Rapid molecular identification method for codonopsis pilosula, pilose asiabell root and tangshen codonopsis pilosula
By using the rpl16 intron region sequence as barcode, specific primers are designed for PCR amplification and sequencing, the problem of difficult to accurately distinguish Codonopsis, Codonopsis and Sichuan Codonopsis in the existing technology is solved, and the accuracy and rapidity of Codonopsis is achieved in the existing technology. Identification, strong specificity, suitable for variety identification and germplasm resource development.
Patent Information
- Application Number
- CN202411866759.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2025-02-14
Smart Images
Figure CN119433090A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of Chinese medicinal material origin identification, and specifically relates to identifying and distinguishing samples of Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula by using specific single nucleotide polymorphism (SNP) sites. Background Art
[0002] The Chinese Pharmacopoeia (2020 edition) lists Codonopsis pilosula as the dried root of Codonopsis pilosμla (Franch.) Nannf., Codonopsis pilosμla Nannf.var.modesta (Nannf.) LTShen or Codonopsis tangshen Oliv. of the Campanulaceae family. There are still many counterfeit Codonopsis pilosula on the market, such as Codonopsis pilosula, Codonopsis pilosula, Codonopsis tangshen Oliv. of the same genus, as well as Codonopsis pilosula of the Campanulaceae family, Codonopsis pilosula, Codonopsis tangshen Oliv. of the same genus, Codonopsis pilosula ...tang
[0003] Many multi-origin medicinal materials in the pharmacopoeia have obvious differences in the plant stage, but the medicinal materials are not very different. Traditional identification methods of Chinese medicine (properties, microscopy, physical and chemical, etc.) have certain limitations. Some samples are difficult to identify accurately, especially for decoction pieces or medicinal powders. It is easy to misuse and mix them, such as the three origins of Codonopsis. The DNA barcode technology in molecular identification has broken away from the constraints of traditional morphological identification methods that rely on long-term experience, and is not affected by individual morphology, size and other characteristics and integrity, and is limited by experience. It can directly provide rich identification basis at the genetic level, and can achieve accurate and rapid identification of Chinese medicinal materials and origin species.
[0004] Existing molecular identification experiments on Codonopsis pilosula can only identify counterfeit Codonopsis pilosula (Codonopsis pilosula, Codonopsis pilosula, Codonopsis pilosula, Codonopsis pilosula, etc.), and although the molecular identification of Codonopsis pilosula (Franch.) Nannf., Codonopsis pilosula Nannf.var.modesta (Nannf.) LTShen and Codonopsis tangshen Oliv. includes ISSR fingerprint identification, ITS2 sequence identification, and 5S rDNA sequence difference percentage identification of Codonopsis pilosula, it is still impossible to accurately, simply and intuitively distinguish the three origins of Codonopsis pilosula.
[0005] The Rpl16 sequence is a gene encoding ribosomal proteins in chloroplasts. It is located in a large single copy region of the chloroplast genome, has two exons and a type II intron. The intron region sequence of the rpl16 sequence has a very fast evolution rate and is suitable for phylogenetic studies of lower taxonomic levels or closely related groups and later differentiated groups. The present invention uses the rpl16 intron region sequence for the first time to identify Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula. Specific primers are designed based on the rpl16 sequence, which are used for PCR amplification and sequencing, and the sequencing results are corrected and compared. The original plants, medicinal materials, seeds and seedlings of Codonopsis pilosula can be accurately and intuitively identified, and the specificity is strong.
[0006] It should be noted that the Flora of China records that Codonopsis pilosula is a variant of Codonopsis pilosula, and the main difference between Codonopsis pilosula and the original variant is that Codonopsis pilosula is almost smooth and hairless; the calyx lobes are small, about 10 mm long, so Codonopsis pilosula is downgraded to a variant. In the process of biological evolution, the gene variation of Codonopsis pilosula and Codonopsis pilosula is very small. There may be samples that are in the transition stage of gene variation, and the genetic information carried by the DNA sequence of some bases is not enough to achieve inter-species identification. Therefore, the identification method of the present invention has the phenomenon that the morphological identification results and the molecular identification results are not completely consistent for the identification and distinction of Codonopsis pilosula and Codonopsis pilosula. Summary of the invention
[0007] To achieve the above object, the present invention adopts the following technical solutions:
[0008] In the first aspect, the present invention provides an amplification primer for identifying Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula, the amplification primer is used to amplify a barcode sequence fragment of the rpl16 intron region of chloroplast DNA, the GenBank accession number of which sequence is KP318199.1, and the nucleotide sequence of the amplification primer is DC2 or DC3 or DC4.
[0009] The nucleotide sequences of the primers are shown in Table 1.
[0010] Table 1 Primer names and nucleotide sequences
[0011]
[0012] In a second aspect, the present invention provides a use of the amplification primers described in the first aspect for identifying Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula.
[0013] In a third aspect, the present invention provides a rapid molecular identification method for Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula, comprising the following steps:
[0014] (1) Extracting total DNA from the Codonopsis pilosula to be tested;
[0015] (2) taking the total DNA extracted in step (1), and using the primers described in the first aspect to perform PCR amplification on the barcode sequence fragment of the intron region of chloroplast DNA rpl16;
[0016] (3) Sequencing the amplified chloroplast DNA rpl16 intron region barcode sequence fragment obtained in step (2), and determining the origin of the Codonopsis pilosula species based on the 634th and 741st bases from the 5' end of the rpl16 intron region barcode sequence.
[0017] Preferably, when the 634th position of the barcode sequence in the intron region of the chloroplast DNA rpl16 is T and the 741th position is T, the medicinal material being tested is Codonopsis pilosula; when the 634th position of the barcode sequence in the intron region of the chloroplast DNA rpl16 is A and the 741st position is G, the medicinal material being tested is Codonopsis pilosula; when the 634th position of the barcode sequence in the intron region of the chloroplast DNA rpl16 is T and the 741st position is G, the medicinal material being tested is Codonopsis pilosula or Codonopsis pilosula.
[0018] Preferably, the DNA is extracted using a kit.
[0019] Preferably, the PCR reaction procedure is pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 56-58°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; final extension at 72°C for 10 min, and storage at 12°C.
[0020] The method provided by the present invention can accurately and quickly identify the original plants, medicinal materials, seeds and seedlings of Codonopsis pilosula. The identification method is stable and highly specific, and can effectively solve the problems of variety identification, breeding and cultivation, and germplasm resource development and utilization of Codonopsis pilosula. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is the electrophoresis diagram of the primer design of Example 1. 1-6 in the figure correspond to sample numbers 1-6.
[0022] Figure 2 This is a comparison of the sequencing results after primer 1 amplified the rpl16 intron region sequence fragment.
[0023] Figure 3 This is a comparison of the sequencing results after primer 2 amplified the rpl16 intron region sequence fragment.
[0024] Figure 4 This is a comparison of the sequencing results after primer 3 amplified the rpl16 intron region sequence fragment.
[0025] Figure 5 This is a comparison of the sequencing results after primer 4 amplified the rpl16 intron region sequence fragment.
[0026] Figure 6 This is a comparison chart of sequencing results after primer 2 was used to amplify the rpl16 intron region sequence fragment after adding new batches of samples.
[0027] Figure 7 This is a sample picture of the morphological identification of fresh Codonopsis pilosula medicinal materials (from left to right are Codonopsis pilosula, Codonopsis pilosula, and Codonopsis pilosula).
[0028] Figure 8 This is a sample picture of the morphological identification of dry Codonopsis pilosula medicinal materials (from left to right are Codonopsis pilosula, Codonopsis pilosula, and Codonopsis pilosula). DETAILED DESCRIPTION
[0029] In order to make the present application clearer and more complete, the technical scheme of the present invention is further illustrated by specific examples below. However, the following examples are only examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims. The present application will be described in detail below with reference to specific examples.
[0030] Example 1 A method for identifying Codonopsis pilosula and screening of amplification primers
[0031] (1) Extraction of total DNA from Codonopsis pilosula
[0032] Two batches of samples of Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula were collected from different origins. The collection information is shown in Table 2, and the morphology is shown in Appendix Figure 8 .
[0033] Codonopsis pilosula is long cylindrical, slightly curved, 10 to 35 cm long, 0.4 to 2 cm in diameter. The surface is grayish yellow, yellowish brown to grayish brown, with many warty protrusions of stem scars and buds on the root head, and the top of each stem scar is concave and dot-shaped; there are dense annular horizontal stripes under the root head, which gradually become sparse downwards, and some are half of the total length. The cultivated products have fewer or no annular horizontal stripes; the whole body has longitudinal wrinkles and scattered horizontal long lenticel-like protrusions, and there are often dark brown colloids at the broken roots. The texture is slightly soft or slightly hard and slightly tough, the cross section is slightly flat, with cracks or radial textures, the cortex is light brown to yellow brown, and the wood is light yellow to yellow. It has a special aroma and tastes slightly sweet.
[0034] Codonopsis pilosula (Codonopsis pilosula) is 10-35cm long and 0.5-2.5cm in diameter. The surface is yellowish white to grayish yellow, and the dense ring-shaped horizontal stripes under the root head often reach more than half of the total length. There are many cracks in the cross section, and the skin is grayish white to light brown.
[0035] Codonopsis pilosula is 10 to 45 cm long and 0.5 to 2 cm in diameter. Its surface is grayish yellow to yellowish brown with obvious irregular longitudinal grooves. It is soft and firm, with few cracks on the cross section and yellowish white skin.
[0036] Table 2 Sample information of Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula
[0037]
[0038] Take 50-100 mg of the Chinese medicinal materials in Table 2 respectively, and use the plant genome kit (purchased from Tiangen Biochemical Technology Beijing Co., Ltd.) to extract total DNA. The specific steps are as follows:
[0039] ① Take 50-100 mg of medicinal powder in a 2.0 mL EP tube, add grinding beads and a small amount of quartz sand, and grind thoroughly using a frozen ball grinder;
[0040] ② Quickly transfer the ground medicinal powder to a centrifuge tube pre-filled with 700 μL of 65°C preheated buffer GP1 (containing 0.1% mercaptoethanol), quickly invert to mix, and place in a 65°C water bath for 20 minutes. Invert several times during the water bath to mix the sample;
[0041] ③ Add 700 μL DNA extraction solution (phenol: chloroform: isoamyl alcohol 25:24:1), mix thoroughly, and centrifuge at 12000 rpm for 5 min;
[0042] ④ Take the upper aqueous phase and add 700 μL of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 5 min;
[0043] ⑤ Transfer the aqueous phase into a new centrifuge tube, add 700 μL of buffer GP2, and mix well;
[0044] ⑥ Transfer the liquid into the adsorption column CB3, centrifuge at 12000rpm for 1min, and discard the waste liquid;
[0045] ⑦ Add 500 μL GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;
[0046] ⑧ Add 600 μL of rinsing solution GW, centrifuge at 12000 rpm for 30 s, and discard the waste liquid; repeat twice;
[0047] ⑨ Place the adsorption column CB3 back into the waste liquid collection tube, centrifuge at 12000rpm for 2min, and place the adsorption column CB3 at room temperature for several minutes to completely dry the remaining rinse solution;
[0048] ⑩ Transfer the adsorption column CB3 into a new centrifuge tube, add 70 μL of elution buffer TE to the hollow part of the adsorption membrane, place it at room temperature for 3 minutes, centrifuge it at 12000 rpm for 2 minutes, and obtain the total DNA solution of the sample, which is stored at -4℃ for future use.
[0049] (2) PCR amplification
[0050] Snapgene was used for primer design, and the designed primer sequences were:
[0051] Primer 1 DC1-F AAATCAAGAGCTTCGAGCCA DC1-R TCCCTTCCGCCATCCA
[0052] Primer 2 DC2 -F TCGCCCGCGAAAACTTTATT DC2 -R ACACCGAAGTATGGATTTCATTTAA
[0053] Primer 3 DC3-F AGAGTACATATTCGCCCGCG DC3-R AGTAATACACCGAAGTATGGATTTCA
[0054] Primer 4 DC4-F AGAGTACATATTCGCCCGCG DC4-R AGTGAATTTTCATGAACTTCAGATAGA
[0055] The primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and dissolved and diluted to 10 μM with sterile deionized water.
[0056] The PCR reaction system was 25 μl, as shown in Table 3 , and the PCR reaction program was shown in Table 4 .
[0057] Table 3 PCR reaction system
[0058]
[0059] Table 4 PCR reaction procedure
[0060]
[0061] (3) Electrophoresis
[0062] After the PCR reaction was completed, 5 μL of the reaction product was electrophoresed on a 1% agarose gel and then detected on a gel imager (see Figure 1 ).
[0063] (4) Sequencing
[0064] The remaining PCR reaction products after electrophoresis detection were sequenced, and each sample was sequenced in both forward and reverse directions.
[0065] (5) Sequence alignment
[0066] SeqMan software was used for analysis, proofreading, and splicing of sequencing results, and MEGA11.0 was used for sequence alignment.
[0067] Depend on Figure 1 It can be seen that the four pairs of primers designed can amplify a single sequence band. Figure 2-5 It can be seen that there are no three base-specific SNP sites in the rpl16 intron region sequence fragment amplified by primer 1 (bases 296-482 from the 5' end of the rpl16 sequence), and primers 2, primer 3, and primer 4 can all amplify three base-specific SNP sites in the rpl16 intron region sequence fragment. According to the bases 634 and 741 from the 5' end of the rpl16 intron region barcode sequence amplified by primers 2, primer 3, and primer 4, the base species of the medicinal material Codonopsis pilosula can be determined: if the 634th base is T and the 741th base is T, it is identified as Sichuan Codonopsis pilosula; if the 634th base is A and the 741th base is G, it is identified as Codonopsis pilosula; if the 634th base is T and the 741th base is G, it is identified as Codonopsis pilosula; if the 634th base is T and the 741th base is G, it may be Codonopsis pilosula or Codonopsis pilosula.
[0068] Example 2 Verification of the molecular identification of Codonopsis pilosula
[0069] The identification method is the same as in Example 1, except that the samples to be tested are different (see Table 5). Figure 7 , Attachment Figure 8 . Fixed primer 2 was selected.
[0070] DC2 -F TCGCCCGCGAAAACTTTATT DC2 -R ACACCGAAGTATGGATTTCATTTAA
[0071] Table 5 Sample information of Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula
[0072]
[0073] SeqMan software was used for analysis, proofreading, and splicing of sequencing results, and MEGA11.0 was used for sequence alignment (see Figure 6 ). This once again confirmed that the original species of Codonopsis pilosula can be determined based on the 634th and 741th bases from the 5' end of the amplified rpl16 intron region barcode sequence: if the 634th base is T and the 741th base is T, it is identified as Codonopsis pilosula; if the 634th base is A and the 741th base is G, it is identified as Codonopsis pilosula; if the 634th base is T and the 741th base is G, it may be Codonopsis pilosula or Codonopsis pilosula, that is, there are two genotypes of Codonopsis pilosula in this sequence fragment.
[0074] The embodiments described above are part of the embodiments of the present application, rather than all of the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents the selected embodiments of the present application. It should be clear to those skilled in the art that, without departing from the technical solution concept of the present application, several variations and improvements may be made, which all fall within the scope of protection of the present application.
Claims
1. An amplification primer for identifying Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula, characterized in that: The amplification primer is used to amplify the barcode sequence fragment of the chloroplast DNA rpl16 intron region, the GenBank accession number of the sequence is KP318199.1, and the nucleotide sequence of the amplification primer is DC2 or DC3 or DC4.
2. Use of the amplification primers according to claim 1 for identifying Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula.
3. A rapid molecular identification method for Codonopsis pilosula, Codonopsis pilosula and Codonopsis pilosula, characterized in that: The following steps are involved: (1) Extracting total DNA from the Codonopsis pilosula to be tested; (2) taking the total DNA extracted in step (1), and using the primers described in claim 1 to perform PCR amplification on the barcode sequence fragment of the intron region of chloroplast DNA rpl16; (3) Sequencing the amplified chloroplast DNA rpl16 intron region barcode sequence fragment obtained in step (2), and determining the original species of Codonopsis pilosula based on the 634th and 741st bases from the 5' end of the rpl16 intron region barcode sequence.
4. The method according to claim 3, characterized in that: When the 634th position from the 5' end of the barcode sequence of the rpl16 intron region of the chloroplast DNA is T and the 741st position is T, the medicinal material being tested is Codonopsis pilosula; when the 634th position from the 5' end of the barcode sequence of the rpl16 intron region of the chloroplast DNA is A and the 741st position is G, the medicinal material being tested is Codonopsis pilosula; when the 634th position from the 5' end of the barcode sequence of the rpl16 intron region of the chloroplast DNA is T and the 741st position is G, the medicinal material being tested is Codonopsis pilosula or Codonopsis pilosula.
5. The method according to claim 3 or 4, characterized in that: The DNA extraction method is a kit method.
6. The method according to any one of claims 3 to 5, characterized in that: The PCR reaction procedure is: pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 30 seconds, annealing at 55-60°C for 30 seconds, extension at 72°C for 1 minute, a total of 35 cycles; final extension at 72°C for 10 minutes, and storage at 12°C.