Peptide structure particles with signal transduction

Abstract

Peptide structure particle with signal transmission, characterized in that it comprises a particle body which represents a spherical whole, wherein the particle body comprises, from the outside inwards, a protective membrane, a spherical capsule and a small peptide; The small peptide enhances the secretory capacity of the signal peptide, and its amino acid sequence is represented in the following general formula: M(αXβYγ / αYβXγ) η ; where X represents an acidic amino acid; α stands for 0-2 neutral amino acids; β stands for 0-2 neutral amino acids; γ represents 1-10 neutral amino acids; η 1-3 is; where “ / ” in the general formula means “or”.

Description

Technical area

[0001] The utility model relates to the field of protein engineering and genetic engineering, in particular to a peptide structural particle with signal transmission. State of the art

[0002] The protein secretion system is not only the prerequisite for the sorting, localization, and realization of physiological functions of proteins, but also an important means for the development of genetic engineering and protein engineering technology. Various prokaryotic and eukaryotic expression systems have been developed for the production of recombinant proteins. The E. coli expression system has attracted considerable attention due to its clear genetic background, ease of operation, rapid growth in inexpensive media, and ease of large-scale fermentation and cultivation. Currently, the E. coli system is used to produce various enzyme preparations and even some pharmaceutical proteins such as interferon, insulin, and human serum albumin, and has achieved remarkable results in the field of biotechnology.

[0003] In E. coli, recombinant proteins can basically be produced by the following methods: 1. intracellular production of soluble proteins; 2. intracellular production of inclusion bodies; 3. secretion into the periplasmic space or extracellular medium. The E. coli system is suitable for the production of proteins that do not require post-translational modification and processing. Since E. coli lacks the cofactors required for protein folding, intermediates often accumulate in large quantities and easily form inclusion body precipitates, requiring lengthy processes such as renaturation. The periplasmic oxidation-type redox environment is favorable for protein folding.If the proteins are localized in the periplasmic space across the inner cell membrane or even secreted directly across the outer cell membrane into the extracellular medium, the downstream multiplexing, isolation, and purification processes can be significantly simplified, the toxicity and metabolic burden of the expressed proteins for the host bacteria can be reduced, and the expression level can be significantly increased.

[0004] Most existing secretory expression systems secrete into the periplasmic space, and the recovery of recombinant proteins still requires cell disruption and purification. The few that are secreted extracellularly are due to the imperfection of the E. coli protein secretion system or limitations in human understanding of its secretion system, resulting in extremely low secretion efficiency and post-processing problems of the fusion protein.

[0005] Signal peptide is a type of polypeptide with approximately 10-60 amino acids, generally located at the N-terminus of secreted proteins. The general approach for using signal peptides for secretion of expressed proteins is to clone the gene encoding the target protein into the tail end of the signal peptide sequence, achieve fusion of the target gene and the signal peptide sequence at the transcriptional and translational levels in the host, and rely on the signal peptide at the N-terminus of the protein precursor to guide the entire polypeptide chain for binding with intracellular molecular chaperones or secretory signal recognition particles, localization in membranes, or secretion outside the cell.

[0006] Although the extracellular secretion expression strategy has significant advantages over other expression methods, there are still many limitations to the widespread use of this strategy in E. coli systems. Therefore, it is a prerequisite to have a signal peptide that can promote the target protein for secretion from the cell. Even if the signal peptide has the ability to mediate extracellular secretion of the protein, this does not mean that a specific signal peptide possesses this mediating ability or the same degree of mediating ability for all recombinant proteins. Each recombinant protein has its own specific coding gene, the signal peptide and transition point sequence of the recombinant protein are different, and the structure of the recombinant protein itself is also different.Therefore, the secretion level of the recombinant protein depends on the optimal level of its signal peptide, the favorable transmembrane structure of the target protein and the degree of match between them.

[0007] In the E. coli expression system, the basic secretion pathways for secreted proteins that cross the plasma membrane are mainly Sec or Tat. For example, the signal peptide of the outer membrane protein (OmpA) and the signal peptide of pectate lipid lyase (PelB) pass through the Sec pathway, and the signal peptide of trimethylamine N-oxide reductase (TorA) passes through the Tat pathway. Both types of signal peptides have been successfully used for the secretion and expression of foreign proteins. To address the problem of defective or incomplete hydrolysis of target proteins in the yeast processing system, patent EP0461165B1 discloses a polypeptide structure consisting of a hydrophobic signal peptide, a hydrophilic leader peptide, and a heterologous protein. By modifying the amino acid sequence between the C-terminus of the leader peptide and / or the N-terminus of the heterologous protein (i.e.Negatively charged amino acids are trapped near the yeast processing site (next to the yeast processing site). This promotes complete exposure of the processing site, thereby improving the efficiency of protease cleavage, increasing the expression of the correctly processed (active) target protein, and subsequently excreting it from the cell. Content of the invention

[0008] Against this background, the present utility model provides a peptide structural particle with signal transduction containing a small peptide that can enhance the secretion ability of the signal peptide, thus facilitating the transport of the small peptide and its preservation by the particles, so as to facilitate the further development and application of the small peptide and its in-depth research.

[0009] The technical solutions of this utility model are as follows: a peptide structure particle with signal transmission comprising a particle body that is a spherical whole, the particle body comprising, from the outside to the inside, a protective membrane, a spherical capsule and a small peptide; The small peptide enhances the secretion ability of the signal peptide, and its amino acid sequence is represented in the following general formula: M(αXβYγ / αYβXγ) η ; where X represents an acidic amino acid; α stands for 0-2 neutral amino acids; β stands for 0-2 neutral amino acids; γ stands for 1-10 neutral amino acids; η is 1-3; where “ / ” in the general formula means “or”.

[0010] When η=1, the upper small peptide motif has a better effect on improving secretion; and when α is a neutral amino acid, β is 0 neutral amino acid, γ is 2-5 neutral amino acids, X is Glu and Y is Arg, the small peptide motif has the best effect on improving secretion.

[0011] Furthermore, the spherical capsule is a water-soluble neutral spherical capsule.

[0012] Furthermore, the spherical capsule is made of polyethylene glycol or povidone.

[0013] Furthermore, the protective membrane is attached to the spherical capsule and is made of a waterproof polymer material.

[0014] Furthermore, the small peptide is a nanoscale particle or a solution of a small peptide.The adoption of the above-mentioned technical solutions has the following positive effects: the small peptide of the particles of the present utility model has the ability to enhance the secretion of the signal peptide. For example, the small peptide of the present utility model can be fused to the leading end of the signal peptide, and then a secretion vector is constructed, which is transformed into an Escherichia coli expression host and then induced to express, so as to realize the secretory ability of the secretory signal peptide. Thus, the utility model develops small peptide structural particles that have the ability to enhance the secretion of the signal peptide, thus facilitating the transport of the small peptide and its preservation by the particles, thus facilitating the further development and application of the small peptide and its in-depth research. Short description of the drawings

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the utility model or the technical solutions in the prior art, the accompanying drawings are briefly introduced below, which must be used in describing the embodiments or the prior art, and it is obvious that the accompanying drawings in the following description only illustrate some of the embodiments of the utility model, and for the person with ordinary skill in the art, other drawings can be obtained according to the accompanying drawings without creative work. Fig. 1 is a schematic representation of the structure of the present utility model; Fig.Figure 2 is a schematic representation of the recombinant vector pET-EompA-FRU6 of the embodiment, where: ompASP: outer membrane protein A signal peptide coding sequence; FRU6: fructosidase FRU6 coding sequence; Ampsequence: ampicillin resistance gene coding sequence; and T7promoter: T7 promoter. Fig. Figure 3 shows the relationship between the improved secretion efficiency of the small peptide motif and the fermentation time of the embodiment; Fig. Figure 4 is a comparison of the enzyme activities of BL21 / pET-EompA-FRU6 and BL21 / pET-EpelB-FRU6 in the LB medium of the embodiment and the fermentation supernatant of the negative control; Fig.Figure 5 is an SDS-PAGE electropherogram of the BL21 / pET-EompA-FRU6 fermentation broth in the LB medium of the embodiment; including M: protein marker; 1 and 2: negative control, fermentation supernatant of the BL21 strain without the signal peptide sequence upstream of fructosidase FRU6, and cell disruption supernatant; 3 and 4: supernatant of the BL21 / pET-ompA-FRU6 strain fermentation broth and cell disruption supernatant; 5 and 6: supernatant of the BL21 / pET-EompA-FRU6 strain fermentation broth and cell disruption supernatant. (In the pET-EompA-FRU6 plasmid, the small peptide motif sequence added before the ompA signal peptide is MERACALA;) the direction of the arrow is the position of the molecular weight size of the mature peptide of fructosidase FRU6; Fig.Figure 6 is an SDS-PAGE electropherogram of the BL21 / pET-EpelB-FRU6 fermentation broth in the LB medium of the embodiment; M: protein marker; 1 and 2: negative control, fermentation supernatant of the BL21 strain without the signal peptide sequence before fructosidase FRU6, and cell disruption supernatant; 3 and 4: supernatant of the fermentation broth of the BL21 / pET-pelB-FRU6 strain and cell disruption supernatant; 5 and 6: supernatant of the fermentation broth of the BL21 / pET-EpelB-FRU6 strain and cell disruption supernatant; (In the pET-EpelB-FRU6 plasmid, the small peptide motif sequence added before the pelB signal peptide is MERACALA;) the direction of the arrow is the position of the molecular weight size of the mature peptide of fructosidase FRU6; Fig.Figure 7 is an SDS-PAGE electropherogram of the BL21 / pET-EompA-BGL fermentation broth in the LB medium of the embodiment; M: protein marker; 1 and 2: negative control, fermentation supernatant of the BL21 strain without the signal peptide sequence before the glucanase-BGL, and cell disruption supernatant; 3 and 4: supernatant of the fermentation broth of the BL21 / pET-ompA-BGL strain and cell disruption supernatant; 5 and 6: supernatant of the fermentation broth of the BL21 / pET-EompA-BGL strain and cell disruption supernatant; (In the pET-EompA-BGL plasmid, the small peptide motif sequence added before the ompA signal peptide is MERACALA;) the direction of the arrow is the position of the molecular weight size of the mature peptide of the glucanase-BGL; Fig.Figure 8 is an SDS-PAGE electropherogram of the BL21 / pET-EpelB-BGL fermentation broth in the LB medium of the embodiment; M: protein marker; 1 and 2: negative control, fermentation supernatant of the BL21 strain without the signal peptide sequence before the glucanase-BGL, and cell disruption supernatant; 3 and 4: supernatant of the fermentation broth of the BL21 / pET-pelB-BGL strain and cell disruption supernatant; 5 and 6: supernatant of the fermentation broth of the BL21 / pET-EpelB-BGL strain and cell disruption supernatant; (In the pET-EpelB-BGL plasmid, the small peptide motif sequence added before the pelB signal peptide is MERACALA;) the direction of the arrow is the position of the molecular weight size of the mature peptide of the glucanase-BGL. Detailed description of the preferred embodiments

[0016] The utility model is described in more detail below in conjunction with the attached drawings.

[0017] Embodiment 1: a peptide structure particle with signal transmission as in Fig. 1, comprises a particle body 1 which is a spherical whole, the particle body 1 comprising, from the outside to the inside, a protective membrane 2, a spherical capsule 3 and a small peptide 4; The small peptide 4 enhances the secretion ability of the signal peptide, and its amino acid sequence is represented in the following general formula: M(αXβYγ / αYβXγ) η ; where X represents an acidic amino acid; α stands for 0-2 neutral amino acids; β stands for 0-2 neutral amino acids; γ stands for 1-10 neutral amino acids; η is 1-3; where “ / ” in the general formula means “or”. When η=1, the upper small peptide motif has a better effect on improving secretion; and when α is a neutral amino acid, β is 0 neutral amino acid, γ is 2-5 neutral amino acids, X is Glu and Y is Arg, the small peptide motif has the best effect on improving secretion.

[0018] Therefore, the small peptide motif protected by the present utility model, which is obtained on the basis of the above general formula, is, for example, the original small peptide motif: MERACVAV; then its derived analogues can be modified as follows: MREACVAV; MAERACVAV; MEAEACVAV; MDKACVAV; MERLIVFAV;... or the superposition of small peptide sequences such as MERACVA+VEARLIVFAV, etc., with further derivatization types described in specific embodiments of the utility model.

[0019] This means that small peptides 4 within the structural particles can also be replaced by small peptide variants.

[0020] This small peptide variant is an insertion or deletion of one or more amino acid residues and / or an amino acid substitution of one or more amino acid residues of a similar nature that exhibit the highly secretion-signal-enhancing small peptide motif of the present invention. Such variants still possess signal peptide properties or enhanced secretion functions, as is known to those skilled in the art.

[0021] The spherical capsule is 3 a water-soluble neutral spherical capsule.

[0022] The spherical capsule 3 is made of polyethylene glycol or povidone.

[0023] The protective membrane 2 is attached to the spherical capsule 3 and is made of a waterproof polymer material.

[0024] Small peptide 4 is a nanoscale particle or solution of a small peptide.

[0025] The small peptide 4 of the invention, which can enhance the secretion ability of the signal peptide, can be fused to the leading end of the ompA signal peptide or the pelB signal peptide and provided with the small peptide motif of the invention. This can achieve the ability of the aforementioned signal peptide to secrete and express foreign proteins in the E. coli system. This small peptide 4 can also be used to construct a vector that enhances the secretion ability of common signal peptides to improve their secretion and expression of foreign proteins.

[0026] Alternatively, a recombinant vector can be prepared using a nucleotide sequence encoding a small peptide 4, and the recombinant vector can be transformed or transferred into a host cell.

[0027] The term "secretion" in this utility model refers to the transport of protein or peptide molecules out of bacterial cells, including situations where the protein or peptide molecule ends up in the culture medium in completely free form and part of the protein is located outside the bacterium or part of the protein exists in the periplasmic space of the bacterium. The following terms used in this utility model have the following meanings unless otherwise specified: "Variant" of a protein amino acid or polynucleotide refers to an amino acid sequence with one or more amino acid or nucleotide changes, or a polynucleotide sequence encoding one or more amino acid or nucleotide changes. The "changes" may include deletions, insertions, or substitutions of amino acids or nucleotides in an amino acid sequence or nucleotide sequence.Variants can contain conservative changes, where the new amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine. Variants can also contain nonconservative changes, such as replacing glycine with tryptophan.

[0028] "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid or nucleotide sequence. "Insertion" or "addition" refers to a change in an amino acid or nucleotide sequence that results in the addition of one or more amino acids or nucleotides compared to the original molecule. "Substitution" means the replacement of one or more amino acids or nucleotides with another amino acid or nucleotide.

[0029] For specific applications of the small peptide 4 in the structural particles of the utility model, fructosidase FRU6 from Arthrobacter arilaitensis and glucanase BGL from Bacillus subtilis B. subtilis can be used as target proteins; common signal peptides are selected from ompA of the outer membrane protein and pelB signal peptide from pectate lipid lyase. By adding a small peptide sequence to the leading end of the ompA or pelB signal peptide, the thus constructed secretion vector was transformed into a colon expression host and induced for expression. The enhanced secretion function of the small peptide 4 was verified by detection methods.

[0030] The host used was YBL21(DE3), E. coli pET-22b was used as the backbone for vector construction, and the pelB signal peptide sequence in the original pET-22b was removed. The ompA / pelB signal peptide and fructosidase FRU6 or glucanase BGL are fused by overlapping PCR, and upstream primers are designed to add the small peptide motif gene before the signal peptide gene sequence.

[0031] The secretion-enhanced expression vectors pET-EompA-FRU6 and pET-EpelB-FRU6 as well as pET-EompA-BGL and pET-EpelB-BGL were constructed by restriction site ligation and restriction site ligation.

[0032] The recombinant plasmid vectors pET-EompA-FRU6 and pET-EpelB-FRU6 (or pET-EompA-BGL and pET-EpelB-BGL), which contain a fusion of the enhanced secretory signal peptide and the fructosidase FRU6 (or glucanase BGL) genes, were transformed into the host E. coli BL21 and named BL21 / pET-EompA-FRU6 and BL21 / pET-EpelB-FRU6 (or BL21 / pET-EompA-BGL and BL21 / pET-EpelB-BGL). Expression was induced in LB medium using IPTG as the inducer.

[0033] The results after secretion and expression of the two above-mentioned target proteins were determined by detecting enzyme activity inside and outside the culture medium cells and analyzed by SDS-PAGE.

[0034] The utility model covers Fructosidase FRU6 and β-1,3-1,4-glucanase BGL. Fructosidase FRU6 (molecular weight approximately 55 kDa, derived from Arthrobacterarilaitensis NJEM01, strain collection number CCTCCM2012155). Fructosidase, with the systematic classification number EC3.2.1.80, is an extracellular enzyme that specifically catalyzes the hydrolysis of the non-reducing terminal 2,1-β-glycosidic or 2,6-β-glycosidic bond in fructan molecules composed of β-D-fructose. It can also hydrolyze inulin, sucrose, raffinose, and other compounds. It has extensive applications in biology, medicine, the food industry, and other fields. Glucanase BGL (molecular weight is about 28 kDa, EC3.2.1.73, β-glucanase, derived from Bacillus subtilis β.subtilis) is an endohydrolase.It can efficiently and effectively hydrolyze the β-1,4-glycosidic bond adjacent to the β-1,3-glycosidic bond in β-glucan, thereby reducing the negative impact of β-glucan in grains on industrial production. Therefore, it has very important applications in the beer brewing industry, the pharmaceutical industry, and other fields. The small peptide motif of small peptide 4 of this utility model, which can enhance secretion function, is linked to the N-terminus of the signal peptide and has a significant effect on enhancing the secretion of the target protein.Experiments using the secretory expression of fructosidase FRU6 showed that the addition of a small peptide motif before the ompA signal peptide increased secretion efficiency by up to 5.1-fold compared to the method without addition; the addition of a small peptide motif before the pelB signal peptide increased secretion efficiency by up to 5.4-fold compared to the method without addition. Examples of the secretory expression of glucanase BGL showed that the small peptide motif increased the ompA signal peptide by up to 2.3-fold and the pelB signal peptide by up to 2.5-fold. The polypeptide structure disclosed in EP0461165B1 is intended to fully expose the yeast processing site by modifying the amino acid sequence between the C-terminus of the leader peptide and / or the N-terminus of the heterologous protein. This promotes the correct processing of target proteins and increases the expression of active proteins.Furthermore, the secretion expression vector constructed by the utility model can be used to produce various recombinant proteins. Embodiment 1: Application of small peptide amplification motifs in the secretory expression of fructosidase

[0035] First, the source of the fructosidase Fru6 gene described in this embodiment is Arthrobacterarilaitensis NJEM01, the strain disclosed in application CN102732456A. ​​The strain collection number of this strain is CCTCCNO:M2012155. All primers involved in this embodiment were synthesized by Yingjun Company, see Table 1. The following primer numbers are uniformly represented by "P" plus a serial number. For example, primer No. 45 in Table 2 has the code P45, and its number in the sequence listing is SEQ ID NO: 45. Table 1: Nucleotide sequences of primers and synthetic sequences required for embodiment 1 SEQ ID NO Primer-Nucleotidsequenz (5'-3') 1 GCCACCGAACCAGTGCCTGG 2 TTACTTTGCTACTGCTTTGCC 3 ATGAAAAAGACAGCTATCGCG 4 CTGGTTCGGTGGCAGCTTGGGCTACGGTAGCGAAA 5 ACCGTAGCCCAAGCTGCCACCGAACCAGTGCCTGG 6 CCGGAATTC TTACTTTGCTACTGCTTTGCC 7 ATGAAATACCTATTGCCTACG 8 ACTGGTTCGGTGGCAGCCATGGCTGGTTGGGCAGC 9 AACCAGCCATGGCTGCCACCGAACCAGTGCCTGGC 10 CCGGAATTC TTACTTTGCTACTGCTTTGCC

[0036] Note: The underlined parts in the table are restriction enzyme sites. (1) Acquisition of the fructosidase FRU6 gene:

[0037] Using the genome of Athbactearilaitensis NJEM01 as a template, a PCR reaction with primers P1 and P2 was performed to amplify the fructosidase FRU6 gene fragment (except for the signal peptide sequence of the enzyme itself). By cloning into the cloning vector pMD18-T, ljpMD-T-FRU6 was obtained, transformed into the cloning host DH5a, and the DNA sequence was determined to verify its accuracy. (2) Fusion of the signal peptide with the fructosidase gene:

[0038] The signal peptide gene sequences ompA and pB (i.e., primers P11 and P12) were artificially synthesized, and the plasmid pMD-T-FRU6 from step (1) was extracted. By designing overlapping PCR primers P3-P6 or P7-P10, the fructosidase FRU6 and the signal peptide ompA or pelB were fused, respectively, with both P6 and P10 containing EcoRI restriction sites. (3) Design of an improved secretion vector:

[0039] The amino acid sequence of the small peptide motif is MERACALA; other small peptide motifs are listed in Table 2. Using the fusion gene in the second step as a template, upstream primers P45 and P46 were designed, and P45 and P46 each contained NdeI restriction sites. Through a conventional PCR reaction, the combination of primers P45 and P6 can add the small peptide motif gene in front of the ompA signal peptide gene; by combining primers P46 and P10, a small peptide motif gene (for example, the amino acid sequence of the small peptide motif is MERACALA) can be added in front of the pelB signal peptide gene. The target sticky-end fragment was obtained by double digestion with NdeI and EcoRI. The pET-22b vector (purchased from Yingjun Company) was also digested and digested with the restriction enzymes NdeI and EcoRI, and the large plasmid fragment with the removed pelB signal peptide sequence was obtained.Subsequently, the recovered large plasmid fragment and the enzymatic digestion product of the enhanced secretion signal peptide and the fructosidase fusion gene were ligated with T4 ligase to generate pET-EompA-FRU6 (see . Fig. 2 for the plasmid map) and ET-EpelB-FRU6 (the plasmid map is similar to the former, so omitted). The DNA sequence transformed into the cloning host E. coli DH5a was determined to verify its accuracy. Table 2 Amino acid sequences, primers and enzyme activities of secretion-enhancing small peptide motifs involved in corresponding fructosidase n M α X (oder Y) β Y (oder X) Y Primer Signalpeptid Enzymaktivität 1 M E R 13 ompA 1279 14 pelB 1521 1 M R E 15 ompA 801 16 pelB 917 1 M E R A 17 ompA 1831 18 pelB 1734 1 M E A R AA 19 ompA 1678 20 pelB 1530 1 M AA E R AC 21 ompA 2169 22 pelB 178 1 1 M R E IV 23 ompA 907 24 pelB 862 1 M E R LC 25 ompA 2380 26 pelB 1972 1 M T R T E ACA 27 ompA 2024 28 pelB 1976 1 M C R C D ACAL 29 ompA 2175 30 pelB 2005 1 M E R ACAL 31 ompA 2169 32 pelB 1781 1 M V E LT R ACALA 33 ompA 2513 34 pelB 2100 1 M E R ACALA 35 ompA 1877 36 pelB 1762 1 M CL E R ACALA 37 ompA 2395 38 pelB 2230 1 M V E T R ACALA 39 ompA 2460 40 pelB 2195 1 M VA E LT R ACALA 41 ompA 2380 42 pelB 2120 1 M E A R ACVAV 43 ompA 2390 44 pelB 2275 1 M E R ACALA 45 ompA 2016 46 pelB 1979 1 M D K ACVAV 47 ompA 1193 48 pelB 1272 1 M L D V R ACALAA 49 ompA 1754 50 pelB 1644 1 M E R ACALAA 51 ompA 1980 52 pelB 1642 1 M AA D LT K ACALAAA 53 ompA 1766 54 pelB 1790 1 M E R ACALAAA 55 ompA 1987 56 pelB 1755 1 M E R ACALAAA 57 ompA 2485 58 pelB 1643 1 M TC K CL D ACALAAAAA 59 ompA 1906 60 pelB 1560 1 M E R LLCCTTTTT 61 ompA 1986 62 pelB 1756 1 M E R ACALAAAAA 63 ompA 1762 64 pelB 1882 1 M LT K CL E CATACCCCCC 65 OmpA 1883 66 pelB 1986 1 M E R TTLTCCCCCC 67 ompA 1880 68 pelB 1670 2 MERACVAV+MERACVAV 69 ompA 1787 70 pelB 1754 2 MERACALA+VERACAL 71 ompA 2460 72 pelB 1845 3 MERACAL+VERACAL+VERACAL 73 ompA 1680 74 pelB 1855 3 MERCLATL+VERLCVAV+VERACALA 75 ompA 2260 76 pelB 2042 0 blind 77 ompA 420 78 pelB 495

[0040] Note: The primer number in this table corresponds to P or SEQ ID NO.

[0041] The sequences of the OmpA and PelB signal peptides are as follows: OmpA:ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACC GTAGCCCAAGCT (SEQ ID NO: 11), PelB:TGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCTGCCCAA CCAGCCATGGCT (SEQ ID NO: 12). (4) Construction of strains with enhanced secretory expression:

[0042] The vectors pET-EompA-FRU6 and pET-EpelB-FRU6 were transformed into the expression host BL21 as described in the Molecular Cloning Manual. Recombinant strains of Escherichia coli BL21 containing the vectors pET-EompA-FRU6 and pET-EpelB-FRU6 were screened on LB plates containing 100 μg / ml ampicillin and designated BL21 / pET-EompA-FRU6 and BL21 / pET-EpelB-FRU6. (5) Secretory expression of fructosidase FRU6:

[0043] The recombinant bacteria were inoculated overnight into liquid LB medium containing 100 g / ml ampicillin at 37 °C and 200 rpm and then inoculated into fresh LB medium (containing 100 g / ml ampicillin) with a 2% inoculum. When the OD600 at 37 °C and 200 rpm was 0.6-0.9, the inducer IPTG (final concentration 1 mmol / L) was added, and samples were taken every 1 hour. (6) Enzyme activity test:

[0044] After shake-flask fermentation of the recombinant strains, the supernatant was collected by centrifugation, and the cells were crushed to obtain cell-free granules. The fermentation supernatant of BL21 / pET-EompA-FRU6 and BL21 / pET-EpelB-FRU6, as well as intracellular enzyme activities, were analyzed, and recombinant bacteria without amplification of small peptide motifs were used as a negative control. The results are shown in Fig.3 (Comparison of the efficiency of fructosidase secretion in the supernatant after IPTG induction for 0-24 hours, fermentation of BL21 hosts with small peptide motifs, without small peptide motifs and without signal peptide) and Fig. 4 (2% inoculum in LB medium was taken after 6 hours of shake flask fermentation; comparison of the enzyme activity of BL21 / pET-EompA-FRU6 or BL21 / pET-EpelB-FRU6 and the fermentation supernatant of the negative control under unit cell mass (mg) conditions) (see Table 2 for further enhancement effects of the small peptide motifs, where each small peptide motif was selected to be assayed for enzyme activity after 6 hours of fermentation; samples taken at other time points are not listed here).

[0045] The primers to be used in embodiment 1 were developed using conventional methods. Embodiment 2: Application of small peptide amplification motifs in the secretory expression of glucanase

[0046] (1) The construction of an expression vector with small peptide amplification motifs added before various signal peptides at the N-terminus of glucanase BGL is the same as in Embodiment 1. In this embodiment, the fructosidase in Embodiment 1 is replaced with the glucanase gene. Among them, the source of the sequence of glucanase BGL: Bacillus subtilis subsp. subtilis6051-HGW, GenBank sequence number: CP003329.1, range: 4011849 to lj4012490.

[0047] Primers P79 and P80 were used for the PCR reaction to amplify the glucanase BGL gene fragment, and the T-vector pMD-T-BGL was generated. Overlapping PCR primers P81-P84 or P85-P88 fuse glucanase BGL and the signal peptide ompA or pelB, respectively, with both P84 and P88 carrying EcoRI restriction sites. By combining the upstream primers P89-P96 and the downstream primer P84 or P88, various amplification motifs can be designed, which are fused upstream of the ompA or pelB signal peptide. (2) Secretory expression of glucanase BGL in LB medium

[0048] The constructed glucanase-BGL secretion expression vector was transformed into the expression host BL21 (DE3), and the final recombinant strains were named BL21 / pET-EompA-BGL and BL21 / pET-EpelB-BGL. The transformants were tested on LB plates containing 100 μg / ml ampicillin, and the plasmids were extracted for verification as described in the Molecular Cloning Manual.

[0049] The recombinant bacteria were inoculated overnight into liquid LB medium containing 100 g / ml ampicillin at 37 °C and 200 rpm and then inoculated into fresh LB medium (containing 100 g / ml ampicillin) with a 2% inoculum. When the OD600 at 37 °C and 200 rpm was 0.6–0.9, the inducer IPTG (final concentration 1 mmol / L) was added, and samples were collected after 6 hours of induction. (3) Method for measuring glucanase activity

[0050] After shake-flask fermentation of the recombinant strains, the supernatant was separated by centrifugation, and the cell-free slurry was obtained by cell crushing. The fermentation supernatants of BL21 / pET-EompA-BGL and BL21 / pET-EpelB-BGL, as well as intracellular enzyme activity, were detected, and the recombinant bacteria without small peptide motif amplification were used as negative controls. The amplification effects of small peptide motifs are presented in Table 5 (selected partial results, all of which were sampled after 6 hours of fermentation and tested for enzyme activity).

[0051] Determination of enzyme activity using the DNS method: 1.0 mL of 1% (w / v) barley β-glucan (dissolved in pH 6.5, 20 mmol / L Na2HPO4 citrate buffer) was used as the substrate, and 0.5 mL of appropriately diluted enzyme solution was added, and the reaction was carried out at 45°C for 10 minutes. The reducing sugar was determined using the DNS method, and the inactivated enzyme was used as a blank control. Definition of enzyme activity unit: Under the above conditions, the amount of enzyme required to produce 1 μmol of reducing sugar from the substrate per minute is defined as one activity unit (U). Table 3 Amino acid sequences and enzyme activities of secretion-enhancing small peptide motifs involved in the corresponding glucanase n kleine Peptidsequenz Primer Signalpeptid Enzymaktivität 1 MERACVA 89 ompA 115 90 pelB 98 2 MERLCVAV+VERACALA 91 ompA 110 92 pelB 95 3 MERCLATL+VERLCVAV+VERACALA 93 ompA 134 94 pelB 92 1 blind 95 ompA 47 96 pelB 58

[0052] (4) SDS-PAGE detection of the expression products of the recombinant bacteria BL21 / pET-EompA-BGL and BL21 / pET-EpelB-BGL, the operation method is described in the “Molecular Cloning Manual” and the results are shown in Fig. 7 and Fig. 8 shown. QUOTES CONTAINED IN THE DESCRIPTION

[0000] This list of documents submitted by the applicant was generated automatically and is included solely for the convenience of the reader. This list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions. Cited patent literature

[0000] EP 0461165B1 [0007, 0034] CN 102732456A

[0035]

Claims

[1] Peptide structure particles with signal transmission, characterized by that it comprises a particle body which represents a spherical whole, the particle body comprising, from the outside to the inside, a protective membrane, a spherical capsule and a small peptide; The small peptide enhances the secretion ability of the signal peptide, and its amino acid sequence is represented in the following general formula: M(αXβYγ / αYβXγ) η ; where X represents an acidic amino acid; α stands for 0-2 neutral amino acids; β stands for 0-2 neutral amino acids; γ stands for 1-10 neutral amino acids; η is 1-3; where “ / ” in the general formula means “or”. [2] Peptide structure particles with signal transmission according to claim 1, characterized by , that X is selected from Glu or Asp; Y is selected from Arg or Lys; the neutral amino acid is selected from one of the following: Ala, Cys, Leu, Val, Lie, or Phe. [3] Peptide structure particles with signal transmission according to claim 1, characterized by that η is 1. [4] Peptide structure particles with signal transmission according to claim 3, characterized by that α is 1 neutral amino acid, β is 0 neutral amino acid, γ is 2-5 neutral amino acids, X is Glu and Y is Arg. [5] Peptide structure particles with signal transmission according to claim 1, characterized by that the spherical capsule is a water-soluble neutral spherical capsule. [6] Peptide structure particles with signal transmission according to claim 5, characterized by that the spherical capsule is made of polyethylene glycol or povidone. [7] Peptide structure particles with signal transmission according to claim 1, characterized by that the protective membrane is attached to the spherical capsule and is made of a waterproof polymer material. [8] Peptide structure particles with signal transmission according to claim 1, characterized by that the small peptide is a nanoscale particle or a solution of a small peptide.

Images