AMINO ACID-SUBSTITUTED FC RANGE OF AGLYCOSYLATED ANTIBODIES AND ITS USE IN CANCER TREATMENT

Abstract

A polypeptide comprising an Fc domain of a human antibody, the Fc domain comprising the following amino acid substitutions according to the Kabat numbering system: a) Substitutions of 8 amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L; and b) (i) V264E, (ii) V264E and N421S, (iii) V264E and T350A, (iv) V264E, T350 and N421S, (v) T307S, (vi) C226R, F243L and K246E, (vii) T250I and I253N, or (viii) C347R.

Description

[Technical Area]

[0001] The present disclosure relates to an amino acid-substituted Fc region of aglycosylated antibodies, its preparation and use in the treatment of cancer. [State of the art]

[0002] With the global development of biotechnology such as genetic recombination, cell cultivation, and so on, research on the structure and function of proteins has been actively conducted. They contribute greatly to improving the quality of life by promoting the understanding of biological phenomena and explaining the mechanism of various diseases, thus paving the way for effective diagnosis and treatment of diseases. Especially since the development of hybridoma technology, which produces monoclonal antibodies by fusing B cells with myeloma cells, in 1975 (Kohler and Milstein, Nature 256: 495-497, 1975), research and development have been actively carried out in immunotherapy using therapeutic antibodies in clinical areas such as cancer, autoimmune diseases, inflammation, cardiovascular diseases, infections, and so on.

[0003] Therapeutic antibodies are considered one of the most effective cancer therapies because, compared to existing small molecule drugs, they exhibit very high target specificity, low biological toxicity, few side effects, and a better plasma half-life of about 3 weeks. Indeed, major global pharmaceutical companies and research institutes are accelerating their pace in the research and development of therapeutic antibodies, which effectively eliminate cancer-causing factors and cancer cells by specifically binding to them. Leading pharmaceutical companies developing therapeutic antibodies include Roche, Amgen, Johnson & Johnson, Abbott, BMS, and others. In particular, Roche achieves considerable profit from its three representative therapeutic antibodies—Herceptin, Avastin, and Rituxan—with global sales of approximately $19.5 billion in 2012, leading the global antibody drug market.Johnson & Johnson, the developer of Remicade, is also growing rapidly in the global antibody market. Other pharmaceutical companies such as Abbott, BMS, and others are also known to have many therapeutic antibodies in the final stages of development. Thus, biopharmaceuticals, including therapeutic antibodies that are specific to target diseases and have few side effects, are rapidly replacing small-molecule drugs that dominate the global pharmaceutical market.

[0004] One of the most important mechanisms of therapeutic antibodies is to recruit immune cells and target them to antigens. The Fc domain of the antibody plays a crucial role in immune cell recruitment and antibody-dependent cell-mediated cytotoxicity (ADCC). In particular, the ADCC function of the antibody depends on its interaction with Fc receptors (FcRs) present on the surface of many cells. Human Fc receptors are divided into five types. The type of immune cells recruited is determined by the Fc receptor to which the antibody is bound. Accordingly, attempts to modify the antibody to recruit specific cells are very important in the therapeutic field.

[0005] However, most attempts to date have involved modifying the Fc domain using mammalian IgG molecules. Mammalian antibodies are glycosylated. Glycan chains attached to the Fc region of the glycosylated antibody enable the antibody to bind to the Fc receptor by stabilizing the protein structure. In contrast, aglycosylated antibodies produced in bacteria lack the glycan chains linked to the Fc region. Therefore, they cannot bind to the Fc receptors and do not exhibit ADCC function. Therefore, if an aglycosylated antibody is developed that can bind to the Fc receptor, the antibody can be produced using bacteria instead of animal cells, resulting in cost savings.

[0006] Furthermore, although the mammalian antibody with the modified Fc region exhibits increased binding ability to a specific Fc receptor, undesirable immune responses may occur because they retain the ability to bind to other Fc receptors. There are five major FcγRs in humans. Four of the receptors induce immune activation or inflammatory responses, and FcγRIIb induces immune inhibition or an anti-inflammatory response. Most naturally produced antibodies or recombinant glycosylated antibodies bind to both activating and inhibitory Fc receptors. The ADCC-inducing ability of an antibody depends on the ratio of its ability to bind to activating FcγR and its ability to bind to inhibitory FcγRIIb (A / I ratio) (Boruchov et al. J Clin Invest 115 (10): 2914-23, 2005).However, since FcγRIIb shares 96% sequence identity with activating FcγR, attempts to increase the A / I ratio by introducing genetic mutation into the glycosylated antibody fail.

[0007] Jo, Migyeong; Graduate School of Kookmin University, Master's Thesis, December 2015, discloses a polypeptide fusion product (Fc1004-IYG) comprising the eight amino acid substitutions of S298G, T299A, K3261, A327Y, L328G, E382V, N390D, and M428L without any additional substitutions. US 2005 / 0054832A1 and WO2008 / 092117A2 disclose polypeptides with Fc domains modified by amino acid substitutions. Among the various immune cells involved in the mechanism of cancer cell killing using currently clinically used therapeutic IgG antibodies, natural killer cells (NK cells) are now known to have the most potent cancer cell-killing effect. Unlike other immune cells (e.g., monocytes, macrophages, and dendritic cells), NK cells express FcγRIIIa on their surfaces and do not express FcγRI, FcγRIIa, FcγRIIb, and FcγRIIIb.Therefore, to maximize the mechanism of cancer cell killing compared to existing therapeutic antibodies, it is important to improve the affinity for FcγRIIIa expressed on the surface of NK cells by optimizing the Fc region of the IgG antibody.

[0008] The above description of the prior art is provided only to enhance the understanding of the background of the present disclosure and should not be construed as being known to one of ordinary skill in the related art. [Revelation][Technical Problem]

[0009] The present inventors have made persistent efforts to develop an aglycosylated antibody that does not suffer from the heterogeneity problem of existing glycosylated antibodies and exhibits improved binding ability to FcγRIIIa expressed on the surface of NK cells. As a result, they found that the binding ability to FcγRIIIa is greatly improved selectively among Fc receptors by optimizing by substituting a part of an amino acid sequence of a wild-type Fc domain with a different amino acid sequence, thereby enhancing the anticancer effect of NK cells.

[0010] The present disclosure is directed to providing a polypeptide containing an Fc domain in which a portion of an amino acid sequence of a human antibody Fc domain is substituted with a different amino acid sequence. The Fc domain comprises the following amino acid substitutions according to the Kabat numbering system: a) substitutions of 8 amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D, and M428L; and b) (i) V264E, (ii) V264E and N421S, (iii) V264E and T350A, (iv) V264E, T350 and N421S, (v) T307S, (vi) C226R, F243L and K246E, (vii) T250I and I253N, or (viii) C347R.

[0011] The present disclosure is also directed to providing an aglycosylated antibody containing the polypeptide.

[0012] The present disclosure is also directed to providing a nucleotide molecule encoding the polypeptide.

[0013] The present disclosure is also directed to providing a vector containing the nucleotide molecule.

[0014] The present disclosure is also directed to providing a host cell containing the vector.

[0015] The present disclosure is also directed to providing a composition containing the polypeptide, the aglycosylated antibody, the nucleotide molecule or the vector.

[0016] The present disclosure is also directed to providing a method for preventing or treating cancer, including a step of administering the polypeptide, the aglycosylated antibody, the nucleotide molecule, or the vector.

[0017] The present disclosure is also directed to providing a method for producing the polypeptide or the aglycosylated antibody.

[0018] The present disclosure describes a method for screening a polypeptide containing an Fc domain binding to FcγRIIIa.

[0019] Other purposes and advantages of the present disclosure will become apparent from the following detailed description, drawings, and claims. [Technical solution]

[0020] In one aspect, the present disclosure provides a polypeptide containing an Fc domain in which a portion of an amino acid sequence of an Fc domain of human antibodies is substituted with a different amino acid sequence.

[0021] The present inventors have made persistent efforts to develop an aglycosylated antibody that does not have the heterogeneity problem of existing glycosylated antibodies and has improved binding ability to FcγRIIIa expressed on the surface of NK cells. As a result, they found that the binding ability to FcγRIIIa is greatly improved selectively among Fc receptors by optimizing by substituting a part of an amino acid sequence of a wild-type Fc domain with a different amino acid sequence, thereby enhancing the anticancer effect of NK cells.

[0022] An antibody is a protein that specifically binds to a particular antigen. A natural antibody is a heterodimeric glycoprotein of approximately 150,000 daltons, usually consisting of two identical light chains (L) and two identical heavy chains (H).

[0023] The human antibodies used in the present disclosure consist of five major classes: IgA, IgD, IgE, IgG, and IgM. Specifically, IgG is used. An antibody digested by papain yields two Fab fragments and one Fc fragment. The Fc region is produced from the human IgG molecule because the N-terminus of Cys 226 is cleaved by papain (Deisenhofer, Biochemistry 20: 2361-2370, 1981).

[0024] The Fc domain of the antibodies may be an Fc domain of the IgA, IgM, IgE, IgD, or IgG antibody, or a variant thereof. In an exemplary embodiment, the domain is an Fc domain of the IgG antibody (e.g., Fc domain of the IgG1, IgG2a, IgG2b, IgG3, or IgG4 antibody). In an exemplary embodiment, the Fc domain may be the IgG1 Fc domain (e.g., the Fc domain of the anti-HER2 antibody, in particular the Fc domain of trastuzumab). The Fc domain-containing polypeptide of the present disclosure may not be glycosylated at all, or only a portion of the polypeptide (e.g., the Fc domain) may be glycosylated. The polypeptide may further contain, in addition to the Fc domain, one or more antibody-derived regions. Additionally, the polypeptide may further contain an antibody-derived antigen-binding domain. Multiple polypeptides may also form an antibody or antibody-type protein.

[0025] In the present disclosure, the numbering of the amino acid residues of the Fc domain of the antibody follows the commonly used Kabat numbering system (Kabat et al., "Sequences of Proteins of Immunological Interest," 5th ed., U.S. Department of Health and Human Services NIH Publication No. 91-3242 (1991).

[0026] In the present disclosure, the substituted Fc domain of the present disclosure includes the following 8 amino acid substitutions according to the Kabat numbering system: S298G, T299A, K3261, A327Y, L328G, E382V, N390D and M428L.

[0027] In an exemplary embodiment of the present disclosure, the aglycosylated Fc domain is mutated to bind to one or more of FcγRIa, FcγRIIa, FcγRIIb, FcγRIIc, FcγRIIIa, FcγRIIIb, or FcαRI. The mutated aglycosylated Fc domain may have 10% or less, 20% or less, 30% or less, 40% or less, 50% or less, 60% or less, 70% or less, 80% or less, 90% or less, 100%, 2-fold or higher, 3-fold or higher, 4-fold or higher, 5-fold or higher, 6-fold or higher, 7-fold or higher, 8-fold or higher, 9-fold or higher, 10-fold or higher, or 20-fold or higher binding ability to one or more of the above Fc receptors compared to the glycosylated wild-type Fc domain.

[0028] In a specific exemplary embodiment of the present disclosure, the Fc domain contained in the polypeptide of the present disclosure has improved binding ability for FcγRIIIa compared to the Fc domain not substituted with the above 8 amino acids.

[0029] According to the examples of the present disclosure, the Fc domain with only substituted S298G, T299A, N390D, E382V and M428L (Fc1004, US Patent No. 8,952,132) does not bind to FcγRIIIa like the wild-type Fc domain, and the Fc domain with only substituted T299A, K3261, A327Y and L328G (A / IYG, US Patent No. 8,815,237) also shows a very slight increase in binding ability for FcγRIIIa compared to the wild-type Fc domain. In contrast, the Fc domain of the present disclosure, which includes the above 8 amino acid substitutions, shows significantly improved binding ability for FcγRIIIa compared to the wild-type Fc domain, Fc1004 or A / IYG (Examples 3 and 4).

[0030] In the present disclosure, in addition to the amino acid substitution of the present disclosure, one or more additional amino acid substitutions selected from a group consisting of C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T and N421S according to the Kabat numbering system are described.

[0031] In the present disclosure, the Fc domain with 9 or more substituted amino acids is described with an improved binding ability for FcγRIIIa, compared to the Fc domain with only the 8 substituted amino acids S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.

[0032] In the present disclosure, the Fc domain with 9 or more substituted amino acids is described with a 40% or more increased binding ability for FcγRIIIa, compared to the Fc domain with only the 8 amino acids substituted (MW42: 40% or more; MW61: 50% or more; MW54, MW59 and MW86: 200% or more; MW14 and MW87: 300% or more; MW48: 500% or more; Fig. 6A-6C).

[0033] In one example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 9 amino acid substitutions according to the Kabat numbering system: S298G, T299A, T307S, K326I, A327Y, L328G, E382V, N390D and M428L.

[0034] In another example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 9 amino acid substitutions according to the Kabat numbering system: S298G, T299A, K326I, A327Y, L328G, C347R, E382V, N390D and M428L.

[0035] In one example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 10 amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D and M428L.

[0036] In one example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 10 amino acid substitutions according to the Kabat numbering system: T250I, I253N, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.

[0037] In another example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 10 amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D, N421S and M428L.

[0038] In one example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 11 amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D, N421S and M428L.

[0039] In one example of the present disclosure, the substituted Fc domain of the present disclosure includes the following 11 amino acid substitutions according to the Kabat numbering system: C226R, F243L, K246E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.

[0040] In another aspect, the present disclosure provides an aglycosylated antibody containing the polypeptide.

[0041] In the present disclosure, the term “antibody” means a polyclonal antibody, a monoclonal antibody, a human antibody and a humanized antibody and fragments thereof.

[0042] All currently commercially available therapeutic antibodies are produced by animal cell culture. During antibody production, the antibody proteins are modified with various sugar (carbohydrate) variants. In this regard, glycan heterogeneity causes variation in antibody efficacy and stability, and high costs are required for purification, analysis, and quality control (QC) during the antibody preparation process.

[0043] Compared to glycosylated antibodies, which require a costly animal cell culture system, aglycosylated antibodies can be produced on a large scale in bacteria and exhibit superior performance in terms of speed and cost. While the N-linked glycan formed at the Asn297 amino acid of the glycosylated antibody plays a critical role in the structure and function of the antibody, the Fc region of the aglycosylated antibody has a closed structure with a closed CH2 region, or a very flexible structure, unlike the glycosylated antibody Fc produced in animal cells. Therefore, the aglycosylated antibody cannot bind to FcγRIIIa, which plays a crucial role in the recruitment and activation of NK cells, and exhibits no anticancer effect.

[0044] In the present invention, by optimizing the Fc region of the aglycosylated antibodies (8 amino acid substitutions of S298G, T299A, K3261, A327Y, L328G, E382V, N390D and M428L), the antibody exhibits a maximum cancer cell killing mechanism through an improved binding ability for FcγRIIIa expressed on the surface of NK cells, while it can be produced in bacteria at low cost without the problem of glycan heterogeneity.

[0045] In another aspect, the present disclosure provides a nucleotide molecule encoding the polypeptide, a vector containing the nucleotide molecule, or a host cell containing the vector.

[0046] In another aspect, the present disclosure provides a method for producing a polypeptide containing an Fc domain of human antibodies, including: a) a step of culturing a host cell containing a vector containing a nucleotide molecule encoding the polypeptide described above; and b) a step for obtaining the polypeptide expressed by the host cell.

[0047] In another aspect, the present disclosure provides a method for producing an aglycosylated antibody, including: a) a step of culturing a host cell expressing an aglycosylated antibody containing the polypeptide described above; and b) a step to purify the antibody expressed by the host cell.

[0048] The nucleotide molecule of the present disclosure may be an isolated or recombinant nucleotide molecule and includes not only single- and double-chain DNA and RNA, but also corresponding complementary sequences. When the "isolated nucleotide" is a nucleotide isolated from a natural source, the nucleotide is a nucleotide separated from nearby gene sequences present in the isolated genome of an individual. For nucleotides, e.g., PCR products, cDNA molecules, or oligonucleotides, that are synthesized enzymatically or chemically from a template, the nucleotides produced by these methods can be understood as isolated nucleotide molecules. An isolated nucleotide molecule can be a component of a fragment or a larger nucleotide construct. A nucleotide is "operably linked" when it is placed into a functional relationship with another nucleotide sequence.For example, DNA for a presequence or secretion leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects transcription of the polypeptide sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequences are contiguous and, in the case of a secretion leader, contiguous and present in the same reading frame. However, enhancers do not need to be contiguous. Joining is achieved by ligation at appropriate restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

[0049] In the present disclosure, the term "vector" refers to a carrier suitable for introducing a nucleotide sequence into a cell capable of replicating the nucleotide sequence. The nucleotide sequence may be exogenous or heterologous. The vector may be, but is not limited to, a plasmid, a cosmid, or a virus (e.g., a bacteriophage). One skilled in the art can construct the vector using standard recombinant technology (Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc., NY, 1994, etc.).

[0050] In the present disclosure, the term "expression vector" refers to a vector containing a nucleotide sequence encoding at least a portion of a transcribed gene product. In some cases, the RNA molecule is posttranslated into a protein, a polypeptide, or a peptide. The expression vector may contain various regulatory sequences. A vector or an expression vector may contain, in addition to a regulatory sequence that regulates transcription and translation, a nucleotide sequence that provides another function.

[0051] In the present disclosure, the term "host cell" refers to a cell of any transformable organism, including a eukaryote and a prokaryote, that can replicate the vector or express a gene encoded by the vector. The host cell can be transfected or transformed by the vector, which refers to a process by which an exogenous nucleotide molecule is delivered or introduced into the host cell.

[0052] In a specific exemplary embodiment of the present disclosure, the host cell of the present disclosure is a bacterial cell, particularly a Gram-negative bacterial cell. The cell is suitable for the present disclosure in that it has a periplasmic region of the inner and outer membrane. Specific examples of the host cell according to the present disclosure include, but are not limited to, the cell of E. coli, Pseudomonas aeruginosa, Vibrio cholerae, Salmonella typhimurium, Shigella flexneri, Haemophilus influenza, Bordotella pertussis, Erwinia amylovora, Rhizobium sp., etc.

[0053] In the manufacturing method according to the present disclosure, purification of the antibody may include filtration, anion exchange or cation exchange chromatography, high-performance liquid chromatography (HPLC), affinity chromatography, or a combination thereof. Specifically, affinity chromatography using protein A may be used.

[0054] Further described is a method for screening a polypeptide containing an Fc domain that binds to FcγRIIIa, which includes: a) a step of constructing a library of a polypeptide containing an Fc domain including 8 amino acid substitutions (S298G, T299A, K3261, A327Y, L328G, E382V, N390D and M428L) into which a random point mutation has been introduced; and b) a step of screening a polypeptide containing an Fc domain that binds to FcγRIIIa from the library.

[0055] The substituted Fc domain of the present disclosure may further include an amino acid substitution in addition to the 8 amino acid substitutions.

[0056] In a specific exemplary embodiment of the present disclosure, the present disclosure relates to a method for screening a polypeptide containing an Fc domain that binds to FcγRIIIa, which includes: a) a step of constructing a library of a polypeptide containing an Fc domain including 8 amino acid substitutions of S298G, T299A, K3261, A327Y, L328G, E382V, N390D and M428L according to the Kabat numbering system, to which a random point mutation has been additionally introduced; and b) a step of screening a polypeptide containing an Fc domain with improved binding ability for FcγRIIIa from the library compared to the Fc domain substituted with only the 8 amino acids.

[0057] In the examples of the present disclosure, an Fc library was established using a bacterial cell (specifically E. coli) and variants showing high affinity for FcγRIIIa were screened therefrom (Examples 5 and 6).

[0058] The additional amino acid substitution of the Fc domain is not particularly limited. It specifically includes one or more additional amino acid substitutions selected from a group consisting of amino acids 226, 243, 246, 250, 253, 264, 307, 347, 350, 400, and 421 according to the Kabat numbering system, more specifically, one or more additional amino acid substitutions selected from a group consisting of C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T, and N421S.

[0059] The described screening method can use fluorescence-activated cell sorting (FACS) screening or other automated flow cytometry techniques. Instruments for performing flow cytometry are known to those skilled in the art. Examples of instruments include FACSAria, FACS Star Plus, FACScan, and FACSort (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, CO), and MOFLO-XDP (Beckman Coulter, Indianapolis, IN). In general, flow cytometry techniques involve separating cells or other particles from a liquid sample. Typically, the purpose of flow cytometry is to analyze the separated particles for one or more properties (e.g., the presence of a labeled ligand or other molecule). The particles are classified according to size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc.sorted by a sensor as they flow individually.

[0060] In another aspect, the present disclosure provides a composition comprising a polypeptide containing an Fc domain including the amino acid substitution described above, a nucleotide molecule encoding the same, a vector containing the same, or an aglycosylated antibody containing the polypeptide.

[0061] In the present disclosure, the composition of the present invention is a pharmaceutical composition for preventing or treating cancer.

[0062] The pharmaceutical composition of the present invention contains: (a) the polypeptide, aglycosylated antibody, nucleotide molecule, or vector; and (b) a pharmaceutically acceptable carrier.

[0063] In a further aspect, the present disclosure provides a use of a pharmaceutical composition for preventing or treating cancer comprising a polypeptide containing an Fc domain including the above-described amino acid substitution, a nucleotide molecule encoding the same, a vector containing the same, or an aglycosylated antibody containing the polypeptide.

[0064] The pharmaceutical composition of the present disclosure may contain: (a) the polypeptide, aglycosylated antibody, nucleotide molecule, or vector; and (b) a pharmaceutically acceptable carrier.

[0065] The cancer to be prevented or treated in the present disclosure is not limited and includes lymphomas such as leukemia, acute lymphocytic leukemia, acute non-lymphocytic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, etc., childhood solid tumors such as brain tumor, neuroblastoma, retinoblastoma, Wilms tumor, bone tumor, soft tissue sarcoma, etc., and common adult solid tumors such as lung cancer, breast cancer, prostate cancer, urinary tract cancer, uterine cancer, oral cancer, pancreatic cancer, melanoma and other skin cancers, gastric cancer, ovarian cancer, brain tumor, liver cancer, laryngeal cancer, thyroid cancer, esophageal cancer, testicular cancer, etc.

[0066] The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present disclosure is commonly used for preparation and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc. The pharmaceutical composition of the present disclosure may further contain, in addition to the ingredients described above, a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc. Suitable pharmaceutically acceptable carriers and preparations are described in detail in Remington's Pharmaceutical Sciences (19th Edition, 1995).

[0067] The pharmaceutical composition of the present disclosure can be administered orally or parenterally, especially parenterally. For example, it can be administered by intravenous injection, topical injection, intraperitoneal injection, etc.

[0068] A suitable administration dose of the pharmaceutical composition of the present disclosure varies depending on factors such as the formulation method, administration method, age, body weight, gender, and pathological condition of a patient, diet, administration time, administration route, excretion rate, and responsiveness. A normally trained physician can easily determine and prescribe an administration dose effective for the desired treatment or prevention. In a specific exemplary embodiment of the present disclosure, a daily administration dose of the pharmaceutical composition of the present disclosure is 0.0001-100 mg / kg.

[0069] The pharmaceutical composition of the present disclosure can be prepared as a single-dose or multi-dose formulation using a pharmaceutically acceptable carrier and / or excipient by a method readily practiced by one of ordinary skill in the art to which the present disclosure belongs. The formulation may be in the form of a solution in an oily or aqueous medium, a suspension, an emulsion, an extract, a powder, a granule, a tablet, or a capsule, and may further contain a dispersant or a stabilizer.

[0070] The pharmaceutical composition of the present disclosure can be used either alone or in combination with conventional chemotherapy or radiotherapy. The combined therapy may be more effective in treating cancer. A chemotherapeutic agent that can be used together with the composition of the present disclosure includes cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, mitomycin, etoposide, tamoxifen, taxol, transplatin, 5-fluorouracil, vincristine, vinblastine, methotrexate, etc. Radiotherapy that can be used together with the composition of the present disclosure includes X-rays, γ-rays, etc. [Beneficial Effects]

[0071] The features and advantages of the present disclosure can be summarized as follows: (i) The present disclosure provides a polypeptide comprising an Fc domain of a human antibody, the Fc domain comprising the following amino acid substitutions according to the Kabat numbering system: a) substitutions of 8 amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L; and b) (i) V264E, (ii) V264E and N421S, (iii) V264E and T350A, (iv) V264E, T350 and N421S, (v) T307S, (vi) C226R, F243L and K246E, (vii) T250I and I253N, or (viii) C347R. (ii) The present disclosure also provides a process for producing the polypeptide or the aglycosylated antibody. (iii) The Fc domain of the present disclosure, optimized by substituting a portion of an amino acid sequence of a wild-type Fc domain with another amino acid sequence, possesses superior binding ability to FcγRIIIa selectively among Fc receptors and is useful for the treatment of cancer. It can be produced as a homogeneous aglycosylated antibody by bacterial culture. [Brief description of the drawings] Fig. Figure 1 shows an image of purified tetrameric FcγRIIIa (left, SDS-PAGE) and an ELISA result (right) to investigate its activity. Fig. Figure 2 shows an ELISA result investigating the activity of tetrameric FcγRIIIa fluorescently labeled with Alexa 488 Flour. Fig. Figure 3 compares the binding ability of A / IYG and Fc1004 for FcγRIIIa. Fig. Figure 4 compares the binding ability of A / IYG and Fc1004-IYG for FcγRIIIa. Fig. Figure 5 shows a schematic representation of the construction of an Fc library of aglycosylated antibodies based on Fc1004-IYG. Fig. 6A-6C compare the binding ability of high-affinity FcγRIIIa-Fc variants screened by flow cytometric library screening (a and b: comparison of wild type, A / IYG, Fc1004-IYG, MG42, MG59, MG87 and MG48; c: comparison of wild type, A / IYG, Fc1004-IYG, MG61, MG86, MG54 and MG14). Fig. Figure 7 shows an image showing SDS-PAGE of purified screened variants and controls (wild type, A / IYG). Fig. Figure 8 shows a result of the analysis of the affinity of variants for different FcyRs by ELISA. Fig. Figures 9A - 9B show an SPR analysis result of variants (a. Binding ability analysis for FcγRIIIa (V158); b. Binding ability analysis for FcγRIIIa (F158)). Fig. Figure 10 shows a result of the investigation of the HER2 expression level of MCF-7 and SKBR-3. Fig. Figure 11 shows a result of the ADCC tendency analysis depending on the ratio of effector cell to target cell. Fig. Figure 12 shows a result of the analysis of the cancer cell killing effect of variants using human PBMC, SKBR-3 and MCF-7. [Mode for invention]

[0072] The present disclosure will be described in detail below using examples. However, the following examples are for illustrative purposes only, and it will be apparent to one of ordinary skill in the art that the scope of the present disclosure is not limited by the examples. ExamplesExample 1: Fc variant cloning to express aglycosylated antibody on the bacterial inner membrane as full-length IgG (A / IYG, Fc1004-IYG)

[0073] To express the A / IYG variant (US Patent No. 8,815,237) and Fc1004-IYG as full-length IgG, each Fc variant was constructed as a heavy-chain type plasmid. A pMopac12-PelB-VH-CH1-CH2-CH3 (wild-type)-FLAG plasmid was split into two fragments for the T299A substitution, and each strand was amplified with Vent polymerase (New England Biolabs) using MJ#36, MJ#43 / MJ#42, and MJ#37 primers. The two fragments were constructed by assembly PCR using MJ#36 and MJ#37 primers in a pMopac12-PelB-VH-CH1-CH2-CH3(T299A)-FLAG plasmid, SfiI (New England Biolabs), and ligation with T4 DNA ligase (Invitrogen). The 326IYG substitution was performed using the plasmid as a template and the MJ#36, MJ#39 / MJ#38, and MJ#37 primers following the same procedure (construction of pMopac12-PelB-VH-CH1-CH2-CH3(A / IYG)-FLAG).Then, pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004-IYG)-FLAG was constructed by introducing a 326IYG point mutation into pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004)-FLAG using the same MJ#36, MJ#39 / MJ#38 and MJ#37 primers. [Table 1] Primers used in the experiment Primer # Nukleotidsequenz (5'→3') MJ#36 (SEQ ID NR. 17) CGCAGCGAGGCCCAGCCGGCCATGGCGGAGGTT CAATTAGTGGAATCTG MJ#43 (SEQ ID NO 18) GGACGCTGACCACACGGTACGCGCTGTTGTACTG CTCCTCCCG MJ#42 (SEQ ID NO 19) CGGGAGGAGCAGTACAACAGCGCGTACCGTGTGG TCAGCGTCC MJ#37 (SEQ ID NO 20) CGCAATTCGGCCCCCGAGGCCCCTTTACCCGGGG ACAGGGAG MJ#39 (SEQ ID NO 21) GGTTTTCTCGATGGGGGCTGGGCCATAAATGTTGG AGACCTTGCATTTGTACTCCTTG MJ#38 (SEQ ID NO 22) CAAGGAGTACAAATGCAAGGTCTCCAACATTTATG GCCCAGCCCCCATCGAGAAAACC MJ#45 (SEQ ID NO 23) CGACAAGAAAGTTGAGCCCAAATCTTGT MJ#46 (SEQ ID NO 24) CGCAATTCCGGCCCCCGAGGCCCC MJ#44 (SEQ ID NO 25) ACAAGATTTGGGCTCAACTTTCTTGTCG MJ#2 (SEQ ID NO 26) CTGCCCATGTTGACGATTG MJ#49 (SEQ ID NO 27) CGCAGCGAGCGCGCACTCCATGGCGGAGGTTCAA TTAGTGGAATCTG MJ#50 (SEQ ID NO 28) CCCTAAAATCTAGACCTTTACCCGGGGACAGGGAG Example 2: Preparation of tetrameric FcγRIIIa and fluorescent labeling using Alexa 488 Fluor

[0074] The pMAZ-FcγRIIIa (V158)-FLAG-streptavidin-His plasmid was expressed in 300 ml of HEK 293F cells, and affinity chromatography was performed using 1 ml of Ni-NTA agarose (Qiagen) slurry. After culturing, the suspended culture was centrifuged at 7000 rpm for 10 minutes to remove the cells. The supernatant was equilibrated using 25x PBS and then filtered through a 0.2 µm bottle-top filter (Merck Millipore). After adding Ni-NTA slurry equilibrated with PBS and stirring for 16 hours at 4 °C, the solution was passed through a polypropylene column (Thermo Fisher Scientific). After the passage solution was taken and rebound to a resin, it was washed sequentially with 50 ml of 1x PBS, 25 ml of 10 mM imidazole buffer, 25 ml of 20 mM imidazole buffer, and 200 µl of 250 mM imidazole buffer.After elution with 2.5 ml of 250 mM imidazole buffer and replacement of the buffer with PBS by Amicon Ultra-4 (Merck Millipore), the purified protein was analyzed by SDS-PAGE (. Fig. 1). The activity of the purified protein was assayed by analyzing binding to Rituxan (Roche) using ELISA, and 1 mg was taken and fluorescently labeled using the Alexa Fluor 488 protein labeling kit (Thermo Fisher Scientific). After fluorescent labeling, the activity was analyzed by ELISA ( Fig. 2). Thus, highly pure active tetrameric FcγRIIIa was successfully produced, and the protein activity was retained even after fluorescent labeling with Alexa 488 Flour. Example 3: Comparison of the binding ability of wild type, Fc1004 and A / IYG for FcγRIIIa

[0075] Since the clones to be analyzed are plasmids encoding the heavy chain, pMopac12-PelB-VH-CH1-CH2-CH3 (wild type)-FLAG, pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004)-FLAG and pMopac12-PelB-VH-CH1-CH2-CH3(A / IYG)-FLAG, E. coli Jude 1 cells (F' [Tn10(Tet r ) proAB + Iacl q Δ(lacZ)M15] mcrA Δ(mrr-hsdRMS-mcrBC)80dlacZΔM15 ΔIacX74 deoR recA1 araD139 Δ(ara leu)7697 galU galKrpsLendA1nupG) (Kawarasaki et al., 2003) was transformed with the pBAD30-Km-PelB-VL-Ck-NIpA-VL-Ck-His-cMyc plasmid so that heavy chains and light chains could be expressed in the periplasmic region. After 16 hours of cultivation in 5 ml Terrific Broth (TB, BD) containing 2% glucose (Sigma-Aldrich) at 37°C, 5.5 ml of TB were transferred to a 100 ml flask for inoculation at 1:100. After cultivation to OD 600= 0.6, followed by cooling at 25 °C and 250 rpm for 20 minutes, overexpression was carried out for 20 hours at 25 °C and 250 rpm by adding 0.2% arabinose and 1 mM IPTG. After overexpression, the cells were OD 600normalized and harvested by centrifugation at 14,000 rpm for 1 minute. A washing procedure to resuspend the cells by adding 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuging for 1 minute was repeated twice. After resuspending the cells in 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer membrane of the cells was removed by rotation at 37 °C for 30 minutes. After centrifugation, discarding the supernatant, and resuspending by adding 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl2, 10 mM MOPS, pH 6.8], centrifugation was performed. After resuspending in 1 ml of a solution obtained by mixing 1 ml of solution A and 20 µl of 50 mg / ml lysozyme solution, the peptidoglycan layer was removed by rotating at 37 °C for 15 min.After centrifugation, removal of the supernatant, and resuspension in 1 ml PBS, 300 µl were removed and spheroplasts were fluorescently labeled by rotation at room temperature after adding 700 µl PBS and fluorescently labeled tetrameric FcγRIIIa-Alexa 488-Flour. After labeling and washing once with 1 ml PBS, analysis was performed using the Guava instrument (Merck Millipore) (. Fig. 3). As a result, all wild-type Fc, A / IYG, and Fc1004 showed mean values ​​of 30–42, suggesting that binding to FcγRIIIa is poor. Example 4: Comparison of the binding ability of A / IYG and Fc1004-IYG for FcγRIIIa

[0076] pMopac12-PelB-VH-CH1-CH2-CH3 (IYG)-FLAG and pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004-IYG)-FLAG were engineered to express heavy chains and light chains in the periplasmic space by transforming E. coli Jude-1 cells together with the pBAD30-Km-PelB-VL-Ck-NIpA-VL-Ck-His-cMyc plasmid. After culturing the cells for 16 hours at 37°C in 5 ml of TB containing 2% glucose, 5.5 ml of TB was transferred to a 100 ml flask for 1:100 inoculation. After culturing to OD 600 = 0.6, followed by cooling at 25 °C and 250 rpm for 20 minutes, overexpression was carried out for 20 hours at 25 °C and 250 rpm by adding 0.2% arabinose and 1 mM IPTG. After overexpression, the cells were OD 600normalized and harvested by centrifugation at 14,000 rpm for 1 minute. A washing procedure to resuspend the cells by adding 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuging for 1 minute was repeated twice. After resuspending the cells in 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer membrane of the cells was removed by rotation at 37°C for 30 minutes. After centrifugation, discarding the supernatant, and resuspending by adding 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl2, 10 mM MOPS, pH 6.8], centrifugation was performed. After resuspending in 1 ml of a solution obtained by mixing 1 ml of solution A and 20 µl of 50 mg / ml lysozyme solution, the peptidoglycan layer was removed by rotating at 37°C for 15 min.After centrifugation, removal of the supernatant, and resuspension in 1 ml PBS, 300 µl were removed and spheroplasts were fluorescently labeled by rotation at room temperature after which 700 µl of PBS and fluorescently labeled tetrameric FcγRIIIa-Alexa 488-Flour were added. After labeling and washing once with 1 ml PBS, analysis was performed using the Guava instrument (Merck Millipore) (. Fig. 4). As a result, the fluorescence signal intensity of Fc1004-IYG was 199.85 μs, which is 8.4 times that of the wild type (23.92 μs). Accordingly, it was confirmed that the binding ability of Fc1004-IYG was significantly improved compared to A / IYG (41.24 μs, 1.7 times that of the wild type), which is known to have the highest affinity for FcγRIIIa among the currently known aglycosylated antibody Fc variants. Example 5: Construction of an aglycosylated antibody library based on Fc1004-IYG

[0077] To construct an aglycosylated antibody Fc library based on Fc1004-IYG, error-prone PCR and assembly PCR were performed using pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004-IYG)-FLAG as a template. The error-prone PCR technique using Taq polymerase (Invitrogen) was used to introduce a random point mutation into the Fc (CH2-CH3) region. The point mutation was introduced in 0.5% of the nucleotides of the full-length Fc gene using MJ#45 and MJ#46 primers. The front region of Fc was designed to overlap with Fab, allowing assembly as heavy chains.The entire heavy chain-type PCR product was constructed by performing conventional PCR for the Fab (VH-CH1) region using MJ#36 and MJ#44 primers and Vent polymerase, and then performing assembly PCR to ligate the Fab fragment with the Fc fragment using MJ#36 and MJ#46 primers. Then, after Sfi restriction enzyme treatment and ligation, the Fc library of aglycosylated heavy chain-type antibodies was constructed by transformation into Jude-1 cells (library size: 1.14 × 10). 9 , experimental error rate: 0.457%). After obtaining the gene from the library and subsequent transformation into Jude-1 cells transformed with pBAD30-Km-PelB-VL-Ck-NIpA-VL-Ck-His-cMyc, a library displaying full-length IgG on the inner membrane of E. coli was constructed ( Fig. 5). Example 6: Screening the constructed library by flow cytometry and selection of variants MG42, MG48, MG59, MG87, etc. (confirmation of binding ability for FcγRIIIa)

[0078] The constructed library was expanded into 25 ml of TB containing 2% glucose in a 250 ml flask, incubated in a 1 ml vial at 37°C for 4 hours, and then transferred to a 2.5 l flask in 110 ml of TB for 1:100 inoculation. After cultivation to OD 600 = 0.6, followed by cooling at 25 °C and 250 rpm for 20 minutes, overexpression was carried out for 20 hours at 25 °C and 250 rpm by adding 0.2% arabinose and 1 mM IPTG. After overexpression, the cells were OD 600normalized and harvested by centrifugation at 14,000 rpm for 1 minute. After preparing spheroplasts as described above, the cells were labeled with tetrameric FcγRIIIa-Alexa 488 Flour and then washed once with 1 ml PBS. Finally, the sample resuspended in 1 ml PBS was diluted with 20 ml PBS, and only the cells emitting the upper 3% signals were sorted using the S3 cell sorter (BioRad). The separated cells were sorted again. Genes were amplified from the sorted cells by PCR using MJ#36 and MJ#2 primers and Taq polymerase (Biosesang). Then, a sublibrary was obtained by Sfi restriction enzyme treatment, ligation, and transformation, in which the genes of the sorted cells were amplified. After repeating this procedure for a total of 5 rounds, variants that showed high affinity for FcγRIIIa were selected by analyzing more than 90 individual clones ( Fig. 6A and Fig. 6B, Table 2, Position of the mutation follows the Kabat-EU numbering system (Kabat et al., “Sequences of Proteins of Immunological Interest,” 5th ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242, 1991). [Table 2] Point mutation of the main variants Fc-Varianten Punktmutation A / IYG (SEQ ID Nr. 5) T299A, K326I, A327Y, L328G Fc1004 (SEQ ID Nr. 3) S298G, T299A, E382V, N390D, M428L Fc1004-IYG (SEQ ID Nr. 7) S298G, T299A, K326I, A327Y, L328G, E382V, N390D, M428L MG42 (SEQ ID No. 9) (Fc1004-IYG)+264E, 350A, 421S MG48 (SEQ ID No. 11) (Fc1004-IYG)+264E, 350A MG59 (SEQ ID No. 13) (Fc1004-IYG)+264E MG87 (SEQ ID No. 15) (Fc1004-IYG)+264E, 421S

[0079] In addition to these variants, the variants that have a higher affinity for FcγRIIIa than A / IYG were additionally screened (MG61: (Fc1004-IYG) + T307S, MG86: (Fc1004-IYG) + C226R + F243L + K246E MG54: (Fc1004-IYG) + T250I + I253N, MG14: (Fc1004-IYG) + C347R) ( Fig. 6C). Example 7: Cloning for expression of screened variants in animal cells as well as their expression and purification

[0080] To generate MG59, MG87, and MG48 among the screened variants, along with wild-type and A / IYG as controls, pMAZ-IgH (wild-type), pMAZ-IgH (A / IYG), pMAZ-IgH (MG59), pMAZ-IgH (MG87), and pMAZ-IgH (MG48) were constructed in IgG forms soluble in HEK293F cells by amplifying the 'VH-CH1-CH2-CH3' region encoding the heavy chain by PCR using Vent polymerase and MJ#49 and MJ#50 primers, followed by treatment with BssHII and XbaI restriction enzymes (New England Biolabs) and ligation. For IgG expression, they were co-transfected with the pMAZ-IgL plasmid into HEK 293F cells and transiently expressed on a 300 ml scale. After culturing and removing the medium by centrifugation at 7000 rpm for 10 minutes, the supernatant was equilibrated with 25x PBS and filtered through a 0.2 µm bottle-top filter (Merck Millipore).After adding 1 ml of protein A agarose (Genscript) slurry equilibrated with PBS and stirring at 4°C for 16 hours, the solution was passed through a polypropylene column (Thermo Fisher Scientific). After the pass-through solution was taken and rebound to a resin, it was washed by flowing 10 CV (column volume) or more of 1x PBS. After eluting with 3 ml of 100 mM glycine HCl (pH 2.7), the eluate was immediately neutralized with 1 ml of 1 M Tris (pH 8.0). After replacing the buffer with PBS using Amicon Ultra-4 (Merck Millipore), the purified protein was analyzed by SDS-PAGE (BioRad). Fig. 7). It was confirmed that the protein was purified in the form of IgG (150 kDa) with high purity on SDS-PAGE. Example 8: ELISA analysis of variants to confirm the binding ability of FcRs

[0081] Fifty µl of each IgG Fc variant, diluted with 0.05 M Na2CO3 (pH 9.6) to 4 µg / ml, was fixed for 16 hours at 4 °C on a 96-well, flat-bottom, high-binding polystyrene microtiter plate (Costar) and blocked at room temperature with 100 µl of 5% BSA (in 0.05% PBST) for 2 hours. After washing four times with 180 µl of 0.05% PBST, 50 µl of FcRs, serially diluted with a blocking solution, were added to each well. After washing, the antibody reaction was carried out for 1 hour at room temperature using 50 µl of anti-His-HRP conjugate (Sigma-Aldrich) or anti-GST-HRP conjugate (GE Healthcare). After adding 50 µl of 1-Step Ultra TMB ELISA substrate solution (Thermo Fisher Scientific) for color development, the reaction was stopped by adding 50 µl of 2 M H2SO4 and the analysis was performed using the Epoch microplate spectrophotometer (BioTek) ( Fig.8). All experiments were performed in duplicate. Binding ability for the FcRs (FcγRI, FcγRIIa(H), FcγRIIa(R), FcγRIIb, FcRn) was confirmed by ELISA analysis. Example 9: Measurement of K D -values ​​of FcγRIIIa and trastuzumab variants after SPR

[0082] The binding ability of the trastuzumab variants was measured using BIAcore T200 (GE Healthcare). After fixation of the aglycosylated wild-type antibody (Aglyco-T), A / IYG, glycosylated wild-type antibody (Glyco-T; produced by culturing HEK 293F cells), Herceptin (clinical drug product produced in CHO cells), MG48, and MG59 on a CM5 chip by amine coupling, dimeric FcγRIIIa-V158-GST, FcγRIIa-F158-GST using HBS-EP buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 surfactant) (GE Healthcare) was injected, and the binding ability was analyzed ( Fig.9). Regeneration of the CM5 chip was performed sequentially using 50 mM glycine (pH 3.9), 50 mM glycine (pH 9.5), and 3 M NaCl. The bivalent 2:1 analyte model of the BIAevaluation 3.2 software (GE Healthcare) was used to calculate the equilibrium dissociation constants (Ko) of monovalent receptor binding (Table 3). [Table 3] SPR KD values ​​of the variants Ko (M) Magnification by (V / F) FcγRIIIa (158V) FcγRIIIa (158F) Aglyco-T ND ND 0 A / IYG 1,110 × 10 -6 1,737 × 10 -5 1 Glyco-T (HEK) 1,200 × 10 -7 5,782 × 10 -6 9,25 / 3,00 Herceptin (CHO) 8,418 × 10 -8 5,142 × 10 -6 13,19 / 3,38 MG48 6,793 × 10 -8 6,763 × 10 -7 16,34 / 25,68 MG59 1,070 × 10 -7 1,049 × 10 -6 10,37 / 16,56

[0083] As a result, it was confirmed that MG48 and MG59 screened in the present disclosure exhibit binding abilities that were improved up to 16-fold for FcγRlla-V158 and up to 25-fold or more for FcγRlla-F158 compared to A / IYG.

[0084] Example 10: Investigation of HER2 expression levels in SKBR-3 and MCF-7 target cells

[0085] The cells were cultured on a 100 mm dish (80% confluence).

[0086] After removing the medium and washing once with DPBS, the cells were treated with 1.5 ml of Accutase (Merck Millipore) and incubated for 2-3 minutes at 37°C in a CO2 incubator. After confirming that the cells adhered to the bottom of the dish, 6 ml of cell culture medium was added. After the entire solution, including the cells, was removed with a 10 ml pipette, the solution was transferred to a 15 ml tube and centrifuged at 1200 rpm for 3 minutes. After completely removing the solution from the 15 ml tube, adding 5 ml of DPBS and mixing well with the cells, centrifugation was carried out for 3 minutes at 1200 rpm. After removing the DPBS from the tube and adding 3 ml of wash buffer (PBS + 1% BSA) and mixing well with the cells, centrifugation was performed for 3 minutes at 1200 rpm and the wash buffer was removed from the tube.After repeating the washing process twice, 1 ml of wash buffer was added and thoroughly mixed with the cells. FACS tubes (Falcon) were prepared for non-staining, isotype control (normal human IgG-Alexa 488), and trastuzumab-Alexa 488. Cells were counted and 1×10 5Cells / 300 µl were transferred to each tube. After blocking for 15 minutes at 4°C, centrifugation was performed, and the supernatant was removed. 100 µl of wash buffer was added to the FACS tube and mixed well with the cells. 1 µg of isotype control and trastuzumab-Alexa 488 were added, except for the non-staining tube. After blocking light with aluminum foil and conducting an antibody reaction at 4°C for 30 minutes, centrifugation was performed, and the supernatant was removed. The remaining cells were washed by adding 1 ml of wash buffer. This process was repeated three times. After adding 300 µl of running buffer (PBS) to each tube and mixing well with the cells, FACS analysis was performed. As a result, it was confirmed that SKBR-3 had a much higher HER2 expression than MCF-7 ( Fig.10). Accordingly, SKBR-3, which exhibit higher HER2 expression, was confirmed to be more appropriate target cells than MCF-7 for evaluating the ADCC activity of the antibody sample. Example 11: Preliminary test to determine the ratio of effector cell (PBMC): target cell (SKBR-3, MCF-7) for ADCC

[0087] After culturing SKBR-3 and MCF-7 target cells, the target cells were seeded onto a V-bottom 96-well plate (Corning) with 1×10 4 Cells / 50 µl / well were seeded, followed by 10 µl of trastuzumab (20 µg / ml) added per well. PBMCs (CTL, Table 4) were quickly thawed in a 37 °C water bath and treated with DNase I for 30 minutes at room temperature. After cell counting, a sufficient number of PBMCs were added to each well. [Table 4] Data from PBMC donors Example ID # Ethnicity Old Gender SUBSCRIPTION / PH 20091026 Caucasian 24 Masculine A / POS 20100412 Hispanic 30 Masculine A / POS HHU20120530 African American 35 Masculine AB / POS HHU20130318 Asian 38 Masculine A / POS HHU20150924 Asian / Filipino 40 Masculine A / POS

[0088] The ratio of effector cell to target cell was adjusted to 1.5625:1, 3.125:1, 6.25:1, 12.5:1, and 25:1. After centrifugation at 100xg for 1 minute, the cells were cultured at 37°C in a CO2 incubator for 4 hours. Four hours later, the plate was centrifuged at 300xg for 3 minutes. 50 µl of the supernatant was removed and transferred to a 96-well SpectraPlate plate (PerkinElmer). Then, incubation was carried out at room temperature for 30 minutes after adding 50 µl of CytoTox 96. ® Reagent (Promega) was added to each well. After the reaction was terminated by adding 50 µl of a stop solution, the absorbance was measured at 490 nm. This procedure was repeated three times in duplicate, and the average value was taken. As a result, the ADCC assay using SKBR-3 (1×10 4cells / well) with high HER2 expression as target cells and using PBMC as effector cells, an effector cell number-dependent increase in cytotoxicity was observed. Although MCF-7 with low HER2 expression also showed an effector cell number-dependent increase in cytotoxicity, the increase was smaller than with SKBR-3, which showed higher HER2 expression ( Fig. 11). The higher cytotoxicity for SKBR-3 with high HER2 expression than for MCF-7 with low HER2 expression suggests that the cytotoxicity is HER2-specific. Given the difference in the distribution of FcγRIIIa F / V variants in the PBMCs used as effector cells, it was determined that the ratio of effector cell to target cell for assessing ADCC activity should be 25:1 or greater (Table 5). [Table 5] ADCC activity depending on the ratio of effector cell to target cell Effector to target % Cytotoxicity SKBR-3 MCF-7 1,5625 : 1 1,65 0,23 3,125 : 1 2,00 0,98 6,25 : 1 13,54 1,01 12,5 : 1 17,47 7,00 25 : 1 40,21 10,38 Example 12: Comparison of ADCC activity of Herceptin variants using human PBMC

[0089] SKBR-3 and MCF-7 cells were seeded onto a 96-well plate (V-bottom) at 1 × 10 4 Cells / 50 µl were seeded per well, and 10 µl of the test substance was added to each well at 0, 0.032, 0.16, 0.8, 4, and 20 µg / ml. Five individual PBMC samples were quickly thawed in a 37 °C water bath and treated with DNase I for 30 minutes at room temperature. After the cells were counted and 2.5×10 5 After 50 µl of cells / 50 µl of PBMC were added to each well, the plate was centrifuged at 100xg for 1 minute and then cultured in a CO2 incubator at 37°C for 4 hours. Four hours later, the plate was removed and centrifuged at 300xg for 3 minutes. After removing 50 µl of the supernatant and transferring it to a SpectraPlate 96-well plate, 50 µl of CytoTox 96 was added. ®Reagent was added to each well, and the reaction was carried out for 30 minutes at room temperature. After the reaction was terminated by adding 50 µl of a stop solution, the absorbance was measured at 490 nm. This procedure was repeated three times in duplicate, and the mean value was expressed as % cytotoxicity. The SKBR-3 cells with HER2 expression showed a high cytotoxicity of 4-31%, while the MCF-7 cells with low HER2 expression showed a low cytotoxicity of 2-15%. Accordingly, it was confirmed that the cytotoxicity of the test substance was target-specific. Furthermore, it was confirmed that the cancer cell killing effect was significantly improved compared to the aglycosylated wild-type antibody and the human IgG antibody ( Fig. 12).

[0090] Those skilled in the art will recognize that the concepts and specific embodiments disclosed in the foregoing description can be readily used as a basis for modifying or designing other embodiments for carrying out the same purposes of the present disclosure. This is followed by a sequence listing as an electronic document. This can be accessed both in DEPATISnet and in the DPMA register.

Claims

[1] A polypeptide comprising an Fc domain of a human antibody, the Fc domain comprising the following amino acid substitutions according to the Kabat numbering system: a) substitutions of 8 amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L; and b) (i) V264E, (ii) V264E and N421S, (iii) V264E and T350A, (iv) V264E, T350 and N421S, (v) T307S, (vi) C226R, F243L and K246E, (vii) T250I and I253N, or (viii) C347R. [2] The polypeptide of claim 1, wherein the Fc domain comprising the amino acid substitution has a 40% or more improved binding ability for FcγRIIIa compared to the Fc domain with only 8 amino acids of substituted S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L when measured by a flow cytometer. [3] An aglycosylated antibody comprising the polypeptide of claim 1. [4] A nucleotide molecule encoding the polypeptide of claim 1. [5] A vector comprising a nucleotide molecule according to claim 4. [6] A host cell comprising the vector of claim 5, wherein the host cell is a bacterial cell. [7] A composition comprising the polypeptide of claim 1, the aglycosylated antibody of claim 3, the nucleotide molecule of claim 4 or the vector of claim 5. [8] The composition of claim 7, wherein the composition is a pharmaceutical composition for preventing or treating cancer. [9] The polypeptide of claim 1, the aglycosylated antibody of claim 3, the nucleotide molecule of claim 4 or the vector of claim 5 for use in a method of preventing or treating cancer. [10] A process for producing a polypeptide comprising an Fc domain of a human antibody, comprising: a) a step of culturing a host cell comprising a vector comprising a nucleotide molecule encoding the polypeptide of claim 1; and b) a step for obtaining the polypeptide expressed by the host cell. [11] A process for producing an aglycosylated antibody comprising: a) a step of culturing a host cell expressing an aglycosylated antibody comprising the polypeptide of claim 1; and b) a step to purify the antibody expressed by the host cell.

Images