Application of rice molecular marker TDRf10 in identification of CMS fertility restorer trait, kit and identification method

Abstract

The application provides a rice molecular marker TDRf10 in application of CMS fertility restoration trait identification, a kit and an identification method, and relates to the technical field of molecular marker assisted breeding.The molecular marker TDRf10 comprises a 294 bp nucleotide sequence as shown in SEQ ID No.1 and a 444 bp nucleotide sequence as shown in SEQ ID No.2.The marker is closely linked with D1 type cytoplasmic male sterility restoration gene Rf10 and wild failure type cytoplasmic male sterility restoration gene Rf4, and polymorphic sites of the two restoration genes can be simultaneously detected through one PCR reaction.Using the marker, a rice restoration line with the ability of restoring CMS-D1 and CMS-WA can be rapidly identified, and the screening efficiency of the restoration line is significantly improved, and the molecular marker has important values in molecular identification of the CMS fertility restoration trait of rice and molecular marker assisted breeding of hybrid rice.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to the application of the rice molecular marker TDRf10 in the identification of fertility restoration traits in CMS, as well as the kit and identification method. Background Technology

[0002] The foundation of three-line hybrid rice lies in cytoplasmic male sterility. Over the past fifty years, rice breeders have discovered and cultivated more than 60 cytoplasmic male sterile lines, represented by the Gang-type, Macie-type, K-type, dwarf-type, Yinshui-type, Yunnan-Dian type (Dian I and Dian II), Java-type, Baotai-type, and Honglian-type, through interspecific, intersubspecific, and intervarietal hybridization. Among them, the Baotai-type, Dian-type, and Honglian-type belong to the gametophyte sterility type, with a basically consistent restoration-protection relationship. The related sterility gene orf(H)79 and restoration genes Rf1a (PPR791), Rf1b (PPR506), and Rf6 (PPR894) have been cloned, and the mechanisms of sterility and restoration are basically clear. The wild-abort type, Gang-type, K-type, Yinshui-type, Macie-type, and Java-type belong to the sporophyte sterility type, and their restoration-protection relationships are also highly consistent. The wild-type sterility gene WA352 and its restorer gene Rf4 (PPR782) have also been cloned. Studies have shown that other sporophytic sterility types used in production all carry the wild-type sterility gene WA352. It is evident that the sterility types of three-line hybrid rice currently used in production are mainly regulated by two gene systems: orf(H)79 and WA352. This suggests that the application of rice cytoplasmic types in production is relatively limited, and the vulnerability of the genetic basis may pose potential risks to disease and pest resistance. The emergence of new ecotypes of harmful organisms or new pathogenic physiological races could pose a serious threat to rice production.

[0003] The D1 type rice cytoplasmic male sterile line is a novel sporophytic sterility type, characterized by pollen-free abortion. Furthermore, it is difficult to find a restorer source in cultivated rice varieties, and its restorer-maintainer relationship is significantly different from other sterility types. Because strong restorers are almost nonexistent in cultivated rice, the D1 type has a very broad maintainer spectrum, which can overcome the limitations of existing sterile line breeding resources, broadening the source of maintainer lines to early, mid, late, and high-quality rice, and even different subspecies of rice, greatly enhancing the breeding potential of three-line hybrid rice sterile lines. However, although the sterility gene orf182 has been cloned for D1 hybrid rice, the strong restorer gene has not yet been cloned, and related molecular marker-assisted breeding research has not been publicly reported.

[0004] Therefore, developing molecular markers that can simultaneously identify D1-type strong restorer genes and wild-type restorer genes, and using them to create broad-spectrum restorer lines that can simultaneously restore D1-type and wild-type sterile lines, has important application value for advancing molecular breeding of D1-type strong restorer lines and the breeding of D1-type hybrid rice combinations.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The first objective of this invention is to provide an application of the rice molecular marker TDRf10 in the identification of CMS fertility restoration traits. The molecular marker TDRf10 can simultaneously detect polymorphic sites closely linked to the D1 type CMS restorer gene Rf10 and the wild-type CMS restorer gene Rf4 in a single PCR reaction, thereby enabling rapid identification of rice restorer lines that can be used for multiple purposes.

[0007] It should be noted that the rice molecular marker TDRf10 of this invention is a rice Indel molecular marker. Indel (insertion-deletion) markers are markers that use specific primers designed based on the sequences flanking the nucleotide insertion / deletion site for PCR amplification. They have high distribution density, high accuracy, and good stability. This invention develops the Indel molecular marker TDRf10 based on the 150 bp large deletion site at the 3′ end of the Rf4 gene and the PPR796 gene in the genome of the D1 type strong restorer line R1318. This marker is amplified by PCR using a pair of specific primers (TDRf10-F / TDRf10-R), which can simultaneously detect polymorphic sites closely linked to the D1 type CMS restorer gene Rf10 and the wild-type CMS restorer gene Rf4 in one reaction. The amplification products present two specific fragments of 294 bp and 444 bp. This marker can be used to quickly identify rice restorer lines that can restore both CMS-D1 and CMS-WA male sterility lines, significantly improving the efficiency of restorer line screening. It has important application value in the molecular identification of CMS fertility restoration traits in rice and in molecular marker-assisted breeding of hybrid rice.

[0008] The second objective of this invention is to provide a kit for identifying the CMS fertility restoration trait in rice.

[0009] The third objective of this invention is to provide a method for identifying the CMS fertility restoration trait in rice.

[0010] The fourth objective of this invention is to provide an application of the above-mentioned kit for identifying the rice CMS fertility restoration trait and the method for identifying the rice CMS fertility restoration trait.

[0011] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: This invention provides the application of the rice molecular marker TDRf10 in the identification of fertility restoration traits in CMS, wherein the molecular marker TDRf10 comprises the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2, wherein: The nucleotide sequence of SEQ ID No. 1 is a specific fragment of 294 bp in length; The SEQ ID The sequence of No.1 is as follows: TTTGCTGCTCACTCGGCTAACGGTTTAGTGCCAGATGTTTGGACCTACAGTTTAATGGCAGAAAATCTTATAGAGCAGGGGTCGCTAGAAGAATTGGATGATCTATTTCTTTCAATGGAGGAGAATGGCTGTTCCGCCGACTC CCGCATGCTAAATTCCATTGTTAGGAAACTGTTACAGAGGGGTGATATAACCAGGGCTGGCACTTACCTGTTCATGATTGATGAGAAGCACTTCTCCCTCGAAGCATCCACTGCTTCCTTCTTGTTAGAATCTTCCCCAATCGTCTGGGAG.

[0012] The nucleotide sequence of SEQ ID No. 2 is a specific fragment of 444 bp in length.

[0013] The SEQ ID The sequence of No.2 is as follows: TTTGCTGCTCACTCGGCTAACGGTTTAGTGCCAGATGTTTTGGACCTACAGTTTAATGGCAGAAAATCTTATAGAGCAGGGGTCGCTAGAAGAATTGGATGATCTATTTCTTTCAATGGAGGAGAATGGCTGTTCCGCCGACTCCCGCATGCTAAATTCCATTGTTAGGAAACTGTTACAGAGGGGTGATATAACCAGGGCTGGCACTTACCTGTTCAT GATTGATGAGAAGCACTTCTCCCTCGAAGCATCCACTGCTTCCTTGTTTTTAGATCTTTTGTCTGGGGGAAAATATCAAGAATATCATAGGTTTCTCCCTGAAAAATATAAGTCCTTTATAGAATCTTTGAGCTGCTGAAGCCTTTTGCAGCTTTGAAATTCTGTGTTGGAGTTCTTTTCCTACAGTCGTATTAGAGGAGGGATCTTCCCCAATCGTCTGGGAG.

[0014] The TDRf10 marker was associated with fertility restoration traits in D1 type cytoplasmic male sterility (CMS-D1) and wild-type cytoplasmic male sterility (CMS-WA); The TDRf10 marker can be used for the molecular identification of the CMS fertility restoration trait in rice.

[0015] Furthermore, the applications include: PCR amplification of the rice genomic DNA to be tested; If two characteristic bands of SEQ ID No. 2 (444 bp) and SEQ ID No. 1 (294 bp) are amplified, then the rice to be tested is a rice restorer line with the ability to restore both CMS-D1 and CMS-WA. If only a single band of SEQ ID No. 1 with a size of 294 bp is amplified, the rice tested does not have the ability to restore the CMS-D1 type sterile line.

[0016] Furthermore, the PCR primer pair for PCR amplification includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer (TDRf10-F) is shown in SEQ ID No. 3; The sequence of SEQ ID No. 3 is as follows: 5′-TTTGCTGCTCACTCGGCTAA-3′; The nucleotide sequence of the reverse primer (TDRf10-R) is shown in SEQ ID No. 4; The sequence of SEQ ID No. 4 is as follows: 5′-CTCCCAGACGATTGGGGAAG-3′.

[0017] The present invention provides a kit for identifying the CMS fertility restoration trait in rice, the kit comprising the above-mentioned PCR primer pair.

[0018] This invention provides a method for identifying the CMS fertility restoration trait in rice, comprising the following steps: S1. Extract genomic DNA from the rice material to be tested; S2. Using the genomic DNA as a template, PCR amplification is performed on the rice material to be tested using the PCR primers of the present invention to obtain the amplification product. S3. Perform electrophoretic detection on the amplification product. If the amplification product contains two characteristic bands at the same time, namely SEQ ID No.2 of 444 bp and SEQ ID No.1 of 294 bp, then the material to be tested is determined to be a rice restorer line with the ability to restore both CMS-D1 and CMS-WA. If the material contains only a single SEQ ID No. 1 band of 294 bp, it is determined that the material does not have the ability to restore the CMS-D1 type sterile line.

[0019] Furthermore, the reaction system for PCR amplification in step S2 is as follows: 2×Taq Master Mix 5 μL, TDRf10-F 0.25 μL, TDRf10-R 0.25 μL, DNA template 1 μL, ddH2O to bring the total to 10 μL.

[0020] Furthermore, the PCR amplification procedure in step S2 is as follows: Pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 20 s, annealing at 60℃ for 20 s, extension at 72℃ for 20 s, for a total of 34 cycles; extension at 72℃ for 5 min.

[0021] Furthermore, the electrophoresis detection in step S3 uses 2% agarose gel electrophoresis.

[0022] The above-mentioned kit for identifying rice CMS fertility restoration traits and the above-mentioned method for identifying rice CMS fertility restoration traits provided by the present invention are applied in at least one of the following: (A) Molecular identification of rice pollen fertility; (B) Molecular marker-assisted breeding of hybrid rice; (C) Genetic diversity analysis of rice germplasm resources; (D) Identification of the cytoplasmic male sterility restoration gene in rice; (E) Screening and breeding of rice cytoplasmic male sterile restorer lines.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention relates to the application of the rice molecular marker TDRf10 in the identification of CMS fertility restoration traits. The rice Indel molecular marker TDRf10 can simultaneously detect polymorphic sites tightly linked to the D1 type CMS restorer gene Rf10 and the wild-type CMS restorer gene Rf4 in a single PCR reaction, with the amplification products exhibiting two specific fragments of 294 bp and 444 bp. Using this marker, it is possible to determine in one step whether rice materials possess the ability to restore both CMS-D1 and CMS-WA cytoplasmic male sterility types, eliminating the need for separate detection of the two restorer genes, significantly improving the efficiency of restorer line screening and simplifying the identification process.

[0024] The kit for identifying the CMS fertility restoration trait in rice provided by this invention contains the specific PCR primer pairs described above. This kit can be used for the rapid identification of the CMS fertility restoration trait in rice, and has the advantages of standardized operation, stable and reliable results, and suitability for large-scale screening in the laboratory and rapid detection in field breeding sites.

[0025] This invention provides a method for identifying rice fertility restoration traits using CMS (Cellular Methods for Rejuvenating Fertility). The method involves extracting genomic DNA from the rice sample, amplifying it using specific PCR primer pairs, and then performing electrophoresis to detect the result. This allows for rapid identification of fertility restoration traits in rice materials. The method features standardized procedures, simple steps, a short detection cycle, and intuitive result interpretation, making it suitable for screening and identifying large quantities of rice germplasm resources.

[0026] The kit and method for identifying the CMS fertility restorer trait in rice provided by this invention can be applied to various aspects, including molecular identification of rice pollen fertility, marker-assisted breeding of hybrid rice, genetic diversity analysis of rice germplasm resources, identification of the rice cytoplasmic male sterility restorer gene, and screening and breeding of rice cytoplasmic male sterility restorer lines. These applications fully leverage the advantages of this molecular marker detection—high efficiency and stable, reliable results—providing diversified technical support for the identification of the CMS fertility restorer trait in rice and related breeding work, demonstrating good practical value and promising prospects for widespread application. Attached Figure Description

[0027] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0028] Figure 1 This is a pollen fertility analysis diagram of the D1-type sterile line XYA and the strong restorer line R1318 provided in Example 1 of the present invention; Figure 2 This is a fine mapping of the D1 type strong recovery gene Rf10 provided in Embodiment 1 of the present invention; Figure 3 This is a design diagram of the dual-recovery molecular marker TDRf10 provided in Embodiment 2 of the present invention; Figure 4 This is a verification diagram of the molecular marker TDRf10 in the F2 population provided in Example 2 of the present invention; Figure 5 This is a verification diagram of the TDRf10 molecular marker in different rice materials provided in Example 3 of the present invention; Figure 6 This is a verification diagram of TDRf10 in wild rice material provided in Embodiment 4 of the present invention. Detailed Implementation

[0029] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] According to one aspect of the present invention, the application of the rice molecular marker TDRf10 in the identification of CMS fertility restoration traits, wherein the molecular marker TDRf10 comprises nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2, wherein: the nucleotide sequence of SEQ ID No. 1 is a specific fragment of 294 bp in length; and the nucleotide sequence of SEQ ID No. 2 is a specific fragment of 444 bp in length.

[0031] It should be noted that the TDRf10 marker described in this invention is associated with the fertility restoration trait in D1 type cytoplasmic male sterility and wild-type cytoplasmic male sterility. After PCR amplification, the molecular marker TDRf10 can simultaneously yield two specific amplification fragments of 294 bp and 444 bp in length, wherein the 294 bp specific amplification fragment is shown in SEQ ID No. 1; and the 444 bp specific amplification fragment is shown in SEQ ID No. 2. The TDRf10 marker can be used for the molecular identification of the fertility restoration trait in rice CMS.

[0032] The present invention relates to the application of the rice molecular marker TDRf10 in the identification of CMS fertility restoration traits. The TDRf10 marker can simultaneously detect polymorphic sites tightly linked to the D1 type CMS restorer gene Rf10 and the wild-type CMS restorer gene Rf4 in a single PCR reaction, with the amplification products exhibiting two specific fragments of 294 bp and 444 bp. Using this marker, it is possible to determine in one step whether rice materials possess the ability to restore both CMS-D1 and CMS-WA cytoplasmic male sterility types, eliminating the need for separate detection of the two restorer genes, significantly improving the efficiency of restorer line screening and simplifying the identification process.

[0033] In a preferred embodiment of the present invention, the application includes: PCR amplification of the rice genomic DNA to be tested was performed using PCR primers. If two characteristic bands of SEQ ID No. 2 (444 bp) and SEQ ID No. 1 (294 bp) were amplified, then the rice to be tested was a rice restorer line capable of restoring both CMS-D1 and CMS-WA. If only a single band of SEQ ID No. 1 with a size of 294 bp is amplified, the rice tested does not have the ability to restore the CMS-D1 type sterile line.

[0034] The seed setting rate of the double-restoration type rice material testcross with the CMS-D1 type male-sterile line was ≥81%, and the seed setting rate of the testcross with the CMS-WA type male-sterile line was ≥74%.

[0035] In a preferred embodiment of the present invention, the PCR primer pair for PCR amplification includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer (TDRf10-F) is shown in SEQ ID No. 3; The sequence of SEQ ID No. 3 is as follows: 5′-TTTGCTGCTCACTCGGCTAA-3′; The nucleotide sequence of the reverse primer (TDRf10-R) is shown in SEQ ID No. 4; The sequence of SEQ ID No. 4 is as follows: 5′-CTCCCAGACGATTGGGGAAG-3′.

[0036] As a preferred embodiment, the PCR primer pair provided by the present invention can specifically amplify the target fragment of the molecular marker TDRf10, and the amplification product is stable with clear bands, which can accurately distinguish between the two amplification fragments of 294 bp and 444 bp.

[0037] According to one aspect of the present invention, a kit for identifying the CMS fertility restoration trait in rice is provided, the kit comprising the above-described PCR primer pair of the present invention.

[0038] The kit for identifying the CMS fertility restoration trait in rice provided by this invention contains the specific PCR primer pairs described above. This kit can be used for the rapid identification of the CMS fertility restoration trait in rice, and has the advantages of standardized operation, stable and reliable results, and suitability for large-scale screening in the laboratory and rapid detection in field breeding sites.

[0039] According to one aspect of the present invention, a method for identifying the CMS fertility restorer trait in rice includes the following steps: S1. Extract genomic DNA from the rice material to be tested; S2. Using the genomic DNA as a template, PCR amplification is performed on the rice material to be tested using the PCR primers of the present invention to obtain the amplification product. S3. Perform electrophoretic detection on the amplification product. If the amplification product contains two characteristic bands, SEQ ID No. 2 (444 bp) and SEQ ID No. 1 (294 bp), then the material to be tested is determined to be a rice restorer line with the ability to restore both CMS-D1 and CMS-WA. If the material contains only a single SEQ ID No. 1 band of 294 bp, it is determined that the material does not have the ability to restore the CMS-D1 type sterile line.

[0040] This invention provides a method for identifying rice fertility restoration traits using CMS (Cellular Methods for Rejuvenating Fertility). The method involves extracting genomic DNA from the rice sample, amplifying it using specific PCR primer pairs, and then performing electrophoresis to detect the result. This allows for rapid identification of fertility restoration traits in rice materials. The method features standardized procedures, simple steps, a short detection cycle, and intuitive result interpretation, making it suitable for screening and identifying large quantities of rice germplasm resources.

[0041] In a preferred embodiment of the present invention, the PCR amplification reaction system in step S2 is as follows: 5 μL of 2×TaqMaster Mix, 0.25 μL of TDRf10-F, 0.25 μL of TDRf10-R, 1 μL of DNA template, and ddH2O to a final volume of 10 μL.

[0042] In a preferred embodiment of the present invention, the PCR amplification program in step S2 is as follows: pre-denaturation at 95°C for 3-5 min; denaturation at 95°C for 15-30 s, annealing at 59-62°C for 15-30 s, extension at 72°C for 15-30 s, for a total of 32-38 cycles; extension at 72°C for 3-5 min.

[0043] In a preferred embodiment of the present invention, the electrophoretic detection in step S3 is performed using 1.5-3% agarose gel electrophoresis.

[0044] According to one aspect of the present invention, the above-described kit for identifying the rice CMS fertility restorer trait and the above-described method for identifying the rice CMS fertility restorer trait are used in at least one of the following: (A) Molecular identification of rice pollen fertility; (B) Molecular marker-assisted breeding of hybrid rice; (C) Genetic diversity analysis of rice germplasm resources; (D) Identification of the cytoplasmic male sterility restoration gene in rice; (E) Screening and breeding of rice cytoplasmic male sterile restorer lines.

[0045] The kit and method for identifying the CMS fertility restorer trait in rice provided by this invention can be applied to various aspects, including molecular identification of rice pollen fertility, marker-assisted breeding of hybrid rice, genetic diversity analysis of rice germplasm resources, identification of the rice cytoplasmic male sterility restorer gene, and screening and breeding of rice cytoplasmic male sterility restorer lines. These applications fully leverage the advantages of this molecular marker detection—high efficiency and stable, reliable results—providing diversified technical support for the identification of the CMS fertility restorer trait in rice and related breeding work, demonstrating good practical value and promising prospects for widespread application.

[0046] The technical solution of the present invention will be further described below with reference to the embodiments.

[0047] Example 1: Identification of D1 type strong restorer line materials and fine localization of the restorer gene (I) Materials and Methods: 1. Test materials: The test materials included: the D1 type cytoplasmic male sterile line Xinye A (hereinafter referred to as XYA), the strong restorer line GW7 (derived from common wild rice in China, carrying the sterility gene orf182), and the homogeneous strong restorer line R1318 obtained by hybridization of GW7 with cultivated rice and continuous backcrossing.

[0048] Figure 1 Pollen fertility analysis of the D1 type sterile line XYA and the strong restorer line R1318 and their F1 (XYA / R1318) provided in this embodiment.

[0049] Depend on Figure 1 It can be seen that R1318 has a strong recovery ability on the D1 type sterile line XYA.

[0050] See Figure 1 It can be seen that, Figure 1 The top and middle rows show the floral morphology, while the bottom row shows the microscopic observation results of the pollen fertility of the corresponding plants. Among them, the anthers of the D1 type sterile line XYA are small, shriveled, and not exposed, with extremely sparse pollen and mostly aborted grains; the anthers of the strong restorer line R1318 are normally elongated and exposed, with abundant and rounded pollen, indicating normal fertility; the floral morphology and pollen distribution of the F1 generation (XYA / R1318) produced by the cross between the two are basically the same as those of R1318, with dense and deeply stained pollen, indicating normal fertility.

[0051] 2. Genetic analysis: The strong restorer line R1318 was crossed with the D1-type sterile line XYA to obtain F1 and F2 populations. Pollen fertility of the F1 plants was observed, and fertility of the F2 population was investigated. The segregation ratio was analyzed using the chi-square test.

[0052] 3. Preliminary and fine localization of the restored gene: Fifty fertile and 50 sterile plants were selected from the F2 population, and whole-genome sequencing analysis was performed using the MutMap method. The restorer gene was initially located on rice chromosome 10 and named Rf10. Based on this, Indel molecular markers were designed to further refine the mapping of the Rf10 gene. Simultaneously, the genome of the restorer line R1318 was resequencing to analyze candidate genes within the mapped region.

[0053] (II) Results: 1. Genetic analysis of the restoration gene: The strong restorer line R1318 was crossed with the D1 type sterile line XYA, and all F1 generation plants were fertile. A total of 2995 individual plants were investigated in the F2 generation, of which 2275 were fertile and 720 were sterile.

[0054] The chi-square test results showed that the segregation ratio of fertile to sterile plants in the F2 population was 3:1 (χ²=1.472, P=0.225), indicating that the D1 type restorer gene is controlled by single-gene dominant inheritance.

[0055] Table 1. Genetic analysis of the recovery gene Rf10:

[0056] 2. Fine mapping of the recovery gene Rf10: The Indel molecular marker primer sequences used for fine mapping of the Rf10 gene in this embodiment are shown in Table 2.

[0057] Table 2. Indel molecular marker primers used for fine mapping of the Rf10 gene:

[0058] Figure 2 This is a fine mapping of the D1 type strong recovery gene Rf10 provided in this embodiment.

[0059] in, Figure 2 Figure A in the diagram represents the BSA sequencing analysis of the F2 population. Figure 2 Image B is a fine mapping of the recovery gene Rf10.

[0060] See Figure 2 It can be seen that, Figure 2 Figure A shows the BSA sequencing analysis of the F2 population. With ΔSNP-index=0.5 as the threshold (red dashed line), the whole genome scan results show that a significant peak only appears on rice chromosome 10 (chr10), indicating that the restorer gene Rf10 is preliminarily located on this chromosome. Figure 2Figure B shows the fine mapping of the restorer gene Rf10. Using the Indel molecular markers shown in Table 2 above, the mapping interval was further narrowed, ultimately locating the Rf10 gene to the interval between 21,193,741 bp (GW7-17) and 21,329,265 bp (GW7-41) on chromosome 10. Resequencing analysis of the restorer line R1318 revealed six candidate genes encoding PPR proteins within this mapping interval: PPR830, Rf10, PPR332, PPR791, PPR969, and PPR506, with Rf10 being the candidate restorer gene.

[0061] Example 2: Development of tightly linked molecular markers for Rf10 and Rf4 (I) Materials and Methods: 1. Test materials: The test material was the F2 segregating population derived from XYA / R1318 obtained in Example 1, including fertile and sterile single plants.

[0062] 2. Genomic DNA extraction: Genomic DNA was extracted from rice leaves using the CTAB method. The specific extraction method is as follows: Take approximately 200 mg of rice leaves and grind them thoroughly into powder in liquid nitrogen. Transfer the powder to a 2 mL centrifuge tube using a spatula, add 1 mL of CTAB extraction buffer preheated to 65℃, vortex to mix, and then lyse in a 65℃ water bath for 1 hour, inverting and mixing once every 10 minutes during lysis. After lysis, cool to room temperature, add 200 µL of phenol:chloroform:isoamyl alcohol (25:24:1), invert to mix, and then centrifuge at 12000 rpm for 10 minutes. Transfer the supernatant to a new 2 mL centrifuge tube and repeat this extraction process once to remove as much residual protein as possible. Add 2 / 3 to 1 volume of isopropanol to the supernatant, mix, and precipitate at -20℃ for 30 minutes, then centrifuge at 12000 rpm for 15 minutes. Discard the supernatant and wash the precipitate twice with 75% ethanol. After the precipitate dries, dissolve it in 200 μL of ddH2O to obtain the DNA solution, which can be stored at -20℃ for later use.

[0063] 3. Molecular marker design and PCR amplification: Analysis of the restorer line R1318 genome sequence revealed that the wild-type restorer gene Rf4 exists in two copies in the genome, and both copies are located approximately 120 kb upstream of the Rf10 localization region.

[0064] Figure 3 The diagram shows the design of the dual-recovery molecular marker TDRf10 provided in this embodiment.

[0065] See Figure 3In the R1318 restorer line genome, each Rf4 gene is upstream of a PPR796 gene. The two Rf4 copies in the figure are located at 21,046,532 bp and 21,152,838 bp, respectively, corresponding upstream to the PPR796b (21,005,076 bp) and PPR796a (2111,556 bp) genes, while the Rf10 gene is located at 21,273,870 bp. The 5′ ends of Rf4 and PPR796 genes are highly homologous, but a large 150 bp deletion exists at the 3′ end. Based on this deletion site, this invention designs the dual restorer molecular marker TDRf10 (indicated by the red arrow).

[0066] Tables 3-15 are alignment tables of the three nucleotide sequences Rf4, PPR796a, and PPR796b.

[0067] Table 3. Alignment table of nucleotide sequences from position 1 to 200:

[0068] Table 4: Alignment of nucleotide sequences from position 201 to 400:

[0069] Table 5: Nucleotide sequence alignment from position 401 to 600:

[0070] Table 6: Alignment of nucleotide sequences from position 601 to 800:

[0071] Table 7: Alignment of nucleotide sequences from position 801 to 1000:

[0072] Table 8: Alignment of nucleotide sequences from position 1001 to 1200.

[0073] Table 9: Alignment of nucleotide sequences from position 1201 to 1400:

[0074] Table 10: Alignment of nucleotide sequences from position 1401 to 1600:

[0075] Table 11: Alignment of nucleotide sequences from position 1601 to 1800:

[0076] Table 12: Alignment of nucleotide sequences from position 1801 to 2000:

[0077] Table 13: Alignment of nucleotide sequences from position 2001 to 2200:

[0078] Table 14. Alignment of nucleotide sequences from position 2201 to 2400:

[0079] Table 15. Nucleotide sequence alignment from position 2401 to 2499.

[0080] Tables 3 to 15 above are alignment tables for the three nucleotide sequences Rf4, PPR796a, and PPR796b, arranged in segments of 200 sites each. The numbering is based on a uniform alignment coordinate (2499 sites in total), and "-" indicates that Rf4 is missing at that position.

[0081] The alignment results showed that Rf4 is 2349 nucleotides in length, while PPR796a and PPR796b are both 2499 nucleotides in length. The three sequences share 89.2% (2230 / 2499) identical sites, with a total of 119 base substitution sites. The homology between Rf4 and PPR796a and PPR796b is 97.0% and 97.3%, respectively. Rf4 has four unique deletions at the 3′ end relative to PPR796a and PPR796b, specifically at position 22982342 (32 nucleotides) and position 23462461 (81 nucleotides), totaling 150 nucleotides. The sequences of these four segments are identical between PPR796a and PPR796b, indicating that this deletion is unique to Rf4. The aforementioned deletions total 150 nucleotides, a multiple of 3, and therefore do not alter the reading frame downstream of the deleted segments, allowing Rf4 to encode a complete open reading frame of 782 amino acids. PPR796a and PPR796b, however, contain the stop codon TGA within their reading frames (codons at positions 797 and 803, respectively) in positions 2381-2461, prematurely terminating their open reading frames at this location. Because these four deletions are concentrated within the same region, primers designed across this region can produce amplification products of different lengths for Rf4 and for PPR796a and PPR796b, thus achieving differentiation.

[0082] Accordingly, the present invention names the specific molecular marker TDRf10, and its primer sequence is as follows: TDRf10-F: 5′-TTTGCTGCTCACTCGGCTAA-3′ (SEQ ID No. 3); TDRf10-R: 5′-CTCCCAGACGATTGGGGAAG-3′ (SEQ ID No. 4).

[0083] The PCR amplification product of this label contains two specific fragments: a 294 bp fragment (SEQ ID No. 1) and a 444 bp fragment (SEQ ID No. 2), whose nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0084] The SEQ ID The sequence of No.1 is as follows: TTTGCTGCTCACTCGGCTAACGGTTTAGTGCCAGATGTTTGGACCTACAGTTTAATGGCAGAAAATCTTATAGAGCAGGGGTCGCTAGAAGAATTGGATGATCTATTTCTTTCAATGGAGGAGAATGGCTGTTCCGCCGACTC CCGCATGCTAAATTCCATTGTTAGGAAACTGTTACAGAGGGGTGATATAACCAGGGCTGGCACTTACCTGTTCATGATTGATGAGAAGCACTTCTCCCTCGAAGCATCCACTGCTTCCTTCTTGTTAGAATCTTCCCCAATCGTCTGGGAG.

[0085] The SEQ ID The sequence of No.2 is as follows: TTTGCTGCTCACTCGGCTAACGGTTTAGTGCCAGATGTTTTGGACCTACAGTTTAATGGCAGAAAATCTTATAGAGCAGGGGTCGCTAGAAGAATTGGATGATCTATTTCTTTCAATGGAGGAGAATGGCTGTTCCGCCGACTCCCGCATGCTAAATTCCATTGTTAGGAAACTGTTACAGAGGGGTGATATAACCAGGGCTGGCACTTACCTGTTCAT GATTGATGAGAAGCACTTCTCCCTCGAAGCATCCACTGCTTCCTTGTTTTTAGATCTTTTGTCTGGGGGAAAATATCAAGAATATCATAGGTTTCTCCCTGAAAAATATAAGTCCTTTATAGAATCTTTGAGCTGCTGAAGCCTTTTGCAGCTTTGAAATTCTGTGTTGGAGTTCTTTTCCTACAGTCGTATTAGAGGAGGGATCTTCCCCAATCGTCTGGGAG.

[0086] The PCR amplification reaction system was as follows: 5 μL of 2×Taq Master Mix, 0.25 μL of TDRf10-F (10 μM), 0.25 μL of TDRf10-R (10 μM), 1 μL of DNA template, and ddH2O to a final volume of 10 μL.

[0087] The PCR amplification program is as follows: 95℃ pre-denaturation for 3-5 min; 95℃ denaturation for 15-30 s, 59-62℃ annealing for 15-30 s, 72℃ extension for 15-30 s, for a total of 32-38 cycles; 72℃ extension for 3-5 min.

[0088] 4. Electrophoresis detection: The PCR amplification products were separated by 1.5-3% agarose gel electrophoresis (1×TAE buffer, 120 V, 20 min), and the results were observed and recorded using a gel imaging system.

[0089] (II) Results: 1. Design of the molecular marker TDRf10: Analysis of the R1318 restorer line genome sequence revealed two copies of the wild-type restorer gene Rf4, both located approximately 120 kb upstream of the Rf10 mapping region. Each of the two Rf4 copies is upstream of a PPR796 gene. The 5′ ends of Rf4 and PPR796 are highly homologous, but both contain a large 150 bp deletion at the 3′ end.

[0090] Based on this deletion site, the Indel molecular marker TDRf10 was designed (see...). Figure 3 (B), this marker can specifically amplify polymorphic fragments linked to Rf10 and Rf4.

[0091] 2. Validation of the molecular marker TDRf10 in the F2 population: Figure 4 This is a validation diagram of the molecular marker TDRf10 provided in this embodiment in the F2 population.

[0092] See Figure 4 It can be seen that, Figure 4 In Figure A, the result of amplification of fertile individual plants from the F2 localization population is shown. Figure 4 In the middle (B), the amplification results of sterile single plants from the F2 localization population are shown, and DL2000 on the left represents the DNA molecular weight standard. TDRf10 labeling was used to perform PCR amplification and electrophoresis on 24 randomly selected fertile and 24 sterile single plants. The results showed that all 24 fertile single plants stably amplified two bands of 444 bp and 294 bp. Figure 4 (A), while all 24 sterile plants only amplified a single 294 bp band ( Figure 4 (B)

[0093] The specific verification method is as follows: 24 fertile single plants and 24 sterile single plants were randomly selected from the F2 segregating population derived from XYA / R1318. Genomic DNA was extracted using the CTAB method and PCR amplification was performed using TDRf10-F / TDRf10-R as primers. The amplification products were detected by 2% agarose gel electrophoresis.

[0094] The results showed that all 24 randomly selected fertile plants amplified two bands, with sizes of 444 bp and 294 bp, respectively. Figure 4 (A); while the 24 randomly selected sterile plants only amplified a single 294 bp band ( Figure 4 (B). The above results fully demonstrate that the TDRf10 marker is closely linked to the Rf10 and Rf4 fertility restoration genes, and can effectively distinguish between fertile and sterile genotypes, and can be used for molecular identification of fertility restoration traits in rice CMS.

[0095] Example 3: Application of the molecular marker TDRf10 in the screening of double-healing rice materials (I) Materials and Methods: 1. Test materials: The following rice materials were selected for TDRf10 labeling detection: Eight samples of CMS-D1 type recovery system materials (D-Recovery No. 6, D-Recovery 772, D-Recovery 1138, D-Recovery 658, D-Recovery 1032, D-Recovery 1158, D-Recovery 945, D-Recovery 1399); Five samples of CMS-D1 type retainer material (Xinye B, Xinye 3B, Xinye 6B, Xinye 8B, Luoye B); Eleven conventional rice varieties were included (Huang Huazhan, Wushan Simiao, Shaoxiang 100, Yingxiang Simiao, 13xiang, 19xiang, Xiangya Yuzhen, Huahang 38, Zhongjiazao 17, Huazhan, and Nanlingzao 2). Two CMS-HL (Red Lotus type) maintainer lines (Yuetai B, Luohong 2B) and one CMS-HL restorer line (9311). Ten CMS-WA (wild-type) restorer strains (including R225, Mingyue Simiao, Qingsi, R520, R1573, Guanghui 398, Meitezhan, Yahui 2115, Yizhen, and Taihui 808); CMS-WA maintains 12 entries (including Tai Fung B, Heung Ho B, Yeh Heung B, Hsiang Heung B, Soft Wah B, Star B, Kwong 8 B, Tsuen 9311 B, Hsin Gai B, Ma Hsieh B, Tin Fung B, and Heng Fung B).

[0096] Note: For the preparation method of the CMS-D1 type restorer material of the present invention, please refer to the following: Dhui 6 was developed by crossing W17, a fertile common wild rice variety in China, with R225 as the female parent, using molecular markers to detect the presence of D1-type cytoplasm. The F1 hybrid was then crossed with Minhui 3301 as the male parent. Using D1-type sterility gene molecular markers for assisted selection, the highly fertile F2 plants were crossed with Luojia 69. The F1 hybrid was then backcrossed with Mingyue Simiao for two generations, and further selection using D1-type sterility and restorer gene molecular markers was conducted to trace inbred lines. (Dhui 939 and Dhui 6 are of the same lineage.) Dhui 658 was developed by crossing W17, a fertile common wild rice of China with D1-type cytoplasm, with R225 as the female parent using molecular marker detection. The F1 hybrid was then crossed with Minhui 3301 as the male parent. The F2 high-fertile plants were selected with the help of D1-type sterility gene molecular markers and crossed with Yuehuihang 1698. The F1 hybrid was then backcrossed with Mingyue Simiao for two generations using the female parent. Finally, the inbred lines were selected by tracking the D1-type sterility and restorer gene molecular markers.

[0097] Dhui 1138 was developed by crossing W17, a fertile common wild rice variety in China carrying D1-type cytoplasm, with R225 as the female parent. The F1 hybrid was then crossed with Minhui 3301 as the male parent. Using D1-type sterility gene molecular marker-assisted selection, the highly fertile F2 plants were crossed with Yuehuihang 1698. The F1 hybrid was then backcrossed with Lisi rice for two generations, and further selection using D1-type sterility and restorer gene molecular markers was conducted to trace inbred lines. (Dhui 1032, Dhui 1158, and Dhui 1138 are of the same lineage.) Dhui772 was developed by crossing W17, a fertile common wild rice of China with D1-type cytoplasm, with R225 as the female parent, using molecular markers to detect the presence of D1-type cytoplasm. The F1 hybrid was then crossed with Minhui3301 as the male parent. The high fertile F2 plants were selected with the help of D1-type sterility gene molecular markers and backcrossed with Mingyue Simiao for two generations. Finally, the inbred lines were selected by the help of D1-type sterility and restorer gene molecular markers.

[0098] Dhui945 was developed by crossing W17, a fertile common wild rice of China with D1-type cytoplasm, with R225 as the female parent, using molecular markers to detect the presence of D1-type cytoplasm. The F1 hybrid was then crossed with Minhui 3301 as the male parent. The F2 high-fertile plants were selected with the help of D1-type sterility gene molecular markers and backcrossed with Mingyue Simiao for two generations. Then, the hybrid BC2F1 was used as the female parent and crossed with the BC3F3 generation of (Guangdong common wild rice GW8 / Yuehuihang 1698). The inbred lines were selected by tracking the D1-type sterility and restorer gene molecular markers. It was bred by the Jiangxi Super Rice Research and Development Center.

[0099] The parental source of Dhui1399 is {[(Chinese common wild rice W17 / R225 / / Minhui3301) / Mingyue Simiao] / Guanghui398}, which was selected by tracking inbred lines through molecular marker-assisted selection of D1 type sterility and restoration gene.

[0100] The preparation method of the CMS-D1 type retainer material of the present invention is as follows: Xinye A is a D1-type three-line male-sterile rice line developed by crossing the D1-type male-sterile line Dpei A with the F6 generation of Wushan Simiao / Yuehui 520, and then backcrossing it for 5 years and 9 generations. Among them, Dpei A is a D1-type three-line male-sterile rice line developed by crossing Dongxiang wild rice with Peidixuan as the male parent and then backcrossing it.

[0101] Luoye A is a three-line male-sterile indica rice D1 type, bred by crossing Luohong 2B with D1 type male-sterile line Dpei A as the female parent and undergoing 9 generations of backcrossing over 5 years.

[0102] Xinye 3A is a D1-type three-line male-sterile rice variety developed by crossing the D1-type male-sterile line Xinye A with the F6 generation of Xin B / Taifeng B, and then undergoing 9 generations of backcrossing over 5 years.

[0103] The remaining conventional varieties and commercial maintainer / restorer lines are conventional commercial varieties and can be obtained through commercial channels.

[0104] It should also be noted that the application of the TDRf10 mark of this invention does not depend on a specific material as the sole source. Those skilled in the art can use similar materials from any source to repeatedly implement the technical solution of this invention.

[0105] 2. Genomic DNA extraction and PCR amplification: All the above materials were extracted from rice leaves using the CTAB (hexadecyltrimethylammonium bromide) method. The specific extraction method is as follows: Take approximately 200 mg of rice leaves and grind them thoroughly into powder in liquid nitrogen. Transfer the powder to a 2 mL centrifuge tube using a spatula, add 1 mL of CTAB extraction buffer preheated to 65℃, vortex to mix, and then lyse in a 65℃ water bath for 1 hour, inverting and mixing once every 10 minutes during lysis. After lysis, cool to room temperature, add 200 µL of phenol:chloroform:isoamyl alcohol (25:24:1), invert to mix, and then centrifuge at 12000 rpm for 10 minutes. Transfer the supernatant to a new 2 mL centrifuge tube and repeat this extraction process once to remove as much residual protein as possible. Add 2 / 3 to 1 volume of isopropanol to the supernatant, mix, and precipitate at -20℃ for 30 minutes, then centrifuge at 12000 rpm for 15 minutes. Discard the supernatant and wash the precipitate twice with 75% ethanol. After the precipitate dries, dissolve it in 200 μL of ddH2O to obtain the DNA solution, which can be stored at -20℃ for later use. Using the extracted genomic DNA as a template, PCR amplification was performed using the TDRf10-F / TDRf10-R primer pair. The PCR reaction system and amplification procedure were the same as in Example 2.

[0106] 3. Electrophoresis detection: The PCR amplification products were separated by 2% agarose gel electrophoresis (1×TAE buffer, 120 V, 20 min), and the amplification bands were observed and recorded using a gel imaging system.

[0107] 4. Testcross verification: CMS-D1 type restorer line materials that simultaneously amplified double bands (294 bp and 444 bp) were selected and testcrossed with CMS-D1 type male-sterile line Xinye A (XYA) and CMS-WA type male-sterile lines Xianghe A and Ansheng A, respectively. The seed setting rate of each hybrid combination was counted.

[0108] (II) Results: 1. Banding distribution of TDRf10 markers in different rice materials: The above rice materials were subjected to PCR amplification and detection using TDRf10 labeling. Electrophoresis results are shown below. Figure 5 As shown.

[0109] Figure 5 The verification diagram of the TDRf10 molecular marker provided by this invention in different rice materials.

[0110] in, Figure 5 A represents the amplification result of the CMS-D1 restorer line; Figure 5 B represents the amplification results of the CMS-D1 maintainer line and conventional varieties; Figure 5 C represents the amplification results of the CMS-HL maintainer and restorer lines; Figure 5 D represents the amplification results of the CMS-WA type restorer and maintainer lines; DL2000 is the DNA molecular weight standard.

[0111] Depend on Figure 5 It can be seen that, Figure 5 Image A shows the amplification results of eight CMS-D1 type restorer lines (D-Restore 6, D-Restore 772, D-Restore 1138, D-Restore 658, D-Restore 1032, D-Restore 1158, D-Restore 945, and D-Restore 1399). All materials simultaneously amplified two characteristic bands of 294 bp and 444 bp. Figure 5 The results of amplification of five CMS-D1 type maintainer lines (Xinye B, Xinye 3B, Xinye 6B, Xinye 8B, and Luoye B) and 11 conventional varieties were all amplified, and only a single 294 bp band was amplified. Figure 5 In the middle, C represents the amplification results of the CMS-HL type maintainer line (Yuetai B, Luohong 2B) and restorer line (9311), both of which only amplified a single 294 bp band; Figure 5 D represents the amplification results of 10 CMS-WA type restorer lines and 12 CMS-WA type maintainer lines, all of which amplified only a single 294 bp band.

[0112] The results indicate that the TDRf10 marker amplified two bands (294 bp and 444 bp) only in CMS-D1 type restorer line materials, while only a single band (294 bp) was amplified in other types of rice materials, indicating that the marker has specific recognition ability for CMS-D1 type restorer lines.

[0113] 2. Testcross verification of TDRf10-labeled dual-healing materials: Test materials: Eight restorers of the CMS-D1 type, identified by TDRf10 markers as having double bands (294 bp, 444 bp), including Dhui6, Dhui772, Dhui1138, Dhui658, Dhui1032, Dhui1158, Dhui945, and Dhui1399. The sterile lines were the CMS-D1 type sterile line Xinye A, and the CMS-WA type sterile lines Xianghe A and Ansheng A.

[0114] Testcross method: The above 8 double-restor type restorer lines were artificially emasculated and cross-pollinated with CMS-D1 male-sterile line Xinye A, CMS-WA male-sterile line Xianghe A and Ansheng A, respectively. After harvesting the hybrid seeds, the F1 population was planted, and the natural seed setting rate of each hybrid combination was counted at maturity.

[0115] Table 3. Recovery test results of dual-recovery materials screened using TDRf10 markers:

[0116] Referring to Table 3, the natural seed setting rate of all tested restorer lines and Xinye A testcross F1 was higher than 81%, with Dhui 945 and Xinye A showing the highest seed setting rate at 89.6%. In testcrosses with the CMS-WA sterile line, all restorer lines also demonstrated good restoration capabilities, with Dhui 772 and Ansheng A testcross F1 showing the highest seed setting rate at 90.1%; Dhui 1158 and Xianghe A testcross F1 showed a seed setting rate of 74.3%, and the seed setting rates of the remaining combinations were between 80.1% and 89.2%.

[0117] The above results show that the double-banded restorer lines screened by the TDRf10 marker have the ability to restore both CMS-D1 and CMS-WA male-sterile lines, confirming that the TDRf10 marker can conveniently and efficiently screen double-restore materials with both D1-type and wild-type restorer abilities, which has important practical value for accelerating the screening of double-restore materials and the breeding of new rice varieties.

[0118] Example 4: Application of the molecular marker TDRf10 in identifying restorer sources in wild rice (I) Materials and Methods: 1. Test materials: Nineteen wild rice accessions carrying the CMS-D1 type sterility gene orf182 were selected, namely: GW8, GW7, GW73, GW106, 802, 1106, 1393, N567, N570, K40, K60, K70, K130, K140, GW3, GW16, GW68, DX50 and GW38.

[0119] 2. Genomic DNA extraction and PCR amplification: All the above materials were prepared by extracting genomic DNA from rice leaves using the CTAB method. Using the extracted genomic DNA as a template, PCR amplification was performed using the TDRf10-F / TDRf10-R primer pair. The PCR reaction system and amplification procedure were the same as in Example 2.

[0120] 3. Electrophoresis detection: The PCR amplification products were separated by 2% agarose gel electrophoresis (1×TAE buffer, 120 V, 20 min), and the amplification bands were observed and recorded using a gel imaging system.

[0121] (II) Results: PCR amplification and detection of 19 wild rice materials carrying the orf182 gene were performed using TDRf10 markers. Electrophoresis results are as follows: Figure 6 As shown.

[0122] Figure 6 This is a verification diagram of TDRf10 in wild rice material provided in this embodiment.

[0123] in, Figure 6 DL2000 is the molecular weight standard for DNA; lanes 1-20 are as follows: GW8, GW7, GW73, GW106, 802, 1106, 1393, N567, N570, K40, K60, K70, K130, K140, DL2000, GW3, GW16, GW68, DX50 and GW38.

[0124] See Figure 6 It can be seen that, except for GW3, GW16, GW68, and DX50, which only amplified a single 294 bp band, the other tested wild rice materials all amplified two characteristic bands of 294 bp and 444 bp, respectively. This indicates that the TDRf10 marker of this invention can effectively identify wild rice materials carrying the CMS-D1 type restorer source, further verifying the accuracy of this marker in restorer source identification.

[0125] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of rice molecular marker TDRf10 in the identification of fertility restoration traits in CMS, characterized in that, The molecular marker TDRf10 comprises the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2, wherein: The nucleotide sequence of SEQ ID No. 1 is a specific fragment of 294 bp in length; The nucleotide sequence of SEQ ID No. 2 is a specific fragment of 444 bp in length.

2. The application according to claim 1, characterized in that, The applications include: PCR amplification of the rice genomic DNA to be tested; If two characteristic bands of SEQ ID No. 2 with a size of 444 bp and SEQ ID No. 1 with a size of 294 bp are amplified, then the rice to be tested is a rice restorer line with the ability to restore both CMS-D1 and CMS-WA. If only a single band of SEQ ID No. 1 with a size of 294 bp is amplified, the rice tested does not have the ability to restore the CMS-D1 type sterile line.

3. The application according to claim 2, characterized in that, The PCR primer pairs used for PCR amplification of rice genomic DNA to be tested include: forward primers and reverse primers; The nucleotide sequence of the forward primer is shown in SEQ ID No. 3; The nucleotide sequence of the reverse primer is shown in SEQ ID No.

4.

4. A kit for identifying the CMS fertility restorer trait in rice, characterized in that, The kit contains the PCR primer pair as described in claim 3.

5. A method for identifying the CMS fertility restoration trait in rice, characterized in that, Includes the following steps: S1. Extract genomic DNA from the rice material to be tested; S2. Using the genomic DNA as a template, PCR amplification is performed on the rice material to be tested using the kit described in claim 4 to obtain the amplification product; S3. Perform electrophoretic detection on the amplification product. If the amplification product contains two characteristic bands at the same time, namely SEQ ID No. 2 (444 bp) and SEQ ID No. 1 (294 bp), then the rice material to be tested is determined to be a dual-recovery rice material with the ability to recover both CMS-D1 and CMS-WA. If the rice material tested contains only a single SEQ ID No. 1 band of 294 bp, it is determined that the rice material does not have the ability to restore the CMS-D1 type sterile line.

6. The identification method according to claim 5, characterized in that, The reaction system for PCR amplification in step S2 is as follows: 2×Taq Master Mix 5 μL, TDRf10-F 0.25 μL, TDRf10-R 0.25 μL, DNA template 1 μL, ddH2O to bring the total to 10 μL.

7. The identification method according to claim 5, characterized in that, The PCR amplification procedure described in step S2 is as follows: Pre-denaturation at 95℃ for 3-5 min; denaturation at 95℃ for 15-30 s, annealing at 59-62℃ for 15-30 s, extension at 72℃ for 15-30 s, for a total of 32-38 cycles; extension at 72℃ for 3-5 min.

8. The identification method according to claim 5, characterized in that, The electrophoresis detection in step S3 uses 1.5%~3% agarose gel electrophoresis.

9. The application of the kit for identifying the rice CMS fertility restoration trait as described in claim 4, and the identification method as described in any one of claims 5 to 8, in at least one of the following: (A) Molecular identification of rice pollen fertility; (B) Molecular marker-assisted breeding of hybrid rice; (C) Genetic diversity analysis of rice germplasm resources; (D) Identification of the cytoplasmic male sterility restoration gene in rice; (E) Screening and breeding of rice cytoplasmic male sterile restorer lines.

Images