A method for molecular identification of pure homozygotes of the sex-linked lophochroa feather of lophura (lophura nycho)

Abstract

The application discloses a kind of molecular identification methods of sex-linked luhua feather homozygote of luhua chicken, belong to molecular marker assisted breeding technical field.The application can quickly and accurately detect homozygous sex-linked luhua chicken individual by designing KASP detection primer for detecting three sex-linked luhua feather color strong linkage sites, and the genotype of three sites can quickly and accurately detect homozygous sex-linked luhua chicken individual, when SNP2 (C->A) at 389bp of the first intron of CDKN2A gene, SNP3 and SNP4 at 172bp (T->A) and 174bp (T->C) of the first exon are AA, AA and CC respectively, then the chicken to be measured is homozygous sex-linked luhua chicken, otherwise the chicken to be measured is heterozygous sex-linked luhua chicken or non-sex-linked luhua chicken.The application provides an effective technical means for purifying sex-linked luhua feather color gene of luhua chicken, and helps to speed up the breeding speed of sex-linked luhua chicken strain homozygote and its matching system.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular marker assisted breeding, and particularly relates to a molecular identification method of sex-linked luhua feather homozygote of luhua chicken. BACKGROUND

[0002] Sex-linked feather color traits are concerned in poultry breeding production, and the use of sex-linked feather color traits can realize the self-differentiation of female and male chicks, reduce the stress damage of artificial flip anus identification on chicks, and reduce the production cost. Luhua feather, also known as horizontal stripe feather, is a typical feather color trait in chickens. The luhua phenotype of chickens includes sex-linked luhua phenotype and autosomal luhua phenotype, and both of them form two different color stripes on the feathers. The use of sex-linked luhua feather traits can realize the breeding of self-differentiation of female and male new varieties (matching lines), which brings great convenience to poultry production. In the conventional traditional breeding technology, pure sex-linked luhua line hens need to be bred, and the genotypes of luhua feather phenotype of male chickens need to be determined as homozygotes through test cross experiments, which is laborious and time-consuming and affects the breeding speed. Therefore, it is urgent to establish a rapid and accurate molecular detection method for identifying pure sex-linked luhua chicken, to identify whether the luhua feather male chicken is a sex-linked luhua feather homozygote, and then to establish a pure line as soon as possible and accelerate the breeding speed of the self-differentiation of female and male matching line of luhua chicken.

[0003] The molecular mechanism of the local chicken breed affecting the sex-linked horizontal stripe phenotype (luhua phenotype) has been studied in depth abroad, which is mainly related to the CDKN2A gene. For domestic local chicken breeds, Wenshang luhua chicken is the only local chicken breed in China with sex-linked luhua feather traits as a typical characteristic. Although the CDKN2A gene has been found to be related to the sex-linked luhua phenotype, the research on the CDKN2A gene of domestic local chicken breeds is relatively less, and with the update of the chicken reference genome version in the database, the specific mutation site affecting the phenotype needs to be further accurately located and explored. At the same time, accelerating the breeding speed of the sex-linked luhua chicken line and its matching line is also of great significance for the mining of the sex-linked luhua feather color gene of the luhua chicken. SUMMARY

[0004] The present application provides a molecular identification method of sex-linked luhua feather homozygote of luhua chicken, which can quickly and accurately detect pure sex-linked luhua chicken individuals and significantly improve the purity of the sex-linked luhua chicken line.

[0005] To achieve the above object, the present application provides the following scheme:

[0006] The present application provides a molecular identification method of sex-linked luhua feather homozygote of luhua chicken, which comprises the following steps:

[0007] extracting a DNA sample of a chicken to be tested;

[0008] using the DNA sample of the chicken to be tested as a template, performing PCR amplification by using KASP detection primers for detecting SNP sites related to the plumage sex-linked trait of the Luzhou chicken, judging the genotype of the chicken to be tested according to the amplification result, and judging whether the chicken to be tested is a plumage sex-linked homozygote of the Luzhou chicken according to the genotype of the chicken to be tested;

[0009] the SNP sites related to the plumage sex-linked trait of the Luzhou chicken include SNP2, SNP3 and SNP4;

[0010] the SNP2 has a C / A mutation at position 131 of the sequence shown in SEQ ID NO. 14, and the genotype includes CC, CA and AA;

[0011] the SNP3 has a T / A mutation at position 113 of the sequence shown in SEQ ID NO. 15, and the genotype includes TT, TA and AA;

[0012] the SNP4 has a T / C mutation at position 115 of the sequence shown in SEQ ID NO. 15, and the genotype includes TT, TC and CC;

[0013] when the genotype of the site where the SNP2 is located is AA, the genotype of the site where the SNP3 is located is AA, and the genotype of the site where the SNP4 is located is CC, the chicken to be tested is a plumage sex-linked homozygote of the Luzhou chicken.

[0014] Optionally, the KASP detection primers include a primer combination for detecting SNP2, a primer combination for detecting SNP3 and a primer combination for detecting SNP4; the primer combination for detecting SNP2 includes an upstream primer SNP2-F1 shown in SEQ ID NO. 5, an upstream primer SNP2-F2 shown in SEQ ID NO. 6 and a downstream primer SNP2-R shown in SEQ ID NO. 7; the primer combination for detecting SNP3 includes an upstream primer SNP3-F1 shown in SEQ ID NO. 8, an upstream primer SNP3-F2 shown in SEQ ID NO. 9 and a downstream primer SNP3-R shown in SEQ ID NO. 10; and the primer combination for detecting SNP4 includes an upstream primer SNP4-F1 shown in SEQ ID NO. 11, an upstream primer SNP4-F2 shown in SEQ ID NO. 12 and a downstream primer SNP4-R shown in SEQ ID NO. 13.

[0015] Optionally, a universal fluorescent label is added to the 5' end of the upstream primer in the primer combination for detecting SNP2, the primer combination for detecting SNP3 and the primer combination for detecting SNP4.

[0016] Optionally, the universal fluorescent label comprises a FAM fluorescent label and a VIC fluorescent label.

[0017] Optionally, the sequence of the FAM fluorescent label is shown in SEQ ID NO. 16, and the sequence of the VIC fluorescent label is shown in SEQ ID NO. 17.

[0018] Optionally, the reaction system for PCR amplification is 2*KASPmaster mix 2.5 μL, primer mixture 1.25 μL and DNA sample 1.25 μL; wherein the primer mixture is composed of upstream primer 1, upstream primer 2 and downstream primer at a volume ratio of 1:1:3; the reaction conditions for PCR amplification are pre-denaturation at 95℃ for 10 min, 1 cycle; denaturation at 95℃ for 20 sec, annealing / elongation at 61-55℃ for 60 sec, 10 cycles; denaturation at 95℃ for 20 sec, annealing / elongation at 55℃ for 60 sec, 27 cycles; reading at 25℃ for 30 sec, 1 cycle.

[0019] The application further provides application of KASP detection primers for detecting SNP sites related to the sex-linked Luhua feather trait of Luhua chicken in identifying homozygotes of the sex-linked Luhua feather of Luhua chicken, wherein the SNP sites related to the sex-linked Luhua feather trait of Luhua chicken comprise SNP2, SNP3 and SNP4; the SNP2 has a C / A mutation at position 131 of the sequence shown in SEQ ID NO. 14, and the genotype comprises CC, CA and AA; the SNP3 has a T / A mutation at position 113 of the sequence shown in SEQ ID NO. 15, and the genotype comprises TT, TA and AA; and the SNP4 has a T / C mutation at position 115 of the sequence shown in SEQ ID NO. 15, and the genotype comprises TT, TC and CC.

[0020] Optionally, the KASP detection primer comprises a primer combination for detecting SNP2, a primer combination for detecting SNP3 and a primer combination for detecting SNP4; the primer combination for detecting SNP2 comprises an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO. 5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO. 6 and a downstream primer SNP2-R of the sequence shown in SEQ ID NO. 7; the primer combination for detecting SNP3 comprises an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO. 8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO. 9 and a downstream primer SNP3-R of the sequence shown in SEQ ID NO. 10; and the primer combination for detecting SNP4 comprises an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO. 11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO. 12 and a downstream primer SNP4-R of the sequence shown in SEQ ID NO. 13.

[0021] Optionally, a universal fluorescent label is added to the 5' end of the upstream primer in the primer combination for detecting SNP2, the primer combination for detecting SNP3 and the primer combination for detecting SNP4; the universal fluorescent label comprises a FAM fluorescent label and a VIC fluorescent label.

[0022] Optionally, the sequence of the FAM fluorescent label is shown in SEQ ID NO. 16, and the sequence of the VIC fluorescent label is shown in SEQ ID NO. 17.

[0023] The present application discloses the following technical effects:

[0024] The present application can quickly and accurately detect homozygous linkage Luzhou chicken individuals by designing KASP detection primers for detecting three sex-linked Luzhou feather color strongly linked loci, and can significantly improve the purity of sex-linked Luzhou chicken strains. This high-purity strain is of great significance for maintaining breed characteristics, improving production efficiency and meeting market demand. The molecular identification method of the present application is more direct and efficient than the traditional phenotype selection method, greatly shortening the breeding period.

[0025] The present application provides an effective technical means for purifying sex-linked Luzhou feather color genes of Luzhou chicken, which helps to accelerate the breeding speed of sex-linked Luzhou chicken strain homozygosity and its matching system. It lays a foundation for improving the competitiveness of Luzhou chicken industry and promoting the development of related industries. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows. Obviously, the accompanying drawings in the following description only only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 The agarose gel electrophoresis diagram of PCR amplification products of three SNP sites; the leftmost and rightmost lanes are Marker (2000bp), and the lengths of SNP2 and SNP3 / 4 amplification fragments are 356bp and 370bp respectively;

[0028] Figure 2 The first-generation sequencing peak diagram of SNP2, SNP3 and SNP4 three sites; wherein A is the first-generation sequencing peak diagram of SNP2 site, and B is the first-generation sequencing peak diagram of SNP3 and SNP4 sites;

[0029] Figure 3 The KASP genotyping results of each site; wherein a is the KASP genotyping result of SNP2 site; b and c are respectively the KASP genotyping results of SNP3 and SNP4 sites, the higher the FAM fluorescence ratio in the horizontal coordinate is, which is homozygous type 1 (yellow circle), the higher the VIC / HEX fluorescence ratio in the vertical coordinate is, which is homozygous type 2 (blue square); the middle region has two fluorescence ratios, which is heterozygous type (green triangle); the black in the lower left corner is negative control (NTC). DETAILED DESCRIPTION

[0030] The detailed description of the various exemplary embodiments of the present application is not considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0031] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the range, and any other stated value or intermediate value in the range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0032] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains unless otherwise specifically defined herein. Although preferred methods and materials are described herein, any method and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described herein. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0033] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application. The specification and examples are illustrative only.

[0034] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0035] Examples

[0036] 1. Sample source

[0037] The chicken used in the experiment of the present application is Wen Shang Lu chicken, which is provided by Jiangsu Poultry Science Institute National Local Chicken Gene Library.

[0038] 2. Blood collection and DNA extraction

[0039] 2 mL of blood was collected from the wing vein, and after EDTA anticoagulation, it was stored in a 4°C refrigerator for a short time. The blood DNA was extracted by phenol-chloroform extraction method and used for PCR amplification test.

[0040] 3. Primer synthesis

[0041] According to the 3 SNP sites on the CDKN2A gene, the primers were designed, and the 3 SNP sites were SNP2 (C->A) at 389 bp of the first intron of CDKN2A gene, SNP3 (T->A) at 172 bp of the first exon, and SNP4 (T->C) at 174 bp (reference genome bGalGal1.mat.broiler.GRCg7b version).

[0042] According to the primer sequences provided in Table 1, 3 SNP site-specific amplification primers and DNA sequencing primers were synthesized; according to the primer sequences provided in Table 2, KASP identification typing primers of 3 SNP sites were synthesized.

[0043] Table 1 Information of specific amplification and first sequencing primers of target fragments

[0044]

[0045] Table 2 KASP site identification primer information

[0046]

[0047] 4. PCR amplification and first-generation sequencing

[0048] SNP2 amplification system 50 μL: template DNA 2.0 μL; 10 pM primers each 1.0 μL; ddH2O 21.0 μL; 2x EasyTaq PCR SuperMix 25.0 μL. Amplification procedure: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 30 seconds, a total of 34 cycles; 72°C post-extension for 5 minutes.

[0049] SNP3 and SNP4 amplification system 40 μL: template DNA 1.5 μL; 10 pM primers each 1.75 μL; 1.1x T3 SuperPCR Mix 35.0 μL. Amplification procedure: 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 65°C annealing for 10 seconds, 72°C extension for 10 seconds, a total of 36 cycles; 72°C post-extension for 5 minutes.

[0050] PCR amplification to obtain the target fragment, and the PCR product was subjected to agarose gel electrophoresis, and the results were as shown in Figure 1 . After purification of the amplification product, the first-generation sequencing primer in Table 1 was used for DNA Sanger sequencing to further obtain accurate sequence and site information, and the sequencing results of the three sites were as shown in Figure 2 , and the sequence information of the amplification product was as follows:

[0051] SNP2 amplification product sequence (SEQ ID NO. 14):

[0052] AAGCAGCAGGTGGTCGGCAGGCTATCTCTGTCTTTTCTCCCTCTTTGACAAATAATTTCTCTTCCCCCGGGCATAACTCAAAGCAGAAGAGCGCAGCTCCCCTCACACCGTCTGGGCGTTCTACCCTCGGAGGGCAGAAAAGCGCCGTGGCCGCCCCCGCGGGTGTAACTTTTCCCCGCCGTAAGTGGGGGGAAATGCGTCTCCGGAGGCTTTAGAGACATTTCCCCGATTTCAGATGGCAAAAGTGGGTCGCTGCGACTCTGCACAGCTCAGCTTAGGCCTCGGTCGTTGTACACAATTGTGTGTGTAAGGAAAAATAACGCGGCTGCTCGTTATGATGAGAATACGTGGACCTC.

[0053] SNP3 and SNP4 amplification product sequence (SEQ ID NO. 15):

[0054] ATGGAGAGTGAGAGAGCTTTCTTACGGTGGGGGCCCCGCGGAGGGAACGCATTTCCATCGCGGCTCTCCGGGACCTCTCCTGTTCCCATGACCTCTCGGATAAGGTGCACCGACCGCCTTCGGCGCGCCCGCAGCCGGCCTCTGTCCTTCTCGCTGCTCCGGCGCATCTTGCGCGGGGTGGCCGCTGTCCTGCGGCGCTCCGGGACGCTTCGCCGCATTCTGCGCCGGGTTCTGAGAAGGAGGCACCGGGGCAGCCGCCGGCCCAGGTACGGCGGGGGGCGGCGGGGCCCGGAGGGCCGAGTGGAGGCGGCACGGGGCCCGCACGCGTCGTTCTCTCCTCTTTCTATTCTACTTTACTTTTCTCTTGAGC.

[0055] Wherein, the 131th position of the sequence shown in SEQ ID NO. 14 is SNP2 site, the base of which has C / A mutation; the 113th position of the sequence shown in SEQ ID NO. 15 is SNP3 site, the base of which has T / A mutation, and the 115th position is SNP4 site, the base of which has T / C mutation.

[0056] 5. KASP identification typing

[0057] (1) Add universal fluorescent label to the 5' end of the primer shown in Table 2, F1 (FAM): GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 16), F2 (VIC): GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 17).

[0058] (2) The newly synthesized primer is diluted to 10 μM with TE (pH = 8.0), and then mixed according to the volume ratio of 1:1:3 of the upstream typing primer F1: the upstream typing primer F2: the downstream universal primer R, and then loaded onto the machine, with 1.25 μL of the primer mixture added to each 5 μL reaction system.

[0059] (3) DNA sample dilution and addition: The DNA sample is diluted to the lowest concentration sample (45.0 ng / μL) to the individual digit ratio for batch sample dilution, with 1.25 μL of the diluted DNA sample contained in each 5 μL reaction system.

[0060] (4) PCR reaction system construction (each reaction) as shown in Table 3, the reaction is carried out on a 96-well plate.

[0061] Table 3 PCR reaction system

[0062]

[0063] (5) Seal the 96-well PCR reaction plate, shake, centrifuge, and ensure uniform mixing of the reaction system.

[0064] (6) After centrifugation, perform PCR reaction, and the reaction program is as shown in Table 4.

[0065] Table 4 PCR reaction program

[0066]

[0067] 6. Result interpretation

[0068] SNP2 corresponds to homozygous type 1 AA genotype, SNP3 and SNP4 correspond to homozygous type 2 AA and CC genotype, respectively. Figure 3 The test chicken phenotype and genotype information for detection is shown in Table 5. According to the data in Table 5 and Figure 3 , if the genotypes of SNP2, SNP3 and SNP4 are AA, AA and CC, respectively, then the test chicken is homozygous linkage Luhua chicken (Z B Z B ); otherwise, the test chicken is heterozygous linkage Luhua chicken (Z B Z b ) or non-linkage Luhua chicken (Z b Z b ).

[0069] Table 5. Phenotypic and genotypic information for test chickens

[0070]

[0071] The above embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A method for molecular identification of homozygous plumage of Wanshang Luzhou chicken sex-linked Luzhou chicken, characterized in that, The method comprises the following steps: extracting a DNA sample of a chicken to be tested; using the DNA sample of the chicken to be tested as a template, performing PCR amplification using KASP detection primers for detecting SNP sites related to the sex-linked flaxen feather trait of Wenshang flaxen chicken, and judging the genotype of the chicken to be tested according to the amplification result, and judging whether the chicken to be tested is a homozygote of the sex-linked flaxen feather of Wenshang flaxen chicken according to the genotype of the chicken to be tested; the SNP sites related to the sex-linked flaxen feather trait of Wenshang flaxen chicken comprise SNP2, SNP3 and SNP4; the SNP2 has a C / A mutation at position 131 of the sequence shown in SEQ ID NO. 14, and the genotype comprises CC, CA and AA; the SNP3 has a T / A mutation at position 113 of the sequence shown in SEQ ID NO. 15, and the genotype comprises TT, TA and AA; the SNP4 has a T / C mutation at position 115 of the sequence shown in SEQ ID NO. 15, and the genotype comprises TT, TC and CC; when the genotype of the site where the SNP2 is located is AA, the genotype of the site where the SNP3 is located is AA, and the genotype of the site where the SNP4 is located is CC, the chicken to be tested is a homozygote of the sex-linked flaxen feather of Wenshang flaxen chicken.

2. The method of molecular identification of claim 1, wherein, the KASP detection primers comprise a primer combination for detecting SNP2, a primer combination for detecting SNP3 and a primer combination for detecting SNP4; the primer combination for detecting SNP2 comprises an upstream primer SNP2-F1 of the sequence shown in SEQ ID NO. 5, an upstream primer SNP2-F2 of the sequence shown in SEQ ID NO. 6 and a downstream primer SNP2-R of the sequence shown in SEQ ID NO. 7; the primer combination for detecting SNP3 comprises an upstream primer SNP3-F1 of the sequence shown in SEQ ID NO. 8, an upstream primer SNP3-F2 of the sequence shown in SEQ ID NO. 9 and a downstream primer SNP3-R of the sequence shown in SEQ ID NO. 10; the primer combination for detecting SNP4 comprises an upstream primer SNP4-F1 of the sequence shown in SEQ ID NO. 11, an upstream primer SNP4-F2 of the sequence shown in SEQ ID NO. 12 and a downstream primer SNP4-R of the sequence shown in SEQ ID NO.

13.

3. The method of molecular identification of claim 2, wherein, In the primer combination for detecting SNP2, the primer combination for detecting SNP3 and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer.

4. The method of molecular identification of claim 3, wherein, the universal fluorescent label comprises a FAM fluorescent label and a VIC fluorescent label.

5. The method of molecular identification of claim 4, wherein, the sequence of the FAM fluorescent label is shown in SEQ ID NO. 16, and the sequence of the VIC fluorescent label is shown in SEQ ID NO.

17.

6. The method of molecular identification of claim 1, wherein, The reaction system of the PCR amplification is 2*KASP master mix 2.5 μL, primer mixture 1.25 μL and DNA sample 1.25 μL; wherein the primer mixture is composed of upstream primer 1, upstream primer 2 and downstream primer at a volume ratio of 1:1:3; the reaction conditions of the PCR amplification are pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 sec, annealing / elongation at 61-55°C for 60 sec, 10 cycles; denaturation at 95°C for 20 sec, annealing / elongation at 55°C for 60 sec, 27 cycles; reading at 25°C for 30 sec, 1 cycle.

7. The use of KASP detection primers for detecting SNP sites related to the sex-linked hackle feather traits of Wenshang Luhua chicken in identifying Wenshang Luhua chicken sex-linked hackle feather homozygotes, characterized in that, The SNP site related to the sex-linked asil plumage trait of Wenshang asil chicken includes SNP2, SNP3 and SNP4; the SNP2 is a C / A mutation at position 131 in the sequence shown in SEQ ID NO. 14, and the genotype includes CC, CA and AA; the SNP3 is a T / A mutation at position 113 in the sequence shown in SEQ ID NO. 15, and the genotype includes TT, TA and AA; the SNP4 is a T / C mutation at position 115 in the sequence shown in SEQ ID NO. 15, and the genotype includes TT, TC and CC; when the genotype of the site where the SNP2 is located is AA, the genotype of the site where the SNP3 is located is AA, and the genotype of the site where the SNP4 is located is CC, the chicken to be tested is a Wenshang asil chicken sex-linked asil plumage homozygote.

8. Use according to claim 7, characterized in that, The KASP detection primer includes a primer combination for detecting SNP2, a primer combination for detecting SNP3 and a primer combination for detecting SNP4; the primer combination for detecting SNP2 includes an upstream primer SNP2-F1 shown in SEQ ID NO. 5, an upstream primer SNP2-F2 shown in SEQ ID NO. 6 and a downstream primer SNP2-R shown in SEQ ID NO. 7; the primer combination for detecting SNP3 includes an upstream primer SNP3-F1 shown in SEQ ID NO. 8, an upstream primer SNP3-F2 shown in SEQ ID NO. 9 and a downstream primer SNP3-R shown in SEQ ID NO. 10; the primer combination for detecting SNP4 includes an upstream primer SNP4-F1 shown in SEQ ID NO. 11, an upstream primer SNP4-F2 shown in SEQ ID NO. 12 and a downstream primer SNP4-R shown in SEQ ID NO.

13.

9. Use according to claim 8, characterized in that, In the primer combination for detecting SNP2, the primer combination for detecting SNP3 and the primer combination for detecting SNP4, a universal fluorescent label is added to the 5' end of the upstream primer; the universal fluorescent label includes a FAM fluorescent label and a VIC fluorescent label.

10. Use according to claim 9, characterized in that, The sequence of the FAM fluorescent label is shown in SEQ ID NO. 16, and the sequence of the VIC fluorescent label is shown in SEQ ID NO. 17.

Images