60 h, and 72 h) for DNA extraction. The relative abundance of the viral B646L gene fragment was detected by qPCR using primers F1 (SEQ ID NO. 1) and R1 (SEQ ID NO. 2).

[0074] The results are as follows Figure 4 As shown, the viral genome copy number in the supernatant increased significantly with prolonged ASFV infection time; however, in the presence of AZ1, the increase in viral genome copy number in the supernatant was significantly slowed down. Figure 4 This result indicates that AZ1 can delay the multi-step growth process of ASFV, thereby effectively inhibiting viral replication.

[0075] Example 5: Inhibitory effect of AZ1 on overall ASFV transcriptome expression

[0076] BK2258 cells were seeded in 6-well plates with 2 mL of DMEM medium per well and cultured overnight. 2 µL of DMSO or AZ1 (10 µM, DMSO solvent) was added to each well. Cells were infected with the ASFV HLJ18 / BK33 strain at an MOI of 0.5, with a control group (DMSO added, uninfected). Thirty-six hours post-infection, cells were collected and rapidly frozen at -80°C. Transcriptome sequencing was then performed on an Illumina NovaSeq 6000 platform using a paired-end sequencing strategy.

[0077] Raw sequencing data were processed using FASTP software to remove low-quality reads and adapter sequences. The resulting high-quality clean data were then aligned using HISAT2 (v2.2.1) to the host wild boar (Sus scrofa) reference genome (Sscrofa11.1; GCF_000003025.6) and the ASFV HLJ / 18 strain reference genome (GenBank accession number: MK333180.1). Gene expression levels were counted using featureCounts (v2.0.6) from the Subread package. Gene expression levels were normalized using the number of model fragments per thousand exons per million aligned reads (FPKM) for subsequent comparative analysis of gene expression profiles.

[0078] The results are as follows Figure 5 As shown. Analysis of over 180 genes of ASFV revealed that, under infection conditions, more than 170 viral genes showed significant expression; however, after AZ1 treatment, the transcriptional levels of these viral genes generally decreased significantly. Figure 5 This result indicates that AZ1 can effectively suppress the expression abundance of ASFV in almost the entire transcriptome.

[0079] Example 6: Analysis of the expression levels of USP25 and USP28 in ASFV-susceptible cells

[0080] To investigate the mechanism by which AZ1 inhibits ASFV, considering that AZ1 can simultaneously target ubiquitin-specific peptidase 25 (USP25) and ubiquitin-specific peptidase 28 (USP28), this invention examined their expression levels in ASFV-susceptible host cells (BK2258 and PAMs) to clarify whether these two molecules play a role in ASFV replication. Transcriptomic data from K2258 and PAMs cells were measured using the same method as in Example 5. Statistical analysis of the transcriptomic data from BK2258 and PAMs cells showed that the transcriptional level of USP25 was significantly higher than that of USP28 in both susceptible cell types. Figure 6 This result suggests that USP25 may play a more important role than USP28 in the ASFV infection process.

[0081] Example 7: Knockout of USP25 in host cell lines significantly inhibits ASFV replication.

[0082] (1) Design and plasmid construction of sgRNA targeting porcine USP25

[0083] The single guide RNA (sgRNA) sequence for the porcine (Sus scrofa) Usp25 gene (GenBank ID: XM_021070825.1) was designed using the CRISPOR online program (https: / / crispor.gi.ucsc.edu / ).

[0084] The protein sequence encoded by the porcine USP25 gene is shown in SEQ ID NO.3.

[0085] The following pig Usp25 sgRNA target sequences were designed: sgRNA-1 (SEQ ID NO.4), sgRNA-2 (SEQ ID NO.5), and sgRNA-3 (SEQ ID NO.6).

[0086] Following the method described in Reference 1, and in accordance with the reagent supplier's instructions, lentiCRISPRv2 vectors (Addgene, #52961) carrying the aforementioned three sgRNA target sequences were prepared and named plasmid 1, plasmid 2, and plasmid 3.

[0087] Document 1: Sanjana, N., Shalem, O. & Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11, 783–784 (2014). https: / / doi.org / 10.1038 / nmeth.3047; PubMed 25075903).

[0088] (2) Construction of USP25 knockout BK2258 cell line

[0089] HEK293T cells were co-transfected with 2.5 μg of psPAX2 plasmid (Addgene, #12260), 1 μg of pMD2.G plasmid (Addgene, #12259), and 3 μg of lentiCRISPRv2 plasmid expressing sgRNAs (1 μg each of plasmid 1, plasmid 2, and plasmid 3) via PEI (Polysciences, #23966-100). 72 hours after transfection, the culture supernatant was collected and filtered through a 0.45 μm filter to remove cell debris. The filtered viral supernatant was mixed with an equal volume of fresh DMEM complete growth medium, and polybrene was added to a final concentration of 8 μg / mL. This mixture was then added to target BK2258 cells seeded in 6-well plates. 24 hours after transduction, the medium was replaced with fresh DMEM, and the cells were cultured for another 24 hours. The cells were then expanded to 10 cm culture dishes for antibiotic selection (passage 5) to obtain a gene-editing cell bank. To obtain USP25 knockout cell clones, single cells were sorted into 96-well plates using flow cytometry. Individual clones were expanded and cultured, and their effectiveness was verified using Western blotting with an anti-USP25 antibody. Genomic DNA was further extracted from the successfully knocked-out USP25 clones and sequenced for confirmation.

[0090] (3) Assess ASFV replication in USP25 knockout cell lines

[0091] Wild-type (WT) and USP25-deficient (USP25-KO) BK2258 cells were infected with the ASFVHLJ / 18-7GD strain at MOI = 0.5. Ninety-six hours after infection, cells were collected for flow cytometry analysis to assess changes in infection positivity. Simultaneously, immunoblot samples were prepared using mouse anti-African swine fever virus P72 protein monoclonal antibody IgG (self-made), mouse anti-African swine fever virus P30 protein monoclonal antibody IgG (self-made), mouse anti-pig USP25 protein monoclonal antibody (purchased from Santa Cruz), and mouse anti-β-actin monoclonal antibody IgG (purchased from Nanjing Genscript Biotech) as primary antibodies, and HRP-labeled goat anti-mouse IgG as secondary antibody (purchased from Jackson ImmunoResearch). Immunoblotting was performed using the ECL method. In addition, DNA was extracted from the infection supernatant, and the relative content of the viral B646L gene fragment was detected by qPCR using primers F1 (SEQ ID NO.1) and R1 (SEQ ID NO.2).

[0092] The results are as follows Figure 7 As shown. Flow cytometry results showed that the ASFV strain achieved an infection rate of 42% in WT cells, while it was only 14% in USP25-KO cells. Figure 7 A) indicates that knocking out USP25 reduces the infection efficiency of ASFV in host cells. Immunoblotting results further confirmed that USP25 is not expressed in USP25-KO cells, and the expression level of ASFV viral proteins is significantly downregulated in these cells (A). Figure 7 B). Meanwhile, qPCR analysis of the infection supernatant showed that USP25 deletion significantly inhibited ASFV viral genome replication (B). Figure 7 C). The above results demonstrate that the expression of USP25 protein in host cells plays a crucial promoting role in ASFV replication.

[0093] Example 8: Knockdown of USP25 in porcine primary cells using siRNA

[0094] (1) Design and synthesize siRNA targeting porcine USP25

[0095] A pair of non-targeted control (NC) siRNAs and three pairs of specific siRNAs were designed and synthesized targeting the porcine (Sus scrofa) Usp25 gene (GenBank ID: XM_021070825.1). NC consists of NC-F (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.7) and NC-R (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.8). The first pair of specific siRNAs (siUSP25-1) consists of siUSP25-1-F (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.9) and siUSP25-1-R (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.10). The second pair of specific siRNAs (siUSP25-2) consists of siUSP25-2-F (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.11) and siUSP25-2-R (with a TT-protected base at the 3' end, its partial RNA sequence is shown in SEQ ID NO.8). The third pair of specific siRNAs (siUSP25-3) consists of siUSP25-3-F (with TT protective bases at the 3' end, and its partial RNA sequence is shown in SEQ ID NO.13) and siUSP25-3-R (with TT protective bases at the 3' end, and its partial RNA sequence is shown in SEQ ID NO.14).

[0096] Porcine alveolar macrophages (PAMs) were seeded in 6-well plates and cultured for 6 hours in RPMI 1640 medium, with 2 mL of medium per well. siRNA transfection was performed using SuperTrans transfection reagent (Genecfps, #TRS002) according to the manufacturer's instructions, using each pair of sex siRNAs. Twelve hours after transfection, the medium was replaced with fresh RPMI 1640 growth medium, and the cells were cultured for another 48–72 hours.

[0097] (2) Evaluate the knockdown effect of siRNA on USP25

[0098] Total RNA was extracted from cells using the RNAiso Plus kit (TaKaRa, #9108) and quantified using a NanoDrop spectrophotometer. 1 μg of RNA was taken from each sample and analyzed using PrimeScript. TM The RT kit (containing gDNA Eraser) (TaKaRa, #RR047A) reverse transcribed RNA into cDNA. THUNDERBIRD was used. TM SYBR ®qPCR Mix (Toyobo, #QPS-201) was used with porcine USP25 forward primer F2 (SEQ ID NO.15) / porcine USP25 reverse primer R2 (SEQ ID NO.16) and porcine GAPDH forward primer F3 (SEQ ID NO.17) / porcine GAPDH reverse primer R3 (SEQ ID NO.18) in ABIQuantStudio. TM 5. Real-time quantitative PCR was performed on a PCR system. Using Gapdh as an internal control, the relative mRNA expression level of the specified gene was calculated using the classic 2^(-ΔΔCt) method.

[0099] The results are as follows Figure 8 As shown. In PAMs cells, transfection with three pairs of siRNAs targeting USP25 significantly downregulated the mRNA level of USP25 (as shown). Figure 8 This indicates that these siRNAs all have good USP25 expression interference capabilities and can be used for subsequent ASFV infection experiments.

[0100] Example 9: Knocking down USP25 in primary porcine cells inhibits ASFV replication.

[0101] Following the method described in Example 8, three pairs of siRNAs were transfected into PAMs cells. Forty-eight hours after transfection, cells were infected with the ASFV HLJ / 18-7GD strain with an MOI of 1 for 72 hours. After infection, cells were collected for fluorescence microscopy imaging, and DNA was extracted from the infection supernatant. The relative abundance of the viral B646L gene fragment was detected by qPCR using primers F1 (SEQ ID NO.1) and R1 (SEQ ID NO.2).

[0102] The results are as follows Figure 9 As shown. In the control siRNA transfection group (NC), there were more mCherry-positive cells, indicating a higher number of cells infected with ASFV; while in each USP25 siRNA transfection group (siUSP25-1, siUSP25-2, siUSP25-3), the number of infected cells was significantly reduced. Figure 9 A). PCR detection results of viral genome in the supernatant showed that the viral genome copy number produced by each USP25 siRNA group was significantly lower than that of the control siRNA group ( Figure 9 B). The above results indicate that knocking down USP25 expression in primary porcine PAMs cells significantly inhibits ASFV replication in these cells.

[0103] Example 10: Overexpression of USP25 in host cells promotes ASFV infection.

[0104] (1) Construction of the USP25-Flag expression vector

[0105] Using PAMs cell cDNA as a template, PCR amplification was performed using primers F4 (SEQ ID NO.19) and R4 (SEQ ID NO.20) to obtain the target fragment. Homologous recombination was performed using a homologous recombination kit (purchased from Novizan Biotechnology), where the gel-purified amplification product was combined with a linearized pCDH-CMV-MCS-EF1-Puro vector (purchased from Miaoling Biotechnology) carrying a Flag tag, digested with XbaⅠ and BamHⅠ, according to the kit instructions. The recombinant product was transformed into *E. coli* Stbl3 competent cells, and the plasmid was extracted. Sanger sequencing was used to verify the correctness of the recombinant sequence. Sequencing results showed that the inserted fragment was completely identical to the coding sequence of the porcine USP25 gene. Because the backbone vector carries a Flag tag, the recombinant vector expresses the Flag-tagged USP25 protein and was named USP25-Flag.

[0106] (2) Construction of BK2258 cell line stably expressing USP25-Flag

[0107] 2.5 μg psPAX2 (Addgene, #12260), 1.0 μg pMD2.G (Addgene, #12259), and 3 μg USP25-Flag recombinant plasmid or empty vector control plasmid were co-transfected into HEK293T cells cultured in DMEM medium via PEI (Polysciences, #23966-100). 72 hours after transfection, the culture supernatant was collected and filtered through a 0.45 μm filter to remove cell debris. The filtered viral supernatant was mixed with an equal volume of fresh DMEM complete growth medium, and polybrene was added to a final concentration of 8 μg / mL. The mixture was then added to 10 μL of DMEM medium-cultured BK2258 cells seeded in 6-well plates. 24 hours after transduction, the medium was replaced with fresh DMEM growth medium, and the cells were cultured for another 24 hours. The cells were then expanded to 10 cm culture dishes for antibiotic screening (5 generations) to obtain empty vector control cell lines and cell lines that stably express USP25-Flag.

[0108] (3) Assessment of the effect of USP25 overexpression on ASFV replication

[0109] In the control cell line (BK2258 cells) and the USP25-Flag overexpressing cell line, DMEM medium was used to infect the ASFV HLJ / 18-7GD strain with an MOI of 0.5. After 72 hours of infection, cells were digested with trypsin and collected, and the positivity rate of ASFV-infected cells was detected by flow cytometry.

[0110] The results are as follows Figure 10 As shown. Flow cytometry analysis results showed that the infection positivity rate of ASFV HLJ / 18-7GD strain in the control cell line was 12%; while in the USP25-Flag overexpressing cell line, the infection positivity rate increased to 18%. Figure 10 (A, 10B). The above results indicate that USP25 overexpression promotes ASFV replication.

[0111] Example 11: AZ1 significantly inhibits wild-type ASFV replication in PAMs cells

[0112] Porcine alveolar macrophages (PAMs) were seeded into 12-well plates and cultured for 6 hours in RPMI 1640 medium, with 1 mL of medium per well. The cells were infected with the wild-type ASFV HLJ / 18 strain at an MOI of 0.1, and simultaneously treated with either DMSO or AZ1 (10 µM, DMSO solvent), at a volume of 1 µL per well. The supernatant was collected 96 hours post-infection, DNA was extracted, and the relative abundance of the viral B646L gene fragment was detected by qPCR using primers F1 (SEQ ID NO.1) and R1 (SEQ ID NO.2).

[0113] The results are as follows Figure 11 As shown, the ASFV HLJ / 18 strain exhibited good replication ability in PAMs cells; however, after AZ1 treatment, the virogen copy number in the supernatant was significantly reduced. This result indicates that AZ1 can effectively inhibit the replication of the wild-type ASFV HLJ / 18 strain in PAMs cells.

[0114] This invention uses two attenuated strains, HLJ / 18-7GD and HLJ18 / BK33, for ASFV inhibition experiments, ensuring better laboratory safety. Using the HLJ / 18-7GD strain makes it easier to detect viral load via fluorescence. Both the HLJ / 18-7GD and HLJ18 / BK33 strains are derived from the HLJ / 18 strain, and AZ1 can also significantly inhibit the replication of the HLJ / 18 strain.

[0115] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or its equivalents are included in this invention.

[0116] sequence list

[0117] F1 (SEQ ID NO.1): CTATGTGGAGCCGGAGACAG

[0118] R1 (SEQ ID NO.2): CAAGTCGCCGGTATTCACTC

[0119] The protein sequence encoded by the porcine USP25 gene (SEQ ID NO.3)

[0120]

[0121] sgRNA-1 (SEQ ID NO.4):GCTGATTCAAAAACGTCTGC

[0122] sgRNA-2 (SEQ ID NO.5): CAAGGCTTGCTGTAGTATCT

[0123] sgRNA-3 (SEQ ID NO.6): CTGATGTACCGATCATTGCC

[0124] NC-F (SEQ ID NO.7):UUCUCCGAACGUGUCACGU

[0125] NC-R (SEQ ID NO.8): ACGUGACACGUUCGGAGAA

[0126] siUSP25-1-F (SEQ ID NO.9):GGGAGUGCUUGAAGGUAAA

[0127] siUSP25-1-R (SEQ ID NO.10):UUUACCUUCAAGCACUCCC

[0128] siUSP25-2-F (SEQ ID NO.11):GGCAAUACUUGCUGGUUUA

[0129] siUSP25-2-R (SEQ ID NO.12): UAAACCAGCAAGUAUUGCC

[0130] siUSP25-3-F (SEQ ID NO.13):GGCUCUUGUUGGAAUAGAA

[0131] siUSP25-3-R (SEQ ID NO.14):UUCUAUUCCAACAAGAGCC

[0132] Porcine USP25 forward primer F2 (SEQ ID NO.15): CAGCTGAGAGAAATTACTGGCATT

[0133] Porcine USP25 reverse primer R2 (SEQ ID NO.16): CACCGCTAGCTCCAAGTTTC

[0134] Porcine GAPDH forward primer F3 (SEQ ID NO.17): ACCCAGAAGACTGTGGATGG

[0135] R3(SEQ ID NO.18):ACGCCTGCTTCACCACCTTC

[0136] F4(SEQ ID NO.19):CCTCCATAGAAGATTCTAGAatgaccgtggagcagaacg

[0137] R4(SEQ ID NO.20):TCGTCGTCCTTGTAGTCGGATCCtcttccatcagcaggagttcg

Claims

1. The use of a biomaterial in the preparation of formulations for treating African swine fever or inhibiting African swine fever virus; The biomaterials include: Reagents for knocking out or editing the coding sequence of the ubiquitin-specific peptidase 25 gene; Inhibitor of ubiquitin-specific peptidase 25 gene transcriptional activity; Inhibitors of ubiquitin-specific peptidase 25 gene transcript activity; and Ubiquitin-specific peptidase 25 inhibitor.

2. The application as described in claim 1, characterized in that, The amino acid sequence of the ubiquitin-specific peptidase 25 is shown in SEQ ID NO. 3; or The African swine fever mentioned is caused by the African swine fever virus strain Pig / HLJ / 2018; the African swine fever virus is the African swine fever virus strain Pig / HLJ / 2018. The GenBank accession number for the genome of the African swine fever virus strain Pig / HLJ / 2018 is MK333180.1; the accession number for the African swine fever virus strain Pig / HLJ / 2018 is CCTCC NO: V 202403.

3. The application as described in claims 1 and 2, characterized in that, The reagents used to knock out or edit the coding sequence of the ubiquitin-specific peptidase 25 gene include sgRNAs that target the coding sequence of the ubiquitin-specific peptidase 25 gene. The ubiquitin-specific peptidase 25 gene transcript activity inhibitor includes siRNA that targets the ubiquitin-specific peptidase 25 gene transcript; or The ubiquitin-specific peptidase 25 inhibitors include monoclonal antibodies targeting ubiquitin-specific peptidase 25, polyclonal antibodies targeting ubiquitin-specific peptidase 25, and small molecule inhibitors of ubiquitin-specific peptidase 25.

4. The application as described in claim 3, characterized in that, The target sequence of the sgRNA is the sequence shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.

6.

5. The application as described in claim 3, characterized in that, The siRNA that targets the ubiquitin-specific peptidase 25 gene transcript is a first group of siRNAs, a second group of siRNAs, or a third group of siRNAs. In the first group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.9, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.10; In the second group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.11, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.12; In the third group of siRNAs, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.13, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.

14.

6. The application as described in claim 3, characterized in that, The small molecule inhibitors of ubiquitin-specific peptidase 25 include: AZ1; AZ1 medicinal salt; Compositions with AZ1 as the active ingredient; and A composition using pharmaceutical salts of AZ1 as the active ingredient; The molecular formula of AZ1 is as follows: 。 7. The application as described in claim 6, characterized in that, The small molecule inhibitors of ubiquitin-specific peptidase 25 include: Compositions with AZ1 as the sole active ingredient; and A composition in which the pharmaceutical salt of AZ1 is the sole active ingredient.

8. An siRNA, wherein the siRNA is a first siRNA pair, a second siRNA pair, or a third siRNA pair; In the first siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.9, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.10; In the second siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.11, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.12; In the third siRNA pair, the upstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.13, and the downstream nucleic acid molecule is formed by adding TT protective bases to the 3' end of the RNA sequence shown in SEQ ID NO.

14.

9. A method for preparing a pig breed with reduced susceptibility to African swine fever virus, wherein the preparation method comprises: modifying the parent pigs through genetic engineering to reduce or inactivate ubiquitin-specific peptidase 25 in the modified pig breed.

10. The preparation according to claim 9, characterized in that, The amino acid sequence of the ubiquitin-specific peptidase 25 is shown in SEQ ID NO. 3; or The African swine fever mentioned is caused by the African swine fever virus strain Pig / HLJ / 2018; the GenBank accession number of the genome of the African swine fever virus strain Pig / HLJ / 2018 is MK333180.1; the preservation number of the African swine fever virus strain Pig / HLJ / 2018 is CCTCC NO: V 202403.

Images