A quinazoline compound, compositions and uses thereof

Abstract

The application discloses a quinazoline compound, a composition and application thereof, and belongs to the field of chemical medicines. The application provides a quinazoline compound as shown in formula (I) or formula (II) or a pharmaceutically acceptable salt, a prodrug, a hydrate or a solvate compound, a crystal form, a stereoisomer or an isotopic variant thereof, which is used for preventing or treating TXNIP-mediated related diseases.

Description

Technical Field

[0001] This invention belongs to the field of chemical medicine, specifically relating to a quinazoline compound, a composition, and its uses. Background Technology

[0002] Thioredoxin-interacting protein (TXNIP) is a 46 kDa protein composed of 39 amino acid residues, expressed in various tissues. Its gene is located on chromosome 1q21.1 and is highly conserved across species. TXNIP is a ubiquitously expressed cellular redox regulator and a top-level gene for glucose-induced responses in human pancreatic islet gene expression microarray studies. TXNIP is a key mediator of glucose toxicity induction.

[0003] TXNIP is the most upregulated gene in human pancreatic islets, particularly in cells exposed to high glucose levels. The promoter of TXNIP in pancreatic β-cells contains a binding site for carbohydrate response element-binding protein (ChREBP). In cardiac and skeletal muscle cells, glucose-induced TXNIP expression is primarily regulated by Mondo A, a homolog of ChREBP. Increased glucose levels promote the production of glycolytic intermediates, which can induce the ChREBP / Mondo A-Max-like protein (MIx) complex to bind to ChRE on the TXNIP promoter, thereby increasing promoter activity and promoting TXNIP expression.

[0004] Upregulation of TXNIP expression is associated with changes in insulin sensitivity, insulin secretion, glucose uptake, pancreatic islet cell apoptosis, and increased hepatic gluconeogenesis, indicating its important role in the progression of diabetes. A large-scale population study showed that TXNIP expression in the skeletal muscle of diabetic and prediabetic patients was higher than in healthy individuals, and that TXNIP expression was negatively correlated with glucose uptake. Therefore, inhibiting TXNIP can protect pancreatic β-cells and help restore their ability to secrete insulin, reducing insulin resistance in adipose tissue and the liver. Thus, inhibiting TXNIP overexpression is a potentially effective method for the prevention and treatment of type 1 and type 2 diabetes.

[0005] A novel compound, SRI-37330, has been reported, with the structure shown below:

[0006]

[0007] SRI-37330 can treat and inhibit glucagon secretion and function, reduce hepatic glucose production, and reverse hepatic steatosis. SRI-37330 also shows in vivo potential, exhibiting favorable pharmacokinetic properties and good tolerability in healthy mice. In the context of streptozotocin-induced diabetes, oral administration of SRI-37330 can promote β-cell survival, prevent diabetes, and even significantly improve obvious diabetes. However, the activity and metabolic stability of this small molecule inhibitor still need further improvement. Summary of the Invention

[0008] [Technical Issues]

[0009] This invention provides a novel quinazoline compound with superior inhibitory activity and better metabolic stability.

[0010] [Technical Solution]

[0011] To address the above problems, the present invention provides the following technical solution:

[0012] One object of the present invention is to provide quinazoline compounds with the structure shown in formula (I) or (II), or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope-labeled compounds, or prodrugs thereof:

[0013]

[0014] In the formula:

[0015] n is independently selected from 0 or 1;

[0016] R1 is independently selected from C1-C4 straight-chain or branched alkyl groups and C3-C6 cycloalkyl groups;

[0017] R2 is independently selected from H, halogen, CN, SF5, C1-C4 straight-chain or branched alkyl, C3-C6 cycloalkyl, C1-C4 alkoxy, and halogenated C1-C4 alkyl.

[0018] In one embodiment of the present invention, the halogenated C1-C4 alkyl group may specifically be trifluoromethyl (-CF3).

[0019] In one embodiment of the present invention, the above-mentioned quinazoline compounds may be specifically selected from:

[0020]

[0021] In one embodiment of the present invention, the pharmaceutically acceptable salt is an inorganic salt or an organic salt. The inorganic salt is selected from hydrochloride, hydrobromide, hydroiodide, sulfate, hydrogen sulfate, nitrate, phosphate, and acid phosphate. The organic salt is selected from acetate, trifluoroacetate, propionate, pyruvate, glycolate, oxalate, malonate, fumarate, maleate, lactate, malate, citrate, tartrate, methanesulfonate, sulfonate, benzenesulfonate, and salicylate.

[0022] The present invention also provides the use of compounds of the above general formulas (I) and (II) or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope labels or prodrugs thereof in the preparation of medicaments for the prevention or treatment of diseases related to glucose hormone levels.

[0023] The present invention also provides the use of compounds of the above general formulas (I) and (II) or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope labels or prodrugs in the preparation of medicaments for the prevention or treatment of TXNIP-mediated diseases.

[0024] The diseases mentioned include: diabetes and related diseases (such as type 1 diabetes), type 2 diabetes, gestational diabetes, impaired glucose control, impaired glucose tolerance or prediabetes, insulin resistance, hyperlipidemia, non-alcoholic fatty liver disease, diabetic complications including diabetic nephropathy, neuropathy, retinopathy, cardiomyopathy and cardiovascular disease, as well as pancreatic β-cell loss or pancreatic islet dysfunction (including dysregulation of insulin and / or glucose hormone production or secretion) or diseases related to endoplasmic reticulum stress and / or cellular oxidative stress.

[0025] The present invention also provides methods for preparing compounds of general formulas (I) and (II).

[0026] The present invention also provides pharmaceutical compositions comprising the above-described compounds of general formulas (I) and (II) of the present invention or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope labels or prodrugs, and pharmaceutical excipients.

[0027] In one embodiment of the present invention, the pharmaceutical excipient includes a pharmaceutically acceptable carrier, excipient, or diluent.

[0028] Pharmaceutically acceptable carriers include microspheres, nanoparticles, and liposomes.

[0029] In one embodiment of the present invention, the dosage form of the pharmaceutical composition includes injection, lyophilized powder for injection, suspension, implant, embolization, capsule, tablet, pill and oral liquid.

[0030] [Beneficial Effects]

[0031] The compounds of this invention can be used as inhibitors of conserved thioredoxin-interacting protein (TXNIP), exhibiting significantly enhanced inhibitory activity compared to the positive control (SRI-37330), and can be used to treat and / or prevent diseases related to glucose hormone levels.

[0032] Furthermore, the compounds or their salts of the present invention have virtually no side effects and exhibit good drug metabolic stability compared to the positive control (SRI-37330). Therefore, the compounds designed in this invention have excellent prospects for development and application. Detailed Implementation

[0033] The technical solution of the present invention will be described in detail below with reference to the embodiments.

[0034] In this invention, “administering” or “giving” an individual compound means providing the compound of this invention to an individual in need of treatment.

[0035] The term "pharmaceutically acceptable salt" refers to a salt that, within reasonable medical judgment, is suitable for contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic reactions, etc., and has a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art.

[0036] <Pharmaceutical Composition>

[0037] The present invention also provides pharmaceutical compositions comprising the above-described compounds or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope labels, and pharmaceutically acceptable carriers, excipients, or diluents thereof.

[0038] The compounds of the present invention or pharmaceutically acceptable salts thereof can be formulated into solid dosage forms for oral administration, including, but not limited to, capsules, tablets, pills, powders, granules, etc. In these solid dosage forms, the compounds of the present invention are mixed as active ingredients with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate. Or it may be mixed with the following components: (1) fillers or solubilizers, such as starch, lactose, sucrose, glucose, mannitol and silica; (2) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, gum arabic; (3) humectants, such as glycerin; (4) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginic acid, certain silicates and sodium carbonate; (5) slowing agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glyceryl monostearate; (8) adsorbents, such as kaolin; (9) lubricants, such as talc, calcium stearate, solid polyethylene glycol, sodium dodecyl sulfate, etc., or mixtures thereof. Buffers may also be included in capsules, tablets and pills.

[0039] The solid dosage forms, such as tablets, sugar pills, capsules, pellets, and granules, can be coated or microencapsulated with coating and shell materials such as enteric coatings and other materials known in the art. They may contain opaque agents, and the release of the active ingredient from such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active ingredient may also be formed into microcapsules with one or more of the excipients described above.

[0040] The compounds of the present invention or their pharmaceutically acceptable salts can be formulated into liquid dosage forms for oral administration, including, but not limited to, pharmaceutically acceptable emulsions, solutions, suspensions, syrups, tinctures, etc. In addition to the compounds or their pharmaceutically acceptable salts as active ingredients, the liquid dosage forms may contain inert diluents conventionally used in the art, such as water and other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn oil, olive oil, castor oil, sesame oil, etc., or mixtures thereof. Besides these inert diluents, the liquid dosage forms of the present invention may also include conventional adjuvants, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and fragrances.

[0041] The suspending agent includes, for example, ethoxylated octadecyl alcohol, polyoxyethylene sorbitol, and dehydrated sorbitol, microcrystalline cellulose, agar, or mixtures thereof.

[0042] The compounds of this invention and their pharmaceutically acceptable salts can be formulated into dosage forms for parenteral injection, including, but not limited to, physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions and dispersions. Suitable carriers, diluents, solvents, and excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0043] The compounds of the present invention or pharmaceutically acceptable salts thereof can be formulated into dosage forms for topical administration, including ointments, powders, suppositories, drops, sprays, and inhalers. The compounds of the present invention or pharmaceutically acceptable salts thereof, as active ingredients, are mixed under sterile conditions with a physiologically acceptable carrier and optionally with preservatives, buffers, and propellants, if necessary.

[0044] The pharmaceutical compositions of the present invention comprise the above-described compound or a pharmaceutically acceptable salt thereof as the active ingredient, and a pharmaceutically acceptable carrier, excipient, and diluent. In preparing the pharmaceutical compositions, the compound of the present invention or a pharmaceutically acceptable salt thereof is typically mixed with a pharmaceutically acceptable carrier, excipient, or diluent. The content of the compound or its pharmaceutically acceptable salt may be 0.01-1000 mg, for example 0.05-800 mg, 0.1-500 mg, 0.01-300 mg, 0.01-200 mg, 0.05-150 mg, 0.05-50 mg, etc.

[0045] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. The technical solutions of the present invention will be described in detail below with reference to the embodiments.

[0046] The following examples are illustrative and not limiting of the methods for synthesizing the compounds. All temperatures are in degrees Celsius. Unless otherwise specified, all evaporations were performed under reduced pressure. Unless otherwise specified, reagents were purchased from commercial suppliers and used without further purification. The structures of the final products, intermediates, and starting materials were confirmed by standard analytical methods, such as elemental analysis and spectroscopic characterization, such as MS and NMR. Abbreviations used are conventional abbreviations in the art.

[0047] For the compounds described above in this invention, the linking groups and substituents have a significant impact on the pharmacodynamic properties of the compounds. Although this disclosure has been described in some detail and some specificity has been used with respect to several described embodiments, it is not intended to limit it to any such details or embodiments or any particular embodiment, but should be interpreted with reference to the appended claims in order to provide the broadest possible interpretation of such claims in light of the prior art, and thus effectively cover the intended scope of this disclosure.

[0048] Preparation of tert-butyl 3-(cyclopropanesulfonamide methyl)piperidine-1-carboxylate (intermediate a-2):

[0049]

[0050] At room temperature, triethylamine (1.80 g, 18.66 mmol) and cyclopropanesulfonyl chloride (1.96 g, 14.0 mmol) were added to a stirred solution of tert-butyl 3-(aminomethyl)piperidine-1-carboxylate (a-1, CAS No: 162167-97-7, 2.00 g, 9.33 mmol) in dichloromethane (20 mL). The reaction mixture was stirred at room temperature for 16 hours. After complete consumption, the reaction mixture was poured into water (50 mL) and extracted with dichloromethane (50 mL x 2). The solution was dried over anhydrous sodium sulfate with saturated sodium bicarbonate (40 mL x 3), water (40 mL x 3), and brine (40 mL x 3), and concentrated under reduced pressure to give intermediate a-2: 1.52 g, yield: 74.4%.

[0051] MS-ESI (m / z): 319.19 [M+l] + .

[0052] Preparation of (R)-3-(methanesulfonamide methyl)piperidine-1-carboxylic acid tert-butyl ester (intermediate b-2):

[0053]

[0054] Following the synthetic method for intermediate a-2, b-1 (CAS No: 140645-23-4) was reacted with methanesulfonyl chloride to give a white solid compound b-2: 1.37 g, yield: 76.3%, MS-ESI (m / z): 293.12 [M+l]. + .

[0055] Preparation of tert-butyl 3-(cyclopropanesulfonamide)piperidine-1-carboxylate (intermediate c-2):

[0056]

[0057] At room temperature, triethylamine (1.90 g, 19.98 mmol) and cyclopropanesulfonyl chloride (2.10 g, 15.0 mmol) were added to a stirred solution of tert-butyl 3-aminopiperidine-1-carboxylate (c-1, CAS No: 184637-48-7, 2.00 g, 9.99 mmol) in dichloromethane (20 mL). The reaction mixture was stirred at room temperature for 16 hours. After complete consumption, the reaction mixture was poured into water (50 mL) and extracted with dichloromethane (50 mL x 2). The solution was dried over anhydrous sodium sulfate with saturated sodium bicarbonate (40 mL x 3), water (40 mL x 3), and brine (40 mL x 3), and concentrated under reduced pressure to give intermediate a-2: 2.3 g, yield: 75.9%.

[0058] MS-ESI (m / z): 305.18 [M+l] + .

[0059] Preparation of tert-butyl 3-(methylsulfonamide)piperidine-1-carboxylate (intermediate d-2):

[0060]

[0061] Following the synthetic method for intermediate c-2, c-1 was reacted with methanesulfonyl chloride to give a white solid compound d-2: 2.12 g, yield: 76.3%, MS-ESI (m / z): 279.11 [M+l]. + .

[0062] Preparation of N-(piperidin-3-ylmethyl)cyclopropanesulfonamide hydrochloride (intermediate a-3):

[0063]

[0064] A solution of 1,4-dioxane (10 mL) of a-2 (1.50 g, 4.7 mmol) was stirred at room temperature, and hydrochloric acid (4 M, 10 mL) was added for 2 hours. After the starting material was completely consumed, the mixture was concentrated under reduced pressure to give intermediate a-3: 1.07 g, yield: 86%. MS-ESI (m / z): 219.13 [M+l] + .

[0065] Intermediates b-3, c-3, and d-3 were obtained by the same method as intermediate a-3, and their specific structural information is shown in Table 1.

[0066] Table 1 Intermediate Structure

[0067]

[0068] Preparation of 4-chloro-6-(pentafluorinated thio)quinazoline (intermediate e-6):

[0069]

[0070] Preparation of 2-bromo-5-(pentafluorinated thio)aniline (intermediate e-2):

[0071] 4-(pentafluorinated thio)aniline (e-1, 10.0 g, 45.7 mmol) was dissolved in 1,4-dioxane (20 mL). NBS (8.12 g, 45.7 mmol) was added aliquots to the mixture at 23 °C for 8 hours. The reaction mixture was quenched by adding saturated ammonium chloride aqueous solution (20 mL), and the mixture was extracted with ethyl acetate (20 mL x 3). The mixed organic layer was washed with saturated sodium chloride (20 mL x 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to remove the solvent. The residue was purified and subjected to silica gel column chromatography to give the desired intermediate e-2: 10.30 g, yield: 75.9%.

[0072] MS-ESI (m / z): 297.92 [M+l] + .

[0073] Preparation of 2-amino-5-(pentafluorinated thio)benzonitrile (intermediate e-3):

[0074] To a stirred solution of intermediate e-2 (10.00 g, 33.7 mmol) in N-methylpyrrolidone (10 mL), Zn(CN)2 (4.35 g, 37.1 mmol) was added to a microwave-safe vial, and the solution was degassed with Ar(g) for 10 min. The vial was then sealed with Ar(g) and irradiated at 150 °C for 2 h in a CEM microwave instrument. After the starting material was completely consumed, the reaction mixture was poured into water (100 mL) and extracted with ethyl acetate (100 mL x 3). The combined organic extracts were washed with water (100 mL x 3) and brine (100 mL x 3). The residue was purified by silica gel column chromatography, eluting (ethyl acetate:hexane = 2:8). The fractions containing the product were combined and concentrated. Under reduced pressure, intermediate e-3 (5.04 g) was given as a pale yellow solid, yield: 61.3%. MS-ESI (m / z): 245.01 [M+l] + .

[0075] Preparation of 2-amino-5-(pentafluorinated thio)benzoic acid (intermediate e-4):

[0076] At room temperature, 50 mL of 6N sodium hydroxide solution was added to a solution of e-3 (5.00 g, 20.5 mmol) in 1,4-dioxane. The reaction mixture was stirred at 100 °C for 16 hours. After the starting material was completely consumed, the reaction mixture was poured into water (50 mL), neutralized with 2 M HCl, and extracted with ethyl acetate (50 mL x 3). The organic layers were combined. The organic extract was washed with water (50 mL x 3) and brine (50 mL x 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was eluted by silica gel column chromatography (ethyl acetate:hexane = 1:9). The fractions containing the product were combined and concentrated under reduced pressure to give intermediate e-4: 2.87 g, yield: 53.1%, as a yellow solid. MS-ESI (m / z): 264.01 [M+l] + .

[0077] Preparation of 6-(pentafluorinated thio)quinazolin-4-ol (intermediate e-5):

[0078] To a stirred solution of intermediate e-4 (2.80 g, 10.6 mmol) in ethoxyethanol (30 mL), formamidine acetate (2.20 g, 21.2 mmol) was added at room temperature. The reaction mixture was stirred at 130 °C for 24 hours. After the starting material was completely consumed, the reaction mixture was poured into water (50 mL), the precipitate was collected by filtration and dried to give a white solid e-5: 2.4 g, yield: 85.6%. MS-ESI (m / z): 273.01 [M+l] + .

[0079] Preparation of 4-chloro-6-(pentafluorinated thio)quinazoline (intermediate e-6):

[0080] To a stirred solution of intermediate e-5 (2.35 g, 8.6 mmol) in dichloromethane (10 mL), triethylamine (1.73 g, 17.3 mmol), DMF (3 drops), and oxalyl chloride (1.64 g, 12.9 mmol) were added at room temperature, and the reaction mixture was reacted for 16 hours. After the starting material was completely consumed, the reaction mixture was concentrated under reduced pressure. The residue was purified and subjected to silica gel column chromatography to obtain the desired intermediate e-6: 2.36 g, yield: 93.6%. MS-ESI (m / z): 290.97 [M+l] + .

[0081] Example 1

[0082] Preparation of N-((1-(6-(pentafluoridethio)quinazolin-4-yl)piperidin-3-yl)methyl)cyclopropanesulfonamide:

[0083]

[0084] An appropriate amount of intermediate a-3 (439 mg, 1.72 mmol) was added to a solution of intermediate e-6 (500 mg, 1.72 mmol) and N,N-diisopropylethylamine (1.5 mL) in tetrahydrofuran (20 mL), and the mixture was reacted at room temperature for 16 hours. After the starting material was completely consumed, the reaction mixture was poured into water (30 mL) and extracted with ethyl acetate (30 mL x 3). The organic extract was washed with water (30 mL x 3) and brine (30 mL x 3), dried over anhydrous Na₂SO₄, and concentrated under reduced pressure. The residue was purified and obtained by silica gel column chromatography to give the desired product: Example 1: 370 mg, yield: 45.5%.

[0085] MS-ESI (m / z): 473.13 [M+l] + .

[0086] 1 H NMR (400MHz, DMSO-d6): δ8.63(s,1H),8.07(s,1H),7.98(d,J=8.8Hz,1H),7.71(d,J=8.6Hz,1H),7.19(m,1H),4.29(d,J=14.2H z,1H),4.14(d,J=12.2Hz,1H),3.20-3.12(m,1H),2.99-2.93(m,3H),1.92-1.83(m,4H),1.71-1.65(m,2H),0.94-0.89(m,4H).

[0087] Examples 2-4

[0088] Using e-6 as the starting material, and b-3, c-3 and d-3 respectively, the materials of Examples 2-4 were prepared according to the synthesis method of Example 1. The results are shown in Table 2.

[0089] Example 5

[0090] Preparation of (R)-N-(1-(6-(trifluoromethyl)quinazolin-4-yl)piperidin-3-yl)methyl)methanesulfonamide:

[0091]

[0092] By replacing the corresponding raw materials, Example 5 was obtained using a similar preparation method as in Example 1, and the results are shown in Table 2.

[0093] The raw material f-1 (CAS No: 16499-64-2) can be purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd.

[0094] Table 2 Structural information of Examples 2-5

[0095]

[0096]

[0097] Example 6: Bioactivity Test

[0098] Test 1: INS-1 Activity Assay

[0099] Rat INS-1 cell line (Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) was used and preserved in a humidified incubator at 37°C and 5% CO2, supplemented with 10% fetal bovine serum (FBS), 100 U / mL RPMI-1640 (Hyclone), penicillin, 100 mg / mL streptomycin, 10 mM HEPES, 1 mM sodium pyruvate, 50 μM 2-mercaptoethanol, and 11.1 mM glucose. 4 x 10⁶ cells per well were cultured. 4 Cells were seeded into 96-well plates and incubated overnight at 37°C. A portion of the cells were then cultured in medium containing 5 mM glucose for 24 hours, followed by a second treatment in medium containing or without the test compound at 25 mM glucose for 24 hours.

[0100] INS-1 cell viability was determined by quantifying ATP using the Cell Titer Glo luminescent cell viability assay kit (Promega), which indicates the presence of metabolically active cells. In short, INS-1 cells were cultured at 4.5 x 10⁶ cells per well. 4 and 3.5x10 4 Cells were seeded at the specified cell density into 96-well plates and incubated overnight at 37°C with 5% CO2. The following day, cells were treated with the assay compound for 24 and 72 hours, respectively. After treatment with Cell Titer-Glo assay reagent, the luminescence signal was measured using a Synergy 4 multi-mode microplate reader (PerkinElmer).

[0101] Test 2: β-cell proliferation assay

[0102] For the primary high-throughput screening (HTS) assay after stable transfection, single-clone INS-1 cells were divided using trypsin (2 mL per T75 flask) and seeded at a specific density in 10V wells of 384-well plates, incubated overnight at low 5 mM glucose. The next day, the medium was changed to high glucose (25 mM) or "high glucose + test compound" for 24 hours before luciferase detection. In the secondary qPCR-HTS, compounds that inhibited glucose-induced TXNIP promoter activity by more than 50% but were inactive in reverse selection with general transcription inhibitors were further tested, demonstrating a dose-dependent reduction in glucose-induced endogenous TXNIP expression. For the secondary screening, total RNA was extracted from 96 well-cultured cells using the RNeasy 96 kit (Qiagen). Then, one-step qRT-PCR amplification was performed using the QuantiFast SYBR Green RT-PCR kit (Qiagen). RNA was amplified in 10 μL of reaction, with 0.5 μM of each primer (rat TXNIP 5' primer: CGAGTCAAGCCGTCAGGAT; rat TXNIP 3' primer: TTCATAGGCAAGTAGTCCAAGGT; or rat 18S rRNA 5' primer: AGTCCCTGCCCTGTGTTACACA; and rat 18S rRNA 3' primer: GATCCGAGGGCTTCATAAC), 5 μL of 2x SYBR Green master mix, and 0.1 μL of QuantiFast RT mix. The SYBR Green assay was performed using a LightCycler 480II (Roche). The initial incubation time was 10 min RT at 50°C, followed by denaturation at 95°C for 5 min and amplification using a thermal cycling pattern of 95°C for 10 s and 60°C for 30 s. Subsequently, melting curves were recorded by holding at 95°C for 60 seconds, cooling to 60°C for 60 seconds, and then heating back to 95°C at a rate of 0.11°C / s. Data were collected and analyzed using LightCycler 480 software version 1.5.0SP3. The relative abundance of TXNIP mRNA was normalized to housekeeping genes at 18S rRNA levels, and the transformed data were expressed as a percentage of repression according to the 2-ΔΔCt method.

[0103] The activity evaluation results are shown in Table 3 below:

[0104] Table 3 Results of compound activity evaluation

[0105]

[0106] As can be seen from Table 3, the compounds in the embodiments of the present invention have better inhibitory activity than the positive control (SRI-37330).

[0107] Example 7: Metabolic stability test of the compound in human liver microsomes

[0108] 1. Experimental Materials

[0109] Human liver microsomes, purchased from Corning;

[0110] NADPH, purchased from Bidex Pharmaceuticals.

[0111] 2. Experimental Methods

[0112] Microparticles (20 mg / mL) are stored at -80°C. Before use, they are thawed in a 37°C water bath and then placed on ice.

[0113] 10 μL of microsomes (20 mg / mL, final concentration 0.5 mg / mL), 200 μL of phosphate buffer (200 mM, final concentration 100 mM), 40 μL of magnesium chloride (50 mM, final concentration 5 mM), and 106 μL of purified water were added to a 96-well plate. The system was pre-incubated in a 37°C water bath for 10 minutes. 40 μL of NADPH solution (10 mM, final concentration 1 mM) was added to the reaction system; 40 μL of ultrapure water was used as a negative control instead of NADPH solution.

[0114] The reaction was initiated by adding 4 μL of 100 mM of the test compound and the control drug (Verapamil), with the final drug concentration being 1 μM.

[0115] At 0, 5, 15, 30, and 60 min, 50 μL of the reaction sample was collected and quenched with 4 volumes of cold acetonitrile containing internal standards (3% formic acid, 100 nM alprazolam, 200 nM labetalol, 2 μM ketoprofen, and 200 nM caffeine). The sample was centrifuged at 3220 g for 45 min. After centrifugation, 100 μL of the supernatant was mixed with 100 μL of ultrapure water and used for LC-MS / MS analysis.

[0116] 3. Data Analysis

[0117] Peak areas were detected by extracting ion spectra. The in vitro half-life (t) of the parent drug was determined by linearly fitting the percentage disappearance of the parent drug with time. 1 / 2 ).

[0118] In vitro half-life (t) 1 / 2 ) Calculated by slope:

[0119] In vitro t 1 / 2 = 0.693 / k (k = -slope value)

[0120] The following formula is used to measure the in vitro t 1 / 2 Converted to in vitro clearance rate (CL) int (μL / min / mg protein):

[0121]

[0122] The incubation volume was 400 μL, and the protein amount was 0.2 mg. The results are shown in Table 4 below:

[0123] Table 4

[0124]

[0125] As can be seen from Table 4, the compounds in the embodiments of the present invention have good drug metabolism stability compared with the positive control (SRI-37330).

Claims

1. Quinazoline compounds having the structure shown in general formula (I) or (II), or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope-labeled prodrugs: In the formula: n is independently selected from 0 or 1; R1 is independently selected from C1-C4 straight-chain or branched alkyl groups and C3-C6 cycloalkyl groups; R2 is independently selected from H, halogen, CN, SF5, C1-C4 straight-chain or branched alkyl, C3-C6 cycloalkyl, C1-C4 alkoxy, and halogenated C1-C4 alkyl.

2. The quinazoline compound or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug according to claim 1, characterized in that, The compounds are specifically selected from:

3. The quinazoline compound or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug according to claim 1, characterized in that, The pharmaceutically acceptable salt is an inorganic or organic salt; the inorganic salt is selected from hydrochloride, hydrobromide, hydroiodide, sulfate, hydrogen sulfate, nitrate, phosphate, and acid phosphate; the organic salt is selected from acetate, trifluoroacetate, propionate, pyruvate, glycolate, oxalate, malonate, fumarate, maleate, lactate, malate, citrate, tartrate, methanesulfonate, sulfonate, benzenesulfonate, and salicylate.

4. Use of the quinazoline compound of any one of claims 1-3, or a pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug thereof, in the preparation of a medicament for treating diseases associated with elevated TXNIP and / or elevated TXNIP.

5. The use according to claim 4, characterized in that, The diseases mentioned are diabetes and its complications, gestational diabetes, hyperlipidemia, non-alcoholic fatty liver disease, pancreatic β-cell loss or pancreatic islet dysfunction, and diseases related to endoplasmic reticulum membrane stress and / or cellular oxidative stress.

6. The use according to claim 4, characterized in that, The diseases mentioned are impaired glucose control, impaired glucose tolerance or prediabetes, and insulin resistance-related diseases.

7. A pharmaceutical composition, characterized in that, The product contains a quinazoline compound as described in any one of claims 1-3, or a pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, prodrug, and pharmaceutical excipient.

8. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical excipients include pharmaceutically acceptable carriers, excipients, or diluents.

9. The pharmaceutical composition according to claim 8, characterized in that, Pharmaceutically acceptable carriers include microspheres, nanoparticles, and liposomes.

10. The pharmaceutical composition according to claim 7, characterized in that, The dosage forms of the pharmaceutical composition include injections, lyophilized powder for injection, suspensions, implants, embolic agents, capsules, tablets, pills, and oral liquids.

Images