Salmon product species source high-throughput molecular identification method based on double markers
The dual-label high-throughput molecular identification method solves the problems of low efficiency and high cost in large-scale species identification of salmon products, achieving efficient and accurate species identification. It is applicable to salmon products in various processing states, protecting consumers and market order.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-14
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are insufficient to meet the needs for rapid, accurate, and economical species identification of large quantities of salmon products, especially in processed samples, where traditional methods are inefficient and costly.
A dual-label-based high-throughput molecular identification method was used. DNA was extracted by phenol-chloroform method, PCR amplification was performed using primers with specific tags, a high-throughput sequencing library was constructed, and paired-end sequencing was performed on the Illumina NovaSeq platform. The results were then compared and analyzed using the NCBI database.
It enables efficient and accurate species identification of dozens to hundreds of salmon samples, reduces testing costs, is applicable to salmon products in various processing states, protects consumer rights, and maintains market order.
Smart Images

Figure CN121759587A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection technology, specifically to a high-throughput molecular identification method for salmon product species based on dual labeling. Background Technology
[0002] Salmon, as one of the world's most important economic fish, is highly favored by consumers for its rich nutritional value and unique flavor. Salmon is rich in protein, unsaturated fatty acids (especially EPA and DHA), vitamin D, vitamin B12, selenium, and other nutrients. As a major salmon consumer, China experiences exponential growth in market demand. However, driven by huge market demand and substantial profits, the salmon market has encountered a serious problem of species substitution. Some unscrupulous merchants, in pursuit of higher economic benefits, use relatively inexpensive Pacific salmon, such as rainbow trout, coho salmon, and sockeye salmon, to impersonate more expensive Atlantic salmon. This substitution not only seriously infringes upon consumers' legitimate rights and interests but also disrupts normal market order, negatively impacting the healthy development of the entire salmon industry. The reason this substitution phenomenon can persist on such a large scale is mainly due to the similarities in appearance, texture, and taste among different salmonid species, especially after processing, making it difficult for ordinary consumers to accurately distinguish them based solely on sensory characteristics. Furthermore, some merchants further conceal the true species information by altering product packaging and labels, making it even more difficult for consumers to identify the authenticity of the product.
[0003] For whole, fresh fish, traditional morphological identification methods remain effective to some extent. However, when salmon undergoes various processing methods, such as slicing, smoking, pickling, and canning, its original morphological characteristics are mostly destroyed or altered, rendering traditional morphological identification methods useless. Especially in the modern food industry, salmon products are being processed in increasingly diverse ways, from simple frozen slices to complex deep-processed products, all requiring reliable species identification techniques to ensure accurate product labeling. With the rapid development of molecular biology techniques, molecular identification methods are widely used in the field of food species identification. These techniques, based on the DNA or proteins of organisms, can accurately identify species at the molecular level. Compared to proteins, DNA is more stable and maintains high identification accuracy even after severe sample processing. In the molecular identification of salmonid fish, mitochondrial DNA sequences have become the most commonly used molecular markers due to their moderate evolutionary rate, small intraspecific variation, and significant interspecific differences. Among them, the COI gene and 16S rRNA gene are considered the most effective DNA barcode sequences, capable of accurately distinguishing most salmonid fish. By amplifying the target gene fragment by PCR and then combining it with Sanger sequencing technology, the DNA sequence information of the sample can be obtained, and the species identity can be determined by comparison and analysis with a reference database.
[0004] While molecular biology techniques have demonstrated significant advantages in species identification, existing methods still have some limitations and struggle to meet the demands of large-scale commercial testing. First, traditional molecular identification methods are primarily based on single-sample testing, requiring individual sequencing analysis for each sample. This level of efficiency is insufficient to meet the rapid testing needs of modern food industries for large volumes of samples. Second, single-sample testing is relatively expensive. When testing a large number of samples, the overall cost increases significantly, posing a major constraint on routine quality control and market supervision.
[0005] Against this backdrop, traditional single-sample testing methods can no longer meet practical needs, necessitating the development of a high-throughput testing technology capable of processing large batches of samples simultaneously. This technology must not only ensure the accuracy and reliability of the test results but also possess characteristics such as high efficiency, low cost, and ease of operation to adapt to the actual requirements of modern food testing.
[0006] The development of high-throughput sequencing technology has provided a new approach to solving this problem. Combined with sample labeling technology, dozens or even hundreds of samples can be processed simultaneously in a single sequencing reaction, greatly improving detection efficiency and reducing the cost per sample. At the same time, high-throughput sequencing technology can also provide richer sequence information, helping to improve the accuracy and reliability of species identification. Summary of the Invention
[0007] The purpose of this invention is to provide a high-throughput molecular identification method for salmon product species based on dual markers, in order to solve the technical problems of high cost and inability to meet the needs of large-scale sample testing in the existing technology.
[0008] To achieve the above objectives, this invention provides a high-throughput molecular identification method for salmon product germplasm based on dual markers, the method comprising the following steps: (1) DNA was extracted from salmonid fish samples using the phenol-chloroform method; (2) The extracted DNA sample was amplified by PCR using fish universal primers with specific tags to obtain the target sequence and the sample was labeled for the first time. The target sequence is the mitochondrial 16S fragment. (3) Construct a high-throughput sequencing library from the target sequence using a sequencing kit and perform a second labeling; (4) Use the Illumina NovaSeq platform to perform paired-end sequencing on the library; perform quality control and data processing on the obtained raw sequencing data to obtain high-quality sequence data, and compare and analyze the high-quality sequence data with the reference sequence.
[0009] Furthermore, the salmonid fish mentioned include Atlantic salmon, rainbow trout, coho salmon, salmon, and pink salmon.
[0010] Furthermore, the primers are universal primers for identifying fish. Furthermore, the universal primer sequences are designed as follows: forward primer 5'-NNNNNN-GACCCTATGGAGCTTTAGAC-3', reverse primer 5'-MMMMMM-CGCTGTTATCCCTAGGGTAACT-3', The nucleotide sequence of SEQ ID NO.1 is GACCCTATGGAGCTTTAGAC, and the nucleotide sequence of SEQ ID NO.2 is CGCTGTTATCCCTAGGGTAACT.
[0011] Furthermore, NNNNNN and MMMMMM represent the 6bp specific tag sequences at the 5' ends of the forward and reverse primers, respectively.
[0012] Furthermore, the specific tag is a 6 bp DNA sequence located at the 5' end of the primer.
[0013] Furthermore, the tag sequences include, but are not limited to, TTAGGC, TGACCA, TAGCTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, and ACAGTG.
[0014] Furthermore, the tag sequences differ by at least 3 bases.
[0015] Furthermore, the PCR amplification system is: containing Mg²⁺ + The mixture contained 5 μL of 10×Ex Taq buffer, 5 μL of 2.5 mM dNTPs mixture, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 0.25 μL of 5 U / μL TaKaRa Ex Taq enzyme, 1 μL of 50 ng / μL DNA template, and 37.75 μL of sterile water.
[0016] Furthermore, the PCR amplification conditions are as follows: pre-denaturation at 94°C for 5 minutes, followed by 35 cycles, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 42 seconds, and a final extension at 72°C for 10 minutes.
[0017] Furthermore, the first labeling identifies the sample through a unique combination of the forward primer label and the reverse primer label.
[0018] Furthermore, the high-throughput sequencing library construction process includes: PCR product purification, equimolar mixing of samples with different tags, addition of sequencing adapters, and quality detection.
[0019] Furthermore, the second labeling uses Illumina sequencing adapters, including P5 and P7 adapter sequences, each adapter containing a 6bp sample index sequence, to achieve a second identification of the sample.
[0020] Furthermore, the index sequences include, but are not limited to, TTAGGC, TGACCA, TAGCTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, and ACAGTG.
[0021] Furthermore, the quality testing includes AATI testing to determine the integrity of the library DNA fragments and the size of the inserted fragments, and qPCR testing to determine the effective concentration of the library.
[0022] Furthermore, the read length of the paired-end sequencing is 150bp×2.
[0023] Furthermore, the quality control and data processing include removing adapter and primer sequences, splitting mixed sequencing data into individual sample data, filtering low-quality bases and reads, and removing short sequences.
[0024] Furthermore, the comparison analysis involves BLASTing high-quality sequence data with reference sequences of salmonid fish in the NCBI database, with a similarity threshold set to ≥99%.
[0025] Furthermore, the method can process dozens to hundreds of samples simultaneously, achieving high-throughput batch detection.
[0026] Furthermore, the method is applicable to salmon products with different degrees of processing, including: (1) fresh products: fresh salmon, chilled salmon slices, frozen salmon chunks; (2) lightly processed products: smoked salmon, salted salmon, marinated salmon; (3) heat-processed products: cooked salmon, grilled salmon, steamed salmon; (4) canned products: boiled salmon cans, oil-packed salmon cans.
[0027] Compared with the prior art, the beneficial effects of the present invention are as follows: Employing a high-throughput detection mode, this invention can process hundreds of samples simultaneously, significantly improving detection efficiency. Detection costs are substantially reduced, enhancing the economics and practicality of the detection method. It has a wide range of applications, suitable for salmon products in various processing stages, from fresh to highly processed products, accurately detecting salmon in diverse scenarios. This invention provides an efficient, accurate, and economical technical solution for the species identification of salmon products, effectively addressing the issue of salmon species substitution in the market, protecting consumer rights, and maintaining market order. It has significant practical value and broad application prospects for food safety supervision and consumer protection. Attached Figure Description
[0028] Figure 1 A schematic diagram of the high-throughput molecular identification method for salmon product species based on dual markers provided by the present invention; Figure 2 This is a simplified experimental flowchart of the high-throughput molecular identification method for salmon product species based on dual labeling, as described in this invention. Detailed Implementation
[0029] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0030] In this embodiment of the invention, a total of 186 salmon samples were collected from offline supermarkets, restaurants, and online shopping platforms in Shenzhen between June 2024 and May 2025, including fresh salmon fillets, sushi, and canned salmon. All samples were transported to the laboratory via cold chain (temperature controlled at 2-8℃). Upon arrival, the samples were immediately processed, and the processed samples were stored in a -20℃ refrigerator for later use.
[0031] Example like Figure 1 and 2 As shown, The species of 186 collected salmon samples were identified using a dual-label high-throughput molecular identification method. The steps are as follows: (1) Sample DNA extraction: DNA was extracted from salmonid fish samples using the phenol-chloroform method.
[0032] (2) First labeling and PCR amplification: The DNA sample was amplified by PCR using universal primers for fish with specific tags to obtain the mitochondrial 16S target sequence. The universal primer sequences were: forward primer 5'-NNNNNN-GACCCTATGGAGCTTTAGAC-3' and reverse primer 5'-MMMMMM-CGCTGTTATCCCTAGGGTAACT-3', where NNNNNN and MMMMMM represent the 6bp specific tag sequence at the 5' end of the primer. The tag sequence includes, but is not limited to, TTAGGC, TGACCA, TAGCTT, GGCTAC, ... Tags such as GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, and ACAGTG, with at least 3 base differences between their sequences, are used to initially identify samples through a unique combination of forward and reverse primer tags. In this example, 10 sets of tags are used, with sequences: TTAGGC, TGACCA, TAGCTTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, and ATCACG. These can be combined to obtain 100 tags. The PCR amplification system contains Mg²⁺. + The amplification conditions were as follows: 5 μL of 10×Ex Taq buffer, 5 μL of 2.5 mM dNTPs mixture, 1 μL each of 10 μM forward and reverse primers, 0.25 μL of 5 U / μL TaKaRa Ex Taq enzyme, 1 μL of 50 ng / μL DNA template, and 37.75 μL of sterile water. The amplification conditions were: 94℃ pre-denaturation for 5 minutes followed by 35 cycles (95℃ denaturation for 30 seconds, 52℃ annealing for 30 seconds, 72℃ extension for 42 seconds), and a final extension at 72℃ for 10 minutes.
[0033] (3) Second labeling and library construction: After purifying the PCR products, 93 samples labeled with different tag groups were mixed at equal concentrations to obtain two initial pools. Illumina sequencing adapters (P5 and P7 adapter sequences, each adapter containing a 6bp sample index sequence) were added to the initial pools and a second labeling was performed. The index sequences include, but are not limited to, TTAGGC, TGACCA, TAGCTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, ACAGTG, etc. In this example, two sets of tags were used, with sequences of TTAGGC and TGACCA. After mixing the two initial pools into a final pool, the integrity of the library DNA fragments and the size of the inserted fragments were detected by AATI, and the effective concentration of the library was detected by qPCR to complete the quality test.
[0034] (4) High-throughput sequencing and data analysis: 150bp×2 paired-end sequencing was performed using the Illumina NovaSeq platform. The raw sequencing data was processed, including removing adapter and primer sequences, splitting mixed data into individual sample data, filtering low-quality bases and reads, and removing short sequences less than 180bp. The high-quality sequence data were then subjected to BLAST analysis with reference sequences of salmonid fish in the NCBI database. The sequence alignment results are shown in Table 1.
[0035] Comparative Example In this comparative example, Sanger sequencing was used to perform bidirectional sequencing analysis on the samples in Example 1. The DNA extraction and PCR amplification steps were the same as in the example. The primers used were unlabeled. The forward primer sequence was 5'-GACCCTATGGAGCTTTAGAC-3', and the reverse primer sequence was 5'-CGCTGTTATCCCTAGGGTAACT-3'. The purified PCR products were sent to a biotechnology company for Sanger sequencing. After removing the primers, the sequences obtained from the sequencing were compared with the reference sequences for salmonid fish in the NCBI database using BLAST analysis. The sequence alignment results are shown in Table 1.
[0036] Table 1 As shown in Table 1, a dual-label high-throughput molecular identification method was used to detect 186 salmon samples, and accurate species identification results were successfully obtained for all samples. The results showed that the samples mainly contained four species: Atlantic salmon, pink salmon, rainbow trout, and salmon chum, with sequence similarity ranging from 99.51% to 100.00%, completely consistent with traditional Sanger sequencing results, demonstrating the reliability of this method. The dual-label system achieved unique identification and accurate differentiation of samples. The first labeling obtained 100 identifiers through forward and reverse combinations of 10 sets of 6bp tags, and the second labeling utilized Illumina adapter indexes for secondary labeling of the samples. Compared with traditional single-sample detection methods, this invention achieves high-throughput batch detection and reduces costs while ensuring detection accuracy.
[0037] Mixed sample detection: "Atlantic salmon vs. rainbow trout" DNA mixtures of 99:1, 95:5, and 90:10 were prepared and detected using the method of this invention. The results are shown in Table 2.
Claims
1. A high-throughput molecular identification method for the germplasm of salmon products based on dual markers, characterized in that: The method includes the following steps: (1) DNA was extracted from salmonid fish samples using the phenol-chloroform method; (2) The extracted DNA sample was amplified by PCR using fish universal primers with specific tags to obtain the target sequence and the sample was labeled for the first time. The target sequence is the mitochondrial 16S fragment. (3) Construct a high-throughput sequencing library from the target sequence using a sequencing kit and perform a second labeling; (4) The library was sequenced by paired ends using the Illumina NovaSeq platform. The raw sequencing data was processed to obtain high-quality sequence data. The high-quality sequence data was then compared and analyzed with the reference sequence.
2. The method according to claim 1, characterized in that: The fish-specific universal primers for the specific tag mentioned in step (2) are: forward primer 5'-NNNNNN-SEQ ID NO.1-3', and reverse primer 5'-MMMMMM-SEQ ID NO.2-3'. NNNNNN and MMMMMM represent the 6bp specific tag sequences at the 5' end of the forward and reverse primers, respectively. The 6bp specific tag sequences at the 5' end have at least 3 base differences, including TTAGGC, TGACCA, TAGCTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, and ACAGTG.
3. The method according to claim 1, characterized in that: The PCR amplification system in step (2) is: containing Mg²⁺ + The following were prepared: 5 μL of 10×Ex Taq buffer, 5 μL of 2.5 mM dNTPs mixture, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 0.25 μL of 5 U / μL TaKaRa Ex Taq enzyme, 1 μL of 50 ng / μL DNA template, and 37.75 μL of sterile water. The PCR amplification conditions were: pre-denaturation at 94 °C for 5 minutes, followed by 35 cycles, each cycle consisting of denaturation at 95 °C for 30 seconds, annealing at 52 °C for 30 seconds, extension at 72 °C for 42 seconds, and final extension at 72 °C for 10 minutes.
4. The method according to claim 1, characterized in that: The first labeling in step (2) identifies the sample by a unique combination of the forward primer label and the reverse primer label.
5. The method according to claim 1, characterized in that: The high-throughput sequencing library construction process in step (3) includes: PCR product purification, equimolar mixing of samples with different tags, addition of sequencing adapters, and quality detection.
6. The method according to claim 5, characterized in that: The quality testing involves AATI testing to determine the integrity of the DNA fragments in the library and the size of the inserted fragments, and qPCR testing to determine the effective concentration of the library.
7. The method according to claim 1, characterized in that: In step (4), the second labeling uses Illumina sequencing adapters, including P5 and P7 adapter sequences. Each adapter contains a 6bp sample index sequence to achieve the second identification of the sample. The index sequences include TTAGGC, TGACCA, TAGCTT, GGCTAC, GCCAAT, GATCAG, CTTGTA, CGATGT, CAGATC, ATCACG, ACTTGA, and ACAGTG. The read length of paired-end sequencing is 150bp×2.
8. The method according to claim 1, characterized in that: The data processing described in step (4) includes removing adapter and primer sequences, splitting the mixed sequencing data into individual sample data, filtering low-quality bases and reads, and removing short sequences with a length of less than 180 bp.
9. The method according to claim 1, characterized in that: The comparison analysis described in step (4) involves BLASTing high-quality sequence data with reference sequences of salmonid fish in the NCBI database, with a similarity threshold set to ≥99%.
10. The method according to claim 1, characterized in that: The method is applicable to salmon products with different degrees of processing, including: (1) fresh products: fresh salmon, chilled salmon slices, frozen salmon chunks; (2) lightly processed products: smoked salmon, salted salmon, marinated salmon; (3) heat-processed products: cooked salmon, grilled salmon, steamed salmon; (4) canned products: boiled salmon, oil-packed salmon, seasoned salmon.