A freshwater aquatic animal zoonotic parasite synchronous detection primer probe combination, kit and application

Abstract

The application discloses a freshwater aquatic animal zoonotic parasite synchronous detection primer probe combination, a kit and application. The primer probe combination comprises upstream and downstream primers and probes with different fluorescence / quenching markers for Clonorchis sinensis, Orientobilharzia, Metagonimus yokogawai and Echinorhynchus miyagawai; four kinds of parasite nucleic acids can be simultaneously detected through single-tube multiplex fluorescence quantitative PCR. The primer combination and the kit provided by the application are high in sensitivity, strong in specificity and stable in repeatability, the detection targets are not interfered with each other and have no cross reaction, and the primer combination and the kit can be applied to molecular diagnosis, epidemiological investigation and epidemic situation monitoring of the four kinds of zoonotic parasites in freshwater aquatic animals.

Description

Technical Field

[0001] This invention belongs to the field of detection technology, specifically relating to a primer and probe combination, reagent kit, and application for the simultaneous detection of zoonotic parasites in freshwater aquatic animals. Background Technology

[0002] Clonorchis sinensis, Bicornuate locomonas, Opisthocosidae yokokawa, and Echinostoma miyagawa are all typical zoonotic parasites of freshwater aquatic animals. Their metacercariae can parasitize the muscles, subcutaneous tissues, and other areas of freshwater fish, shrimp, and snails. When humans or other definitive hosts consume raw or undercooked freshwater fish, shrimp, or snails, the metacercariae can develop into adult worms within the body, causing various parasitic diseases.

[0003] Currently, the detection of metacercariae of the aforementioned parasites in freshwater aquatic animals mainly relies on traditional morphological identification methods. These methods require microscopic observation of the metacercariae's morphological characteristics and internal structure for identification. However, the metacercariae of Clonorchis sinensis, Clonorchis orientalis, Opisthocosidae, and Echinostomata are highly similar morphologically. Key distinguishing features such as metacercariae size, membrane thickness, and internal larval morphology show subtle differences, demanding extremely high levels of expertise and practical experience from operators. Inexperienced operators are highly prone to missed detections and misdiagnoses. Furthermore, freshwater aquatic animals also harbor various autoparasites and other parasites that can infect birds, cats, dogs, and other animals. Their metacercariae, also visible under a microscope as wriggling larvae within the membrane, are easily confused with the metacercariae of the aforementioned zoonotic parasites, further increasing the difficulty of morphological identification and the rate of misdiagnosis, making accurate identification difficult.

[0004] While multiplex conventional PCR detection methods for the aforementioned parasites have emerged with the development of molecular detection technologies, these methods still have significant limitations. Compared to fluorescent PCR, conventional PCR has lower sensitivity, making it difficult to detect samples with low infectivity and prone to false negatives. Furthermore, conventional PCR requires multiple steps, including PCR amplification, product electrophoresis, and result interpretation, resulting in a complex and time-consuming process that hinders rapid screening and fails to meet the practical needs of batch sample testing and rapid on-site detection. In addition, existing multiplex conventional PCR methods are mostly designed for single or partial parasites, lacking simultaneous and accurate detection reagents for Clonorchis sinensis metacercariae, Hypogonadalococcus orientalis metacercariae, Opisthocolate clonorchis sinensis metacercariae, and Echinostoma miyagawa metacercariae, thus failing to address the detection scenarios of mixed parasite infections in freshwater aquatic animals.

[0005] In summary, existing technologies for detecting zoonotic parasites in freshwater aquatic animals suffer from drawbacks such as high operational difficulty, low accuracy, insufficient sensitivity, long detection time, and inability to simultaneously detect multiple target parasites. These limitations make it difficult to meet the practical needs of food safety supervision, parasitic disease control, and the aquaculture industry. Therefore, developing a detection reagent and kit capable of simultaneously detecting Clonorchis sinensis, Biseudomonas orientalis, Opisthocolate clonorchis, and Echinostoma miyagawa, enabling rapid, accurate, and highly sensitive simultaneous screening of multiple zoonotic parasites, is of significant practical importance for ensuring food safety, controlling zoonotic parasitic diseases, and promoting the healthy development of the aquaculture industry. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a primer-probe combination, kit, and application for the simultaneous detection of zoonotic parasites in freshwater aquatic animals. The primer-probe combination provided by this invention can rapidly and accurately detect four zoonotic parasites in freshwater aquatic animals: Clonorchis sinensis, Clonorchis orientalis, Opisthocosidae yokokawa, and Echinostoma miyagawa.

[0007] The present invention adopts the following technical solution: The first aspect of this invention provides a primer-probe combination for the simultaneous detection of zoonotic parasites in freshwater aquatic animals. The primer-probe combination includes upstream primers, downstream primers, and a probe for detecting *Clonorchis sinensis*, upstream primers, downstream primers, and a probe for detecting *Phyllostachys orientalis*, upstream primers, downstream primers, and a probe for detecting *Odontospira yokokawa*, and upstream primers, downstream primers, and a probe for detecting *Echinostoma miyagawa*. The nucleotide sequence of the upstream primer used for detecting Clonorchis sinensis is shown in SEQ ID NO:10: 5'-CCGATGGGTACTCCACTTTG-3', the nucleotide sequence of the downstream primer is shown in SEQ ID NO:11: 5'-CCAATAACTAAACATACTCAACAAGC-3', and the nucleotide sequence of the probe is shown in SEQ ID NO:12: 5'-AACCTCCTAACGCACCAGCAGACA-3'. The probe is labeled with a FAM group at its 5' end and a BHQ1 group at its 3' end. The nucleotide sequence of the upstream primer used for detecting *Clonorchis orientalis* is shown in SEQ ID NO:16: 5'-TGGTGTGTGGTAGTTATAGGTC-3', the nucleotide sequence of the downstream primer is shown in SEQ ID NO:17: 5'-AATCCAAAGGAGTACGATTACAC-3', and the nucleotide sequence of the probe is shown in SEQ ID NO:18: 5'-CACAGAGCATACCGACAAGCCACA-3'. The probe is labeled with a Cy5 group at its 5' end and a BHQ1 group at its 3' end. The nucleotide sequence of the upstream primer used for detecting Yokokawa clonorchis is shown in SEQ ID NO:19: 5'-GCTATGCTTGCGATAGTGTACTTG-3', the nucleotide sequence of the downstream primer is shown in SEQ ID NO:20: 5'-CCAACATGTACAGCCAGGAAAAC-3', and the nucleotide sequence of the probe is shown in SEQ ID NO:21: 5'-ACCCGTCGGCACCCCAATTACCAT-3'. The probe is labeled with a VIC group at its 5' end and a BHQ2 group at its 3' end. The nucleotide sequence of the upstream primer used for detecting Echinostoma miagara is shown in SEQ ID NO:28: 5'-AGGTGAGATCCTGTCGTTTCTC-3', the nucleotide sequence of the downstream primer is shown in SEQ ID NO:29: 5'-GAGTTTCCTCTGGCTTCAACC-3', and the nucleotide sequence of the probe is shown in SEQ ID NO:30: 5'-AGGCACGAGGCCGCCACTACGCCAT-3'. The probe is labeled with a Texas Red group at its 5' end and a BHQ2 group at its 3' end.

[0008] In some preferred embodiments, under the conditions of a 20 μL fluorescent PCR detection system and 20 μM primer and probe stock solution, for Clonorchis sinensis, Clonorchis orientalis, Clonorchis yokokawa, and Echinostoma miyagawa, the volume ratio of upstream primer, downstream primer, and probe in each primer and probe combination is 0.25~1:0.25~1:0.1~0.5, preferably 0.25:0.25:0.125.

[0009] A second aspect of the present invention provides a kit for simultaneous detection of zoonotic parasites in freshwater aquatic animals, the kit comprising the primer-probe combination described above.

[0010] In some embodiments, the kit further includes a quadruple nucleic acid standard, which is a recombinant plasmid or nucleic acid fragment containing the DNA sequence shown in SEQ ID NO:35. The sequence of the quadruple nucleic acid standard is: CCGATGGGTACTCCACTTTGGATAGCTCCATTTGTTTGTTTGCCCGAAACACTCAGTTATATTGTTCGTCCTGGTGTTTTAATGATGCGTCCTTTCGTTAAATTGTCTGCTGGTGCGTTAGGAGGTTACGCATTGGGCTTGTTGAGTATGTTTAGTTATTGGGCTAGCTGG TGTGTGGTAGTTATAGGTCTTTTCTTTTTAGAGAGTTTTTGGGGTTTGGTTTTTGTTTTACCTGTATGCTATTTTTTGTGGCTTGTCGGTATGCTCTGTGAGTGTAATCGTACTCCTTTGGATTGCTAGCGCTATGCTTGCGATAGTGTACTTGGGTAGTGTTGTTTGGG CGCATCACATGTTTATGGTGGGTCTGGATTTGAAGACGGCAGTCTTCTTTAGCTCGGTAACTATGGTAATTGGGGTGCCGACGGGTATAAAAGGTGTTTTCCTGGCTGTACATGTTGGGCTAGCGTGAAAGTAAAGGTTCGGCTTGTCCGGACTGAGGTGAGATCCTGTCGTT TCCTCACGCCTGGTACTACCAAGCATCGAGCGGCGGGCGCATCACCGGCCCGTCCCATGGCGTAGTGGCGGCCTCGTGCCTGCTCATCGTCGGGGCGGAGCATGAGCGTACATGTTGAGACCCGAAAGATGGTGAACTATGCTTGCGCAGGTTGAAGCCAGAGGAAACTCTGG Preferably, the quadruple nucleic acid standard is packaged separately and independently.

[0011] In some embodiments, the kit further includes a fluorescent PCR premixed reaction solution and enzyme-free water.

[0012] A third aspect of the present invention provides a method for simultaneous detection of zoonotic parasites in freshwater aquatic animals for purposes other than disease diagnosis and treatment, the method comprising the following steps: 1) Use DNA extracted from the freshwater aquatic animal sample to be tested as a template; the DNA is total DNA from freshwater aquatic animal tissue, or DNA extracted from metacercariae isolated from freshwater aquatic animal tissue; 2) Using the above DNA as a template, perform multiplex quantitative PCR amplification using the primer and probe combination or the kit described above, and collect the fluorescence signal; 3) Determine whether the sample contains nucleic acids of Clonorchis sinensis, Clonorchis orientalis, Obostoma yokokawa and / or Echinostoma miyagawa based on the fluorescence signal.

[0013] In some embodiments, the reaction program for the multiplex quantitative PCR reaction is as follows: 92~98℃ for 3~10 min; 92~98℃ for 5~20 sec, 54~60℃ for 15~40 sec, for 38~48 cycles.

[0014] More preferably, the reaction procedure for the multiplex quantitative PCR reaction is: 95℃ for 5 min; 95℃ for 15 sec, 58℃ for 31 sec, for 45 cycles, wherein the fluorescence signal is acquired in the 58℃ for 31 sec step.

[0015] Specifically, the criteria for determining the results after multiplex quantitative PCR are as follows: when the Ct value of the FAM channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Clonorchis sinensis nucleic acid; when the Ct value of the Cy5 channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Clonorchis orientalis nucleic acid; when the Ct value of the VIC channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Obstetricus yokokawa nucleic acid; when the Ct value of the Texas Red channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Echinostoma miyagawa nucleic acid; when there is no Ct value or a Ct value >40 and no typical S-shaped amplification curve in the four channels of FAM, Cy5, VIC and Texas Red, it is determined to be negative for the nucleic acids of Clonorchis sinensis, Obstetricus yokokawa, Obstetricus yokokawa and Echinostoma miyagawa.

[0016] The above methods are used for non-disease diagnosis and treatment purposes and can be applied to food safety testing of freshwater aquatic animal samples, parasite epidemiological surveys, or environmental monitoring.

[0017] Compared with the prior art, the present invention has the following advantages: This invention screens and obtains primer-probe combinations compatible with the same reaction system, specifically targeting four morphologically similar and difficult-to-distinguish zoonotic parasites in freshwater aquatic animals—*Clonorchis sinensis*, *Phyllostachys orientalis*, *Odontospira yokokawa*, and *Echinostoma miyagawa*—for simultaneous detection and specific identification. Based on this, matching detection reagents and kits are developed, and a simultaneous detection method applicable to these four types of parasites in freshwater aquatic animal samples is established. Using this invention, parallel detection of the four target parasites can be completed in a single amplification using single-tube fluorescent PCR, eliminating the need for multiple experiments in separate tubes. This method exhibits excellent specificity, with no cross-interference between detection channels, and also boasts high detection sensitivity, stable and reproducible experimental results, meeting the needs for batch and rapid screening of the aforementioned four zoonotic parasites in edible freshwater aquatic animal samples. Attached Figure Description

[0018] Figure 1 This is the result of fluorescent PCR singleton amplification of four gene targets of Clonorchis sinensis in Example 1.

[0019] Figure 2 This is the result of fluorescent PCR singleton amplification of two gene targets of Clonorchis orientalis in Example 1.

[0020] Figure 3 This is the result of fluorescent PCR singleton amplification of the COX1 gene of *Ostomyces yokokawa* using two sets of primers, as shown in Example 1.

[0021] Figure 4 The results of singlet fluorescent PCR amplification using two sets of fluorescent PCR primers for Echinostoma miggae in Example 1 are shown.

[0022] Figure 5 Examples 2 show the amplification results of two-stage fluorescent PCR reaction systems assembled with three target genes of *Clonorchis sinensis* and *Ph. orientalis*, and the amplification results of a three-stage fluorescent PCR reaction system composed of *Clonorchis sinensis*, *Ph. orientalis*, and *Omega yokokawa*. A: Amplification results of a two-stage fluorescent PCR reaction system assembled with the *Clonorchis sinensis* ND5 gene and the *Ph. orientalis* ND1 genome; B: Amplification results of a two-stage fluorescent PCR reaction system assembled with the *Clonorchis sinensis* ATP6 gene and the *Ph. orientalis* ND1 genome; C: Amplification results of a two-stage fluorescent PCR reaction system assembled with the *Clonorchis sinensis* ND4 gene and the *Ph. orientalis* ND1 genome; D: Amplification results of a three-stage fluorescent PCR reaction system composed of the first set of primers for the *Clonorchis sinensis* ATP6 gene, the *Ph. orientalis* ND1 gene, and the *Omega yokokawa* COX1 gene.

[0023] Figure 6Example 2 shows the amplification results of a quadruple fluorescent PCR reaction system composed of two sets of primers and probes for *Echinostoma miggae*, *B. spp. 18*, and *O. spp. 19*. A: Amplification results of a quadruple fluorescent PCR reaction system composed of the first set of primers and probes for the *Echinostoma miggae* ITS2 gene, *B. spp. 18*, and *O. spp. 19*; B: Amplification results of a quadruple fluorescent PCR reaction system composed of the second set of primers and probes for the *Echinostoma miggae* ITS2 gene, *B. spp. 18*, and *O. spp. 19*.

[0024] Figure 7 Example 3 shows the sensitivity amplification curves and standard curves for quadruple fluorescent PCR detection of DNA from four parasites. A: Amplification curve of quadruple fluorescent PCR for serially diluted Clonorchis sinensis DNA; B: Standard curve of quadruple fluorescent PCR for serially diluted Clonorchis sinensis DNA; C: Amplification curve of quadruple fluorescent PCR for serially diluted Clonorchis orientalis DNA; D: Standard curve of quadruple fluorescent PCR for serially diluted Clonorchis orientalis DNA; E: Amplification curve of quadruple fluorescent PCR for serially diluted Metaclonorchis yokokawa DNA; F: Standard curve of quadruple fluorescent PCR for serially diluted Metaclonorchis yokokawa DNA; G: Amplification curve of quadruple fluorescent PCR for serially diluted Echinostoma miyagawa DNA; H: Standard curve of quadruple fluorescent PCR for serially diluted Echinostoma miyagawa DNA.

[0025] Figure 8 This is the specific detection result of quadruple fluorescent PCR in Example 4.

[0026] Figure 9 Example 5 shows the fluorescence PCR amplification curves and standard curves for the detection of nucleic acid standards using quadruple fluorescence PCR. A: Amplification curve of *Clonorchis sinensis* in quadruple fluorescence PCR for serially diluted nucleic acid standards; B: Standard curve of *Clonorchis sinensis* in quadruple fluorescence PCR for serially diluted nucleic acid standards; C: Amplification curve of *Phyllostachys orientalis* in quadruple fluorescence PCR for serially diluted nucleic acid standards; D: Standard curve of *Phyllostachys orientalis* in quadruple fluorescence PCR for serially diluted nucleic acid standards; E: Amplification curve of *Odontospira yokokawa* in quadruple fluorescence PCR for serially diluted nucleic acid standards; F: Standard curve of *Odontospira yokokawa* in quadruple fluorescence PCR for serially diluted nucleic acid standards; G: Amplification curve of *Echinostoma miagawa* in quadruple fluorescence PCR for serially diluted nucleic acid standards; H: Standard curve of *Echinostoma miagawa* in quadruple fluorescence PCR for serially diluted nucleic acid standards.

[0027] Figure 10Example 6 illustrates the application of quadruple fluorescent PCR in detecting freshwater aquatic animal samples. A: Metacercariae morphology found by the minnow squash method; B: The second metacercariae morphology found under microscopic examination after minnow pepsin digestion; C: The third metacercariae morphology found under microscopic examination after minnow pepsin digestion; D: The first metacercariae morphology found under microscopic examination after loach pepsin digestion; E: Amplification results of quadruple fluorescent PCR detection of the DNA from the metacercariae found by squash and the three types of metacercariae found after digestion. Detailed Implementation

[0028] The present invention will be further described below with reference to embodiments. However, the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific use, and the implementation conditions not specified are conventional conditions in the industry. The technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other. Unless otherwise specified, the reagents used in this embodiment are all commercially available molecular biology standard reagents, and the amplification instrument is a real-time fluorescence quantitative PCR instrument.

[0029] Example 1: Design and screening of primers and probes for different gene targets

[0030] 1.1 Primer and probe design To design better primer-probe combinations, we selected multiple target genes for each parasite for primer design. Based on the gene sequences retrieved from GenBank, we used Beacon design software to design specific primers and probes for the ITS2, ND4, ND5, and ATP6 genes of Clonorchis sinensis, the ND1 and ITS2 genes of Anaerobicum orientalis, the COX1 gene of Obocelenia yokokawa, and the ITS2 gene of Echinostoma miyagawa. We then performed online BLAST alignment analysis on the primer and probe sequences to analyze their specificity. Primer-probe combinations with good specificity were selected for synthesis. The synthesized primer-probe combination sequences are shown in Table 1 and were diluted to 20 μM with ddH2O for later use.

[0031] Table 1 Primer and probe sequences for different targets of four parasites

[0032] 1.2 Extraction of parasite genomic DNA Freshwater fish such as minnows, loach, crucian carp, and anchovies were collected from the market. Those found to contain metacercariae upon microscopic examination of the compressed specimens were digested overnight with pepsin. 200g of the fish meat was then washed with physiological saline several times the next day. Finally, the sediment was collected and morphologically isolated from Clonorchis sinensis metacercariae, Clonorchis orientalis metacercariae, Opisthocolate cytotoxicum metacercariae, and Echinostoma miyagawa metacercariae under a microscope. DNA from each metacercariae was extracted using the Qiagen DNeasy Blood & Tissue Kit, and the concentration was determined before storage at -20℃ for later use. Screening of fluorescent PCR primers and probes

[0033] Genomic DNA from *Clonorchis sinensis* metacercariae, *Phyllostachys orientalis* metacercariae, *Odontospira yokokawa* metacercariae, and *Echinostoma miyagawa* metacercariae were used as templates. Singleton fluorescent PCR was performed using the Qiagen Quantinova probe PCR Kit. The reaction system followed the kit instructions: 0.25 μL of 20 μM forward and reverse primers, and 0.125 μL of probe. After optimizing the annealing temperature, the preliminary fluorescent PCR amplification program was determined to be: 95℃ for 5 min; 95℃ for 15 s; 56℃ for 31 s, with corresponding fluorescence signals collected at each step, for 45 cycles. The results of singleton fluorescent PCR amplification of the four gene targets of *Clonorchis sinensis* are shown below. Figure 1 As shown in the figure, the fluorescent PCR primers and probes designed based on the ITS2 gene have extremely poor amplification efficiency; amplification only begins after 40 cycles with the same template. Therefore, these primers and probes are discarded. Thus, ND4, ND5, and ATP6 genes are selected as candidates for quadruple fluorescent PCR. The results of single-gene fluorescent PCR amplification of two target genes from *Clonorchis orientalis* are shown below. Figure 2 As shown in the figure, the fluorescence value of the fluorescent PCR primer-probe amplification curve based on the ND1 gene is higher than that based on the primer-probe designed for the ITS2 gene, and the CT value is also smaller under the same template. Therefore, the ND1 gene of *Clerodendrum orientalis* was selected as a candidate for quadruple fluorescent PCR. Two sets of primers and probes were designed for *Ostomyces yokokawa* targeting the COX1 gene, and their amplification results are shown in the figure. Figure 3 As can be seen from the figure, the Ct value of the fluorescence PCR amplification curve of the first set of primers is smaller, indicating higher amplification efficiency. Therefore, the first set of primers for the COX1 gene was selected as a candidate for quadruple fluorescence PCR. The single fluorescence PCR amplification curves of the two sets of fluorescence PCR primers for Echinostoma miagarae are shown in the figure. Figure 4 As can be seen from the figure, both sets of primers have good amplification results and can be used as alternatives for quadruple fluorescent PCR amplification reaction systems.

[0034] Example 2 Assembly and optimization of a quadruple fluorescent PCR reaction system 2.1 Primer combination screening in a quadruple fluorescent PCR system The Qiagen Quantinova probe PCR Kit was used to prepare the fluorescent PCR reaction system. First, two-fold fluorescent PCR reactions were performed using *Clerodendrum chinense* (ND4, ND5, ATP6), which showed superior amplification efficiency, and *Clerodendrum orientalis* (ND1), respectively. Then, the first set of primers for *Odontospira yokokawa* (COX1) was added to form a triplet fluorescent PCR system to verify the amplification effect. Finally, four-fold fluorescent PCR reactions were performed using the first and second sets of primers for *Echinostoma miyagawa*, respectively. The reaction system is shown in Table 2. The reaction program was: 95℃ for 5 min; 95℃ for 15 s; 56℃ for 31 s, with corresponding fluorescence signals collected at each step, for 45 cycles.

[0035] Table 2 Quadruple Fluorescence PCR Reaction System

[0036] Experiments revealed that when the ND5 gene of Clonorchis sinensis was assembled with that of Isodon grandiflorus for duplex fluorescent PCR amplification, the negative control of the ND1 gene of Isodon grandiflorus exhibited a nonspecific amplification curve (see...). Figure 5 A) indicates that there is a cross-reactivity between the primers and probes of the Clonorchis sinensis ND5 gene and the Clonorchis orientalis ND1 gene, therefore this combination cannot be used; while comparing the double fluorescent PCR amplification reaction composed of Clonorchis sinensis ND4 gene and ATP6 gene with Clonorchis orientalis, under the same DNA template, the Ct value detected by ATP6 is smaller ( Figure 5 Therefore, the ATP6 gene of Clonorchis sinensis and the ND1 gene of Clonorchis orientalis were selected to form a dual fluorescent PCR amplification reaction system.

[0037] When the primers and probes of *Odontocerca yokokawa* were added to a two-stage fluorescent PCR reaction system containing *Clonorchis sinensis* and *Clonorchis orientalis*, although the fluorescence value was lower than that of the single-stage reaction, the negative controls were all valid, there was no non-specific amplification, and the Ct value did not change significantly. Figure 5 (D) indicates that the triple fluorescent PCR amplification reaction system is usable.

[0038] When the first set of primers for Echinostoma miagarae ITS2 was used to form a quadruple fluorescent PCR reaction with Clonorchis sinensis, Clonorchis orientalis, and Obocele yokokawa, the negative control of Clonorchis orientalis showed a nonspecific amplification curve. Figure 6 A), when using the second set of primers for Echinostoma miagarae ITS2 with Clonorchis sinensis, Clonorchis orientalis, and Obstetricus yokokawa to form a quadruple fluorescent PCR reaction, the negative controls for all four parasites were established, with no nonspecific amplification, and the positive control amplification curves were all good. Figure 6Therefore, a quadruple fluorescent PCR reaction system was selected, consisting of primers and probes for the ATP6 gene of Clonorchis sinensis, the ND1 gene of Clonorchis orientalis, the first set of primers and probes for the COX1 gene of Opisthocotomyces yokokawa, and the second set of primers and probes for the ITS2 gene of Echinostoma miyagawa.

[0039] 2.2 Optimization of the quadruple fluorescent PCR amplification reaction system and reaction procedure Different primer-to-probe volume ratios were designed as follows: 1:1:0.5, 0.5:0.5:0.25, 0.5:0.5:0.125, 0.25:0.25:0.125, and 0.3:0.3:0.1. The 1:1:0.5 ratio was used in a 25 μL reaction system, while the others were used in a 20 μL reaction system for quadruple fluorescent PCR amplification. The results showed that when using the same amount of DNA from various parasites as templates, the 0.25:0.25:0.125 ratio resulted in the lowest Ct values ​​for the positive amplification curves of each parasite (see Table 3), and the amplification curves were also good. Therefore, to obtain better detection sensitivity, the optimal primer-to-probe volume ratio was selected as 0.25:0.25:0.125.

[0040] Table 3. Ct values ​​of positive amplification curves for four parasites under different primer-probe ratios.

[0041] The quadruple fluorescent PCR amplification reaction system was configured with the optimal primer-probe ratio. Quadruple fluorescent PCR amplification reactions were performed at four different annealing temperatures: 54℃, 56℃, 58℃, and 60℃, using the same amount of DNA from various parasites as templates. The results showed that when annealing at 58℃, the Ct values ​​of the positive amplification curves for each parasite were the lowest (see Table 4), and the amplification curves were also good. Therefore, the optimal amplification reaction program for quadruple fluorescent PCR was determined to be: 95℃ for 5 min; 95℃ for 15 s; 58℃ for 31 s, with corresponding fluorescence signals collected at each step, for 45 cycles.

[0042] Table 4. Ct values ​​of positive amplification curves of four parasites at different annealing temperatures.

[0043] Example 3: Sensitivity and repeatability testing of quadruple fluorescent PCR 3.1 Serial dilutions of DNA from four parasites Based on the parasitic nucleic acid DNA extracted in Example 1, the initial concentration of various parasitic DNAs was first adjusted to 100 pg / μL using ddH2O. Then, each DNA was serially diluted 10-fold using ddH2O, resulting in a total of six different concentration gradients: 100 pg / μL, 10 pg / μL, 1 pg / μL, 0.1 pg / μL, 0.01 pg / μL, and 0.001 pg / μL.

[0044] 3.2 Sensitivity detection of quadruple fluorescent PCR Optimized quadruple fluorescent PCR was used to detect the serially diluted DNAs of the four parasites to determine the minimum DNA concentrations required to detect the four target genes, and standard curves were plotted. The results showed ( Figure 7 The minimum DNA concentrations required for the established quadruple fluorescence PCR method to detect target genes in four parasites were: 0.01 pg / μL for Clonorchis sinensis, 0.1 pg / μL for Bicyrtospira orientalis, 0.1 pg / μL for Obturus yokokawa, and 0.01 pg / μL for Echinostoma miyagawa. The R-value of the standard curve was... 2 The values ​​were 0.9993 (Clonorchis sinensis), 0.9903 (Clonorchis orientalis), 0.9916 (Octoporhynchus yokokawa), and 0.9945 (Echinostoma miyagawa). Since the Ct values ​​of the above-mentioned limits of detection are all ≤40, a Ct value ≤40 is used as the criterion for a positive test result.

[0045] 3.3 Repeatability test of quadruple fluorescent PCR The repeatability of the quadruple fluorescent PCR method was performed on DNA mixed templates at three concentrations: 100 pg / μL, 10 pg / μL, and 1 pg / μL, with intra-assay and inter-assay (2-week intervals). Each concentration was measured three times, and the intra-assay and inter-assay coefficients of variation were calculated to evaluate the repeatability and stability of the method. The results (see Table 5) showed that the intra-assay coefficients of variation for Ct values ​​of the four parasites were 1.96%–3.58%, and the inter-assay coefficients of variation were 3.4%–4.89%, both less than 5%, indicating that the established quadruple fluorescent PCR method has good repeatability and stability.

[0046] Table 5. Repeatability and stability test results of the quadruple fluorescence PCR detection method

[0047] Example 4 Specific detection of quadruple fluorescent PCR 4.1 Extraction of control parasite nucleic acid DNA Anisakis, Paragonimus westermani, Fasciolopsis buski, Clonorchis sinensis, Bicornuate clonorchis orientalis, Opisthorchis yokokawa, Echinostoma miyagawa, Echinostoma japonicum, Coronavirus trematode, unidentified species of Chlorella cupella, and unidentified species of Heterodontia are all preserved in our laboratory. DNA from each parasite was extracted using Qiagen's DNeasy Blood & Tissue Kit, and after concentration determination, it was stored at -20℃ for later use.

[0048] 4.2 Specific detection by quadruple fluorescent PCR The specificity of the quadruple fluorescent PCR was verified by detecting the parasite DNA in 4.1 using optimized quadruple fluorescent PCR. The results showed that ( Figure 8 Except for Clonorchis sinensis, Clonorchis orientalis, Clonorchis yokokawa, and Echinostoma miyagawa, which showed positive amplification in their respective fluorescent detection channels, the DNA of the other control parasites and the negative control showed no amplification, indicating that the quadruple fluorescent PCR detection method has good specificity.

[0049] Example 5: Preparation of four parasitic nucleic acid standards 5.1 Preparation of Nucleic Acid Standards To address the drawbacks of excessively long parasite genomes, which are prone to fragmentation due to repeated freeze-thaw cycles leading to incomplete amplification and amplification failure, and are unsuitable for long-term storage, this invention prepares a suitable nucleic acid standard in conjunction with the established quadruple fluorescent PCR detection method. This nucleic acid standard is constructed by artificially synthesizing four target gene sequences linked by GCTAGC (the restriction site of the NheI restriction enzyme) and inserting them into the pGEM-T cloning vector to construct the recombinant plasmid pGEMT-CMME. The specific sequence is shown in Table 6. The recombinant plasmid pGEMT-CMME was transformed into DH5α competent cells. After overnight culture, white spots were picked and cultured overnight. The next day, the bacterial culture was subjected to quadruple fluorescent PCR detection. For bacterial cultures showing amplification curves in all four fluorescence channels, 10 μL of plasmid was extracted and sent to Qingke Biotechnology for sequencing. The concentration of the remaining plasmid was determined and adjusted to 100 ng / μL, then aliquoted and stored at -20℃ for later use. Sequencing results showed that the obtained sequence was completely consistent with the predetermined sequence and could be used for subsequent experiments.

[0050] Table 6. Detection target sequences and nucleic acid standard gene sequences of four parasites

[0051] 5.2 Serial dilution and detection of nucleic acid standards The above nucleic acid standards were processed according to the formula: Copy number = (DNA mass (ng) × 6.022 × 10⁻⁶) / (DNA mass (ng) × 6.022 × 10⁻⁶) 23 ) / (plasmid length (bp) × 1 × 10 9 The copy number was calculated using (×650), and then serially diluted to 0.5×10⁻⁶ using ddH₂O.7 Copy number / μL, 0.5 × 10 6 Copy number / μL, 0.5 × 10 5 Copy number / μL, 0.5 × 10 4 Copy number / μL, 0.5 × 10 3 Copy number / μL, 0.5 × 10 2 Copy number / μL, 0.5 × 10 1 Copy number / μL, 0.5 × 10 0 Copy number / μL. Using ddH2O as a negative control, the serially diluted nucleic acid standards were detected by quadruple fluorescent PCR, with 2 μL of template added to each concentration. The results showed ( Figure 9 Nucleic acid standards at 0.5×10 7 Copy number / μL ~0.5×10 1 Within the copy number / μL range, all four parasites showed positive results with good linearity (Table 7), indicating relatively accurate detection results. To further verify the detection sensitivity of the quadruple fluorescent PCR method for nucleic acid standards, 0.5 × 10⁻⁶ samples were analyzed. 1 Copy number / μL, 0.5 × 10 0 Two concentrations of nucleic acid standards, each with a copy number / μL, were tested 10 times in total. (0.5 × 10⁻⁶) 1 Amplification curves were observed for all four parasites at copy number / μL each time, while 0.5×10 0 Only two replicates of Clonorchis sinensis were amplified at a copy number / μL, indicating that the limit of detection for nucleic acid standards using the four parasite fluorescence PCR methods is 0.5 × 10⁻⁶. 1 The copy number / μL indicates high sensitivity. The Ct values ​​of the lowest detection limits for the above nucleic acid standards are all ≤40, further validating the reliability of using a Ct value ≤40 as the criterion for a positive test result.

[0052] Table 7. Standard curves, linear equations, and R values ​​of serially diluted nucleic acid standards for the detection of four parasites. 2

[0053] 5.3 Repeatability and stability testing of nucleic acid standards Take 0.5×10 6 Copy number / μL, 0.5 × 10 5 Copy number / μL, 0.5 × 10 4 Three concentrations of nucleic acid standards (copy number / μL) were analyzed using a quadruple fluorescence PCR method at different time points to verify the intra-assay repeatability of the nucleic acid standards; an additional 0.5 × 10⁻⁶ μL of the standard was also tested. 7 Copy number / μL was serially diluted three times to 0.5×10⁻⁶ copies / μL. 6Copy number / μL, 0.5×10 5 Copy number / μL, 0.5 × 10 4 Three concentrations of nucleic acid standards (copy number / μL) were prepared, and the three batches of nucleic acid standards at these three concentrations were tested using quadruple fluorescence PCR to verify the batch-to-batch differences. The results (see Table 8) showed that the intra-batch repeatability coefficients of variation (Ct values) for the four parasites at the three different concentrations of nucleic acid standards were 2.63%–3.72%, and the inter-batch repeatability coefficients of variation were 2.58%–3.69%, both less than 5%, indicating that the prepared nucleic acid standards had good repeatability and stability.

[0054] Table 8. Results of repeatability and stability tests of nucleic acid standards by quadruple fluorescent PCR.

[0055] Example 6: Detection of freshwater fish samples by quadruple fluorescent PCR 6.1 Sample Collection Purchase 1 pound each of minnows and loach from the morning market of the farmers' market. Remove dirt from the surface of the fish, clean them, and remove the scales, head, fins, internal organs and bones. Collect the muscle tissue from the back and tail of the fish.

[0056] 6.2 Microscopic examination of fish muscle tissue squashes Following the squash method in GB31610.4-2023, approximately 2 g of fish tissue was placed between two glass slides, compressed, and bound. Metacercariae of trematodes were examined under a low-power microscope. Samples that tested negative under squash microscopy required further examination using the pepsin digestion method to prevent missed detection. Through squashing of some fish tissue, metacercariae with suspected morphology were found. Figure 10 A) Collect fish tissue containing metacercariae separately for DNA extraction.

[0057] 6.3 Pepsin digestion Prepare the digestion solution according to the pepsin digestion method in GB31610.4-2023; weigh 200 g of fish meat sample, add the digestion solution at a ratio of sample weight to digestion solution volume of 1:5, and digest at 37℃±1℃ for 4-16 h until the fish meat is basically digested. Filter the digestion solution through a 60-mesh copper sieve, collect the filtrate, and repeatedly precipitate and wash with physiological saline 3-5 times until the supernatant is clear; under a stereomicroscope, pick out suspected metacercariae from the precipitate for later use. Figure 10 B. Figure 10 C and Figure 10 D).

[0058] 6.4 DNA Extraction Fish tissue containing metacercariae detected by microscopic examination and metacercariae isolated by microscopy after digestion were collected separately. DNA was extracted using the Qiagen DNeasy Blood & Tissue Kit, and the nucleic acid concentration was measured before storage at -20℃.

[0059] 6.5 Quadruple fluorescent PCR detection Use 2-4 μL of DNA as a template and perform detection using the optimized 20 μL quadruple fluorescent PCR reaction system and amplification program of this invention; set up quadruple nucleic acid standards as positive controls and enzyme-free water as negative controls. Reaction program: 95℃ for 5 min; 95℃ for 15 s, 58℃ for 31 s (fluorescence signal acquisition in this step), for a total of 45 cycles. After detection, the results are judged based on Ct values, and the quadruple fluorescent PCR detection results are compared with the morphological microscopic examination results.

[0060] This embodiment uses two actual samples, minnows and loach, as the detection objects, and refers to the morphological methods in national standard GB31610.4-2023 as a reference to verify the quadruple fluorescent PCR method of this invention on real freshwater fish matrix samples. The results of the quadruple fluorescent PCR method show that ( Figure 10 E) The metacercariae found during the microscopic examination of the pressed slide were *Clonorchis orientalis* metacercariae. Two types of metacercariae were found after pepsin digestion: one was *Clonorchis sinensis* metacercariae, and the other was *Odontospira yokokawa* metacercariae. Since three types of metacercariae were found in the minnow, the minnow was determined to be positive for *Clonorchis sinensis*, *Clonorchis orientalis*, and *Odontospira yokokawa* infection. *Echinostoma miyagawa* was not detected, and *Echinostoma miyagawa* infection was negative. No metacercariae were found during the microscopic examination of the pressed slide of the loach. However, one type of metacercariae was found in the precipitate after pepsin digestion, and it was identified as *Echinostoma miyagawa*. Therefore, the loach sample was determined to be positive for *Echinostoma miyagawa* infection. *Clonorchis sinensis*, *Clonorchis orientalis*, and *Odontospira yokokawa* infection was not detected, and *Clonorchis sinensis*, *Clonorchis orientalis*, and *Odontospira yokokawa* infection was negative. The national standard GB31610.4-2023 stipulates that metacercariae detected by morphological methods need to be identified as Clonorchis sinensis by PCR and sequencing. This invention performs PCR and sequencing identification simultaneously according to the standard identification method for Clonorchis sinensis. The identification results are consistent with the detection results of Clonorchis sinensis by the quadruple fluorescent PCR method of this invention. This invention also identifies Clonorchis orientalis, Obsidian clonorchis yokokawa, and Echinostoma miyagawa. This indicates that the quadruple fluorescent PCR method of this invention can be directly applied to the simultaneous screening of Clonorchis sinensis, Obsidian orientalis, Obsidian yokokawa, and Echinostoma miyagawa in actual freshwater aquatic animal samples, and is suitable for food safety testing and epidemiological sample testing scenarios.

[0061] The present invention has been described in detail above, with the aim of enabling those skilled in the art to understand and implement the invention. However, this description should not be construed as limiting the scope of protection of the invention. All equivalent changes or modifications made in accordance with the spirit and essence of the invention should be included within the scope of protection of the invention.

Claims

1. A primer-probe combination for simultaneous detection of zoonotic parasites in freshwater aquatic animals, characterized in that, include: The upstream primer, downstream primer, and probe used for detecting Clonorchis sinensis are shown in SEQ ID NO:10, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:11, and the nucleotide sequence of the probe is shown in SEQ ID NO:

12. The probe is labeled with a FAM group at its 5' end and a BHQ1 group at its 3' end. The upstream primer, downstream primer, and probe for detecting *Clonorchis orientalis* are shown in SEQ ID NO:16, the downstream primer in SEQ ID NO:17, and the probe in SEQ ID NO:

18. The probe is labeled with a Cy5 group at its 5' end and a BHQ1 group at its 3' end. The upstream primer, downstream primer, and probe used for detecting Yokokawa clonorchis are shown in SEQ ID NO:19, the downstream primer in SEQ ID NO:20, and the probe in SEQ ID NO:

21. The probe is labeled with a VIC group at its 5' end and a BHQ2 group at its 3' end. The upstream primer, downstream primer, and probe used for detecting Echinostoma miagarae are shown in SEQ ID NO:28, the downstream primer in SEQ ID NO:29, and the probe in SEQ ID NO:

30. The probe is labeled with a Texas Red group at its 5' end and a BHQ2 group at its 3' end.

2. The primer-probe combination according to claim 1, characterized in that, In a 20 μL fluorescent PCR reaction system with 20 μM primer and probe stock solution, the volume ratio of the upstream primer, downstream primer, and probe in each primer and probe combination is 0.25~1:0.25~1:0.1~0.5, preferably 0.25:0.25:0.

125.

3. A kit for simultaneous detection of zoonotic parasites in freshwater aquatic animals, characterized in that, Includes the primer-probe combination as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, It also includes quadruple nucleic acid standards, which are recombinant plasmids or nucleic acid fragments containing the DNA sequence shown in SEQ ID NO:

35.

5. The reagent kit according to claim 4, characterized in that, It also includes fluorescent PCR premixed reaction solution and enzyme-free water.

6. A method for simultaneous detection of zoonotic parasites in freshwater aquatic animals for purposes other than disease diagnosis and treatment, characterized in that, Includes the following steps: (1) Use DNA extracted from the freshwater aquatic animal sample to be tested as a template; the DNA is total DNA from freshwater aquatic animal tissue, or DNA extracted from metacercariae isolated from freshwater aquatic animal tissue; (2) Perform multiplex real-time PCR using the primer-probe combination as described in claim 1 or 2 or the kit as described in any one of claims 3-5; (3) Determine the results based on the Ct value of the fluorescence channel: When the Ct value of the FAM channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Clonorchis sinensis nucleic acid; When the Cy5 channel Ct value is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Orientia ectenes nucleic acid; When the Ct value of the VIC channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Yokokawa metaclonal nucleic acid; When the Ct value of the Texas Red channel is ≤40 and a typical S-shaped amplification curve appears, it is determined to be positive for Echinostoma miagara nucleic acid; When all four channels—FAM, Cy5, VIC, and Texas Red—have no Ct value or a Ct value > 40 and no typical S-shaped amplification curve, the organism is identified as being negative for the nucleic acid of Clonorchis sinensis, Clonorchis orientalis, Clonorchis yokokawa, or Echinostoma miyagawa.

7. The method according to claim 6, characterized in that, The multiplex quantitative PCR reaction program is as follows: 92~98℃ for 3~10min; 92~98℃ for 5~20sec, 54~60℃ for 15~40sec, for 38~48 cycles; preferably: 95℃ for 5min; 95℃ for 15sec, 58℃ for 31sec, for 45 cycles, with fluorescence signal acquisition at 58℃ for 31sec.

8. The application of the primer-probe combination according to claim 1 or 2 or the kit according to any one of claims 3-5 in detecting Clonorchis sinensis, Clonorchis orientalis, Clonorchis yokokawa, and Echinostoma miyagawa in freshwater aquatic animal samples.

Images