NON-HUMAN CHIMERATIVE ANIMAL WITH HUMAN LIVER DEFICIENCED IN P450 OXIDOREDUCTASE AND METHOD FOR USE THEREMISH
Patent Information
- Application Number
- DE602017093606
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-05-23
- Filing Date
- 2017-06-27
- Publication Date
- 2026-01-21
- Estimated Expiration
- 2037-06-27
AI Technical Summary
Current experimental animal models fail to accurately predict human xenobiotic metabolism, leading to inefficacy or toxicity issues in clinical drug trials, necessitating better preclinical tools.
A human liver chimeric non-human animal model is developed by creating a conditional knockout of the NADPH-P450 oxidoreductase (Por) gene in mice, allowing for almost complete replacement with human hepatocytes, using CRISPR/Cas9 and adenoviral gene therapy to inhibit murine cytochrome metabolism.
The model enables accurate prediction of human drug metabolism and toxicity, enhancing the identification of human-specific metabolites and reducing murine interference, thereby improving drug development safety.
Description
BACKGROUND OF THE INVENTION
[0001] Only one out of ten drugs in development gets approved for clinical use. The majority fails during clinical trials due to inefficacy or toxicity in humans. The lack of experimental animal models to accurately predict human xenobiotic metabolism is a significant limitation, which jeopardizes human lives and drives drug development costs. Hence, there is a compelling need to develop better preclinical tools. The present disclosure solves these needs in the art by providing a human liver chimeric non-human animal model and methods of using the human liver chimeric non-human animal model to predict human specific drug metabolism. Azuma H., et al. (2007) Nature Biotechnol. 25(8):903-910 describes the expansion of human hepatocytes in Fah - / -< / Rag2 - / -< / N2rg - / -< mice.SUMMARY OF THE INVENTION
[0002] The invention is defined according to the appended claims and provides a method for preparing a chimeric non-human animal comprising human hepatocytes, the method comprising: (a) providing a non-human animal comprising a deletion of NADPH-P450 oxidoreductase (Por) gene resulting in reduced or absent expression of Por protein; and (b) transplanting human hepatocytes into the non-human animal, wherein the the non-human animal is a FRG (Fah- / - / Rag2- / - / Il2rg- / -) non-human animal, wherein the non-human animal is a mouse. Any reference to a non-human animal in the context of the present disclosure is to be interpreted as referring to a mouse.
[0003] The reduced or deleted Por gene can be a conditional knockdown or knockout of the Por gene. The reduced or deleted Por gene can be the result of a mutation, a transgene, treatment with an exogenous substance or somatic genome engineering, including a CRISPR (Clustered regularly interspaced short palindromic repeats) system. The somatic genome engineering comprises Guide RNA (gRNA) and Caspase 9 (Cas9).
[0004] The non-human animal can comprise a floxed allele of the Por gene, and wherein the non-human animal is provided with a Cre recombinase sufficient to produce a conditional knockout of the Por gene. The non-human animal comprising the floxed allele of the Por gene can be provided with at least a first dose of a virus that encodes Cre recombinase. The non-human animal can be provided with at least a second dose of a virus that encodes Cre recombinase. The non-human animal can comprise the floxed allele of the Por gene is crossed with a transgenic non-human animal strain expressing Cre recombinase. The crossing of the non-human animals is not part of the invention.
[0005] In a one aspect, the method of the present disclosure comprises (a) providing a non-human animal comprising a floxed allele of the Por gene with a first does of a virus that encodes Cre recombinase; (b) transplanting human hepatocytes into the non-human animal; and (c) providing the non-human animal with a second dose of a virus that encodes Cre recombinase. Steps (a) and (b) can occur sequentially or simultaneously.
[0006] In one aspect, the non-human animal can further comprise a deletion of UDP-glucose 6-dehydrogenase (UGDH) gene, or a deletion of Glutathione synthetase (GSS) gene.FRG (Fah- / - / Rag2- / - / Il2rg- / -) non-human animal.
[0007] The present disclosure also provides a chimeric non-human animal, or a portion thereof, which has a chimeric liver comprising human hepatocytes, prepared by any method disclosed herein, wherein the non-human animal is a mouse.
[0008] The chimeric non-human animal can be immunodeficient. Human hepatocytes can account for at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of all hepatocytes in the chimeric liver of the chimeric non-human animal.
[0009] The present disclosure further provides a method for screening for a substance that affects human liver functions, comprising: (a) administering a test substance to the chimeric non-human animal of the present disclosure; (b) measuring one or more values in the chimeric non-human animal to which the test substance is administered in (a); and (c) selecting a test substance that causes an increase or an decrease in one or more values measured in (b), compared with the one or more values measured in a chimeric non-human animal to which no test substance is administered. Preferably, the one or more values is selected from the group consisting of a metabolite of the test substance, human albumin concentration, body weight curve, liver-weight-to-body-weight ratio, total albumin level, total protein level, ALT level, AST level, and total bilirubin level, histological assessment for pathologies in the human and non-human organs.
[0010] The present disclosure also provides a method for evaluating the toxicity of a test substance against human hepatocytes, comprising: (a) administering a test substance to the chimeric non-human animal of the present disclosure; (b) measuring one or more indicators in the chimeric non-human animal to which the test substance is administered in (a); and (c) evaluating the effect of the test substance on human hepatocytes using, one or more indicators measured in (b), compared with the one or more indicators measured in a chimeric non-human animal to which no test substance is administered. Preferably, the one or more indicators is selected from the group consisting of an increase or a decrease in any one or more of a metabolite of the test substance, human albumin concentration, body weight curve, liver-weight-to-body-weight ratio, total albumin level, total protein level, ALT level, AST level, and total bilirubin level, histological assessment for toxicity in the human and non-human organs. A "non-human animal" can be amphibian, reptile, avian, or a non-human mammal.
[0011] Throughout the specification the word "comprising," or variations such as "comprises" or "comprising," will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0012] About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about."BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The above and further features will be more clearly appreciated from the following detailed description when taken in conjunction with the accompanying drawings. Figure 1A-D shows the generation of the PIRF strain and deletion of the murine P450 (Por) oxidoreductase. Figure 1A is a schematic representation of deleted and transgenic loci in the PIRF strain. Figure 1B is a graph showing qPCR of Por mRNA upon intravenous injection of adenovirus expressing the CRE recombinase (Adeno-Cre). Figure 1C is a series of immunostaining photographs for Por demonstrating a gradient across the hepatic acinus with higher pericentral (cv) and lower periportal (pv) expression. Upon injection with Adeno-CrePor is barely detectable. Figure 1D is a photograph of a Western blot showing the almost complete disappearance of Por protein. Figure 2A-E shows the humanization of the PIRF strain and gene expression profiling upon deletion of murine P450 oxidoreductase (Por). Figure 2A is a series of immunostaining photographs showing humanized PIRF and FRG mice for murine Por (mPor) and human nuclei (hNuc) after injection of Adeno-Cre (2.2x10 10< pfu / mouse) once (1x) or twice (2x). Counterstaining in merged picture using DAPI. Figure 2B is a schematic showing the experimental outline for murine and human transcriptomics from chimeric livers with or without Por deletion. Figure 2C is a graph showing the murine cytochrome mRNA originating from livers of the PIRF model. Figure 2D is a graph showing the human cytochrome mRNA originating from livers of the PIRF model. Figure 2E is a graph showing the comparison gene expression of the main drug metabolizing human cytochromes in humanized, Por-deleted PIRF (Hu-PIRF 2x) mice with the original, isogenic human hepatocytes. Gene expression has been normalized to three murine respectively human housekeeping genes (PSMB2, PSMB4 and RAB7A resp. Rab7 25< ). PIRF; Por c / c< / Il2rg - / -< / Rag2 - / < -< , Fah - / -< FRG; Fah - / -< / Rag2 - / -< / Il2rg - / < -< . Figure 3A-E shows xenobiotic metabolism in humanized PIRF mice. Figure 3A is a graph showing the selection of abundant and decreased gefitinib metabolites upon murine P450 oxidoreductase (Por) deletion in non-humanized PIRF mice using mass spectrometry in the murine feces within 24 hours after intravenous injection of gefitinib. Figure 3B is a schematic showing gefitinib metabolites and know modifications. Figure 3C is a graph showing that murine Por-deleted, human liver chimeric PIRF (Hu-PIRF 2x) mice and control groups show the most abundant human metabolite, M4. Figure 3D is a graph showing that murine Por-deleted, human liver chimeric PIRF (Hu-PIRF 2x) mice and control groups show the human specific metabolite M28. PIRF; Por c / c< / Il2rg - / < -< Mag2 - / < -< , Fah - / < -< , FRG; Fah -l-< / Rag2 - / -< / Il2rg - / < -< . * p< 0.05 using non-parametric Mann-Whitney test. Figure 3E is a graph is a graph showing a mass spectrometry analysis of PIRF liver homogenates 30 min after injection with atazanavir, a retroviral therapeutic. A major human metabolite (M15) is shown. The overall abundance of metabolites from atazanavir or gefitinib was set as 100% in each sample. The data are expressed as mean. PIRF; Por c / c< / Il2rg - / < -< Mag2 - / -< / Fah - / < -< , FRG; Fah - / -< / Rag2 - / -< / Il2rg - / -< * p< 0.05 using non-parametric Mann-Whitney test. Figure 4A-B shows a schematic of an exemplary probe of the present disclosure. Figure 4A is a schematic showing the design of the targeting vector and modified Por locus. Figure 4B is a photograph of Southern blotting with three probes demonstrating proper targeting of ESC. Figure 5 shows beta galactosidase (lacZ) expression from the POR-lacZ allele. X-gal staining of heterozygous mouse embryo and liver demonstrate expression of the galactosidase from the Por-lacZ allele. Figure 6A shows a scheme of Il2 rg, Rag2 and Fah genes showing the gRNA location (in color) and the primers used to genotype the mice. Figure 6B shows an electrophoresis gel of the PCR products obtained from genotyping. Lane 1: PCR bands using external (Fw and Rv) primers. For Rag2 and Fah heterozygotes, a wild type (arrow) and deleted (arrowhead) allele can be detected. Il2 rg is an X-linked gene and no founder heterozygote females were generated. Homozygotes mice for Il2 rg, Rag2 and Fah show a single deleted allele's band of 460bp, 530bp and 200bp, respectively. Lane 2: PCR bands using one of the external (Fw or Rev) and the internal (Int) primer located between the two gRNA sites. Only heterozygotes have a clear PCR band formed from the wild type allele. Fah and Rag2 homozygotes show multiple unspecific bands while Il2 rg homozygotes do not produce any band. Figures 7A and 7B show the spectrum of genomic deletions in the Il2-rg, Rag2 and Fah gene. Figure 7A is a schematic showing CRISPR / Cas9 injected zygotes of conditional Por - / -< mice sequenced to determine of deletion of DNA. Figure 7B is a schematic showing CRISPR / Cas9 injected zygotes of conditional Por- / - mice sequenced to determine of deletion of amino acids. Figure 8 shows lipid phenotype in the liver of PIRF mice upon deletion of the Por gene using an adenovirus expressing the CRE recombinase. Two weeks after injection of the adenovirus hepatocytes start to accumulated lipids. Oil-red-O stained livers have previously been validated for efficient deletion (upper panel) respectively expression (lower panel) of the Por gene (not shown). Figure 9 shows clonal expansion of Por expressing hepatocytes in non-humanized PIRF mice. Mice were injected intravenously with adenovirus expressing CRE recombinase deleting the Por gene (POR fl / fl< ). Figure 10 shows the experimental setup for drug studies in humanized and non-humanized control mice. Humanized (Hu) and not-humanized PIRF and FRG ice were injected once (1x, before transplantation of human hepatocytes) or twice (2x, before and after reaching high human chimerism) before doing drug studies. Injected adenovirus expresses the CRE-recombinase, which leads to deletion of the Por gene in the PIRF, but not in the FRG strain (control). Orange; murine drug metabolism, white; inhibited murine drug metabolism, blue; human drug metabolism. Figures 11A and 11B show that the conditional KO of POR can also be generated using a transgenic animal, which carries an expression cassette (albumin promoter) of the CRE recombinase. Figure 11A shows that POR can be detected in immunofluorescence with the control group where only one allele carries a floxed POR sequence the other one the wild-type POR (POR c / +< ). In Figure 11B, both POR alleles are floxed (POR c / c< ), leading to an almost complete deletion of the POR gene and a barely detectable POR protein. POR (green) and nuclei (blue, DAPI). Figure 12 depicts the expression of P450 oxidoreductase in humanized PIRF mice. Figure 12A is a bar graph showing qPCR of human and murine specific Por normalized to human and murine Gapdh, respectively. Figure 12B is a western blot image showing murine Por and β-actin of liver samples from the same humanized mice. Figure 13 depicts Gefitinib metabolites upon murine P450 oxidoreductase (Por) deletion. Figure 13A is a bar graph showing deletion by adenoviral delivery of CRE. Figure 13B is a bar graph showing by crossing of Por c / c< with Alb-Cre mice, generating an Alb-Cre / Por c / c< strain. Figure 14 depicts the deletion of murine P450 oxidoreductase by crossing Por c / c< with an Alb-Cre transgenic mouse. Figure 14A is a confocal immunostaining image showing complete Por deletion. Figure 14b is a western blot image showing Por protein liver samples from a control Porc / c mouse and three different Alb-Cre / Porc / c mice. Figure 14C is a bar graph showing qPCR of murine Por mRNA levels. Figure 15 is a bar graph showing Gefitinib metabolite M28 in feces. Figure 16 is a pair of bars graphs showing Gefitinib metabolite M28 in the (A) serum and (B) urine of hu-PIRF-2x mice and control groups. Figure 17 is a Southern blot image of targeted ESCs. Figure 17A shows the use of a 5'probe, Figure 17B shows the use of a 3' probe and Figure 17C shows the use of a neomycin probe. Figure 18 is a Western blot image showing murine Por and Gadph from PIRF mice injected with Adeno-CRE. Figure 19A-B is a Western blot image showing murine Por and Gadph from Humanized PIRF mice (a) and Por c / c< and (b) Por c / c< / Alb-CRE mice. Figure 20 is an H&E stain of liver lobe four weeks after transduction with adenovirus showing macro- and microvesicular steatosis. Left picture is a higher magnification of boxed area on right Figure 21A-B shows gene therapy vector design for liver-specific deletion by genome engineering of drug metabolizing enzymes in humanized mice. A. Two vector design: S.pyogenes Cas9 under the control of CMV promoter in an adenoviral vector (Ad), and Adeno-Associated Virus (AAV) expressing a sgRNA targeting a drug metabolizing enzyme and co-expression of GFP on the same construct. Figure 21B. Single vector design: S. aureus Cas9 and sgRNA can be delivered on the same AAV vector (4.85 kb). HA, HA-epitope. Figure 22 shows simultaneous deletion of murine P450 oxidoreductase (Por) and other murine enzymes involved in drug metabolism in humanized mice by somatic genome engineering. Humanized FRG mice (human albumin in murine serum >2 mg / ml) have been injected with Adeno-Associated Virus (AAV, serotype 8) expressing sgRNA targeting an early exon of murine Por ,UDP-glucose 6-dehydrogenase (Ugdh) or the glutathione synthetase (Gss) gene (see gene therapy vector design, figure 21). AAVs have been injected (2x10 11< GC / AAV / mouse) 1 week before injection of Adenovirus expressing Cas9 (7x10 9< pfu / Ad / mouse). Control mice have been injected with adenoviral vector only (lower row). Shown are serial sections of a representative humanized area with immunostaining for human specific Pre-ALB (transthyretin), Por, Ugdh, Gss, hALB and GFP, the latter being expressed from the AAV gene therapy vector (see gene therapy vector design, figure 21). Bar represents 50 µm. ALB, Albumin. Figure 23 shows genomic deletion of por by CRISPR / Cas9: Wild type and humanized FRG mice (human albumin in murine serum >2 mg / ml) are injected with two Adeno-Associated Virus (AAV, serotype 8) expressing sgRNA targeting consecutive early exons of murine Por as well as S. aureus Cas9(see gene therapy vector design, figure 21). AAVs are injected (2x10 11< GC / AAV / mouse). Control mice are injected with adenoviral vector expressing Cas9 only (7 x10 9< pfu / Ad / mouse). Shown are PCR amplifications of the region spanning the two nearby targeting sites. Upon CRISPR / Cas9 mediated cutting of DNA on both target sites results in a deletion of the por gene leading to a smaller PCR amplicon. Figure 24 shows humanized PIRF mouse with transgenic Alb-CRE and deletion of other murine enzymes involved in drug metabolism. Por was deleted by expression of CRE, but instead of adenoviral CRE, this PIRF mouse carries an Alb-CRE sequence within the murine genome. After humanization, mice were injected with Adeno-Associated Virus (AAV, serotype 8) expressing sgRNA targeting an early exon UDP-glucose 6-dehydrogenase (Ugdh) or the glutathione synthetase (Gss) gene (see gene therapy vector design, figure 21). AAVs are injected (2x10 11< GE / AAV / mouse) 1 week before injection of Adenovirus expressing Cas9 (7 x10 9< GE / Ad / mouse). Shown are serial sections of a representative humanized area with immunostaining for human specific Pre-ALB (transthyretin), Por, Ugdh or Gss. Bar represents 50 µm. ALB, Albumin. Figure 25A-D shows troglitazone Phase II metabolites detected in liver of humanized and non-humanized FRG mice with and without Por and Ugdh deletion. Percentage of liver glucuronidated and sulfated metabolites detected in humanized livers 2 hours after i.p injection of troglitazone (600mg / kg). Figure 25A. Humanized FRG mice. Figure 25B. Humanized FRG mice after murine Por and Ugdh deletion. Figure 25C. Non-humanized FRG mice. Figure 25D. Non-humanized FRG mice with Por and Ugdh genes deleted. Sulfate metabolites of troglitazone in red and glucuronide conjugates in blue. DETAILED DESCRIPTION OF THE INVENTION
[0014] Human liver chimeric mice have been recently introduced to predict human xenobiotic metabolism and toxicity. Despite their potential, the remaining murine liver, containing an expanded set of P450 cytochromes, makes it difficult to accurately predict human drug metabolism. Therefore, the present disclosure provides a conditional knock-out mouse of theNADPH-P450 oxidoreductase (Por) gene, which is the only electron donor for all murine cytochromes and if deleted, embryonically lethal 1< , thereby allowing a functional inactivation of all murine cytochromes.
[0015] Any mouse comprising mutations and / or transgenes that allow its liver to be repopulated with human hepatocytes may be used in combination with the conditional knock-out allele or other genomic deletion of the NADPH-P450 oxidoreductase (Por) gene. In certain aspects, the mouse comprising mutations and / or transgenes that allow its liver to be repopulated with human hepatocytes is (i) the FRG (Fah - / -< / Rag2 - / -< / Il2rg - / -< ) mouse, (ii) a transgenic uPA mouse, which overexpress urokinase type plasminogen activator (uPA) under an inducible promoter, preferably a liver- restricted albumin promoter, (iii) the TK-NOG mouse, which is a immunodeficient NOG mouse with transgenic expression of thymidine kinase under control of liver-restricted albumin promoter, (iv) a mouse expressing an inducible Caspase 8 in the liver, (v) a mouse expressing an inducible Caspase 9 in the liver or (vi) a mouse expressing human heparin-binding epidermal growth factor-like receptor (HB-EGF)-like receptors under the control of a liver cell-specific albumin promoter (alb-TRECK). Using such mice and an adenoviral or transgenic strategy expressing CRE, an almost complete deletion of the murine Por gene can be generated leading to an exclusive human cytochrome metabolism.
[0016] In the uPA-SCID mouse (Rhim et al 1994; Tateno et al. 2004), the genetic cause of mouse hepatocyte ablation is uroplasminogen activator (uPA); the mouse is in the SCID immune deficient background or Rag2 (or Rag1)- / - and / or Il2rg- / - all leading to the ability to transplant and engraft human hepatocytes.
[0017] In the FRG mouse (Azuma et al 2007 7< , Bissig et al 2007 5< ), the genetic cause of mouse hepatocyte ablation is fumarylacetoacetate hydrolase deficiency and mouse hepatocyte ablation is controlled by ± NTBC and / or ± low tyrosine diet; the mouse is in the Il2rg - / - and Rag2 - / background. The FRG mouse combines immune-deficiency-mediating mutations, in the recombination activating gene 2 (Rag2) and the gamma chain of the interleukin 2 receptor (Il2rg), with a functional knockout of the fumarylacetoacetate hydrolase (Fah) gene (Azuma et al 2007 7< , Bissig et al 2007 5< ),. The latter gene codes for an enzyme in the tyrosine catabolic pathway and its mutation leads to an intracellular accumulation of a toxic inter-mediate in hepatocytes. Unlike the uPA / SCID model, the onset and severity of hepatocellular injury in FRG mice is controllable through the administration and withdrawal of the protective drug 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3- cyclohexanedione (NTBC), which blocks an upstream enzyme in the tyrosine path-way and thereby prevents accumulation of the toxic intermediate.
[0018] In the TK-NOG mouse (Hasegawa et al 2011), the genetic cause of mouse hepatocyte ablation is the herpes simplex virus thymidine kinase and mouse hepatocyte ablation is controlled by ± ganciclovir; the mouse is in the Il2rg - / - and SCID background. Mouse hepatocyte ablation in this TK-NOG model was achieved through the liver-specific expression of the herpes simplex virus 1 thymidine kinase (HSVtk) in severely immunodeficient NOG mice and administration of ganciclovir (GCV), utilizing the fact that HSVtk converts the otherwise nontoxic GCV into a toxic intermediate.
[0019] In the AFC8 mouse (Washburn et al 2011), the genetic cause of mouse hepatocyte ablation is a FK508-capsae 8 fusion and mouse hepatocyte ablation is controlled by ± AP20187; the mouse is in the Il2rg - / - and Rag2 - / - background.
[0020] In the Alb-TRECK / SCID mouse (Zhang et al 2015), the genetic cause of mouse hepatocyte ablation is the human heparin-binding EGF-like receptor and mouse hepatocyte ablation is controlled by ± Diphtheria toxin; the mouse is in the SCID immune deficient background.
[0021] Sheer and Wilson, 2015 compares major features of various different liver humanized models and process of liver reconstitution in the most frequently used models to date.
[0022] The present disclosure also provides methods of utilizing the humanized, murine Por deficient mice to predict human drug metabolism. In an aspect, the FRG mouse and the conditional Por- / - mouse was combined to generate the PIRF (Por- / - Il2rg- / - / Rag2- / - / Fah- / -) strain, which allows repopulation with human hepatocytes. Homozygous PIRF mice are fertile and can be repopulated with human hepatocytes generating high human chimerism (>80% human).
[0023] Human p450 cytochrome clusters contain 57 putatively functional genes and 58 pseudogenes, while the mouse cytochrome clusters are greatly expanded accounting for 102 putatively functional genes and 88 pseudogenes 2< . This makes accurate prediction of human drug metabolism in the mouse challenging. In addition hepatotoxicity together with hypersensitivity / cutaneous reactions have the poorest correlation with animal studies yet are the most common reasons for toxicity related termination of drugs in clinical developments.
[0024] Since the liver is the main organ for drug metabolism, human liver chimeric mice are increasingly used for xenobiotic studies 4-6.< The shortcoming of humanized mice is the remaining murine liver tissue. It has been previously shown that even in mice that can achieve high human chimerism, the average humanization rate is 42% 7< . In order to functionally block the murine cytochrome metabolism, a conditional (floxed exon 3 and 4) knock-out of the NADPH-P450 oxidoreductase (Por) gene was generated by targeting mouse embryonic stem cells 8< (Figure 4). Injected blastocysts with properly targeted embryonic stem cells generated mice with germline transmission of the Por "knock-out first" allele 9< . Expression from the targeted Por locus using the lacZ expression cassette was confirmed in the embryo and adult liver (Figure 5). The mice were then bred with a flippase expressing strain 10< to generate a CRE recombinase conditional Por knock-out strain. Homozygous zygotes from this strain were injected with the bacterial type II Clustered Regularly-Interspaced Short Palindromic Repeats / Cas9 (CRISPR-Cas9) system 11-13< targeting simultaneous deletion of critical exons of the Il2-rg and Rag2 and Fah gene (Figure 6) to generate the PIRF strain (Figure 1A). Homozygous PIRF mice are immune deficient (T-, B- and NK-cell deficient), but healthy and fertile. Since adenoviral gene therapy vectors efficiently transduce hepatocytes in vivo, the Por gene was deleted using an adenovirus coding the CRE recombinase (Adeno-CRE). Increasing doses (2.2 x 10 8-10< per mouse) of the virus were injected intravenously into PIRF mice. Quantitative RT-PCR of the POR mRNA in liver revealed efficient deletion only at high doses (Figure 1B). Immunostaining for POR (Figure 1C) confirmed these findings, while a minimal residual signal could be detected by Western blotting even at the highest dose used (Figure 1D). POR-deleted PIRF mouse livers accumulated lipids starting two weeks after adenoviral transduction (Figure 7) similar to a previously reported liver specific Por deletion 14< .
[0025] To generate human specific P450 cytochrome metabolism, human liver chimeric mice were generated by transplanting human hepatocytes 7, 15, 16< into Por deleted PIRF mice. However, since a clonal expansion of residual Por expressing murine hepatocytes was observed in Adeno-Cre treated PIRF mice (Figure 8), some humanized PIRF (Hu-PIRF) mice were injected with an additional dose of Adeno-Cre. Immunostaining revealed that only in double injected humanized PIRF (Hu-PIRF 2x) mice an almost complete deletion of the Por gene could be achieved (Figure 2A).
[0026] Gene expression profiling was then performed comparing Hu-PIRF mice repopulated with the identical human hepatocytes with or without deletion of the Por (Figure 2B). Expression of the murine P450 cytochromes was clearly altered for half of the genes: 14 cytochromes were upregulated >1.5-fold and 18 cytochromes downregulated <0.5-fold (Figure 2c). The expression profiles of these murine cytochromes were comparable to previous work in non-humanized mice (Table 1). Table 1 shows the comparison of murine gene expression profiles of chimeric livers to previously published non-humanized mice. Gene expression of conditional (Alb-Cre) Por KO mice have been quantified by microarray analysis (Weng et al. 2005 J Biol Chem 280, 31686-31698 (2005)). Here, RNA-Seq was used to compare the gene expression (Figure 2B) in humanized livers transduced with Adeno-Cre and Adeno-GFP. Table 1 lists all previously published cytochromes with values (fold changes) compared to the herein-described data set. Multiple numbers represent multiple sets of microarray probes. Table 1: Comparison of murine gene expression profiles of chimeric livers to previously published non-humanized mice.Murine P450 Cytochromes Present Disclosure Weng et al. 2005 Change Fold (Por-deleted / Por non-deleted mice)Cyp2a41.44.5Cyp2a51.34.5Cyp2b1012.415.8 / 16.3 / 9.1Cyp2c391.81.4Cyp2c5514.617.2Cyp4a103.70.3 / 0.7Cyp7a14.63.1 / 4.9Cyp7b11.60.2 / 0.3Cyp26a16.73.5Cyp510.62.2
[0027] In the same chimeric liver, all human P450 cytochromes were down regulated upon deletion of murine Por with the exception of CYP2C18 (Figure 2D). Half of the human cytochromes were only slightly (<50%) reduced, and the other half including CYP3A4 and CYP2C19, were more significantly downregulated (>1.5-fold).
[0028] Not all human cytochromes take an important role in xenobiotic metabolism. From the 200 most transcribed drugs in the United States about three quarter are metabolized through P450 cytochromes, of which CYP3A4 / 5, 2C9, 2C19, 2D6 and 1A2 contribute to ~95% of 17< . These human cytochrome clusters were compared from chimeric livers (Hu-PIRF 2x) with the originating, isogenic primary hepatocytes after isolation from the donor liver. Expression levels were similar for most clusters and these important cytochromes robustly expressed in chimeric livers (Figure 3D).
[0029] To validate utility of Hu-PIRF mice for human drug metabolism, the xenobiotic metabolism of gefetinib 18< , an inhibitor of epidermal growth factor receptor used against lung cancer and a variety of other cancers 19< , was studied. Gefetinib is primarily metabolized by the P450 cytochrome system including CYP3A4 and 2D6. New gefetinib metabolites were recently identified and demonstrated considerable differences between human and mouse liver microsomes 20< . Gefetinib is excreted in the feces and less than 7% in the urine, irrespectively of dose, route or species 21, 22< . Therefore, the feces of non-humanized PIRF mice was analyzed for gefetinib metabolites during the first 24-hours after intravenous injection of gefetinib. Mass spectrometry revealed a reduction of several gefetinib metabolites upon deletion of the Por gene, implying a Por-dependent P450 cytochrome deficiency for these metabolites (Figure 3A). The biggest and most relevant reduction was observed for O-desmethyl gefitinib (M4, M523595), which is by far the most abundant metabolite in human feces while rodents produce many different metabolites including M4 21, 22< (Figure 3B). Therefore, the M4 metabolite was analyzed in murine Por-deleted and Por-expressing humanized and non-humanized control mice (Figure 9). The highest level of M4 could be detected in murine Por-deficient Hu-PIRF mice, where human hepatocytes preferentially metabolize gefitinib to M4 and remaining murine hepatocytes are inhibited in their drug metabolism (Figure 3C). Although murine hepatocytes preferentially produce other metabolites than M4, human specific metabolites were measured. M28 was the most abundant human metabolite, which could not be detected in the non-humanized control mice. Mass spectrometry again showed the highest level of this human specific metabolite in murine Por-deficient Hu-PIRF mice confirming a more human like metabolism in these mice (Figure 3D). Human xenobiotic metabolism was also determined with another drug, however, this time using liver homogenates of PIRF mice. Using human and mouse microsomes, it was previously demonstrated that atazanavir metabolite M15 is a predominately human metabolite (See, Li, F et al., "CYP3A-mediated generation of aldehyde and hydrazine in atazanavir metabolism." Drug Metab Dispos 39, 394-401. Mice were intravenously injected with the retroviral therapeutic and livers were harvested 30 min after injection. Results showed that M15 was 5.4-times elevated in POR-deleted humanized PIRF mice compared to non-deleted mice (Figure 3E) again confirming optimized human drug metabolism in this novel mouse model.
[0030] Identification of human metabolites using current experimental animal models is a major challenge. Nevertheless, identification of reactive metabolites is crucial since they drive human drug toxicity 23, 24< . The novel humanized mouse model of the instant disclosure inhibits murine drug metabolism without impeding on the human metabolism. Murine Por-deficient humanization can be used in combination with other repopulation models like the transgenic uPA mouse and can identify more readily human specific metabolites for a greater benefit of drug safety.
[0031] Identification of mostly human or human specific metabolites is possible with the present disclosure irrespectively of toxicity. Toxicity may be present; however this is not always the case. For instance, as shown here, gefitinib did not cause any elevation of liver enzymes, yet mainly human metabolites were identified.
[0032] The present disclosure provides a method for preparing a chimeric mouse substantially lacking murine hepatocytes and instead comprising human hepatocytes, comprising steps of: (a) providing a mouse comprising a knockout mutation in each of the Il2-rg, Rag2, and Fah genes and a floxed allele of the NADPH-P450 oxidoreductase (Por) gene with a first dose of a virus that encodes Cre recombinase, thereby producing a conditional knockout of the Por gene or the knockout of the por gene using somatic genome engineering (CRIPSR / Cas9) and gene therapy vectors in Il2-rg, Rag2, and Fah deficient mice; (b) transplanting human hepatocytes into the mouse; and (c) providing the mouse with a second dose of the virus that encodes Cre recombinase. Steps (a) and (b) can occur sequentially or simultaneously.
[0033] The conditional knock-out POR alleles can also be generated by delivering CRE recombinase in any way known in the art. Non-limiting examples of Cre recombinase delivery include viral or non-viral gene therapy vectors. In one aspect, the gene therapy vector is an adenovirus. Also considered are genetic delivery of Cre recombination, e.g., under a cell-, tissue-, or developmental-specific promoter or under an inducible promoter. Indeed, Cre recombinase can be activated in the murine liver in a transgenic animal with Cre expressed under the albumin or other liver specific promoter (Figure 11).
[0034] The present disclosure also provides a chimeric mouse, offspring thereof, or a portion thereof, which has a chimeric liver comprising human hepatocytes. Preferably, the chimeric mouse, offspring thereof or a portion thereof is prepared by the methods of the present disclosure. The chimeric mouse can be immunodeficient.
[0035] In the present disclosure, examples of the chimeric mouse include portions of the mouse. The term "a portion(s) of the mouse" refers to, mouse-derived tissues, body fluids, cells, and disrupted products thereof or extracts therefrom, for example (the examples thereof are not particularly limited to them). Examples of such tissues include, but are not particularly limited to, heart, lungs, kidney, liver, gallbladder, pancreas, spleen, intestine, muscle, blood vessel, brain, testis, ovary, uterus, placenta, marrow, thyroid gland, thymus gland, and mammary gland. Examples of body fluids include, but are not particularly limited to, blood, lymph fluids, and urine. The term "cells" refers to cells contained in the above tissues or body fluids, and examples thereof include cultured cells, sperm cells, ova, and fertilized eggs obtained by isolation or culture thereof. Examples of cultured cells include both primary cultured cells and cells of an established cell line. Examples of the portions of the mouse also include tissues, body fluids, and cells at the developmental stage (embryonic stage), as well as the disrupted products or extracts thereof. In addition, an established cell line from the mouse of the present disclosure can be established using a known method (Primary Culture Methods for Embryonic Cells (Shin Seikagaku Jikken Koza (New Biochemical Experimental Lecture Series), Vol. 18, pages 125-129, TOKYO KAGAKU DOZIN CO., LTD., and Manuals for. Mouse Embryo Manipulation, pages 262-264, Kindai Shuppan)).
[0036] The mouse of the present disclosure can be an immunodeficient mouse. The immunodeficient mouse of the present disclosure can be used as a host mouse for transplantation of human hepatocytes. Examples of the "immunodeficient mouse" may be any mouse that does not exhibit rejection against hepatocytes (in particular, human hepatocytes) from a different animal origin, and include, but are not limited to, SCID (severe combined immunodeficiency) mice exhibiting deficiency in T- and B-cell lines, mice (NUDE mice) that have lost T cell functions because of genetic deletion of the thymus gland, and mice (RAG2 knockout mice) produced by knocking out the RAG2 gene by a known gene targeting method (Science, 244: 1288-1292, 1989).
[0037] Moreover, the present disclosure provides a chimeric mouse having human hepatocytes. The chimeric mouse of the present disclosure can be immunologically deficient. The chimeric mouse of the present disclosure can be prepared by transplanting human hepatocytes into an immunodeficient mouse of the present disclosure.
[0038] As human hepatocytes to be used for transplantation, human hepatocytes isolated from normal human liver tissue by a conventional method such as a collagenase perfusion method can be used. The thus separated hepatocytes can also be used by thawing after cryopreservation. Alternatively, the chimeric mouse hepatocytes, which are defined as the human hepatocytes separated by a technique such as a collagenase perfusion method from a chimeric mouse liver, in which mouse hepatocytes have been replaced by human hepatocytes, can be used in a fresh state, and the cryopreserved chimeric mouse hepatocytes are also available after thawing.
[0039] Such human hepatocytes can be transplanted into the liver via the spleen of a mouse of the present disclosure. Such human hepatocytes can also be directly transplanted via the portal vein. The number of human hepatocytes to be transplanted may range from about 1 to 2,000,000 cells and preferably range from about 200,000 to 1,000,000 cells. The gender of the mouse of the present disclosure is not particularly limited. Also, the age on days of the mouse of the present disclosure upon transplantation is not particularly limited. When human hepatocytes are transplanted into a young mouse (early weeks of age), human hepatocytes can more actively proliferate as the mouse grows. Hence, about 0- to 40-day-old mice after birth, and particularly about 8- to 40-day-old mice after birth are preferably used.
[0040] The transplanted human hepatocytes account for any percentage of human chimerism greater than about 1%, for example at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of all hepatocytes in the chimeric liver of the chimeric non-human animal.
[0041] The present disclosure further provides a method for screening for a substance that affects human liver functions, with the use of the chimeric mouse of the present disclosure. An example of the method is an evaluation method comprising the following steps of: (a) administering a test substance to the chimeric mouse of the present disclosure; (b) measuring one or more values in the chimeric mouse to which the test substance is administered in (a); and (c) selecting a test substance that causes an increase or an decrease in one or more values measured in (b), compared with the one or more values of the chimeric mouse to which no test substance is administered.
[0042] Preferably, the one or more values are selected from the group consisting of the human albumin concentration, the body weight curve, the liver-weight-to-body-weight ratio, the total albumin level, the total protein level, the ALT level, the AST level, and the total bilirubin level, histological assessment for toxicity in the human and non-human organs.
[0043] Examples of the "test substance" in the method of the present disclosure are not particularly limited and include natural compounds, organic compounds, inorganic compounds, proteins, antibodies, peptides, and single compounds such as an amino acid, and nucleic acids, as well as compound libraries, expression products from gene libraries, cell extracts, cell culture supernatants, products of fermenting microorganisms, extracts from marine creatures, plant extracts, extracts from prokaryotic cells, extracts from eukaryotic single cells, and extracts from animal cells. These products may be purified products or crude products such as plant, animal, or microbial extracts. Also, a method for producing a test substance is not particularly limited. A test substance to be used herein may be a substance isolated from a natural product, synthesized chemically or biochemically, or prepared by genetic engineering techniques.
[0044] The above test substance can be adequately labeled and then used as necessary. Examples of labels include radiolabels and fluorescent labels. Examples of the test substance include, in addition to the above test samples, mixtures of a plurality of types of these test samples.
[0045] Examples of test samples include and are not limited to feces, urine, blood (and any blood product, e.g., whole blood, serum, and plasma), and tissue, e.g., liver tissue. Liver tissue may be derived from a sample of a liver (e.g., a biopsy or explant) or may be derived from a whole, intact liver, e.g., that has been harvested after a mouse has been sacrificed.
[0046] Examples of a method for administering a test substance to mice are not particularly limited. Such an administration method can be adequately selected from among oral administration or parenteral administration such as subcutaneous, intravenous, local, transdermal, and enteral (intrarectal) administration, depending on the type of a test substance to be administered.
[0047] The present disclosure further provides a method for evaluating hepatotoxicity of a test substance against human hepatocytes, with the use of the chimeric mouse of the present disclosure. An example of this method is an evaluation method comprising the following steps of: (a) administering a test substance to the chimeric mouse of the present disclosure; (b) measuring one or more values in the chimeric mouse to which the test substance is administered in (a); and (c) evaluating the effect of the test substance on human hepatocytes using one or more indicators measured in (b), compared with the one or more indicators of the chimeric mouse to which no test substance is administered.
[0048] Preferably, the one or more values are selected from the group consisting of the human albumin concentration, the body weight curve, the liver-weight-to-body-weight ratio, the total albumin level, the total protein level, the ALT level, the AST level, and the total bilirubin level. Preferably, the one or more indicators are selected from the group consisting of an increase or a decrease in any one or more of the human albumin concentration, the body weight curve, the liver-weight-to-body-weight ratio, the total albumin level, the total protein level, the ALT level, the AST level, and the total bilirubin level.
[0049] A human nucleic sequence encoding an exemplary Por gene of the disclosure consist or comprises, Genbank Accession number: NM_000941.2:
[0050] The corresponding human amino acid sequence encoding an exemplary Por gene of the disclosure consist or comprises, Genbank Accession number: NP_000932.3:
[0051] A murine nucleic sequence encoding an exemplary Por gene of the disclosure consist or comprises, Genbank Accession number: NM_008898.2:
[0052] The corresponding murine amino acid sequence encoding an exemplary Por gene of the disclosure consist or comprises, Genbank Accession number: NP_032924.1:
[0053] A human nucleic sequence encoding an exemplary II2-rg gene of the disclosure consist or comprises, Genbank Accession number: NM_000206.2:
[0054] The corresponding human amino acid sequence encoding an exemplary II2-rg gene of the disclosure consist or comprises, Genbank Accession number: NP_000197.1:
[0055] A murine nucleic sequence encoding an exemplary II2-rg gene of the disclosure consist or comprises, Genbank Accession number: NM_013563.4:
[0056] The corresponding murine amino acid sequence encoding an exemplary II2-rg gene of the disclosure consist of, Genbank Accession number: NP_038591.1:
[0057] A human nucleic sequence encoding an exemplary Rag2 gene of the disclosure consist or comprises, Genbank Accession number: NM_000536.3:
[0058] The corresponding human amino acid sequence encoding an exemplary Rag2 gene of the disclosure consist or comprises, Genbank Accession number: NP_000527.2:
[0059] A murine nucleic sequence encoding an exemplary Rag2 gene of the disclosure consist or comprises, Genbank Accession number: NM_009020.3:
[0060] The corresponding amino acid sequence encoding an exemplary Rag2 gene of the disclosure consist or comprises of gene consist of, Genbank Accession number: NP_033046.1:
[0061] A human nucleic sequence encoding an exemplary Fah gene of the disclosure consist or comprises of gene consist of, Genbank Accession number: NM_000137.2:
[0062] The corresponding human amino acid sequence encoding an exemplary Fah gene of the disclosure consist or comprises of gene consist of, Genbank Accession number: NP_000128.1:
[0063] The corresponding murine amino acid sequence encoding an exemplary Fah gene of the disclosure consist or comprises of gene consist of, Genbank Accession number: NP_034306.2:
[0064] The following examples are provided to better illustrate the claimed disclosure.EXAMPLESExample 1: Generation of the Por-floxed mouse strain
[0065] Por knock-out first targeting vector was purchased from the National Institutes of Health (NIH) Knock-Out Mouse Program (KOMP) (Figure 4A). The vector was linearization with the AsisI restriction enzyme, and DNA was electroporated into Jm8A3 mouse embryonic stem cells (ESC) (Pettitt, S.J. et al. "Agouti C57BL / 6N embryonic stem cells for mouse genetic resources." Nat Methods 6, 493-495 (2009)) by the Mouse Embryonic Stem Cell Core at Baylor College of Medicine. Integrated clones were selected using neomycin resistance. DNA of ESC clones was digested with NSiI restriction enzyme and screened for site specific integration by Southern blotting using DIG nonisotopic detection system (Roche Applied Biosciences) following the manufacturer's instructions (full blots in Figure 17). The 500bp-size 5' and 3' probes that bind outside the vector's homology arms were synthesized using the following set of primers. 5' POR Fw2 GGCCTCAGAGAGGACATAGTGCCC (SEQ ID NO:1) 5' POR Rev2 GCCCTCTGGTGTCAGGTCCC (SEQ ID NO:2) 3' POR Fw2 CCTCACGCAGCTTAATGTGGCC (SEQ ID NO:3) 3'POR Rev2 GGAAGTTAAGGACGTGATTACAGGGAGC (SEQ ID NO:4)
[0066] Correctly targeted ESCs cells were injected into C57 / BL blastocysts by the Genetically Engineered Mouse Core at Baylor College of Medicine. The male chimeras were bred with C57 / BL albino females (Taconic) to access germline transmission of targeted ESC. To remove the FRT-flanked LacZ and the neomycin cassette and generate a conditional POR knock-out strain, the mice were crossed with a Rosa26- FLPe strain (Farley, F.W., Soriano, P., Steffen, L.S. & Dymecki, S.M. "Widespread recombinase expression using FLPeR (flipper) mice." Genesis 28, 106-110 (2000)). Genotyping was performed by Transnetyx (Cordova, TN).Example 2: X-Gal staining
[0067] Embryos and fresh liver sections were fixed in 4% PFA for 1hour at 4°C and washed 2x30min in X-Gal rinse buffer (PBS 1x with 0.02% Igepal and 0.01% deoxycholate) followed by overnight incubation with X-Gal staining solution (PBS 1x with 5mM K3Fe(CN)6, 5mM K4Fe(CN)6, 0.02% Igepal, 0.01% deoxycholate, 2mM MgCl2, 5mM EGTA and 1mg / ml of fresh X-Gal). Samples were post-fixed overnight in 4% PFA at4°C.Example 3: Generating of the PIRF (Por c / < c< - / Il2rg- / - / Rag2- / - / Fah- / -) mouse strain
[0068] Six gRNA sequences targeting critical exons of the Rag2, Il2-rg or Fah gene were selected (Figure 1A, Figure 6 and Figure 7) using two different online tools (crispr.mit.edu and COSMID) (Cradick, T.J., Qiu, P., Lee, C.M., Fine, E.J. & Bao, G. "COSMID: A Web-based Tool for Identifying and Validating CRISPR / Cas Off-target Sites." Molecular therapy. Nucleic acids 3, e214 (2014)). Complementary oligonucleotides were annealed and ligated into the DR274 vector (Addgene plasmid # 42250) (Hwang, W.Y. et al. "Efficient genome editing in zebrafish using a CRISPR-Cas system." Nat Biotechnol 31, 227-229 (2013)) using standard molecular cloning techniques with the restriction enzyme BsaI (NEB) and T4 DNA Ligase (NEB). A T7 bacterial promoter sequence was inserted into the pX330-U6-Chimeric_BB-CBh-hSpCas9vector (Addgene plasmid # 42230) (Cong, L. et al. "Multiplex genome engineering using CRISPR / Cas systems." Science 339, 819-823 (2013)) upstream of the Cas9 transcription start site using standard molecular cloning techniques. DR274 vectors were cut using DraI (NEB) and gel purified using the Zymoclean Gel DNA Recovery Kit (Zymo, Cat#11-301). In vitro transcription of sgRNA was performed using the MEGAshortscript T7 Transcription Kit (Life Technologies, AM1354), according to manufacturer's instructions. The resulting RNA was purified using the RNA Clean & Concentrator-5 (Zymo, R1015) and eluted in RNAse-free water. Synthesis was verified by polyacrylamide gel electrophoresis. pX330 (with T7 promoter) was digested with NcoI and NotI, and gel purified. Cas9 mRNA was synthesized from the digested pX330-T7 vector using the mMessage mMachine T7 ULTRA Kit (life tech AM1345), according to the manufacturer's protocol. Poly-adenylation was verified by denaturing agarose gel electrophoresis (1% agarose and 6.6% formaldehyde in MOPS buffer).
[0069] Zygotes from Por c / c mice were injected with S. pyogenes Cas9 mRNA (60ng / ul) and the six gRNA (15ng / uL each). All viable zygotes were implanted into 3 pseudopregnant females. To detect the deleted regions all twenty-three pups were genotyped after weaning using the following primers: Fah Fw CTGGGTTGCATACTGGTGGG (SEQ ID NO:5) Fah Rev AAACAGGGTCTTTGCTGCTG (SEQ ID NO:6) Fah Int Fw ACAAAGGTGTGGCAAGGGTT (SEQ 1D NO:7) Il2 Fw CCACCGGAAGCTACGACAAA (SEQ ID NO:8) Il2 Rev GGGGGAATTGGAGGCATTCT (SEQ ID NO:9) Il2 Int Rev CTTCTTCCCGTGCTACCCTC (SEQ ID NO: 10) Rag2 Fw CCTCCCACCTCTTCGTTATCC (SEQ ID NO: 11) Rag2 Rev AGTCTGAGGGGCTTTTGCTA (SEQ ID NO:12) Rag2 Int Fw AGTCTGAGGGGCTTTTGCTA (SEQ ID NO:13) Further offspring genotyping was performed by Transnetyx (Cordova, TN). Example 4: Humanization of PIRF mice
[0070] Hepatocytes (3x10 6< / mouse) were transplanted into the murine liver of PIRF mice by splenic injections as originally described for mouse hepatocytes (Ponder, K.P. et al. "Mouse hepatocytes migrate to liver parenchyma and function indefinitely after intrasplenic transplantation." Proc Natl Acad Sci U S A 88, 1217-1221 (1991)). In brief, the abdominal cavity was opened by a midabdominal incision, and 3x10 6< human hepatocytes in a volume of 100 µl PBS were injected into the spleen. Immediately after transplantation, selection pressure towards transplanted human hepatocytes was applied by withdrawing the drug nitisinone (NTBC) from the drinking water in the following steps: 2 days at 25%, then 2 days at 12% and eventually 2 days at 6% of the colony maintenance dose (100% = 7.5mg / l) prior to discontinuing the drug completely (Bissig, K.D. et al. "Human liver chimeric mice provide a model for hepatitis B and C virus infection and treatment." The Journal of clinical investigation 120, 924-930 (2010)). Mice with clinical symptoms (hunched posture, lethargy, weight loss, etc) were put back on 100% nitisinone for a few days before once again being weaned off the drug as described above. In order to determine the extent of human chimerism, human albumin (ELISA, Bethyl laboratories) in the murine blood, having previously shown that human albumin levels correlate with the level of human chimerism assessed by immunostaining of human hepatocytes was measured (Bissig, K.D. et al. (2010)). Only mice with a human chimerism >70% were further used. Where indicated, some PIRF mice were injected intravenously with 100 µl Adenovirus coding CRE recombinase under the CMV promoter (Ad5 CMV-Cre, 2.3x10 11< pfu / ml, provided by the Vector Development Laboratory at Baylor College of Medicine) either 24-hours before hepatocyte transplantation and / or when reaching high human chimerism (>70%). Available hepatocyte donor information is given in Table 2. All animal experiments were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee (IACUC). All animals used for humanization (including controls) were female, due to fewer postsurgical complications.Example 5: qPCR
[0071] Total mRNA was isolated from fresh frozen tissue samples using Purelink RNA mini kit (Invitrogen). 2µg of total mRNA was reverse transcribed using the qScript cDNA supermix (Quanta Biosciences) and 20ng of cDNA was used for the qPCR reactions, performed with Perfecta SYBR Green Fast Mix (Quanta Biosciences) and analyzed on ABI Prism 7900HT Sequence Detection System (Applied Biosciences). The following primers were used for Por mRNA amplification of PIRF mouse samples: mPor Fw2 GGCCCCACCTGTCAAAGAGAGCAGC (SEQ ID NO: 14) mPor Rev1: CAAACTTGACACCCGTGAGGTCC (SEQ ID NO:15)
[0072] For humanized PIRF mouse liver samples, mouse Por and human POR were amplified using the following set of primers: mPor Fw1: TCTATGGCTCCCAGACGGGAACC (SEQ ID NO:16) mPor Rev2: CCAATCATAGAAGTCCTGCGCG (SEQ ID NO: 17) hPOR Fw1: CCAATCATAGAAGTCCTGCGCG (SEQ ID NO: 18) hPOR Rev5: ACCTTGGCCGCATCTATGTCGG (SEQ ID NO: 19)
[0073] Each sample was normalized to Gapdh / GADPH as an internal control gene using the following primers: mGapdh Fw AGAACATCATCCCTGCATCCA (SEQ ID NO:20) mGapdh Rev CAGATCCACGACGGACACATT (SEQ ID NO:21) hGAPDH Fw: CAGAACATCATCCCTGCCTCTAC (SEQ ID NO:22) GAPDH Rev: TTGAAGTCAGAGGAGACCACCTG (SEQ ID NO:23) Example 6: RNA-Seq libraries
[0074] Whole-transcriptome RNA sequencing (RNA-Seq) was performed using total RNA extracted from fresh-frozen liver tissue sampled from all seven liver lobes. Total RNA was isolated using the Purelink RNA mini kit (Invitrogen). Libraries were generated from total RNA according to the manufacturer's recommendation using the TrueSeq Stranded mRNA LT kit (Illumina). The libraries were sequenced on a NextSeq 500 sequencer. The average read per sample was 17 millions. RNA-Seq TPM expression values were calculated with RSEM 52< (version 1.2.17) using the read aligner Bowtie2 53< applied to the combined human and mouse NCBI Refseq (3 / 21 / 16) transcriptomes. RNA sequencing data is available from European Nucleotide Archive, ENA accession PRJEB14714. Low-abundance cytochromes (human < 20 TPM and mouse < 20 TPM) were only compared if one of the experimental groups reached >20TPM. Gene expression has been normalized to three human housekeeping genes and their murine counterparts (PSMB2, PSMB4, RAB7A and VPS2929; Psmb2, Psmb4, Rab7 and Vps29) 54< . RNA-Seq data is available from European Nucleotide Archive, ENA accession code PRJEB14714Example 7: Western blot
[0075] Western blotting was performed as described previously (Bissig-Choisat, B. et al. "Development and rescue of human familial hypercholesterolaemia in a xenograft mouse model." Nature communications 6, 7339 (2015)). Tissue from snap frozen liver was homogenized in RIPA buffer (Sigma, cat# R0278-50ml) containing proteases inhibitors (Roche, cat# 04693159001). 30µg of total protein was electrophoresed in a NuPAGE 4-12% Bis Tris Gel (Invitrogen, cat# NP0336BOX) and transferred to a PVDF membrane (Millipore, cat# IPVH00010). The blot was then blocked in 5% milk, followed by primary antibody incubation. Rabbit anti-Por (Abcam cat# ab13513) or mouse anti-β-actin (Sigma cat# A1978) were diluted 1:1,000 and 1:3,000, respectively (full blots in Figure 18 and Figure 19). Secondary antibodies were donkey anti-rabbit IgG / HRP and donkey anti-mouse IgG / HRP (Jackson Immunoresearch Labs, cat# 711-035-152 and 711-035-150) used at 1:10,000 and 1:50,000, respectively. The membrane was imaged using Amersham ECL Western Blotting Detection Reagent (General Electric Healthcare Life Sciences, cat# RPN2106).Example 8: Immunohistochemistry
[0076] 10 µm sections from cryopreserved tissue blocks were fixed with 3% PFA for 15 minutes and incubated overnight at 4°C with the following primary antibodies: anti-Por (Abcam, cat# ab13513) diluted 1:500, anti-human Nuclei (EMD Millipore, cat# MAB1281) diluted 1:250 in PBS containing 0.2% TritonX-100 and 0.5% BSA. Secondary antibodies (1:1,000 Alexa-fluor conjugated, Molecular Probes) were incubated for 60 min at room temperature in the same buffer. Sections were mounted with Vectashield plus DAPI (Vector Labs).Example 9: Mouse Husbandry
[0077] All mice (6-10 months old, humanized or non-humanized) were maintained under a standard 12-h dark / light cycle with water and chow provided ad libitum. All animal experiments were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee (IACUC).Example 10: Sample preparation for mass spectrometry
[0078] One group of mice was treated (i.v.) with gefitinib (10 mg / kg) and housed separately in metabolic cages for 16 h feces collection. Feces samples were weighted and homogenized in water (100 mg feces in 1,000 µl of H 2 O). Subsequently, 300 µl of methanol was added to 100 µl of the resulting mixture, followed by centrifugation at 15,000 g for 20 min. The supernatant was transferred to a new Eppendorf vial for a second centrifugation (15,000 g for 20 min). The final concentration of agomelatine is 2 µM. Each supernatant was transferred to an auto sampler vial for analysis (described below).
[0079] For atazanavir metabolism in liver, liver samples were harvested 30 min after the treatment of atazanavir (i.v., 30 mg / kg). Briefly, livers were weighted and homogenized in water / MeOH with the internal standard agomelatine [100 mg liver in 300 ul of H 2 O / MeOH (v / v 3:1)]. Subsequently, 300 µl of methanol was added to 100 µl of the resulting mixture, followed by centrifugation at 15,000 g for 20 min. The supernatant was transferred to a new Eppendorf vial for a second centrifugation (15,000 g for 20 min). The final concentration of agomelatine is 2 µM in samples. Each supernatant was transferred to an auto sampler vial. Five µl of each prepared sample was injected to a system combining ultra-high performance liquid chromatography (UHPLC) and quadruple time-of-flight mass spectrometry (QTOFMS) for analysis.Example 11: Mass spectrometry (UHPLC-QTOFMS analyses)
[0080] Metabolites from gefitinib and atazanavir were separated using a 1260 Infinity Binary LC System (Agilent Technologies, Santa Clara, CA) equipped with 100 mm x 2.7 mm (Agilent XDB C18) column. The column temperature was maintained at 40 °C. The flow rate of was 0.3 mL / min with a gradient ranging from 2% to 98% aqueous acetonitrile containing 0.1% formic acid in a 15-min run. Quadrupole time of flight mass spectrometry (QTOFMS) was operated in positive mode with electrospray ionization. Ultra-highly pure nitrogen was applied as the drying gas (12 L / min) and the collision gas. The drying gas temperature was set at 325 °C and nebulizer pressure was kept at 35 psi. The capillary voltages were set at 3.5 kV. During mass spectrometry, real time mass correction and accurate mass were achieved by continuously measuring standard reference ions at m / z 121.0508, 922.0098 in the positive mode. Mass chromatograms and mass spectra were acquired by MassHunter Workstation data Acquisition software (Agilent, Santa Clara, CA) in centroid and profile formats from m / z 50 to 1000. The acquisition rate was set as 1.5 spectra per second. The method used in this study has been validated by the previous study of gefitinib metabolism in human liver microsomes 39< . Meanwhile, the quality control samples were performed every 10 samples in the process of the sample running. Due to the authentic compounds of metabolites not available, the metabolite identification was based on their exact mass and MS / MS fragments. The chromatograms and relative abundance of metabolite were performed on Qualitative Analysis software (Agilent, Santa Clara, CA). The relative abundance was evaluated based on integrated peak area of each metabolite.Example 12: Statistics
[0081] Sample sizes for experiments were determined by estimated differences between groups and availability of highly humanized mice. No randomization of animals before allocation to experimental groups nor blinding of experimental groups was done. Statistical analysis was performed using PRISM version 6.0 software (Graph Pad software) using Mann-Whitney test, or ANOVA. Statistical significance was assumed with a p-value <0.05 (*). Bars in graphs represent mean ±SEM unless noted otherwise. Group size (N) represents biological sample size.Example 13: Generation of novel mouse model for hepatocyte repopulation
[0082] In order to functionally block murine cytochrome metabolism, conditional (floxed exon 3 and 4) knock-out of the NADPH-P450 oxidoreductase (Por) gene by targeting mouse embryonic stem cells 28< was generated (Figure 4). Injected blastocysts with properly targeted embryonic stem cells produced chimeras with germline transmission of the Por "knock-out first" allele 29< . Expression from the targeted Por locus using the lacZ expression cassette in the embryo and adult liver was confirmed (Figure 5). Next mice were bred with a flippase-expressing strain 30< to generate a CRE recombinase conditional Por knock-out strain (Por c / c< ). Homozygous zygotes from this strain were injected with the bacterial type II Clustered Regularly-Interspaced Short Palindromic Repeats / Cas9 (CRISPR-Cas9) system 31,32,33< targeting simultaneous deletion of critical exons of the Il2-rg, Rag2, and Fah genes (Figure 6 and Figure 7) to generate the PIRF strain (Figure 1A). Homozygous PIRF mice are thus immune-deficient, lacking T, B and NK cells, but are healthy and fertile. Since adenoviral gene therapy vectors efficiently transduce hepatocytes in vivo, the Por gene was deleted using an adenovirus coding the CRE recombinase (Adeno-CRE). Increasing doses (2.2 x 10 8-10< per mouse) of the virus were injected intravenously into PIRF mice. Quantitative RT-PCR of the Por mRNA in liver revealed efficient deletion only at high doses of adenovirus (Figure 1B). Immunostaining for Por (Figure 1C) confirmed these findings, although a minimal residual signal could be detected by Western blotting even at the highest dose used (Figure 1D). Por-deleted PIRF mouse livers accumulated lipids starting about two weeks after adenoviral transduction (Figure 2), but in contrast to the immune competent Alb-Cre / Por c / c< strain 25, 27< , without infiltration and lacking necrosis (Figure 20). Nevertheless, residual Por expressing hepatocytes had a growth advantage over the lipid-rich Por-deleted hepatocytes, and clonal expansion of a few Por expressing cells could be detected four weeks after adenoviral transduction by immunostaining (Figure 9).Example 14: Characterization of humanized PIRF mice
[0083] Human liver chimeric mice using the PIRF strain were generated 5, 20, 34< . To ensure cytochrome P450 metabolism would be human-specific, we injected Adeno-Cre (2.3x10 10< pfu / mouse) before human hepatocyte transplantation and an additional dose of Adeno-Cre in some highly humanized PIRF (Hu-PIRF) mice. Immunostaining revealed that an almost complete deletion of the Por gene could be achieved only in double-injected humanized PIRF (Hu-PIRF 2x) mice (Figure 2A). Quantitative PCR and Western blotting corroborated the massive reduction of murine Por upon adenoviral delivery of CRE (Figure 12). Gene expression profiling was performed to compare PIRF mice repopulated with human hepatocytes (Hu-PIRF) that were injected with either Adeno-CRE (Hu-PIRF 2x) or Adeno-GFP (Figure 2B). Both groups were repopulated with human hepatocytes from the same hepatocyte donors (Table 2) to avoid inter-individual variations. Table 2: Characteristics of human hepatocyte donors used in the present disclosure. Hepatocyte Age* Gender Race BMI Cause of death Usage in present study #1 24 Male African American 20.3 Anoxia RNAseq (chimeric mice, hepatocytes) #2 2 Female African American 19.6 Head trauma RNAseq (chimeric mice, hepatocytes) #3 45 Female Caucasian 20.8 Anoxia RNAseq (Chimeric mice) #4 1.2 Female Caucasian 20.8 Head trauma Gefetinib metabolites #5 18 Male Caucasian 24.3 Cardiovascular ATV metabolites * in years
[0084] Expression of the murine P450 cytochromes was clearly altered for 27 out 38 genes analyzed after Por deletion (Figure 2C): 24 cytochromes were significantly upregulated (1.5-12.5-fold) and 3 cytochromes significantly downregulated (0.5-0.3-fold). The expression profiles of these murine cytochromes were by in large comparable to those from previous work in non-humanized, Por-deficient mice (Table 1) 35< . In the human part of the same chimeric liver, human P450 cytochromes were less altered upon deletion of murine Por (Figure 2D). Half of the human cytochromes were only slightly altered (0.5-1.5-fold change), while the other half were moderately upregulated (1.5-2.4-fold).
[0085] Not all human cytochromes serve an important role in xenobiotic metabolism. From the 200 most-prescribed drugs in the United States, about three-quarter are metabolized through P450 cytochromes, of which CYP3A4 / 5, 2C9, 2C19, 2D6 and 1A2 contribute to ~95% 36< . Comparing these human cytochrome clusters from chimeric livers (Hu-PIRF 2x) with the originating, isogenic primary hepatocytes. For this comparison, two donor hepatocytes (Table 2) and the corresponding human (isogenic) liver chimeric mice (N=6). Expression levels were similar for most clusters, and these important cytochromes were all robustly expressed in chimeric livers (Figure 2E). Interestingly, some human clusters (CYP1A2, CYP2B6, CYP2C19 and CYP3A4) were expressed at even higher levels in the chimeric liver than in primary human hepatocytes.Example 15: Xenobiotic metabolism of humanized PIRF mice
[0086] To validate Hu-PIRF mice for human drug metabolism, xenobiotic metabolism of gefitinib 37< , an inhibitor of epidermal growth factor receptor used against lung cancer and a variety of other neoplasia was used 38< . Gefitinib is metabolized primarily by the P450 cytochrome system, including CYP3A4 and 2D6.Gefitinib metabolites demonstrate considerable differences between human and mouse liver microsomes 39< , but regardless of dose, route or species, gefitinib is excreted primarily in the feces (less than 7% in the urine) 40, 41< . The feces of non-humanized PIRF mice for gefitinib metabolites during the first 24 hours after intravenous injection of gefitinib was then analyzed.
[0087] Mass spectrometry revealed a reduction of several gefitinib metabolites upon deletion of the Por gene, implying a Por-dependent P450 cytochrome deficiency for these metabolites (Figure 3A and Figure 13A). Since some metabolites were not significantly altered, the possibility that residual Por activity was responsible for persistent murine P450 cytochrome metabolism system was tested. The Por c / c< strain was crossed with a transgenic mouse that expresses CRE under the Albumin promoter. Por protein in the liver of Alb-CRE / Por c / c< animals was efficiently deleted (Figure 14); nevertheless, the metabolite profile formed after gefitinib injection was comparable to that of PIRF mice with adenoviral deletion of Por (Figure 13). This result similarity indicates that gefitinib has both P450-dependent and -independent drug metabolism.
[0088] The biggest and most relevant reduction was observed for O-desmethyl gefitinib (M4, M523595), which is by far the most abundant metabolite in human feces. Rodents produce many different metabolites in addition to M4 40, 41< (Figure 3B), so the M4 metabolite in murine Por-deleted and Por-expressing humanized and non-humanized control mice was analyzed (Figure 10). The highest levels of M4 were detected in murine Por-deficient Hu-PIRF mice, where human hepatocytes preferentially metabolize gefitinib to M4 and the remaining murine hepatocytes are inhibited in their drug metabolism were used (Figure 3C). Next, to measure other human-specific metabolites. The most abundant human metabolite was M28, which could not be detected at all in non-humanized control mice. Mass spectrometry again showed the highest level of this human-specific metabolite in murine Por-deficient Hu-PIRF mice (Figure 3D and Figure 15), confirming that these mice showed liver metabolism more similar to humans.
[0089] The Por-deficient Hu-PIRF mouse is a novel model system for drug metabolism studies, and therefore was used to analyze different body compartments, e.g. the serum (one hour after injection) and the urine for these key gefitinib metabolites. M4 could not be detected in the urine and was massively reduced (23-fold in Hu-PIRF mice) in the serum, while M28 was detectable at lower concentrations in both the urine and the serum of Hu-PIRF mice (Figure 16A and Figure 16B). Although present at lower levels in both compartments, M28 mirrored relative abundance observed in feces (Figure 3C). These findings confirm that gefitinib metabolites are primarily excreted trough the feces 40, 41< .
[0090] To confirm human xenobiotic metabolism using liver homogenates of PIRF mice. Atazanavir, an antiretroviral drug (protease inhibitor) for treatment of human immunodeficiency virus was tested. Previous studies in human and mouse microsomes demonstrated that atazanavir metabolite M15 is a predominant human metabolite 42< . To determine levels of M15 in humanized PIRF mice, PIRF mice were intravenously injected with atazanavir and their livers harvested, 30 min after injection. M15 levels in Por-deleted humanized PIRF mice were 5.4 times greater than those observed in non-deleted mice (Figure 3E), again indicating that these mice metabolize drugs as humans do.Example 16: Deletion of the UDP-glucose 6-dehydrogenase (UGDH)
[0091] Deletion of the UDP-glucose 6-dehydrogenase (UGDH) leads to depletion of UDP-glucuronate, which is the substrate of all UDP-glucuronosyl transferases (UGT). UGTs glucuronidate lipophilic drugs in the liver (phase II) and thereby contribute to biotransformation of drugs in the liver; glucuronidated drugs are more polar (hydrophilic) and more easily excreted. Deletion of UGDH is embryonically lethal and therefore needs to be deleted conditionally or by somatic genome engineering, similar to POR. Troglitazone was developed as an antidiabetic drug but withdrawn from the market due to hepatotoxicity. Interestingly, mice and humans metabolize the drug differently, meaning that humans mainly generate sulfate metabolites (main circulating metabolites) while glucuronide conjugates of troglitazone are less prevalent in humans. In contrast to mice, which generate mostly glucuronide conjugates. Hence troglitazone offers an opportunity to validate effectiveness of the approach to inhibit UDP-glucuronosyl transferases (UGT) by deletion of UDP-glucose 6-dehydrogenase (UGDH) in human liver chimeric mice in addition to the Por deletion and humanization.
[0092] Glutathione synthetase (GSS) catalyzes the second step of glutathione biosynthesis. Glutathione is the substrate of Gluthatione S-transferases (GST), which conjugates the molecule to lipophilic drugs (phase II) and thereby contribute to biotransformation of drugs in the liver.
[0093] Somatic genome engineering is used to simultaneously delete murine P450 oxidoreductase (Por) and other murine enzymes involved in drug metabolism in humanized mice. Humanized FRG mice (human albumin in murine serum >2 mg / ml) are injected with Adeno-Associated Virus (AAV, serotype 8) expressing sgRNA targeting an early exon of murine Por ,UDP-glucose 6-dehydrogenase (Ugdh) or the glutathione synthetase (Gss) gene (see gene therapy vector design, Figure 21). AAVs are injected (2x10 11< GC / AAV / mouse) 1 week before injection of Adenovirus expressing Cas9 (7 x10 9< pfu / Ad / mouse). Control mice are injected with adenoviral vector only (Figure. 22, lower row). Results show a deletion of murine por, as well as ugdh and gss genes. The knockdown by CRISPR / Cas9 of the murine por in humanized mice is substantial but not quite as efficient as the knockdown observed with the loxP / CRE system when looking at the DNA (Figure. 23) and protein levels (Figure. 22). Also, the por deletion particularly in FRG mice is independent of the deletion of the other two genes (ugdh and gss), since their sgRNA (targeting molecule) are all on different AAV vectors. However, immunostaining (Figure. 22) demonstrated that substantial amounts of cells had deletion of por and gss (Figure 22), while the deletion of ugdh was less efficient.
[0094] Humanized PIRF mouse with transgenic Alb-CRE and deletion of other murine enzymes involved in drug metabolism are used. Por is deleted by expression of CRE, but instead of adenoviral CRE, this PIRF mouse carries an Alb-CRE sequence within the murine genome. These mice efficiently repopulate with human hepatocytes as evidenced by human specific albumin > 2mg / ml in the murine blood and transthyretin (prealbumin) staining in the chimeric liver (Figure. 24). Murine por is efficiently deleted in the liver of these chimeric mice since the albumin promoter is expressed already in late embryonic stages in the liver. Also in these humanized PIRF mice, in addition to the por, gss and ugdh can also be deleted (Figure. 23).Example 17: Analysis of troglitazone metabolites
[0095] Troglitazone metabolites (two hours after i.p. injection of 600 mg / kg troglitazone) in the livers of humanized and non-humanized FRG mice with and without Por and Ugdh deletion was analyzed. Non-humanized livers of control mice had much higher amounts of glucuronide conjugates than humans or humanized PIRF mice (Figure. 24). Furthermore, glucuronide conjugates reduced significantly upon deletion of ugdh and por in non-humanized and humanized PIRF mice. This data confirms that deletion of ugdh leads also to a functional impairment or abolishment of UGTs in the human liver chimeric liver.
[0096] The present disclosure provides a next generation of humanized mouse model amenable to human drug metabolism with minimal interference from the murine P450 cytochromes. The production of human metabolites for two different drugs between humanized PIRF mice and "normal" humanized FRG mice were compared. Analyses revealed higher concentrations of human metabolites in murine feces and liver homogenate in humanized PIRF mice than in FRG mice and demonstrate that these mice have humanized drug metabolism. The PIRF and FRG strains used in this study are in a mixed (C57B and 129S) genetic background. Aside from potential differences in the background to the two previously published FRG mouse strains 5, 7< , our CRISPR / Cas9 generated knockout strains do not express any transgenes, e.g. the neomycin phosphotransferase that inactivates a wide range of aminoglycoside antibiotics. This model system is useful for early detection of reactive metabolites and is an elegant way to block a large and confounding cluster of drug metabolizing murine enzymes. In addition to the novel mouse model provided herein, the disclosure provides (a) knocking out Por in a combination of multiple organs like the gut and the liver or the lung and the liver would be desirable, (b) additional deletions in other drug-metabolizing enzymes and / or achieving a Por deletion more efficiently. Using transgenic mice expressing Cre recombinase would require yet another crossing step into a quadruple transgenic (PIRF) mouse, however, and an early organ-specific deletion might not generate a robust strain amenable to xenotransplantation.
[0097] In summary, the present disclosure provides a novel mouse model combining human chimerism with functional deletion of all murine cytochromes by Por deletion. Such a murine Por-deficient humanization can be used in combination with other repopulation models such as the transgenic uPA mouse 11, 21< . Studies with two different drugs in two different body compartments demonstrate that studies in humanized PIRF mice efficiently identify human metabolites.REFERENCES
[0098] 1. Olson H, et al. Concordance of the toxicity of pharmaceuticals in humans and in animals. Regulatory toxicology and pharmacology : RTP 32, 56-67 (2000). 2. Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, Nebert DW. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 14, 1-18 (2004). 3. Guengerich FP, Cheng Q. Orphans in the human cytochrome P450 superfamily: approaches to discovering functions and relevance in pharmacology. Pharmacological reviews 63, 684-699 (2011). 4. Mercer DF, et al. Hepatitis C virus replication in mice with chimeric human livers. Nat Med 7, 927-933 (2001). 5. Bissig KD, Le TT, Woods NB, Verma IM. Repopulation of adult and neonatal mice with human hepatocytes: a chimeric animal model. Proc Natl Acad Sci U S A 104, 20507-20511 (2007). 6. Dandri M, et al. Repopulation of mouse liver with human hepatocytes and in vivo infection with hepatitis B virus. Hepatology 33, 981-988 (2001). 7. Azuma H, et al. Robust expansion of human hepatocytes in Fah(- / -) / Rag2(- / -) / Il2rg(- / -) mice. Nat Biotechnol 25, 903-910 (2007). 8. Hasegawa M, et al. The reconstituted 'humanized liver' in TK-NOG mice is mature and functional. Biochemical and biophysical research communications 405, 405-410 (2011). 9. Washburn ML, et al. A humanized mouse model to study hepatitis C virus infection, immune response, and liver disease. Gastroenterology 140, 1334-1344 (2011). 10. Suemizu H, et al. Establishment of a humanized model of liver using NOD / Shi-scid IL2Rgnull mice. Biochem Biophys Res Commun 377, 248-252 (2008). 11. Heckel JL, Sandgren EP, Degen JL, Palmiter RD, Brinster RL. Neonatal bleeding in transgenic mice expressing urokinase-type plasminogen activator. Cell 62, 447-456 (1990). 12. Tateno C, et al. Near completely humanized liver in mice shows human-type metabolic responses to drugs. Am J Pathol 165, 901-912 (2004). 13. Samuelsson K, et al. Troglitazone metabolism and transporter effects in chimeric mice: a comparison between chimeric humanized and chimeric murinized FRG mice. Xenobiotica; the fate of foreign compounds in biological systems 44, 186-195 (2014). 14. Lootens L, et al. Steroid metabolism in chimeric mice with humanized liver. Drug testing and analysis 1, 531-537 (2009). 15. Foster JR, et al. Differential effect of troglitazone on the human bile acid transporters, MRP2 and BSEP, in the PXB hepatic chimeric mouse. Toxicologic pathology 40, 1106-1116 (2012). 16. Xu D, et al. Fialuridine induces acute liver failure in chimeric TK-NOG mice: a model for detecting hepatic drug toxicity prior to human testing. PLoS medicine 11, e1001628 (2014). 17. Bateman TJ, Reddy VG, Kakuni M, Morikawa Y, Kumar S. Application of chimeric mice with humanized liver for study of human-specific drug metabolism. Drug Metab Dispos 42, 1055-1065 (2014). 18. Nishimura T, et al. Using chimeric mice with humanized livers to predict human drug metabolism and a drug-drug interaction. J Pharmacol Exp Ther 344, 388-396 (2013). 19. Tanoue C, et al. Prediction of human metabolism of the sedative-hypnotic zaleplon using chimeric mice transplanted with human hepatocytes. Xenobiotica; the fate of foreign compounds in biological systems 43, 956-962 (2013). 20. Bissig KD, et al. Human liver chimeric mice provide a model for hepatitis B and C virus infection and treatment. The Journal of clinical investigation 120, 924-930 (2010). 21. Meuleman P, et al. Morphological and biochemical characterization of a human liver in a uPA-SCID mouse chimera. Hepatology 41, 847-856 (2005). 22. Kato K, et al. Development of Murine Cyp3a Knockout Chimeric Mice with Humanized Liver. Drug Metab Dispos 43, 1208-1217 (2015). 23. Nakada N, et al. Murine Cyp3a knockout chimeric mice with humanized liver: prediction of the metabolic profile of nefazodone in humans. Biopharmaceutics & drug disposition, (2015). 24. Shen AL, O'Leary KA, Kasper CB. Association of multiple developmental defects and embryonic lethality with loss of microsomal NADPH-cytochrome P450 oxidoreductase. J Biol Chem 277, 6536-6541 (2002). 25. Wu L, et al. Conditional knockout of the mouse NADPH-cytochrome p450 reductase gene. Genesis 36, 177-181 (2003). 26. Henderson CJ, et al. Inactivation of the hepatic cytochrome P450 system by conditional deletion of hepatic cytochrome P450 reductase. J Biol Chem 278, 13480-13486 (2003). 27. Gu J, et al. Liver-specific deletion of the NADPH-cytochrome P450 reductase gene: impact on plasma cholesterol homeostasis and the function and regulation of microsomal cytochrome P450 and heme oxygenase. J Biol Chem 278, 25895-25901 (2003). 28. Thomas KR, Capecchi MR. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51, 503-512 (1987). 29. Skarnes WC, et al. A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474, 337-342 (2011). 30. Farley FW, Soriano P, Steffen LS, Dymecki SM. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 28, 106-110 (2000). 31. Haft DH, Selengut J, Mongodin EF, Nelson KE. A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR / Cas subtypes exist in prokaryotic genomes. PLoS computational biology 1, e60 (2005). 32. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 33. Jansen R, Embden JD, Gaastra W, Schouls LM. Identification of genes that are associated with DNA repeats in prokaryotes. Molecular microbiology 43, 1565-1575 (2002). 34. Bissig-Choisat B, et al. Development and rescue of human familial hypercholesterolaemia in a xenograft mouse model. Nature communications 6, 7339 (2015). 35. Weng Y, DiRusso CC, Reilly AA, Black PN, Ding X. Hepatic gene expression changes in mouse models with liver-specific deletion or global suppression of the NADPH-cytochrome P450 reductase gene. Mechanistic implications for the regulation of microsomal cytochrome P450 and the fatty liver phenotype. J Biol Chem 280, 31686-31698 (2005). 36. Williams JA, et al. Drug-drug interactions for UDP-glucuronosyltransferase substrates: a pharmacokinetic explanation for typically observed low exposure (AUCi / AUC) ratios. Drug Metab Dispos 32, 1201-1208 (2004). 37. Barker AJ, et al. Studies leading to the identification of ZD1839 (IRESSA): an orally active, selective epidermal growth factor receptor tyrosine kinase inhibitor targeted to the treatment of cancer. Bioorganic & medicinal chemistry letters 11, 1911-1914 (2001). 38. Herbst RS, Fukuoka M, Baselga J. Gefitinib--a novel targeted approach to treating cancer. Nat Rev Cancer 4, 956-965 (2004). 39. Liu X, et al. Metabolomics reveals the formation of aldehydes and iminium in gefitinib metabolism. Biochem Pharmacol 97, 111-121 (2015). 40. McKillop D, et al. Metabolic disposition of gefitinib, an epidermal growth factor receptor tyrosine kinase inhibitor, in rat, dog and man. Xenobiotica; the fate of foreign compounds in biological systems 34, 917-934 (2004). 41. Scheffler M, Di Gion P, Doroshyenko O, Wolf J, Fuhr U. Clinical pharmacokinetics of tyrosine kinase inhibitors: focus on 4-anilinoquinazolines. Clinical pharmacokinetics 50, 371-403 (2011). 42. Li F, Lu J, Wang L, Ma X. CYP3A-mediated generation of aldehyde and hydrazine in atazanavir metabolism. Drug Metab Dispos 39, 394-401 (2011). 43. Baillie TA. Future of toxicology-metabolic activation and drug design: challenges and opportunities in chemical toxicology. Chemical research in toxicology 19, 889-893 (2006). 44. Guengerich FP, MacDonald JS. Applying mechanisms of chemical toxicity to predict drug safety. Chemical research in toxicology 20, 344-369 (2007). 45. Dalvie D, et al. Assessment of three human in vitro systems in the generation of major human excretory and circulating metabolites. Chemical research in toxicology 22, 357-368 (2009). 46. Anderson S, Luffer-Atlas D, Knadler MP. Predicting circulating human metabolites: how good are we? Chemical research in toxicology 22, 243-256 (2009). 47. Pettitt SJ, et al. Agouti C57BL / 6N embryonic stem cells for mouse genetic resources. Nat Methods 6, 493-495 (2009). 48. Cradick TJ, Qiu P, Lee CM, Fine EJ, Bao G. COSMID: A Web-based Tool for Identifying and Validating CRISPR / Cas Off-target Sites. Molecular therapy Nucleic acids 3, e214 (2014). 49. Hwang WY, et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31, 227-229 (2013). 50. Cong L, et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013). 51. Ponder KP, et al. Mouse hepatocytes migrate to liver parenchyma and function indefinitely after intrasplenic transplantation. Proc Natl Acad Sci U S A 88, 1217-1221 (1991). 52. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011). 53. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359 (2012). 54. Eisenberg E, Levanon EY. Human housekeeping genes, revisited. Trends in genetics : TIG 29, 569-574 (2013).
Claims
1. A method for preparing a chimeric non-human animal comprising human hepatocytes, the method comprising: (a) providing a non-human animal comprising a deletion of NADPH-P450 oxidoreductase (Por) gene resulting in reduced or absent expression of Por protein; and (b) transplanting human hepatocytes into the non-human animal, wherein the non-human animal is a FRG (Fah- / - / Rag2- / - / Il12rg- / -) non-human animal; wherein the non-human animal is a mouse.
2. The method of claim 1, wherein the deleted Por gene is a conditional knockdown or knockout of the Por gene or is the result of a mutation, a transgene, treatment with an exogenous substance or somatic genome engineering.
3. The method of claim 2, wherein the somatic genome engineering comprises Guide RNA (gRNA) and Cas 9.
4. The method of claim 1, wherein the non-human animal comprises a floxed allele of the Por gene, and wherein the non-human animal is provided with a Cre recombinase sufficient to produce a conditional knockout of the Por gene.
5. The method of claim 4, wherein the non-human animal comprising the floxed allele of the Por gene is provided with at least a first dose of a virus that encodes Cre recombinase, optionally wherein the non-human animal is provided with at least a second dose of a virus that encodes Cre recombinase.
6. The method of claim 1, comprising (a) providing a non-human animal comprising a floxed allele of the Por gene with a first does of a virus that encodes Cre recombinase; (b) transplanting human hepatocytes into the non-human animal; and (c) providing the non-human animal with a second dose of a virus that encodes Cre recombinase.
7. The method of claim 6, wherein steps (a) and (b) occur sequentially or simultaneously.
8. The method of claim 7, wherein the non-human animal comprising the floxed allele of the Por gene has been crossed with a transgenic non-human animal strain expressing Cre recombinase.
9. The method of claim 1, wherein the non-human animal further comprises a deletion of UDP-glucose 6-dehydrogenase (UGDH) or Glutathione synthetase (GSS) gene.
10. A chimeric non-human animal, or a portion thereof, which has a chimeric liver comprising human hepatocytes, prepared by the method according to any one of claims 1-9, wherein the non-human animal is a FRG (Fah- / - / Rag2- / -Il12rg- / -) non-human animal comprising a deletion of NADPH-P450 oxidoreductase (Por) gene resulting in reduced or absent expression of Por protein; wherein the non-human animal is a mouse.
11. The chimeric non-human animal of claim 10, wherein human hepatocytes account for at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of all hepatocytes in the chimeric liver.
12. The chimeric non-human animal of claim 10, wherein the chimeric non-human animal is immunodeficient.
13. A method for screening for a substance that affects human liver functions, comprising: (a) administering a test substance to the chimeric non-human animal of claim 10; (b) measuring one or more values in the chimeric non-human animal to which the test substance is administered in (a); and (c) selecting a test substance that causes an increase or decrease in one or more values measured in (b), compared with the one or more values measured in a chimeric non-human animal to which no test substance is administered, optionally wherein the one or more values is selected from the group consisting of a metabolite of the test substance, human albumin concentration, body weight curve, liver-weight-to-body-weight ratio, total albumin level, total protein level, Alanine Aminotransferase (ALT) level, Aspartate Aminotransferase (AST) level, and total bilirubin level, creatinine, Blood Urea Nitrogen (BUN), troponine, blood count, TSH and histological assessment for pathologies in the human and non-human organs; wherein the non-human animal is a mouse.
14. A method for evaluating the toxicity of a test substance against human hepatocytes and any other non-human organ in the non-human chimeric animal, comprising: (a) administering a test substance to the chimeric non-human animal of claim 10; (b) measuring one or more indicators in the chimeric non-human animal to which the test substance is administered in (a); and (c) evaluating the effect of the test substance on human hepatocytes using, one or more indicators measured in (b), compared with the one or more indicators measured in a chimeric non-human animal to which no test substance is administered, optionally wherein the one or more indicators is selected from the group consisting of an increase or a decrease in any one or more of a metabolite of the test substance, human albumin concentration, body weight curve, liver-weight-to-body-weight ratio, total albumin level, total protein level, ALT level, AST level, and total bilirubin level, creatinine, BUN, troponine, blood count and TSH as well as histological alterations including but not limited to necrosis and apoptosis in the human and non-human organs; wherein the non-human animal is a mouse.