HUMAN ANTIBODIES FROM TRANSGENIC RODENTS WITH MULTIPLE HEAVY-CHAIN IMMUNE LOCI
Patent Information
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- OMNIAB OPERATIONS INC EMERYVILLE
- Filing Date
- 2018-01-19
- Publication Date
- 2026-04-15
AI Technical Summary
Existing methods for producing humanized antibodies in transgenic animals face challenges such as competition between duplicate Ig loci, limited diversity of human immunoglobulin VDJ segments, and impaired expression due to incomplete enhancer sequences, leading to suboptimal antibody production.
The integration of multiple artificial human immunoglobulin VDJ gene segments at different chromosomal sites in transgenic animals, combined with a rat 3' enhancer sequence, enables cooperative expression of a diverse repertoire of human antibodies, overcoming allelic exclusion and enhancing antibody diversity.
This approach results in transgenic animals capable of producing a diverse and functional repertoire of human antibodies with improved expression levels, facilitating the generation of humanized and fully human monoclonal antibodies.
Description
FIELD OF INVENTION
[0001] The invention relates to transgenic rats and mice useful for the production of immunoglobulins with human idiotypes in rodents, and methods for making the same. The invention further relates to compositions and methods for the production of humanized and fully human antibodies using polynucleotides derived from modified large regions on bacterial artificial chromosomes and their combined tandem integration. Crossbreeding of independently obtained transgenic animals allowed the expression of highly diverse human antibody repertoires using many different, potentially all, human VH, D and JH segments. Expression is managed in vivo by regulating separate integration sites in unison such as to obtain VH gene diversity and choice without interference.BACKGROUND OF THE INVENTION
[0002] Human monoclonal antibodies have proven to be invaluable in therapeutic applications, either as IgG of conventional size, single chains or domain modules (Chan & Carter Nature reviews. Immunology 10, 301-316 (2010); Enever et al. Current opinion in biotechnology 20, 405-411 (2009)). Despite the successes there are still major shortcomings in their production, which relies either on specificity selection of available human material and subsequent modification of individual products, or the immunization of the limited availability of transgenic animals (Brüggemann et al. Part I: Selecting and shaping the antibody molecule, Selection Strategies III: Transgenic mice, in Handbook of Therapeutic Antibodies. Ed. Diibel, S. Wiley-VHC, 69-93 (2007)).
[0003] DNA rearrangement and expression of human immunoglobulin (Ig) genes in transgenic animals was pioneered over 20 years ago by stably inserting heavy-chain genes in germline configuration (Bruggemann, M. et al. PNAS 86, 6709-6713 (1989)). One problem associated with the therapeutic application of non-human immunoglobulins is the potential immunogenicity of the same in human patients. In order to reduce the immunogenicity of such preparations, various strategies for the production of chimeric, partially human (humanized) and fully human antibodies have been developed Chimeric antibodies comprise a human constant region and a binding region encoded by non-human V-genes. The ability to produce transgenic antibodies having a human idiotype in non-human animals is particularly desirable as antigen binding detenninants lie within the idiotype region, and non-human idiotypes are thought to contribute to the immunogenicity of current antibody therapeutics. Human idiotype is an especially important consideration in respect of monoclonal antibody therapeutics, which consist of a single idiotype delivered at relatively high concentration as opposed to the variety of idiotypes delivered at lower concentrations by a polyclonal antibody mixture.
[0004] Major improvements resulting in higher expression levels and exclusive production of human Ig, combined two new strategies: gene knock-out in embryonic stem (ES) cells (Kitamura et al. Nature 350, 423-426 (1991)) and locus extension on artificial chromosomes (Davies et al. Nucleic acids research 21, 767-768 (1993)). Silencing of the endogenous Ig genes by gene targeting in ES cells produced several inactive mouse lines without the ability to rearrange their IgH and lgL locus or without producing fully functional IgH, IgK or IgL products. More recently zinc finger nucleases (ZFNs) were designed to generate site-specific double-strand breaks in Ig genes, which allowed gene disruption by deletion and non-homologous DNA repair. Injection of ZFN plasmids into fertilized eggs produced Ig silenced rats and rabbits with IgH and IgL disruptions(Geurts, A.M. et al. Science 325, 433 (2009); Menoret, S. et al. European journal of immunology 40, 2932-2941 (2010); Flisikowska, T. et al. PloS one 6, e21045 (2011)).
[0005] A significant technical challenge encountered with many prior art approaches to producing humanized transgenic antibodies in non-human animals relates to the apparent competition between duplicate Ig loci in the same animal, e.g, an existing or endogenous Ig locus and an exogenous or artificial locus introduced into the transgenic animal. Historically, in the absence of effective knock-out the endogenous locus out-competes the exogenous locus for antibody production, such that the duplicate locus is effectively silenced (Lonberg et al., Nat Bio, 23, 1117, 2005; Nicholson et al. J Immunol, 163, 6898, 1999; Brüggemann et al., AITE 63, 101, 2015). In this regard, therefore, the prior art does not address or resolve whether duplicate Ig loci integrated at different chromosomal sites can act cooperatively in the production of transgenic antibodies in the same host animal, and in fact would reasonably suggest to the skilled artisan that the opposite is true.
[0006] Another technical challenge encountered with the production of transgenic antibodies having a human idiotype in non-human animals is the difficulty with providing the full complement of human immunoglobulin VDJ or VJ gene-segments used to generate the human antibodies. Some have attempted to address the problem by introducing megabase-sized fragments from the human heavy and kappa light chain loci. However, this approach has only proven successful with roughly 80% of the human immunoglobin gene included in the germ-line configuration and has relied on the use of protoplasts to deliver the large fragments of the relevant chromosomes with a yeast artificial chromosome (YAC) system (US 5,939,598).
[0007] While integration of extensive overlapping V H D J H regions, such as to maintain the full functionality of the IgH locus and essential for DNA rearrangement, have been utilized in transgenic animals in order to maximize antibody diversity, the overlapping integration had primarily been reported for much smaller regions (<100 kb) (Wagner et al. Genomics 35, 405-414 (1996); Bruggemann et al. European journal of immunology 21, 1323-1326 (1991)) or with larger regions but still having a limited repertoire at a single integration site (WO2014 / 093908; Bruggemann et al.). At the time of filing, the common understanding in the art was that spreading or multiple integration of BAC or YAC mixtures were rare and would be a disadvantage for breeding to homozygosity. Moreover, laborious integration of large YACs into stem cells and subsequent animal derivation therefrom was more commonly performed (Mendez et al. Nature genetics 15, 146-156 (1997); Davies et al. Biotechnology (N Y) 11, 911-914 (1993)). WO 2014 / 141189 A1 (UNIV ERASMUS MEDICAL CT [NL]; KINDON CRAIG R [GB]) relates to a transgenic non-human mammal containing a heterologous lambda light chain gene locus, and / or a heterologous kappa light chain gene locus, and / or a heterologous heavy chain gene locus, each of which can rearrange so that the immunoglobulin heavy and light chain genes are formed and expressed in B-cells following antigen challenge.
[0008] Optimal production of immunoglobulins or antibodies maximizing the diversity of antibodies with human idiotypes using transgenic animals with the full complement of human V-genes remains a challenge for the generation of novel specificities for therapeutic applications in a broad range of disease areas.SUMMARY OF INVENTION
[0009] The current invention resolves the foregoing uncertainties in the art with the provision of a transgenic animal comprising a plurality of artificial lg heavy chain loci comprising duplicate / overlapping human immunoglobulin VDJ or VJ gene segments integrated at different chromosomal sites, and lacking the capacity to produce endogenous immunoglobulin. The method used to generate these transgenic animals comprising the insertion of two different loci in two different locations on two different chromosomes surprisingly produced functional B cells that advantageously avoids allelic exclusion and provides increased antibody diversity as a result of the full complement of human immunoglobulin VDJ heavy chain gene segments integrated into the genome of the transgenic animal.
[0010] In one aspect of the invention there is provided a non-human transgenic animal comprising at least one inactivated endogenous lg locus and at least two artificial transgenic lg heavy chain loci comprising human overlapping immunoglobulin VDJ gene segments integrated in the animal's genome at different chromosomal sites, wherein said transgenic animal expresses a diverse repertoire of antibodies encoded by the V-genes from the transgenic immunoglobulin loci located at the different chromosomal sites, wherein the at least two artificial transgenic lg heavy chain loci together comprise greater than 40 heavy chain V gene segments in an unrearranged configuration, wherein a first artificial transgenic lg heavy chain locus of the at least two artificial transgenic heavy chain loci is H C30 (Figure 1B) and is reconstituted in the animal's genome by overlapping regions of 3 Bacterial Artificial Chromosomes (BACs), wherein the first artificial transgenic heavy chain locus comprises: human heavy chain V gene segments lg H V3-74. lg H V3-73, lg H V3-72, lg H V2-70, lg H V1-69, lg H V3-66, lg H V3-64, lg H V4-61, lg H V4-59, lg H V1-58, lg H V3-53, lg H V5-51, lg H V3-49, lg H V3-48, lg H V1-46, lg H V1-45, lg H V3-43, lg H V3-21, lg H V3-20, lg H V1-18, lg H V3-15, lg H V3-13, and lg H V6-1; human heavy chain D segments; human heavy chain J H 1-6; and a rat constant region spanning from Eµ to a rat 3' enhancer sequence; wherein the animal lacks a functional endogenous lg heavy chain locus, and wherein the animal is a rat or a mouse.
[0011] Novel polynucleotides are disclosed herein comprising nucleic acid sequences encoding chimeric immunoglobulin chains, particularly chimeric heavy chains for use in creating transgenic animals. The polynucleotides disclosed herein advantageously provide optimal expression due, at least in part, to the inclusion of a 3' enhancer since transloci lacking this 3' enhancer result in impaired isotype switching and low lgG expression. Accordingly, in preferred embodiments there is provided chimeric polynucleotides comprising a rat 3' enhancer sequence, an Ig constant region gene and at least one human immunoglubulin (Ig) joining (J) region gene. In a preferred embodiment, the rat 3' enhancer sequence comprises the sequence set forth as SEQ ID NO:1, or a portion thereof.
[0012] In one embodiment, the chimeric polynucleotides set forth herein may further comprise at least one human variable (V) gene, at least one diversity (D) gene, or a combination thereof. In one embodiment, the constant region gene of the chimeric polynucleotide is selected from the group consisting of a human constant region gene and a rat constant region gene. In a preferred embodiment, the constant region gene is a rat constant region gene. In another preferred embodiment, the constant region gene is selected from the group consisting of Cµ and Cy.
[0013] In one embodiment, the chimeric polynucleotide comprises a nucleic acid sequence substantially homologous to the bacterial artificial chromosome (BAC) Annabel disclosed herein (e.g., SEQ ID NO:10, or a portion thereof), and may optionally further comprise at least one human variable Ig gene isolatable from a BAC6-V H 3-11 and BAC3 construct and / or from a BAC9 and BAC14 / 5 construct. In a preferred embodiment, the chimeric polynucleotides contemplated herein comprise nucleic acid sequences (a) and (b) in 5' to 3' order: (a) a human Ig variable region comprising human V genes in natural configuration isolatable from a BAC6-V H 3-11 and BAC3 construct and / or a BAC9 and BAC 14 / 5 construct, and (b) a human Ig joining region comprising human J genes in natural configuration isolatable from the BAC Annabel. In another embodiment, each of the human Ig variable region, human Ig diversity region, human Ig joining region, the Ig constant region and the rat 3' enhancer region of a chimeric polynucleotide as disclosed herein are in the relative positions as shown in FIG. 1a. In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:2 or a portion thereof. In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:11, or a portion thereof. In a further embodiment, a chimeric polynucleotide as disclosed herein comprises a rearranged V-D-J regions, wherein said rearranged V-D-J regions encode a heavy chain variable domain exon.
[0014] In one embodiment, the transgenic animal further comprises a chimeric polynucleotide wherein said human Ig V region comprises at least one human V region gene isolatable from BAC9 and / or BAC14 / 5. In a preferred embodiment, the chimeric polynucleotides comprise nucleic acid sequences (a) and (b) in 5' to 3' order: (a) a human Ig variable region comprising human V region genes in natural configuration used (or rearranged) from BAC9 and / or BAC14 / 5; and (b) a human Ig joining region comprising human J region genes in natural configuration used (or rearranged) from the bacterial artificial chromosome (BAC) Annabel. In another embodiment, each of the human immunoglobulin variable region (gene), the human immunoglobulin diversity region (segment), the human immunoglobulin joining region (segment), the immunoglobulin constant region gene, and the rat 3' enhancer are in the positions shown in FIG. 1b. In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth in FIG. 6. In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth in FIG. 7, or a portion thereof. In a further embodiment, chimeric polynucleotides as disclosed herein may comprise rearranged V-D-J, wherein said rearranged gene segments are derived from the above SEQ ID NOs and Figures.
[0015] Also disclosed herein are polynucleotides encoding human kappa light chain genes. In one embodiment, a polynucleotide as disclosed herein has a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of RP11-1156D9 (set forth as SEQ ID NO:3) and RP11-1134E24 (set forth as SEQ ID NO:4). In another embodiment, the isolated polynucleotide comprises nucleic acid sequences (a) and (b) in 5' to 3' order: (a) a human Ig variable region comprising human V genes in natural configuration isolatable from bacterial artificial chromosomes (BAC) RP11-156D9 and / or RP11-1134E24; (b) a human Ig joining region comprising human J genes in natural configuration isolatable from the bacterial artificial chromosomes (BAC) RP11-1134E24 and / or RP11-344F17 (set forth as SEQ ID NO:5). In a preferred embodiment, each of the human Ig variable region, the human Ig joining region, and the human Ig constant region are in relative position as shown in FIG. 2. In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:6 or a portion thereof.
[0016] Also provided herein is a rodent cell comprising one or more polynucleotides of the invention. For example, provided herein is a rodent cell comprising a polynucleotide as disclosed herein, preferably comprising a nucleic acid sequence encoding for a chimeric heavy chain, e.g., a nucleic acid sequence encoding a rat 3' enhancer sequence, an Ig constant region gene and at least one human J region gene, and optionally, comprising a nucleic acid sequence substantially homologous to the nucleic acid sequence selected from the group consisting of RP11-1156D9, RP11-1134E24 and portions thereof. The rodent cell contemplated herein may further comprise a polynucleotide encoding a functional light chain, e.g., having a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of the sequence shown in FIG. 2a (set forth as SEQ ID NO:6), the sequence shown in FIG. 2b (set forth as SEQ ID NO:7), and portions thereof. In one embodiment, one or more of the polynucleotides are integrated into the rodent cell genome.
[0017] In another aspect of the invention, a transgenic animal is provided which comprises at least one inactivated endogenous Ig locus and a plurality of artificial transgenic Ig heavy chain loci comprising human overlapping immunoglobulin VDJ gene segments integrated in the animal's genome at different chromosomal sites, wherein said transgenic animal expresses a diverse repertoire of antibodies encoded by the V-genes from the transgenic immunoglobulin loci located at the different chromosomal sites, wherein the at least two artificial transgenic lg heavy chain loci together comprise greater than 40 heavy chain V gene segments in an unrearranged or partially rearranged configuration, wherein a first artificial transgenic lg heavy chain locus of the at least two artificial transgenic heavy chain loci is HC3O (Figure 1B) and is reconstituted in the animal's genome by overlapping regions of 3 Bacterial Artificial Chromosomes (BACs), wherein the first artificial transgenic heavy chain locus comprises: human heavy chain V gene segments lgHV3-74, lgHV3-73, lgHV3-72, lgHV2-7O, lgHV 1-69, lgHV3-66, lgHV3-64, lgHV4-61, lgHV4-59, lgHV1-58, lgHV3-53, lgHV5-51, lgHV3-49, lgHV3-48, lgHV1-46, lgHV1-45, lgHV3-43, lgHV3-21, lgHV3-2O, lgHV1-18, lgHV3-15, lgHV3-13, and lgHV6-1; human heavy chain D segments; human heavy chain JH1-6; and a rat constant region spanning from Eµ to a rat 3' enhancer sequence; wherein the animal lacks a functional endogenous lg heavy chain locus, and wherein the animal is a rat or a mouse. In one embodiment, the transgenic animal having a plurality of artificial Ig heavy chain loci comprises (i) a V-region having at least one human V gene segment encoding a germline or hypermutated human V-region amino acid sequence; (ii) one or more J gene segments; and (iii) one or more constant region gene segments, wherein said artificial Ig heavy chain loci are functional and capable of undergoing gene rearrangement and act cooperatively to produce a repertoire of artificial immunoglobulins. In another embodiment, the transgenic animal comprises the full complement of human variable heavy chain regions. In other various embodiments, the transgenic animal i) has artificial heavy chain loci which comprise overlapping heavy chain gene segments, and / or ii) lacks a functional endogenous lg light chain locus.
[0018] In some embodiments, the transgenic animal lacks a functional Ig light chain locus and is capable of producing heavy chain-only antibodies.
[0019] In these transgenic animals the rat 3' enhancer may comprise the sequence set forth as SEQ ID NO:1. The transgenic animal described in the above embodiments which may further comprise at least one human Ig variable (V) region gene and / or a human Ig diversity (D) region gene. In other embodiments of the invention the constant region gene is selected from the group consisting of a human constant region gene and a rat constant region gene. In certain embodiments the constant region gene comprises a constant region gene selected from the group consisting of Cµ and Cγ. In various embodiments the transgenic animal comprises a nucleic acid sequence substantially homologous to bacterial artificial chromosome (BAC) Annabel, or a portion thereof.
[0020] In certain embodiments, the human Ig V region of the transgenic animal comprises at least one human V region gene isolatable from BAC6-V H 3-11 and / or BAC3. In a specific embodiment the transgenic animal comprises nucleic acids with (a) a human Ig variable region comprising human V region genes in natural configuration isolatable from BAC6-V H 3-11 and / or BAC3; and (b) a human Ig joining region comprising human J region genes in natural configuration isolatable from the bacterial artificial chromosome (BAC) Annabel, in 5' to 3' order. In one embodiment each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin j oining region, the immunoglobulin constant region, and the rat 3' enhancer are in the relative positions shown in FIG. 1a. In another embodiment the transgenic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO:2. In yet another embodiment he transgenic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO:11. In some embodiments he transgenic animal has V-D-J regions which are rearranged and form a complete exon encoding a heavy chain variable domain.
[0021] In certain other embodiments, the transgenic animal has an human Ig V region which comprises at least one human V region gene isolatable from BAC9-V H 3-53 and / or BAC14 / 5. In a specific embodiment these transgenic animals comprises nucleic acids with (a) a human Ig variable region comprising human V region genes in natural configuration isolatable from BAC9-V H 3-53 and / or BAC14 / 5; and (b) a human Ig joining region comprising human J region genes in natural configuration isolatable from the bacterial artificial chromosome (BAC) Annabel, in 5' to 3' order. In one embodiment each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin joining region, the immunoglobulin constant region, and the rat 3' enhancer are in the relative positions shown in FIG. 1b. In another embodiment the transgenic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth in FIG. 6. In yet another embodiment he transgenic animal has a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth in FIG. 7.
[0022] In another aspect of the invention, a method for producing antibodies is provided which comprises immunizing the transgenic animal as described above with an immunogen. In one embodiment a polyclonal antisera composition is produced wherein said antisera comprise antigen-specific antibodies encoded by V-genes encoded by transgenic immunoglobulin loci located at different chromosomal sites. In another embodiment the method for producing a monoclonal antibody comprises (i) immunizing the transgenic animal described above with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; and (iii) using said monoclonal antibody producing cell to produce said monoclonal antibody that specifically binds to said immunogen, or using said monoclonal antibody producing cell to produce a hybridoma cell that produces said monoclonal antibody and using said hybridoma cell to produce said monoclonal antibody.
[0023] In another embodiment, the method for producing a monoclonal antibody, comprises (i) immunizing the transgenic animal as described above with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody producing cell a monoclonal antibody nucleic acid which encodes said monoclonal antibody that specifically binds to said immunogen; and (iv) using said monoclonal antibody nucleic acid to produce said monoclonal antibody that specifically binds to said immunogen. In certain embodiment the monoclonal antibody has a human idiotype.
[0024] In yet another embodiment the method for producing a fully human monoclonal antibody comprises (i) immunizing the transgenic animal as described above with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody producing cell a monoclonal antibody nucleic acid which encodes said monoclonal antibody that specifically binds to said immunogen; (iv) modifying said monoclonal antibody nucleic acid to produce a recombinant nucleic acid encoding a fully human monoclonal antibody; and (v) using said recombinant nucleic acid encoding a fully human monoclonal antibody to produce the encoded fully human monoclonal antibody.
[0025] Disclosed herein is a monoclonal antibody produced by the method described above.
[0026] Disclosed herein is a method for neutralizing an antigenic entity in a human body component is provided which comprises contacting said body component with a polyclonal antisera composition as described above, wherein said polyclonal antisera composition comprises immunoglobulin molecules that specifically bind and neutralize said antigenic entity. In one embodiment the method for neutralizing an antigenic entity in a human body component comprises contacting a body component with the monoclonal antibody according to the above, wherein said monoclonal antibody specifically binds to and neutralizes said antigenic entity.BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1: A summary of the integrated chimeric (human, rat) and fully human Ig loci. The 2 chimeric human-rat IgH regions (HC14 and HC30) contain each 3 overlapping BACs with ≥22 different and potentially functional human V H segments. In HC14 BAC6-3 has been extended with V H 3-11 to provide a 10.6 kb overlap to BAC3, which overlaps 11.3 kb via V H 6-1 with the C region BAC Hu-Rat Annabel (A) and in HC30 BAC9 provides an overlap of 4.6 kb to BAC14 / 5, which was extended by adding VH3-43 followed by part of BAC5 and equipped with an overlap of 6.1 kb to Hu-Rat Annabel (B). The latter is chimeric and contains all human D and J H segments followed by the rat C region with full enhancer sequences. Arrows indicate the VH gene usage in HC14, HC30 and HC14 / HC30 combined. Fainter bands indicate less frequently expressed VH genes. Sequences were obtained by unbiased RT-PCR and NGS. FIG. 2: (A)The human Igk BACs with 12 Vks and all Jks provide a ~14 kb overlap in the Vk region and ~40 kb in Ck to include the KDE. (B) The human Igl region with 17 Vls and all J-Cls, including the 3' enhancer, is from a YAC (Vincent-Fabert, C. et al. Blood 116, 1895-1898 (2010)). FIG. 3: Depicts HC14 locus integration into chromosome 6 and HC30 locus integration into chromosome 15. FIG. 4: Analysis by ELISA of IgM and IgG concentration in serum from HC30 and HC14 / HC30 animals. Each dot (HC30) or square (HC14 / HC30) represents the titre (µg / ml) of one animal. IgG is further analysed for the content of IgG1 and IgG2b. FIG. 5: Analysis by ELISA of anti-β-gal specific antibodies from HC30 and HC14 / HC30. Each dot (HC30) or square (HC14 / HC30) represents the serum titre (in comparative dilution) from one animal. FIG. 6: BAC 9 sequence. FIG. 7: BAC 14 / 5 sequence. DETAILED DESCRIPTION
[0028] Provided herein are chimeric polynucleotides encoding a recombinant or artificial immunoglobulin chain or loci. As described above, the chimeric polynucleotides disclosed herein are useful for the transformation of rodents to include human Ig genes and for the production of immunoglobulins or antibodies having human idiotypes using such rodents. As further provided herein, transgenic animals are generated that comprise at least three distinct transgene constructs harboring the full complement of human immunoglobulin VDJ heavy chain gene segments tandemly integrated into the genome of the transgenic animal, thereby ensuring the availability of the entire human immunoglobulin genes in germ-line configuration in a background of complete inactivation of endogenous immunoglobulin genes or locus. Unexpectedly, as demonstrated herein for the first time, a plurality of transgenic loci comprising different V-genes can act cooperatively in the expression of humanized and fully human transgenic antibodies. The transgenic animals disclosed herein are non-human animals. Accordingly, any reference to an 'animal' in the present disclosure is to be understood as referring exclusively to a non-human animal. In particular, the non-human animal according to the invention is selected from the group consisting of rats and mice.DEFINITIONS
[0029] Immunoglobulin refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognized human immunoglobulin genes include the kappa, lambda, alpha (IgA1 and IgA2), gamma (IgG1, IgG2, IgG3, IgG4), delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Full-length immunoglobulin "light chains" (about 25 Kd, or 214 amino acids) generally comprise a variable domain encoded by an exon comprising one or more variable region gene(s) and one or more joining region gene(s) at the NH 2 -terminus (about 110 amino acids) and constant domain encoded by a kappa or lambda constant region gene at the COOH-terminus. Full-length immunoglobulin "heavy chains" (about 50 Kd, or 446 amino acids), similarly comprise (1) a variable domain (about 116 amino acids) encoded by an exon comprising one or more variable region genes, one or more diversity region genes and one or more j oining region genes, and (2) one of the aforementioned constant domains comprising one or more constant region genes, e.g., alpha, gamma, delta, epsilon or mu (encoding about 330 amino acids). The immunoglobulin heavy chain constant region genes encode for the antibody class, i.e., isotype (e.g., IgM or IgG1).
[0030] As used herein, the term "antibody" refers to a protein comprising at least one, and preferably two, heavy (H) chain variable domains (abbreviated herein as VH), and at least one and preferably two light (L) chain variable domains (abbreviated herein as VL). An ordinarily skilled artisan will recognize that the variable domain of an immunological chain is encoded in gene segments that must first undergo somatic recombination to form a complete exon encoding the variable domain. There are three types of regions or gene segments that undergo rearrangement to form the variable domain: the variable region comprising variable genes, the diversity region comprising diversity genes (in the case of an immunoglobulin heavy chain), and the joining region comprising joining genes. The VH and VL domains can be further subdivided into regions of hyper variability, termed "complementarity determining regions" ("CDRs") interspersed with regions that are more conserved, termed "framework regions" ("FRs"). The extent of the FRs and CDRs has been precisely defined (see, Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; and Chothia et al. (1987) J. Mol. Biol. 196:901-17). Each VH and VL domain is generally composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The antigen binding fragment of an antibody (or simply "antibody portion," or "fragment"), as used herein, refers to one or more fragments of a full-length antibody that retain the ability to specifically bind to an antigen (e.g., CD3).
[0031] Examples of binding fragments encompassed within the term "antigen binding fragment" of an antibody include (i) an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) an F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al. (1989) Nature 341:544-46), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they may be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-26; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-83). Such single chain antibodies are also intended to be encompassed within the term "antigen binding fragment" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
[0032] An antibody may further include a heavy and / or light chain constant domain to thereby form a heavy and light immunoglobulin chain, respectively. In one embodiment, the antibody is a tetramer of two heavy immunoglobulin chains and two light immunoglobulin chains, wherein the heavy and light immunoglobulin chains are interconnected, e.g., by disulfide bonds. The heavy chain constant domain is comprised of three gene segments, CH1, CH2 and CH3. The light chain constant domain is comprised of one gene, CL. The variable domains of the heavy and / or light chains contain a binding domain that interacts with an antigen. The constant domains of the antibodies typically mediate the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.
[0033] By polynucleotide encoding an artificial immunoglobulin locus or artificial immunoglobulin chain is meant an recombinant polynucleotide comprising multiple immunoglobulin regions, e.g., a variable (V) region or gene segment comprising V genes, a joining (J) gene region or gene segment comprising J genes, a diversity (D) region or gene segment comprising D genes in the case of a heavy chain locus and / or at least one constant (C) region comprising at least one C gene. Preferably, each region of the variable domain, e.g., V, D, or J region, comprises or spans at least two genes of the same type. For example a variable region as used herein comprises at least two variable genes, a joining region comprises at least two joining genes and a diversity region comprises two diversity genes. A constant region may comprise only one constant gene, e.g. a κ gene or λ gene, or multiple genes, e.g., CH1, CH2, and CH3.
[0034] "Enhancer sequences" or "enhancer" as used herein refers to sequences that have been identified near many active genes by nuclease digest and hypersensitivity to degradation. Hypersensitive sites may precede promoter sequences and the strength of their activity was correlated with the DNA sequence. Linkage to reporter genes showed elevated transcription if enhancer function was present (Mundt et al., J. Immunol., 166, 3315
[2001] ). In the IgH locus two important transcription or expression regulators have been identified, Eµ and the 3'E at the end of the locus (Pettersson et al., Nature, 344, 165
[1990] ). In the mouse the removal of the whole 3' regulatory region (containing hs3a, hs1,2, hs3b and hs4) allows normal early B-cell development but abrogates class-switch recombination (Vincent-Fabert et al., Blood, 116, 1895
[2010] ) and possibly prevents the optimization of somatic hypermutation (Pruzina et al., Protein Engineering, Design and Selection, 1,
[2011] ). The regulatory function to achieve optimal isotype expression is particularly desirable when transgenic human IgH genes are being used. Transgene constructs with incomplete 3'E region, usually only providing the hs1,2 element, led to disappointing expression levels in transgenic mice even when the endogenous IgH locus was knocked-out. As a consequence, only few antigen-specific fully human IgGs have been isolated from constructs produced in the last 20 years (Lonberg et al., Nature 368, 856
[1994] ; Nicholson et al., J. Immunol., 163, 6898
[1999] ; Davis et al., Cancer Metastasis Rev. 18, 421
[1999] ; Pruzina et al., Protein Engineering, Design and Selection, 1,
[2011] ). In the rat IgH locus, the 3'E region has only been poorly analyzed. A comparison of mouse and rat sequences did not allow identification of hs4, the crucial 4 th< element with additional important regulatory sequences further downstream (Chatterjee et al., J. Biol. Chem., 286,29303
[2011] ). The polynucleotides of the present invention advantageously provide optimal expression due, at least in part, to the inclusion of a rat 3' enhancer since chimeric polynucleotides lacking this 3' enhancer result in impaired isotype switching and low IgG expression. In one embodiment, the rat 3' enhancer has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:1 or a portion thereof.
[0035] As used herein, a polynucleotide having a sequence comprising or substantially homologous to a portion, e.g., less than the entirety, of second sequence (e.g., SEQ ID NO:1, SEQ ID NO:2, etc.) preferably retains the biological activity of the second sequence (e.g., retains the biological activity of a 3' enhancer to provide optimal expression and / or isotype switching of immunoglobulins, is capable of rearrangement to provide a humanized chimeric heavy chain, etc.). In one embodiment, a nucleic acid comprising a sequence comprising or substantially homologous to a portion of SEQ ID NO:1 comprise at least 8 kB, preferably at least 10 kB of continuous nucleic acids that are substantially homologous to SEQ ID NO:1. In another embodiment, a second nucleic acid comprising a sequence comprising or substantially homologous to a portion of SEQ ID NOs:59 or 60 comprise at least 8 kB, preferably at least 10 kB of continuous nucleic acids that are substantially homologous to SEQ ID NOs:59 or 60.
[0036] "Artificial Ig locus" as used herein may refer to polynucleotides that (e.g., a sequence comprising V-,D-, and / or J regions in the case of heavy chain, or V- and / or J regions in the case of light chain, and optionally a constant region for either or both a heavy and light chain) that are unrearranged, partially rearranged, or rearranged. Artificial Ig loci include artificial Ig light chain loci and artificial Ig heavy chain loci. In one embodiment, an artificial immunoglobulin locus of the invention is functional and capable of rearrangement and producing a repertoire of immunoglobulin chains. In a preferred embodiment, the variable domain or portion thereof of a polynucleotide disclosed herein comprises genes in natural configuration, i.e., naturally occurring sequences of an human Ig gene segment, degenerate forms of naturally occurring sequences of a human Ig gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially identical to the polypeptide encoded by a naturally occurring sequence of a human Ig gene segment. In another preferred embodiment, the polynucleotide comprises a variable domain or portion thereof in a natural configuration found in humans. For example, a polynucleotide encoding an artificial Ig heavy chain as disclosed herein may comprise in natural configuration at least two human V genes, at least two D genes, at least two J genes or a combination thereof.
[0037] In a preferred embodiment, an artificial Ig locus comprises a non-human C region gene and is capable of producing a repertoire of immunoglobulins including chimeric immunoglobulins having a non-human C region. In one embodiment, an artificial Ig locus comprises a human C region gene and is capable of producing a repertoire of immunoglobulins including immunoglobulins having a human C region. In one embodiment, an artificial Ig locus comprises an "artificial constant region gene", by which is meant a constant region gene comprising nucleotide sequences derived from human and non-human constant regions genes. For example, an exemplary artificial C constant region gene is a constant region gene encoding a human IgG CH1 domain and rat IgG CH2 and CH3 domain.
[0038] In some embodiments, an artificial Ig heavy chain locus lacks CH1, or an equivalent sequence that allows the resultant immunoglobulin to circumvent the typical immunoglobulin: chaperone association. Such artificial loci provide for the production of heavy chain-only antibodies in transgenic animals which lack a functional Ig light chain locus and hence do not express functional Ig light chain. Such artificial Ig heavy chain loci are used in methods contemplated herein to produce transgenic animals lacking a functional Ig light chain locus, and comprising an artificial Ig heavy chain locus, which animals are capable of producing heavy chain-only antibodies. Alternatively, an artificial Ig locus may be manipulated in situ to disrupt CH1 or an equivalent region and generate an artificial Ig heavy chain locus that provides for the production of heavy chain-only antibodies. Regarding the production of heavy chain-only antibodies in light chain-deficient mice, see for example Zou et al., JEM, 204:3271-3283, 2007.
[0039] By "human idiotype" is meant a polypeptide sequence present on a human antibody encoded by an immunoglobulin V-gene segment. The term "human idiotype" as used herein includes both naturally occurring sequences of a human antibody, as well as synthetic sequences substantially identical to the polypeptide found in naturally occurring human antibodies. By "substantially" is meant that the degree of amino acid sequence identity is at least about 85%-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%.
[0040] By a "chimeric antibody" or a "chimeric immunoglobulin" is meant an immunoglobulin molecule comprising a portion of a human immunoglobulin polypeptide sequence (or a polypeptide sequence encoded by a human Ig gene segment) and a portion of a non-human immunoglobulin polypeptide sequence. The chimeric immunoglobulin molecules of the present invention are immunoglobulins with non-human Fc-regions or artificial Fc-regions, and human idiotypes. Such immunoglobulins can be isolated from animals of the invention that have been engineered to produce chimeric immunoglobulin molecules.
[0041] By "artificial Fc-region" is meant an Fc-region encoded by an artificial constant region gene.
[0042] The term "Ig gene segment" as used herein refers to regions of DNA encoding various portions of an Ig molecule, which are present in the germline of non-human animals and humans, and which are brought together in B cells to form rearranged Ig genes. Thus, Ig gene segments as used herein include V gene segments, D gene segments, J gene segments and C gene segments.
[0043] The term "human Ig gene segment" as used herein includes both naturally occurring sequences of a human Ig gene segment, degenerate forms of naturally occurring sequences of a human Ig gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially identical to the polypeptide encoded by a naturally occurring sequence of a human Ig gene segment. By "substantially" is meant that the degree of amino acid sequence identity is at least about 85%-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%
[0044] Polynucleotides related to the present invention may comprise DNA or RNA and may be wholly or partially synthetic. Reference to a nucleotide sequence as set out herein encompasses a DNA molecule with the specified sequence, and encompasses an RNA molecule with the specified sequence in which U is substituted for T, unless context requires otherwise.
[0045] Calculations of "homology" or "sequence identity" between two sequences (the terms are used interchangeably herein) are performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0046] The comparison of sequences and determination of percent sequence identity between two sequences may be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-53) algorithm, which has been incorporated into the GAP program in the GCG software package (available online at gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the invention) is a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of Meyers and Miller ((1989) CABIOS 4:11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.ARTIFICIAL Ig LOCI
[0047] Disclosed herein are artificial Ig loci and their use in making transgenic animals capable of producing immunoglobulins having a human idiotype. Each artificial Ig locus comprises multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present invention, at least one of the V gene segments encodes a germline or hypermutated human V-region amino acid sequence. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype. In heavy chain loci human or non-human-derived D-gene segments may be included in the artificial Ig loci. The gene segments in such loci are juxtaposed with respect to each other in an unrearranged configuration (or "the germline configuration"), or in a partially or fully rearranged configuration. The artificial Ig loci have the capacity to undergo gene rearrangement (if the gene segments are not fully rearranged) in the subject animal thereby producing a diversified repertoire of immunoglobulins having human idiotypes.
[0048] Regulatory elements, like promoters, enhancers, switch regions, recombination signals, and the like, may be of human or non-human origin. What is required is that the elements be operable in the animal species concerned, in order to render the artificial loci functional. Preferred regulatory elements are described in more detail herein.
[0049] Disclosed herein are transgenic constructs containing an artificial heavy chain locus capable of undergoing gene rearrangement in the host animal thereby producing a diversified repertoire of heavy chains having human idiotypes. An artificial heavy chain locus of the transgene contains a V-region with at least one human V gene segment. Preferably, the V-region includes at least about 5-100 human heavy chain V (or "VH") gene segments. In a preferred embodiments, the V-region includes greater than 20, greater than 25, greater than 30, greater than 35, or greater than 40 VH gene segments. As described above, a human VH segment encompasses naturally occurring sequences of a human VH gene segment, degenerate forms of naturally occurring sequences of a human VH gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about 85%-95%) identical to a human heavy chain V domain polypeptide.
[0050] In a preferred embodiment, the artificial heavy chain locus contains at least one or several rat constant region genes, e.g., Cδ, Cµ and Cγ (including any of the Cγ subclasses).
[0051] In another preferred embodiment, the artificial heavy chain locus contains artificial constant region genes. In a preferred embodiment, such artificial constant region genes encode a human CH1 domain and rat CH2 CH3 domains, or a human CH1 and rat CH2, CH3 and CH4 domains. A hybrid heavy chain with a human CH1 domain pairs effectively with a fully human light chain.
[0052] In a preferred embodiment, an artificial Ig locus comprises 3' enhancer sequences, including hs1,2, hs3a, hs3b and sequences between rat Calpha and 3'hs3b.
[0053] In another preferred embodiment, the artificial heavy chain locus contains artificial constant region genes lacking CH1 domains In a preferred embodiment, such artificial constant region genes encode truncated IgM and / or IgG lacking the CH1 domain but comprising CH2, and CH3, or CH1, CH2, CH3 and CH4 domains. Heavy chains lacking CH1 domains cannot pair effectively with Ig light chains and form heavy chain only antibodies.
[0054] Disclosed herein are transgenic constructs containing an artificial light chain locus capable of undergoing gene rearrangement in the host animal thereby producing a diversified repertoire of light chains having human idiotypes. An artificial light chain locus of the transgene contains a V-region with at least one human V gene segment, e.g., a V-region having at least one human VL gene and / or at least one rearranged human VJ segment. Preferably, the V-region includes at least about 5-100 human light chain V (or "VL") gene segments. Consistently, a human VL segment encompasses naturally occurring sequences of a human VL gene segment, degenerate forms of naturally occurring sequences of a human VL gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about 85%-95%) identical to a human light chain V domain polypeptide. In one embodiment, the artificial light chain Ig locus has a C-region having at least one rat C gene (e.g., rat Cλ or Cκ).
[0055] Disclosed herein are methods of making a transgenic vector containing an artificial Ig locus. Such methods involve isolating Ig loci or fragments thereof, and combining the same, with one or several DNA fragments comprising sequences encoding human V region elements. The Ig gene segment(s) are inserted into the artificial Ig locus or a portion thereof by ligation or homologous recombination in such a way as to retain the capacity of the locus to undergo effective gene rearrangement in the subject animal.
[0056] Preferably, a non-human Ig locus is isolated by screening a library of plasmids, cosmids, YACs or BACs, and the like, prepared from the genomic DNA of the same. YAC clones can carry DNA fragments of up to 2 megabases, thus an entire animal heavy chain locus or a large portion thereof can be isolated in one YAC clone, or reconstructed to be contained in one YAC clone. BAC clones are capable of carrying DNA fragments of smaller sizes (about 50-500 kb). However, multiple BAC clones containing overlapping fragments of an Ig locus can be separately altered and subsequently injected together into an animal recipient cell, wherein the overlapping fragments recombine in the recipient animal cell to generate a continuous Ig locus.
[0057] Human Ig gene segments can be integrated into the Ig locus on a vector (e.g., a BAC clone) by a variety of methods, including ligation of DNA fragments, or insertion of DNA fragments by homologous recombination. Integration of the human Ig gene segments is done in such a way that the human Ig gene segment is operably linked to the host animal sequence in the transgene to produce a functional humanized Ig locus, i.e., an Ig locus capable of gene rearrangement which lead to the production of a diversified repertoire of antibodies with human idiotypes. Homologous recombination can be performed in bacteria, yeast and other cells with a high frequency of homologous recombination events. Engineered YACs and BACs can be readily isolated from the cells and used in making transgenic animalsTransgenic animals comprising artificial Ig loci and capable of producing antibodies having human idiotypes
[0058] In one aspect, the invention provides transgenic animals capable of producing immunoglobulins having human idiotypes, as well as methods of making the same are disclosed herein. The transgenic animals used are selected from rodents (e.g., rats, hamsters, mice and guinea pigs).
[0059] The transgenic animals used for humanized antibody production in the invention carry germline mutations in endogenous Ig loci. In a preferred embodiment, the transgenic animals are homozygous for mutated endogenous Ig heavy chain and / or endogenous Ig light chain genes. Further, these animals carry at least two artificial heavy chain loc Ig loci that are functional and capable of producing a repertoire of immunoglobulin molecules in the transgenic animal. The artificial Ig loci used in the invention include at least one human V gene segment.
[0060] In a preferred embodiment, the transgenic animals carry at least two artificial Ig heavy chain locus and at least one artificial Ig light chain locus that are each functional and capable of producing a repertoire of immunoglobulin molecules in the transgenic animal, which repertoire of immunoglobulin molecules includes antibodies having a human idiotype. In one embodiment, artificial loci including at least one non-human C gene are used, and animals capable of producing chimeric antibodies having a human idiotype and non-human constant region are provided. In one embodiment, artificial loci including at least one human C gene are used, and animals capable of producing antibodies having a human idiotype and human constant region are provided.
[0061] In another preferred embodiment, the transgenic animals carry at least two artificial Ig heavy chain loci, and lack a functional Ig light chain locus. Such animals find use in the production of heavy chain only antibodies.
[0062] Production of such transgenic animals involves the integration of at least two artificial heavy chain Ig loci and one or more artificial light chain Ig loci into the genome of a transgenic animal having at least one endogenous Ig locus that has been or will be inactivated by the action of one or more meganucleases. Preferably, the transgenic animals are nullizygous for endogenous Ig heavy chain and / or endogenous Ig light chain and, accordingly, incapable of producing endogenous immunoglobulins. Regardless of the chromosomal location, an artificial Ig locus of the present invention has the capacity to undergo gene rearrangement and thereby produce a diversified repertoire of immunoglobulin molecules. An Ig locus having the capacity to undergo gene rearrangement is also referred to herein as a "functional" Ig locus, and the antibodies with a diversity generated by a functional Ig locus are also referred to herein as "functional" antibodies or a "functional" repertoire of antibodies.
[0063] The artificial loci used to generate such transgenic animals each include multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present invention, at least one of the V gene segments encodes a germline or hypermutated human V-region amino acid sequence. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype.
[0064] In one embodiment, the artificial loci used comprise at least one non-human C region gene segment. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include chimeric antibodies having a human idiotype.
[0065] In one embodiment, the artificial loci used comprise at least one human C region gene segment. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype and a human constant region.
[0066] In one embodiment, the artificial loci used comprise at least one artificial constant region gene. For example, an exemplary artificial C constant region gene is a constant region gene encoding a human IgG CH1 domain and rat IgG CH2 and CH3 domain. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype and an artificial constant region comprising both human and non-human components.
[0067] The transgenic vector containing an artificial Ig locus is introduced into the recipient cell or cells and then integrated into the genome of the recipient cell or cells by random integration or by targeted integration.
[0068] For random integration, a transgenic vector containing an artificial Ig locus can be introduced into a recipient cell by standard transgenic technology. For example, a transgenic vector can be directly injected into the pronucleus of a fertilized oocyte. A transgenic vector can also be introduced by co-incubation of sperm with the transgenic vector before fertilization of the oocyte. Transgenic animals can be developed from fertilized oocytes. Another way to introduce a transgenic vector is by transfecting embryonic stem cells or other pluripotent cells (for example primordial germ cells) and subsequently injecting the genetically modified cells into developing embryos. Alternatively, a transgenic vector (naked or in combination with facilitating reagents) can be directly injected into a developing embryo. Ultimately, chimeric transgenic animals are produced from the embryos which contain the artificial Ig transgene integrated in the genome of at least some somatic cells of the transgenic animal. In another embodiment, the transgenic vector is introduced into the genome of a cell and an animal is derived from the transfected cell by nuclear transfer cloning.
[0069] In a preferred embodiment, a transgene containing an artificial Ig locus is randomly integrated into the genome of recipient cells (such as fertilized oocyte or developing embryos). In a preferred embodiment, offspring that are nullizygous for endogenous Ig heavy chain and / or Ig light chain and, accordingly, incapable of producing endogenous immunoglobulins and capable of producing transgenic immunoglobulins are obtained.
[0070] For targeted integration, a transgenic vector can be introduced into appropriate recipient cells such as embryonic stem cells, other pluripotent cells or already differentiated somatic cells. Afterwards, cells in which the transgene has integrated into the animal genome can be selected by standard methods. The selected cells may then be fused with enucleated nuclear transfer unit cells, e.g. oocytes or embryonic stem cells, cells which are totipotent and capable of forming a functional neonate. Fusion is performed in accordance with conventional techniques which are well established. See, for example, Cibelli et al., Science (1998) 280:1256; Zhou et al. Science (2003) 301: 1179. Enucleation of oocytes and nuclear transfer can also be performed by microsurgery using injection pipettes. (See, for example, Wakayama et al., Nature (1998) 394:369.) The resulting cells are then cultivated in an appropriate medium, and transferred into synchronized recipients for generating transgenic animals. Alternatively, the selected genetically modified cells can be injected into developing embryos which are subsequently developed into chimeric animals.
[0071] In one embodiment, a meganuclease is used to increase the frequency of homologous recombination at a target site through double-strand DNA cleavage. For integration into a specific site, a site specific meganuclease may be used. In one embodiment, a meganuclease targeting an endogenous Ig locus is used to increase the frequency of homologous recombination and replacement of an endogenous Ig locus, or parts thereof with an artificial Ig locus, or parts thereof. In one embodiment, the transgenic animal lacks a functional Ig light chain locus and comprises an artificial Ig heavy chain locus.
[0072] The preferred embodiments for integration of the human Ig gene segments using YACs and BACs, and interchanging between the two, has the advantage of both, speed and the ability to check integrity when making constructs of large regions by overlapping homology. The tandem integration of the constructs with overlapping regions have the ability to integrate, such as to maintain the full functionality, which is essential for DNA rearrangement. The preferred embodiments of the invention not only have the desired integration by homology but also produce tandem integration as a frequent event. This eases the transgenic technology substantially as no laborious integration of large YACs into stem cells and subsequent animal derivation therefrom has to be performed. In addition, ZFN technology, also performed via DNA injection (Geurts et al. Science 325, 433 (2009); Menoret et al. European journal of immunology 40, 2932-2941 (2010)), produced Ig KO strains easily and may well be the future technology of choice for gene disruptions and replacement. Silenced endogenous Ig gene expression in OmniRats ™< , containing human-rat IgH and human IgL loci, has the advantage that no interfering or undesired rat Ig could give rise to mixed products.
[0073] In the mouse an enhancer region downstream of Cα plays a vital role in class-switch recombination_(Vincent-Fabert et al. Blood 116, 1895-1898 (2010)) and it is likely that elements in that region may facilitate hypermutation (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)). This may be the reason why immune responses and generation of diverse hybridomas at high frequency may be difficult in mice carrying even a large fully human locus (Davis et al. Cancer metastasis reviews 18, 421-425 (1999); Lonberg Current opinion in immunology 20, 450-459 (2008)). As the chimeric human-rat IgH locus facilitates near wt differentiation and expression levels in OmniRats, it can be concluded that the endogenous rat C region and indeed the ~30 kb enhancer sequence 3' of Cα are providing optimal locus control to express and mature human V H genes. Another region, Cδ with its 3' control motif cluster (Mundt et al. J Immunol 166, 3315-3323 (2001)), has been removed from the chimeric C-region BAC since silencing or a lack of IgD did not appear to reduce immune function (Chen Immunol Rev 237, 160-179 (2010)). Normally, mature IgM +< IgD +< B-cells down-regulate IgD upon antigen contact, which initiates class-switch recombination (Id). Thus, switching may be increased without IgD control, which is supported by our finding that IgG transcripts and serum levels are significantly lower when the Cδ region is retained in transgenic constructs (data not shown).
[0074] The production of specific IgG in OmniRats ™< is particularly encouraging as we found that in various immunizations mAbs with diversity in sequence and epitope, comparable to what was produced in wt controls, could be isolated via spleen and lymph node fusion. V-gene, D and J diversity was as expected and nearly all segments were found to be used productively as predicted (Lefranc & Lefranc The immunoglobulin factsbook. FactsBook Series, Academic Press, GB, 45-68 (2001)). This was in stark contrast to mice carrying fully human transloci where clonal expansion from a few precursor B-cells produced little diversity (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)). Since the number of transplanted V-genes is only about half of what is used in humans we anticipated to find restricted immune responses and limited diversity when comparing OmniRats with wt animals. However, this was not the case and a comparison of CDR3 diversity in over 1000 clones (sequences can be provided) revealed the same extensive junctional differences in OmniRats as in wt animals. The few identical gene-segment combinations were further diversified by N-sequence additions or deletion at the V H to D and / or D to J H junctions and also by hypermutation. Thus, it is clear that the rat C region sequence is highly efficient in controlling DNA rearrangement and expression of human V H DJ H . Extensive diversity was also seen for the introduced human Igκ and Igλ loci, similar to what has previously been shown in mice (Nicholson et al. J Immunol 163, 6898-6906 (1999); Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011); Popov et al. The Journal of experimental medicine 189, 1611-1620 (1999)). Hence, substantially reduced efficiency in the production of human antibodies from mice (Lonberg, N. Nature biotechnology 23, 1117-1125 (2005)) has been overcome in OmniRats ™< , which diversify rearranged H-chains reliably and extensively by class-switch and hypermutation to yield high affinity antibodies in bulk rather than occasionally. The yield of transgenic IgG and the level of hypermutation, impressively utilized in antigen-specific mAbs, showed that clonal diversification and production level are similar between OmniRats ™< and wt animals. Routine generation of high affinity specificities in the subnanomolar range was even accomplished by different single immunizations and again compares favorably with wt animals; results that have not been shown in transgenic mice producing human antibody repertoires from entirely human loci (Mendez et al. Nature genetics 15, 146-156 (1997)).
[0075] In summary, to maximize human antibody production an IgH locus that uses human genes for antibody specificity but rodent genes for control of differentiation and high expression should be regarded essential. L-chain flexibility is a bonus as it permits highly efficient human IgH / IgL assembly even when wt Ig is present. For therapeutic applications chimeric H-chains can be easily converted into fully human Abs by C-gene replacement without compromising the specificity.Immunoglobulins having a human idiotype
[0076] Once a transgenic animal capable of producing immunoglobulins having a human idiotype is made, immunoglobulins and antibody preparations against an antigen can be readily obtained by immunizing the animal with the antigen. "Polyclonal antisera composition" as used herein includes affinity purified polyclonal antibody preparations.
[0077] A variety of antigens can be used to immunize a transgenic animal. Such antigens include but are not limited to, microorganisms, e.g. viruses and unicellular organisms (such as bacteria and fungi), alive, attenuated or dead, fragments of the microorganisms, or antigenic molecules isolated from the microorganisms.
[0078] Preferred bacterial antigens for use in immunizing an animal include purified antigens from Staphylococcus aureus such as capsular polysaccharides type 5 and 8, recombinant versions of virulence factors such as alpha-toxin, adhesin binding proteins, collagen binding proteins, and fibronectin binding proteins. Preferred bacterial antigens also include an attenuated version of S. aureus, Pseudomonas aeruginosa, enterococcus, enterobacter, and Klebsiella pneumoniae, or culture supernatant from these bacteria cells. Other bacterial antigens which can be used in immunization include purified lipopolysaccharide (LPS), capsular antigens, capsular polysaccharides and / or recombinant versions of the outer membrane proteins, fibronectin binding proteins, endotoxin, and exotoxin from Pseudomonas aeruginosa, enterococcus, enterobacter, and Klebsiella pneumoniae.
[0079] Preferred antigens for the generation of antibodies against fungi include attenuated version of fungi or outer membrane proteins thereof, which fungi include, but are not limited to, Candida albicans, Candida parapsilosis, Candida tropicalis, and Cryptococcus neoformans.
[0080] Preferred antigens for use in immunization in order to generate antibodies against viruses include the envelop proteins and attenuated versions of viruses which include, but are not limited to respiratory synctial virus (RSV) (particularly the F-Protein), Hepatitis C virus (HCV), Hepatits B virus (HBV), cytomegalovirus (CMV), EBV, and HSV.
[0081] Antibodies specific for cancer can be generated by immunizing transgenic animals with isolated tumor cells or tumor cell lines as well as tumor-associated antigens which include, but are not limited to, Her-2-neu antigen (antibodies against which are useful for the treatment of breast cancer); CD20, CD22 and CD53 antigens (antibodies against which are useful for the treatment of B cell lymphomas), prostate specific membrane antigen (PMSA) (antibodies against which are useful for the treatment of prostate cancer), and 17-1A molecule (antibodies against which are useful for the treatment of colon cancer).
[0082] The antigens can be administered to a transgenic animal in any convenient manner, with or without an adjuvant, and can be administered in accordance with a predetermined schedule.
[0083] For making a monoclonal antibody, spleen cells are isolated from the immunized transgenic animal and used either in cell fusion with transformed cell lines for the production of hybridomas, or cDNAs encoding antibodies are cloned by standard molecular biology techniques and expressed in transfected cells. The procedures for making monoclonal antibodies are well established in the art. See, e.g., European Patent Application 0 583 980 A1 ("Method For Generating Monoclonal Antibodies From Rabbits"), U.S. Patent No. 4,977,081 ("Stable Rabbit-Mouse Hybridomas And Secretion Products Thereof"), WO 97 / 16537 ("Stable Chicken B-cell Line And Method of Use Thereof"), and EP 0 491 057 B1 ("Hybridoma Which Produces Avian Specific Immunoglobulin G"). In vitro production of monoclonal antibodies from cloned cDNA molecules has been described by Andris-Widhopf et al. J Immunol Methods 242:159 (2000), and by Burton Immunotechnology 1:87 (1995).
[0084] Once chimeric monoclonal antibodies with human idiotypes have been generated, such chimeric antibodies can be easily converted into fully human antibodies using standard molecular biology techniques. Fully human monoclonal antibodies are not immunogenic in humans and are appropriate for use in the therapeutic treatment of human subjects.Antibodies of the invention include heavy chain-only antibodies
[0085] In one embodiment, transgenic animals which lack a functional Ig light chain locus, and comprising at least two artificial heavy chain loci, are immunized with antigen to produce heavy chain-only antibodies that specifically bind to antigen.
[0086] In one embodiment, the invention provides monoclonal antibody producing cells derived from such animals, as well as nucleic acids derived therefrom. Also provided are hybridomas derived therefrom. Also provided are fully human heavy chain-only antibodies, as well as encoding nucleic acids, derived therefrom.
[0087] Teachings on heavy chain-only antibodies are found in the art. For example, see PCT publications WO02085944, WO02085945, WO2006008548, and WO2007096779. See also US 5,840,526; US 5,874,541; US 6,005,079; US 6,765,087; US 5,800,988; EP 1589107; WO 9734103; and US 6,015,695.Pharmaceutical Compositions
[0088] As disclosed herein, purified monoclonal or polyclonal antibodies are admixed with an appropriate pharmaceutical carrier suitable for administration to patients, to provide pharmaceutical compositions.
[0089] Patients treated with the pharmaceutical compositions of the invention are preferably mammals, more preferably humans, though veterinary uses are also contemplated.
[0090] Pharmaceutically acceptable carriers which can be employed in the present pharmaceutical compositions can be any and all solvents, dispersion media, isotonic agents and the like. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of the antibodies contained therein, its use in the pharmaceutical compositions of the present invention is appropriate.
[0091] The carrier can be liquid, semi-solid, e.g. pastes, or solid carriers. Examples of carriers include oils, water, saline solutions, alcohol, sugar, gel, lipids, liposomes, resins, porous matrices, binders, fillers, coatings, preservatives and the like, or combinations thereof.Methods of Treatment
[0092] As disclosed herein, methods are provided for treating a disease in a vertebrate, preferably a mammal, preferably a primate, with human subjects being an especially preferred embodiment, by administering a purified antibody composition of the invention desirable for treating such disease.
[0093] The antibody compositions can be used to bind and neutralize or modulate an antigenic entity in human body tissues that causes or contributes to disease or that elicits undesired or abnormal immune responses. An "antigenic entity" is herein defined to encompass any soluble or cell surface bound molecules including proteins, as well as cells or infectious disease-causing organisms or agents that are at least capable of binding to an antibody and preferably are also capable of stimulating an immune response.
[0094] Administration of an antibody composition against an infectious agent as a monotherapy or in combination with chemotherapy results in elimination of infectious particles. A single administration of antibodies decreases the number of infectious particles generally 10 to 100 fold, more commonly more than 1000-fold. Similarly, antibody therapy in patients with a malignant disease employed as a monotherapy or in combination with chemotherapy reduces the number of malignant cells generally 10 to 100 fold, or more than 1000-fold. Therapy may be repeated over an extended amount of time to assure the complete elimination of infectious particles, malignant cells, etc. In some instances, therapy with antibody preparations will be continued for extended periods of time in the absence of detectable amounts of infectious particles or undesirable cells.
[0095] Similarly, the use of antibody therapy for the modulation of immune responses may consist of single or multiple administrations of therapeutic antibodies. Therapy may be continued for extended periods of time in the absence of any disease symptoms.
[0096] The subject treatment may be employed in conjunction with chemotherapy at dosages sufficient to inhibit infectious disease or malignancies. In autoimmune disease patients or transplant recipients, antibody therapy may be employed in conjunction with immunosuppressive therapy at dosages sufficient to inhibit immune reactions.EXAMPLES
[0097] In mice transgenic for human immunoglobulin (Ig) loci, suboptimal efficacy in delivery of fully human antibodies has been attributed to imperfect interaction between the constant regions of human membrane IgH chains and the mouse cellular signaling machinery. To obviate this problem, we here describe a humanized rat strain (OmniRat ™< ) carrying chimeric human / rat IgH loci [comprising 22 human V H s, all human D and J H segments with germline gene spacing but linked to the rat C H locus] together with fully human light-chain loci [12 Vκs linked to Jκ-Cκ and 16 Vλs linked to Jλ-Cλ]. The endogenous rat Ig loci were silenced by designer zinc finger nucleases. Following immunization, OmniRats perform as efficiently as normal rats in yielding high affinity serum IgG. Monoclonal antibodies, comprising fully human variable regions with sub-nanomolar antigen affinity and carrying extensive somatic mutations, are readily obtainable - similarly to the yield of conventional antibodies from normal rats.MATERIALS AND METHODSConstruction of modified human Ig loci on YACs and BACsa) IgH loci
[0098] The human IgH V genes were covered by 2 BACs: BAC6-VH3-11 containing the authentic region spanning from VH4-39 to VH3-23 followed by VH3-11 (modified from a commercially available BAC clone 3054M17 CITB) and BAC3 containing the authentic region spanning from VH3-11 to VH6-1 (811L16 RPCI-11). A BAC termed Annabel was constructed by j oining rat CH region genes immediately downstream of the human VH6-1-Ds-JHs region (Figure 1). All BAC clones containing part of the human or rat IgH locus were purchased from Invitrogen.
[0099] Both BAC6-VH3-11 and Annabel were initially constructed in S. cerevisiae as circular YACs (cYACs) and further checked and maintained in E. coli as BACs..
[0100] Unlike YACs, BAC plasmid preps yield large quantities of the desired DNA. To convert a linear YAC into a cYAC or to assemble DNA fragments with overlapping ends into a single cYAC in S. cerevisiae, which can also be maintained as a BAC in E. coli, two self-replicating S. cerevisiae / E. coli shuttle vectors, pBelo-CEN-URA, and pBelo-CEN-HYG were constructed. Briefly, S. cerevisiae CEN4 was cut out as an AvrII fragment from pYAC-RC (Marchuk & Collins Nucleic acids research 16, 7743 (1988)) and ligated to SpeI - linearised pAP599 (Kaur & Cormack PNAS 104, 7628-7633 (2007)). The resulting plasmid contains CEN4 cloned in between S. cerevisiae URA3 and a hygromycin-resistance expression cassette (HygR). From this plasmid, an ApaLI-BamHI fragment containing URA3 followed by CEN4 or a PmlI-SphI fragment containing CEN4 followed by HygR was cut out, and ligated to ApaLI and BamHI or HpaI and SphI doubly digested pBACBelo11 (New England Biolabs) to yield pBelo-CEN-URA and pBelo-CEN-HYG.
[0101] To construct BAC6-VH3-11, initially two fragments, a 115 kb NotI-PmeI and a 110 kb RsrII-SgrAI, were cut out from the BAC clone 3054M17 CITB. The 3' end of the former fragment overlaps 22 kb with the 5' end of the latter. The NotI-PmeI fragment was ligated to a NotI-BamHI YAC arm containing S. cerevisiae CEN4 as well as TRP1 / ARS1 from pYAC-RC, and the RsrII-SgrAI fragment was ligated to a SgrAI-BamHI YAC arm containing S. cerevisiae URA3, also from pYAC-RC. Subsequently, the ligation mixture was transformed into S. cerevisiae AB1380 cells via spheroplast transformation 41< , and URA+TRP+ yeast clones were selected. Clones, termed YAC6, containing the linear region from human VH4-39 to VH3-23 were confirmed by Southern blot analysis. YAC6 was further extended by addition of a 10.6 kb fragment 3' of VH3-23, and conversion to a cYAC. The 10.6 kb extension contains the human VH3-11 and also occurs at the 5' end of BAC3. We constructed pBeloHYG-YAC6+BAC3(5') for the modification of YAC6. Briefly, 3 fragments with overlapping ends were prepared by PCR: 1) a 'stuff' fragment containing S. cerevisiae TRP1-ARS1 flanked by HpaI sites with 5' tail matching the sequence upstream of VH4-39 and 3' tail matching downstream of VH3-23 in YAC6 (using long oligoes 561 and 562, and pYAC-RC as template), 2) the 10.6 kb extension fragment with a 5' tail matching the sequence downstream of VH3-23 as described above and a unique AscI site at its 3' end (using long oligoes 570 and 412, and human genomic DNA as template), and 3) pBelo-CEN-HYG vector with the CEN4 joined downstream with a homology tail matching the 3' end of the 10.6 extension fragment and the HygR j oined upstream with a tail matching the sequence upstream of VH4-39 as described above (using long oligoes 414 and 566, and pBelo-CEN-HYG as template). Subsequently, the 3 PCR fragments were assembled into a small cYAC conferring HYGR and TRP+ in S. cerevisiae via homologous recombination associated with spheroplast transformation, and this cYAC was further converted into the BAC pBeloHYG-YAC6+BAC3(5'). Finally, the HpaI-digested pBeloHYG-YAC6+BAC3(5') was used to transform yeast cells carrying YAC6, and through homologous recombination cYAC BAC6-VH3-11 conferring only HYGR was generated. Via transformation, see below, this cYAC was introduced as a BAC in E. coli. The human VH genes in BAC6-VH3-11 were cut out as a ~ 182 kb AsiSI (occurring naturally in the HygR) - AscI fragment, and the VH genes in BAC3 were cut out as a ~173 kb NotI- fragment (Figure 1 top).
[0102] A self-replicating shuttle vector, termed pCAU, efficiently working in both Saccharomyces cerevisiae and E. coli, was constructed based on pBelo-CEN-URA published previously. (Osborn et al. J Immunol 2013; 190:1481-1490) In brief, ARSH4 was amplified from S. cerevisiae genomic DNA using primers 878 and 879 (all primer sequences are listed below), with an ApaLI site followed by AsiSI and a SexAI introduced into either end. The fragment was digested with ApaLI and SexAI, and ligated with pBelo-CEN-URA digested with the same restriction enzymes to yield pCAU. This vector contains S. cerevisiae CEN4, URA3 and ARSH4 in the pBeloBAC11 backbone (New England BioLabs).
[0103] Three BACs derived from human chromosome 14 - CTD-2011A5 (BAC9), CTD-3148C6 (BAC14), CTD-2548B8 (BAC5) were purchased from Invitrogen / Thermo Fisher. The human genomic region encompassing IgHV3-74 to IgHV1-58 in BAC9 was isolated as a 185 kb NotI - fragment. BAC(14+5) was constructed from BAC14 and BAC5. The combined genomic regions in this BAC was isolated as a 210 kb BsiwI - fragment including from 5' to 3': a 90.6 kb region derived from BAC14 containing 4.6 kb sequence overlapping with the 3' of the NotI -fragment from BAC9 followed by a 86 kb region encompassing IgHV5-51 to IgHV1-45, a 1.7 kb synthetic region joining BAC14 and BAC5 with IgHV3-43 located in the centre, a 111.7 kb region derived from BAC5 encompassing IgHV3-21 to IgHV3-13, and a 6.1 kb region providing an overlap with the 5' of Anabel (the BAC carrying human Ig constant regions).
[0104] BAC(14+5, also referenced as 14 / 5) was constructed in three steps all involving generating a circular YAC (cYAC) via homologous recombination in yeast and converting the cYAC to BAC as described previously. Firstly, a BAC vector - pCAU+GAP-BAC14,5, was generated by assembling the following 3 overlapping fragments in yeast: a 1.9 kb synthetic DNA (ordered from ThermoFisher) containing from 5' to 3': 116 bp sequence overlapping with the 5' as well as 3' end of the desired region in BAC14 with an unique RsrII site in the centre, 1.6 kb IgHV3-43 gene [including 1.0 kb 5' untranslated region (UTR) and 0.2 kb 3' UTR], 106 bp sequence overlapping with the 5' as well as 3' end of the desired region in BAC5 with an unique PmeI site in the centre, and 38 bp sequence overlapping with the 5' end of Anabel, a 6.1 kb PCR fragment corresponding to the 5' of Anabel using primers 383 and 384, and an amplified pCAU vector using primers 1066 and 1088. Secondly, the pCAU+GAP-BAC14,5 vector was linearized with PmeI, and co-transformed with a 154 kb NotI - fragment isolated from BAC5 into yeast strain AB1380. The resulting BAC (~ 128 kb in length) had the desired region of BAC5 incorporated into the BAC vector via homologous recombination mediated by the homology ends to BAC5 exposed in the PmeI - linearized vector. Thirdly, the BAC carrying BAC5 from the second step was linearized with RsrII to expose the homology ends to the desired region in BAC14, and co-transformed with a 114 kb SnaBI - fragment isolated from BAC14 to yield BAC(14+5).
[0105] For the assembly of the C region with the VH overlap, the human VH6-1-Ds-JHs region had to be joined with the rat genomic sequence immediately downstream of the last JH followed by rat Cs to yield a cYAC / BAC. To achieve this, 5 overlapping restriction as well as PCR fragments were prepared; a 6.1 kb fragment 5' of human VH6-1 (using oligos 383 and 384, and human genomic DNA as template), an ~78 kb PvuI-PacI fragment containing the human VH6-1-Ds-JHs region cut out from BAC1 (RP11645E6), a 8.7 kb fragment joining the human JH6 with the rat genomic sequence immediately downstream of the last JH and containing part of rat µ coding sequence (using oligos 488 and 346, and rat genomic DNA as template), an ~ 52 kb NotI-PmeI fragment containing the authentic rat µ, δ and γ2c region cut out from BAC M5 (CH230-408M5) and the pBelo-CEN-URA vector with the URA3 joined downstream with a homology tail matching the 3' end of the rat γ2c region and the CEN4 j oined upstream with a tail matching the 5' region of human VH6-1 as described (using long oligoes 385 and 550, and pBelo-CEN-URA as template). Correct assembly via homologous recombination in S. cerevisiae was analyzed by PCR and purified cYAC from the correct clones was converted into a BAC in E. coli.
[0106] For the assembly of Annabel parts of the above cYAC / BAC containing humanVH6-1-Ds-JHs followed by the authentic rat µ, δ and y2c region, as well as PCR fragments were used. Five overlapping fragments contained the 6.1 kb fragment at the 5' end of human VH6-1 as described above, an ~83 kb SpeI fragment comprising human VH6-1-Ds-JHs immediately followed by the rat genomic sequence downstream of the last JH and containing part of rat Cµ, a 5.2 kb fragment joining the 3' end of rat µ with the 5' end of rat γ1 (using oligos 490 and 534, and rat genomic DNA as template), an ~118 kb NotI-SgrAI fragment containing the authentic rat γ1, γ2b, ε, α and 3'E IgH enhancer region cut out from BAC I8 (CH230-162I08), and the pBelo-CEN-URA vector with the URA3 joined downstream with a homology tail matching the 3' end of rat 3'E and the CEN4 joined upstream with a tail matching the 5' end of human VH6-1 as described above. There is a 10.3 kb overlap between the human VH6-1 regions in both the BAC3 and Annabel. The human VH6-1 -Ds - JHs followed by the rat CH region together with the S. cerevisiae URA3 in Annabel can be cut out as a single ~183 kb NotI-fragment (see Figure 1).
[0107] BAC6-VH3-11, BAC3, BAC9 and BAC (14+5) and Annabel were checked extensively by restriction analysis and partial sequencing for their authenticity.b) IgL loci
[0108] The human Igλ locus on a ~410 kb YAC was obtained by recombination assembly of a Vλ YAC with 3 Cλ containing cosmids (Popov et al. Gene 177, 195-201 (1996)). Rearrangement and expression was verified in transgenic mice derived from ES cells containing one copy of a complete human Igλ YAC (Popov et al. The Journal of experimental medicine 189, 1611-1620 (1999)). This Igλ YAC was shortened by the generation of a circular YAC removing ~100kb of the region 5' of Vλ3-27. The vector pYAC-RC was digested with ClaI and BspEI to remove URA3 and ligated with a ClaI / NgoMIV fragment from pAP 599 containing HYG. PCR of the region containing the yeast centromere and hygromycin marker gene from the new vector (pYAC-RC-HYG) was carried out with primers with 5' ends homologous to a region 5' of Vλ3-27 (primer 276) and within the ADE2 marker gene in the YAC arm (primer 275). The PCR fragment (3.8 kb) was integrated into the Igλ YAC using a high efficiency lithium acetate transformation method (Gietz & Woods Methods in Microbiology 26, 53-66 (1998)) and selection on hygromycin containing YPD plates. DNA was prepared from the clones (Epicentre MasterPure Yeast DNA purification kit) and analysed for the correct junctions by PCR using the following oligos: 243 + 278 and Hyg end R + 238. Plugs were made (Peterson Nature protocols 2, 3009-3015 (2007)) and yeast chromosomes removed by PFGE (0.8% agarose (PFC) (Biorad) gel [6V / cm, pulse times of 60s for 10hr and 10s for 10hr, 8°C) leaving the circular yeast artificial chromosome caught in the agarose block (Beverly, Nucleic acids research 16, 925-939 (1988)). The blocks were removed and digested with NruI. Briefly, blocks were preincubated with restriction enzyme buffer in excess at a 1X final concentration for 1 hr on ice. Excess buffer was removed leaving just enough to cover the plugs, restriction enzyme was added to a final concentration of 100U / ml and the tube incubated at 37°C for 4-5hrs. The linearized YAC was ran out of the blocks by PFGE, cut out from the gel as a strip and purified as described below.
[0109] For the human Igκ locus 3 BACs were chosen (RP11-344F17, RP11-1134E24 and RP11-156D9, Invitrogen), which covered a region over 300 kb from 5' Vκ1-17 to 3' KDE (Kawasaki et al. European journal of immunology 31, 1017-1028 (2001)). In digests and sequence analyses three overlapping fragments were identified: from Vκ1-17 to Vκ3-7 (150 kb NotI with ~14 kb overlap), from Vκ3-7 to 3' of Cκ (158 kb NotI with ~40 kb overlap) and from Cκ to 3' of the KDE (55 kb PacI with 40 kb overlap). Overlapping regions may generally favour joint integration when co-injected into oocytes (Wagner et al. Genomics 35, 405-414 (1996)).Gel analyses and DNA purification
[0110] Purified YAC and BAC DNA was analysed by restriction digest and separation on conventional 0.7% agarose gels (Sambrook & Russell Molecular Cloning. A laboratory Manual.. Cold Spring Harbor Laboratory Press, NY (2001)). Larger fragments, 50-200 kb, were separated by PFGE (Biorad Chef MapperTM) at 80C, using 0.8% PFC Agaraose in 0.5% TBE, at 2-20 sec switch time for 16 h, 6V / cm, 10mA. Purification allowed a direct comparison of the resulting fragments with the predicted size obtained from the sequence analysis. Alterations were analysed by PCR and sequencing.
[0111] Linear YACs, circular YACs and BAC fragments after digests, were purified by electro-elution using ElutrapTM (Schleicher and Schuell) (Gu et al. Journal of biochemical and biophysical methods 24, 45-50 (1992)) from strips cut from 0.8% agarose gels run conventionally or from pulsed-field-gel electrophoresis (PFGE). The DNA concentration was usually several ng / µl in a volume of ~100µl. For fragments up to ~200 kb the DNA was precipitated and re-dissolved in micro-injection buffer (10 mM Tris-HCl pH 7.5, 100 mM EDTA pH 8 and 100 mM NaCl but without Spermine / Spermidine) to the desired concentration.
[0112] The purification of circular YACs from yeast was carried out using Nucleobond AX silica-based anion-exchange resin (Macherey-Nagel, Germany). Briefly, spheroplasts were made using zymolyase or lyticase and pelleted (Davies et al. Human antibody repertoires in transgenic mice: Manipulation and transfer of YACs. . IRL Oxford, 59-76 (1996)). The cells then underwent alkaline lysis, binding to AX100 column and elution as described in the Nucleobond method for a low-copy plasmid. Contaminating yeast chromosomal DNA was hydolyzed using Plamid -Safe ™< ATP-Dependent DNase (Epicentre Biotechnologies) followed by a final cleanup step using SureClean (Bioline). An aliquot of DH10 electrocompetent cells (Invitrogen) was then transformed with the circular YAC to obtain BAC colonies. For microinjection, the insert DNA (150-200 kb), was separated from BAC vector DNA(~10 kb) using a filtration step with sepharose 4B-CL (Yang et al. Nature biotechnology 15, 859-865 (1997)).Derivation of rats and breeding
[0113] Purified DNA encoding recombinant immunoglobulin loci was resuspended in microinjection buffer with 10 mM Spermine and 10 mM Spermidine. The DNA was injected into fertilized oocytes at various concentrations from 0.5 to 3 ng / µl.
[0114] Plasmid DNA or mRNA encoding ZFNs specific for rat immunoglobulin genes were injected into fertilized oocytes at various concentrations from 0.5 to 10 ng / ul.
[0115] Microinjections were performed at Caliper Life Sciences facility. Outbred SD / Hsd (WT) strain animals were housed in standard microisolator cages under approved animal care protocols in animal facility that is accredited by the Association for the Assessment and Accreditation for Laboratory Animal Care (AAALAC). The rats were maintained on a 14-10 h light / dark cycle with ad libitum access to food and water. Four to five week old SD / Hsd female rats were injected with 20-25 IU PMSG (Sigma-Aldrich) followed 48 hours later with 20-25 IU hCG (Sigma-Aldrich) before breeding to outbred SD / Hsd males. Fertilized 1-cell stage embryos were collected for subsequent microinjection. Manipulated embryos were transferred to pseudopregnant SD / Hsd female rats to be carried to parturition.
[0116] Multi-feature human Ig rats (human IgH, Igκ and Igλ in combination with rat J KO, κ KO and λ KO) and WT, as control, were analyzed at 10-18 weeks of age. The animals were bred at Charles River under specific pathogen-free conditions.
[0117] The procedure of introducing multiple different V H region on separate loci can be implemented through the insertion of these different loci into separate transgenic rats (preferably with a defective rat IgH locus) as described in the example above. These separate loci are used to generate separate transgenic rat lines, which are subsequently crossed to obtain double transgenic rats that would have all of the VHregions used available for the recombination process. Crossing these rats to homozygosity for both loci would double the number of VH regions available for recombination (see FIG. 3 karyogram with one locus integrated on chromosome 6 and one locus on chromosome 15). Having multiple copies of an integrated locus would increase this number yet further.
[0118] The procedure of introducing distinct loci separately, by the transfer of multiple different V H regions in conjunction with one constant region array, allowed unconnected and multiple translocus integration. This was followed by breeding to generate an animal that expresses antibodies from both separately integrated loci.
[0119] The same procedure is also applied for the light chains, where one line of animals is made with a kappa locus and another line is made with a lambda locus. The loci are combined in animals by crossbreeding.PCR and RT-PCR
[0120] Transgenic rats were identified by PCR from tail or ear clip DNA using a Genomic DNA Mini Kid (Bioline). For IgH PCRs < 1kb GoTaq Green Master mix was used (Promega) under the following conditions: 94°C 2 mins, 32 x (94°C 30 secs, 54-67°C (see Table 1 for primers and specific annealing temperatures) 30 secs, 72°C 1 min), 72°C 2 mins. For IgH PCRs >1kb KOD polymerase (Novagen) was used under the following conditions: 95°C 2 mins, 32 x (95°C 20 secs, 56-62°C, Table 1) 20 secs, 70°C 90 secs), 70°C 2 mins. For Igκ and Igλ PCR, all <1kb, the above condition were used except extension at 72°C for 50 secs.
[0121] RNA was extracted from Blood using the RiboPure Blood Kit (Ambion) and RNA extraction from spleen, bone marrow or lymph nodes used RNASpin mini kit. (GE Healthcare). cDNA was made using Oligo dT and Promega Reverse Transcriptase at 42°C for 1 hour. GAPDH PCR reactions (oligos 429-430) determined the concentration.
[0122] RT-PCRs were set up using VH leader primers with rat µCH2 or rat yCH2 primers (Table 2). Amplification with GoTaq Green Master mix were 94°C 2 mins, 34 x (94°C 30 secs, 55-65oC 30 secs, 72°C 50-60 secs), 72°C 2 mins. PCR products of the expected size were either purified by gel or QuickClean (Bioline) and sequenced directly or cloned into pGemT (Promega).
[0123] The sequences of the primers used in the PCR and RT-PCR assays to detect human IgH and IgL integration and expression are provided in Table 3. Characterization of antibodies in immunized OmniRat animals by next generation sequencing
[0124] A total of 6 OmniRat2 animals were immunized with beta-gal and B-cells were isolated from draining lymph nodes. After pelleting the B-cells and removing supernatant, total RNA was prepared from lymph node derived B-cells. RNA was reverse transcribed, and the resulting cDNA was used as template to amplify the full variable region of the Ig heavy chain rearranged locus (the VH region). This amplified product was then prepared for next-generation sequencing (NGS) and the full VH repertoire of each animal was determined by NGS.
[0125] After post-processing and quality control of the raw NGS reads, the V-gene usage of each animal was determined by aligning each unique VH sequence to the germline V-gene reference sequence. The percent V-gene usage was calculated as the number of VH sequences using a particular V-gene divided by the total number of VH sequences in that animal.Protein purification
[0126] IgM was purified on anti-IgM affinity matrix (BAC B.V., Netherlands, CaptureSelect #2890.05) as described in the protocol. Similarly, human Igκ and Igλ was purified on anti-L chain affinity matrix (CaptureSelect anti-Igκ #0833 and anti-Igλ # 0849) according to the protocol.
[0127] For rat IgG purification (Bruggemann et al. J Immunol 142, 3145-3150 (1989)) protein A and protein G agarose was used (Innova, Cambridge, UK, #851-0024 and #895-0024). Serum was incubated with the resin and binding facilitated at 0.1 M sodium phosphate pH 7 for protein G and pH 8 for protein A under gentle mixing. Poly-prep columns (Bio-Rad) were packed with the mixture and washed extensively with PBS pH7.4. Elution buffer was 0.1 M Sodium Citrate pH 2.5 and neutralization buffer was 1 M Tris-HCl pH 9.
[0128] Electrophoresis was performed on 4-15% SDS-PAGE and Coomassie brilliant blue was used for staining. MW standards were HyperPage Prestained Protein Marker (#BIO-33066, Bioline).Flow cytometry analysis and FISH
[0129] Cell suspensions were washed and adjusted to 5x105 cells / 100 µl in PBS-1% BSA-0.1% Azide. Different B-cell subsets were identified using mouse anti-rat IgM FITC-labelled mAb (MARM 4, Jackson Immunoresearch Laboratories) in combination with anti-B cell CD45R (rat B220)-PE-conjugated mAb (His 24, BD biosciences) or anti-IgD-PE-conjugated mAb (MARD-3, Abd Serotec). A FACS CantoII flow cytometer and FlowJo software (Becton Dickinson, Pont de Claix, France) was used for the analysis.
[0130] Fluorescence in situ hybridisation was carried out on fixed blood lymphocytes using purified IgH and IgL C-region BACs as described. (Meisner & Johnson Methods 45, 133-141 (2008))Immunization, cell fusion and affinity measurement
[0131] Immunizations were performed with 125 µg PG in CFA, 150 µg hGHR in CFA, 200 µg Tau / KLH in CFA, 150 µg HEL in CFA, 150 µg OVA in CFA at the base of the tail and medial iliac lymph node cells were fused with mouse P3X63Ag8.653 myeloma cells 22 days later as described (Kishiro et al. Cell structure and function 20, 151-156 (1995)). For multiple immunizations protein, 125 µg PG or HEL, or 100 µg hGHR or CD14 in GERBU adjuvant (www.Gerbu.com), was administered intraperitoneally as follows: day 0, day 14, day 28 and day 41 without adjuvant, followed by spleen cell fusion with P3x63Ag8.653 cells 4 days later (Meisner & Johnson Methods 45, 133-141 (2008)).
[0132] Binding kinetics were analyzed by surface Plasmon resonance using a Biacore 2000 with the antigens directly immobilized as described (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)).Detection of antigen-specific antibodies by ELISA
[0133] Rat serum samples were analysed for B-Gal IgG and IgM antibody and antigen titers using an antigen-coat, anti-IgG or IgM reporter ELISA. 96-well plates were coated with B-Gal overnight at 2-6 °C, blocked with PBS-Casein-Blocker / Diluent 1 X, washed with ELISA Wash Buffer, incubated with serum, washed with ELISA Wash Buffer, incubated with either a mixture of goat anti-rat IgG1-HRP, goat anti-rat IgG2a-HRP, and goat anti-rat IgG2b-HRP (each at a 1 / 5,000 dilution) or goat anti-rat IgM (1 / 5,000 dilution), washed with ELISA Wash Buffer, incubated with TMB Substrate Solution for 30 minutes and ELISA Stop Solution was added to the wells. Absorbance in the plate wells was measured at 450 nm. Except where noted above, incubations were for 1.5 to 2 hours at ambient temperature.Determination of IgM and IgG concentration in rat serum.
[0134] Rat serum samples were also analysed for the concentration of Total Rat IgG1, Rat IgG2b, and Rat IgM using a Double Antibody ELISA Sandwich assay format. Total Rat IgG1, Rat IgG2b, and Rat IgM concentrations were calculated using standard curves generated individually for each isotype. 96-well plated were coated with the respective isotype specific capture antibody (either mouse anti-rat IgG1, mouse anti-rat IgG2b, or goat anti-rat IgM) overnight at 2-6 °C, blocked with PBS-Casein-Blocker / Diluent 1 X, washed with ELISA Wash Buffer, incubated with serum, washed with ELISA Wash Buffer, incubated with the respective detecting antibody (either mouse anti-rat IgG or goat anti-rat IgM), washed with ELISA Wash Buffer, incubated with TMB Substrate Solution for 30 minutes and ELISA Stop Solution was added to the wells. Absorbance in the plate wells was measured at 450 nm. Except where noted above, incubations were for 1.5 to 2 hours at ambient temperature. Table 1 PCR* conditions to detect human IgH and IgL integration and expression IgH Primers Annealing Temp (Tm-5) Fragment size Hyg (5' BAC6)Hyg 3' F - 45954°C~400bpV4-34 (BAC6)205-20665°C~1kbV4-28 (BAC6)203-20465°C~1kbV3-11 (overlap BAC6-BAC3)448-46160°C~500bpV1-8 (BAC3)371-37260°C~300bpV4-4 (BAC3)393-39660°C~750bpV6-1 (BAC3-Annabel)359-36065°C~350bpJH (Annabel)368-36962°C~250bpµ-γ1 (Annabel)583-53562°C~3kbUra (3' Annabel)241-25356°C~3kbIgκ Primers Annealing Temp (Tm-5) Fragment size KDE313-31466°C~600bpcKappa307-30864°C~600bpV4-1333-33460°C~300bpV1-5329-33064°C~400bpV1-6331-33260°C~300bpV3-7309-31066°C~700bpV3-15311-31266°C~500bpIgλ Primers Annealing Temp (Tm-5) Fragment size V3-27215-21667°C~400bpV3-19213-21467°C~700bpV2-14211-21267°C~400bpV middle168-16965°C~500bpJLambda162-16367°C~800bpcLambda170-17167°C~500bpEnhancer172-17367°C~400bp*For DNA extraction from ear and tail clips the Genomic DNA Mini Kit (Bioline) was used._For PCRs 1kb or less in size GoTaq Green Master mix (Promega) was used under the following conditions: 94°C 2 mins, 32 x (94°C 30 secs, Tm-5 (below) 30 secs, 72°C 1 min [50 sec for Igκ / λ]), 72°C 2 mins. Annealing temperatures were set at the lowest primer Tm- 5 0< C (www.sigmagenosys.com / calc / DNACalc.asp). For PCRs >1kb KOD polymerase (Novagen) was used under the following conditions: 95°C 2 mins, 32 x (95°C 20 secs, Tm-5 20 secs, 70°C 90 secs), 70°C 2mins. Table 3 Primer Sequences NumberOligonucleotide sequence 5'-3'162GGGGCCAAGGCCCCGAGAGATCTCAGG163CACTGGGTTCAGGGTTCTTTCCACC168GTGGTACAGAAGTTAGAGGGGATGTTGTTCC169TCTTCTACAAGCCCTTCTAAGAACACCTGG170AGCACAATGCTGAGGATGTTGCTCC171ACTGACCCTGATCCTGACCCTACTGC172AAACACCCCTCTTCTCCCACCAGC173CGCTCATGGTGAACCAGTGCTCTG203GCTATTTAAGACCCACTCCCTGGCA204AAAACCTGCAGCAAGGATGTGAGG205GCTCCTTCAGCACATTTCCTACCTGGA206CCATATATGGCAAAATGAGTCATGCAGG211CTCTGCTGCTCCTCACCCTCCTCACTCAGG212GAGAGTGCTGCTGCTTGTATATGAGCTGCA213TGGCTCACTCTCCTCACTCTTTGCATAGGTT214GATGGTTACCACTGCTGTCCCGGGAGTTAC215ATCCCTCTCCTGCTCCCCCTCCTCATTCTCTG216TGATGGTCAAGGTGACTGTGGTCCCTGAGCTG238AACAAGTGCGTGGAGCAG241GTACTGTTGACATTGCGAAGAGC243TGGTTGACATGCTGGCTAGTC253TGTCTGGCTGGAATACACTC275276278TGACCATTGCTTCCAAGTCC NumberOligonucleotide sequence 5'-3'307GAGGAAAGAGAGAAACCACAGGTGC308CACCCAAGGGCAGAACTTTGTTACT309TGTCCAGGTATGTTGAAGAATGTCCTCC310TGGACTCTGTTCAACTGAGGCACCAG311GGCCTTCATGCTGTGTGCAGACTA312CAGGTCGCACTGATTCAAGAAGTGAGT313TTCAGGCAGGCTCTTACCAGGACTCA314TGCTCTGACCTCTGAGGACCTGTCTGTA329TCACGTGACTGTGATCCCTAGAA330CACTGTTATGCCAACTGAACAGC331CGTAGCAGTCCCCATCTGTAATC332ATGTCAGAGGAGCAGGAGAGAGA333CACGCCTCACATCCAATATGTTA334ATACCCTCCTGACATCTGGTGAA345GCTTTCAGTGATGGTCAGTGTGCTTATGAC346TGGAAGACCAGGAGATATTCAGGGTGTC359TTGCTTAACTCCACACCTGCTCCTG360TGCTTGGAACTGGATCAGGCAGTC368CACCCTGGTCACCGTCTCC369AGACAGTGACCAGGGTGCCAC371TGAGGAACGGATCCTGGTTCAGTC372ATCTCCTCAGCCCAGCACAGC383CCTCCCATGATTCCAACACTG384CTCACCGTCCACCACTGCTG385387TGCTCAGGCGTCAGGCTCAG388TGCTCAGGCGTCAGGCTCAG390ATGGACTGGACCTGGAGGATCC391TCCACGCTCCTGCTGCTGAC392ATGGAGTTTGGGCTGAGCTGG393TGAAACACCTGTGGTTCTTCC394TCATCTTCCTGCCCGTGCTGG396GACTCGACTCTTGAGGGACG398ATGTGGCCACAGGCTAGCTC400ATGAGGGTCCCCGCTCAG401ATGGAAGCCCCAGCTCAGC402CCTGGGAGTTACCCGATTGG412GGCGCGCCAAGCATCATGTCCTACCTGGCTG414429CAGTGCCAGCCTCGTCTCAT430AGGGGCCATCCACAGTCTTC448CTTCACTGTGTGTTCTTGGGATAC459GTGTAATGCTTTGGACGGTGTGTTAGTCTC461GCATAGCGGCGCGCCAAGCATCATGTCCTACCTGGCTG474GACATGAGAGTCCTCGCTCAGC475AAGCCCCAGCGCAGCTTC476ATGGTGTTGCAGACCCAGGTC477GTCCCAGGTTCACCTCCTCAG478TCCTCASYCTCCTCACTCAGG479CGTCCTTGCTTACTGCACAG480AGCCTCCTTGCTCACTTTACAG481CCTCCTCAYTYTCTGCACAG482GCTCACTCTCCTCACTCTTTGC483CCTCCTCTCTCACTGCACAG484GCCACACTCCTGCTCCCACT485ATGGCCTGGGTCTCCTTCTAC488490CTGTCGTTGAGATGAACCCCAATGTGAG534GGAACTGATGTGATCTCAGTCACACAGCTAATGCAAAGGTCAGCAGGCTGTTTACTGCCTGGAGGTTCATCGCCCAATTCCAAAGTCAC535CTAGTCTGCATGGGTCTCCGCAAAC550561562566570583CATGTCCGTATGTTGCATCTGC682GGGAAGATGAAGACAGATG761TGGAGTGGATTGGGAGT878GCGATCGCAAAGACGAAAGGGCCTCGTG879ACCTGGTGATCGCCAACAAATACTACC1066GCGGTGGGTCTCCCACGGGGGCAAACAGCAGTGGTGGACGGTGAGCGTACGGTTATCTATGCTGTCTCACCATAG1088CTGTCAGCTGGAAGCAGTTAAGGTTGGCCTTTGTCTGTATTCGTACGCACACGCTTTTCAATTCAATTCATC RESULTSThe human IgH and IgL loci
[0135] Construction of the human Ig loci employed established technologies to assemble large DNA segments using YACs and BACs (Davies et al. Nucleic acids research 20, 2693-2698 (1992); Davies et al. Biotechnology (N Y) 11, 911-914 (1993); Wagner et al. Genomics 35, 405-414 (1996); Popov et al. Gene 177, 195-201 (1996); Mundt et al.J Immunol 166, 3315-3323 (2001)). As multiple BAC modifications in E. coli frequently deleted repetitive regions such as switch sequences and enhancers, a method was developed to assemble sequences with overlapping ends in S. cerevisiae as circular YAC (cYAC) and, subsequently, converting such a cYAC into a BAC. Advantages of YACs include their large size, the ease of homologous alterations in the yeast host and the sequence stability, while BACs propagated in E. coli offer the advantages of easy preparation and large yield. Additionally, detailed restriction mapping and sequencing analysis can be better achieved in BACs than in YACs.
[0136] Sequence analysis and digests identified gene clusters of interest and ensured locus integrity and functionality to secure DNA rearrangement and switching over a wide region as shown in Figure 1. As shown previously, overlapping regions may generally favor joint integration when co-injected into oocytes (Wagner et al. Genomics 35, 405-414 (1996)). Thereby, insertion of BAC6-VH3-11, a 182 kb AsiSI-AscI fragment, with BAC3, a 173 kb NotI fragment, and BAC3-1N12M5I8 (Hu-Rat Annabel), a 193 kb NotI fragment, led to the reconstitution of a fully functional transgenic IgH locus (HC14) in the rat genome. Similarly, injection of BAC9, BAC (14+5) and BAC3-1N12M5I8, led to the reconstitution of a fully functional transgenic IgH locus (HC30) in the rat genome.
[0137] Similarly, the human Igκ locus was integrated by homologous overlaps. The human Igλ locus was isolated intact as a ~300 kb YAC and also fully inserted into a rat chromosome. The integration success was identified by transcript analysis which showed V(D)J-C recombinations from the most 5' to the most 3' end of the locus injected. Multiple copies were identified by qPCR (not shown) and it is likely that head to tail integrations occurred. In all cases, transgenic animals with single-site integrations were generated by breeding.Breeding to homozygosity
[0138] The derivation of transgenic rats by DNA microinjection into oocytes, their breeding and immunization is comparable to the mouse. However, ZFN technology to obtain gene knock-outs has only been reported recently (Geurts et al. Science 325, 433 (2009); Flisikowska et al. PloS one 6, e21045 (2011)). Silencing of the rat IgH locus by J H deletion using ZFN KO technology has been described (Menoret et al. European journal of immunology 40, 2932-2941 (2010)) and a manuscript describing silencing of the rat IgL loci, targeting of Cκ and deletion of J-Cλ genes, is in preparation. We derived multiple founders with integrated human Ig loci and silenced endogenous Ig production; all analyzed by PCR and FISH with complete trans-locus integration selected and interbred (Table 4). Several founder rats carried low translocus copy numbers; with the rat C-gene BAC in OmniRat ™< likely to be fully integrated in 5 copies as determined by qPCR of Cµ and Cα products (not shown). Identification by FISH of single position insertion in many lines confirmed that spreading or multiple integration of BAC mixtures were rare; an advantage for breeding to homozygosity, which was achieved. Table 4: Generated rat lines: transgenic integration, knock-out and gene usagehuman V H rat C H human Igkhuman IglZFN KOFISHrat lineVH BACs about 400 kb(Annabel) 193 kbBACs 300 kbIgl YAC 300 kbJ H KOIgκ KOIgy KOrat chromosomeHC14√√5q22HC30√√15q24OmniRat √√√√√√√homozygous KOs LC#79√17LC#6.2√6q23#117√6q32#23√4#35√11
[0139] Rats carrying the individual human transloci - IgH, Igκ and Igλ - were crossbred successfully to homozygosity with Ig locus KO rats. This produced a highly efficient new multi-feature line (OmniRats ™< ) with human V H -D-J H regions of over 400 kb containing 22 functional V H s and a rat C region of ~116 kb. DNA rearrangement, expression levels, class-switching and hypermutation was very similar between the different founders and comparable to wt rats. This is probably the result of the associated rat constant region accommodating several Cs and with the 3'E (enhancer control) region in authentic configuration. OmniRat animals carrying the HC14 heavy chain locus were bred with OmniRat animals carrying the HC30 locus to generate OmniRat2. OmniRat2 animals contain two heavy chain loci containing 43 functional VHs.B-cell development in the knock-out background
[0140] To assess whether the introduced human Ig loci were capable of reconstituting normal B-cell development flow cytometric analyses were performed. Particular differentiation stages were analyzed in spleen and bone marrow lymphocytes (Osbom et al. J Immunol 2013; 190:1481-1490), which previously showed a lack of B-cell development in JKO / JKO rats (Menoret et al. European journal of immunology 40, 2932-2941 (2010)), and no corresponding IgL expression in κKO / κKO as well as in λKO / λKO animals (data not shown). Most striking was the complete recovery of B-cell development in OmniRats compared to wt animals, with similar numbers of B220(CD45R) +< lymphocytes in bone marrow and spleen. IgM expression in a large proportion of CD45R +< B-cells marked a fully reconstituted immune system. Size and shape separation of spleen cells was indistinguishable between OmniRats ™< and wt animals and thus successfully restored in the transgenic rats expressing human idiotypes with rat C region. Moreover, the small sIgG +< lymphocyte population was present in OmniRats (Osborn et al. J Immunol 2013; 190:1481-1490).
[0141] The analysis of other OmniRat lymphocyte tissues showed that they were indistinguishable from wt controls and, for example, T-cell subsets were fully retained (data not shown), which further supports the notion that optimal immune function has been completely restored.Ig levels in serum
[0142] To gain unambiguous information about antibody production we compared quality and quantity of serum Ig from HC30 and HC14 / HC30 animals (FIG. 4) The results demonstrated that animals with one Ig locus (HC30) expressed similar amounts of IgM and IgG in serum compared to animals with two heavy chain loci (HC14 and HC30).
[0143] ELISA analysis of serum from immunized OmniRat animals with one HC locus (HC30) or two HC loci (HC14 and HC30) revealed similar titers of anti-beta gal IgM and IgG in such animals (FIG. 5).Diverse human H- and L-chain transcripts
[0144] Extensive transcriptional analysis was carried out using blood lymphocytes or spleen cells from transgenic rats with functional endogenous Ig loci. RT-PCR from specific human V H group forward to Cµ or Cγ reverse primers, showed human V H DJ H usage. For L-chain analysis group specific human Vκ or Vλ forward primers were used with Cκ or Cλ reverse primers.
[0145] In addition, B-cells from animals were collected, RNA was prepared and reverse transcribed, and the resulting cDNA was used as template to amplify the full variable region of the Ig heavy chain rearranged locus (the VH region). This amplified product was then prepared for next-generation sequencing (NGS) and the full VH repertoire of each animal was determined by NGS. After post-processing and quality control of the raw NGS reads, the V-gene usage of each animal was determined by aligning each unique VH sequence to the germline V-gene reference sequence. The percent V-gene usage was calculated as the number of VH sequences using a particular V-gene divided by the total number of VH sequences in that animal. Of the 43 total human V-genes introduced on the transgenes in OmniRat2, we detect 33 V-genes expressed at a level greater than 0.1% in a rearranged IgG transcript.
[0146] The results of the RT-PCR VH-gene expression analysis and NGS repertoire analysis are summarized in Figure 1. These result showed the use of all integrated human V H genes regarded as functional (Lefranc & Lefranc The immunoglobulin factsbook. FactsBook Series, Academic Press, GB, 45-68 (2001)) in combination with diverse use of D segments and all J H segments.
[0147] The results clearly demonstrate that addition of more variable regions provided by the two loci (HC14+HC30) leads to an even broader antibody repertoire. In conclusion, we have demonstrated that antigen specific high affinity Abs of potentially any class can be produced in transgenic animals with one or two Ig heavy chain loci. This technology will allow the production of fully human Abs of any class or fragments thereof in response to antigen challenge for use as therapeutic or diagnostic agents in man. By using different loci our technology also allows for the production of high affinity matured antibodies from rodents for use as reagents, diagnostics or for the treatment of humans.DISCUSSION
[0148] A combination of human and rat genes to assemble a novel IgH locus has resulted in highly efficient near normal expression of antibodies with human idiotypes. Moreover, integration of the human Igκ and Igy loci revealed that chimeric Ig with fully human specificity is readily produced and that association of rat C-regions with human L-chains is not detrimental. Advantages of using part of the rat IgH locus are that speciesspecific C regions and enhancer control elements are kept in their natural configuration, with essentially only the diverse human V H D J H region being transplanted. Furthermore, expression of antibodies with rat Fc-regions allow normal B-cell receptor assembly and optimal activation of the downstream signalling pathway essential for the initiation of highly efficient immune responses. In particular, the quality of an immune response to antigen challenge relies on combined actions of many receptor associated signalling and modifier components (see: www.biocarta.com / pathfiles h bcrpathway.asp).
[0149] The approach of using YACs and BACs, and interchanging between the two, has the advantage of both, speed and the ability to check integrity when making constructs of large regions by overlapping homology. Several founder rats carried low translocus copy numbers; with the rat C-gene BAC in OmniRat likely to be fully integrated in 5 copies as determined by qPCR of Cµ and Cα products (not shown). Identification by FISH of single position insertion in many lines confirmed that spreading or multiple integration of BAC mixtures were rare; an advantage for breeding to homozygosity, which was achieved. Little was known whether extensive overlapping regions would integrate, such as to maintain the full functionality, essential for DNA rearrangement. Previously, overlapping integration has been reported but for much smaller regions (<100 kb) (Wagner et al. Genomics 35, 405-414 (1996); Bruggemann et al. European journal of immunology 21, 1323-1326 (1991)) and our results suggest that desired integration by homology or in tandem is a frequent event. This eases the transgenic technology substantially as no laborious integration of large YACs into stem cells and subsequent animal derivation therefrom has to be performed. (Mendez et al. Nature genetics 15, 146-156 (1997); Davies et al. Biotechnology (N Y) 11, 911-914 (1993)) In addition, ZFN technology, also performed via DNA injection (Geurts et al. Science 325, 433 (2009); Menoret et al. European journal of immunology 40, 2932-2941 (2010)), produced Ig KO strains easily and may well be the future technology of choice for gene disruptions and replacement. Silenced endogenous Ig gene expression in OmniRats, containing human-rat IgH and human IgL loci, has the advantage that no interfering or undesired rat Ig could give rise to mixed products. Interestingly, immunization and hybridoma generation in OmniRats still producing wt Ig revealed that many products were fully human, human-rat IgH and human IgL, despite incomplete Ig KOs. Here, despite the extensive number of wt V genes, it was remarkable that the introduced human genes amplified readily and thus showed to be efficient expression competitors. This is in line with the observation of generally good expression levels of all our integrated transgenes, which favorably compete with the endogenous loci. Previously in mice expressing a human antibody repertoire, Ig KOs were essential as little expression of human products was found when wt Ig is released (Bruggemann et al. PNAS 86, 6709-6713 (1989); Mendez et al. Nature genetics 15, 146-156 (1997)).
[0150] It is possible that the production of fully human Ig loci even in Ig KO mice is suboptimal as strain specific cis-acting sequences are required for high-level expression. In the mouse an enhancer region downstream of Cα plays a vital role in class-switch recombination (Vincent-Fabert et al. Blood 116, 1895-1898 (2010)) and it is likely that elements in that region may facilitate hypermutation (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)). This may be the reason why immune responses and generation of diverse hybridomas at high frequency may be difficult in mice carrying even a large fully human locus (Davis et al. Cancer metastasis reviews 18, 421-425 (1999); Lonberg Current opinion in immunology 20, 450-459 (2008)). As the chimeric human-rat IgH locus facilitates near wt differentiation and expression levels in OmniRats, it can be concluded that the endogenous rat C region and indeed the -30 kb enhancer sequence 3' of Cα are providing optimal locus control to express and mature human V H genes. Another region, Cδ with its 3' control motif cluster (Mundt et al. J Immunol 166, 3315-3323 (2001)), has been removed from the chimeric C-region BAC since silencing or a lack of IgD did not appear to reduce immune function 37. Normally, mature IgM +< IgD +< B-cells downregulate IgD upon antigen contact, which initiates class-switch recombination (Chen Immunol Rev 237, 160-179 (2010)). Thus, switching may be increased without IgD control, which is supported by our finding that IgG transcripts and serum levels are significantly lower when the Cδ region is retained in transgenic constructs (data not shown).
[0151] The production of specific IgG in OmniRats is particularly encouraging as we found that in various immunizations mAbs with diversity in sequence and epitope, comparable to what was produced in wt controls, could be isolated via spleen and lymph node fusion. V-gene, D and J diversity was as expected and nearly all segments were found to be used productively as predicted (Lefranc & Lefranc The immunoglobulin factsbook. FactsBook Series, Academic Press, GB, 45-68 (2001)). This was in stark contrast to mice carrying fully human transloci where clonal expansion from a few precursor B-cells produced little diversity (Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011)). Since the number of transplanted V-genes is only about half of what is used in humans we anticipated to find restricted immune responses and limited diversity when comparing OmniRats with wt animals. However, this was not the case and a comparison of CDR3 diversity in over 1000 clones revealed the same extensive junctional differences in OmniRats as in wt animals. The few identical gene-segment combinations were further diversified by N-sequence additions or deletion at the V H to D and / or D to J H junctions and also by hypermutation. Thus, it is clear that the rat C region sequence is highly efficient in controlling DNA rearrangement and expression of human V H DJ H . Extensive diversity was also seen for the introduced human Igκ and Igy loci, similar to what has previously been shown in mice (Nicholson et al. J Immunol 163, 6898-6906 (1999); Pruzina et al. Protein engineering, design & selection : PEDS 24, 791-799 (2011); Popov et al. The Journal of experimental medicine 189, 1611-1620 (1999)). Hence, substantially reduced efficiency in the production of human antibodies from mice (Lonberg Nature biotechnology 23, 1117-1125 (2005)) has been overcome in OmniRats, which diversify rearranged H-chains reliably and extensively by class-switch and hypermutation to yield high affinity antibodies in bulk rather than occasionally. The yield of transgenic IgG and the level of hypermutation, impressively utilized in antigen-specific mAbs, showed that clonal diversification and production level are similar between OmniRats and wt animals. Routine generation of high affinity specificities in the subnanomolar range was even accomplished by different single immunizations and again compares favorably with wt animals; results that have not been shown in transgenic mice producing human antibody repertoires from entirely human loci. (Mendez et al. Nature genetics 15, 146-156 (1997))
[0152] In summary, to maximize human antibody production an IgH locus that uses human genes for antibody specificity but rodent genes for control of differentiation and high expression should be regarded essential. L-chain flexibility is a bonus as it permits highly efficient human IgH / IgL assembly even when wt Ig is present. For therapeutic applications chimeric H-chains can be easily converted into fully human Abs by C-gene replacement without compromising the specificity.
Claims
1. A non-human transgenic animal comprising at least one inactivated endogenous Ig locus and at least two artificial transgenic Ig heavy chain loci comprising human overlapping immunoglobulin VDJ gene segments integrated in the animal's genome at different chromosomal sites, wherein said transgenic animal expresses a diverse repertoire of antibodies encoded by the V-genes from the transgenic immunoglobulin loci located at the different chromosomal sites, wherein the at least two artificial transgenic Ig heavy chain loci together comprise greater than 40 heavy chain V gene segments in an unrearranged or partially rearranged configuration, wherein a first artificial transgenic Ig heavy chain locus of the at least two artificial transgenic heavy chain loci is HC30 (Figure 1B) and is reconstituted in the animal's genome by overlapping regions of 3 Bacterial Artificial Chromosomes (BACs), wherein the first artificial transgenic heavy chain locus comprises: human heavy chain V gene segments IgHV3-74, IgHV3-73, IgHV3-72, IgHV2-70, IgHV1-69, IgHV3-66, IgHV3-64, IgHV4-61, IgHV4-59, IgHV1-58, IgHV3-53, IgHV5-51, IgHV3-49, IgHV3-48, IgHV1-46, IgHV1-45, IgHV3-43, IgHV3-21, IgHV3-20, IgHV1-18, IgHV3-15, IgHV3-13, and IgHV6-1; human heavy chain D segments; human heavy chain JH1-6; and a rat constant region spanning from Eµ to a rat 3' enhancer sequence; wherein the animal lacks a functional endogenous Ig heavy chain locus, and wherein the animal is a rat or a mouse.
2. The transgenic animal according to claim 1 wherein the 3 BACs are: i) a first BAC comprising a 185kb Notl fragment of BAC9 comprising IgHV3-74 to IgHV1-58; ii) a second BAC comprising rat CH genes immediately downstream of human VH6-1-Ds-JHs region; iii) a third BAC comprising Bsiwl fragment comprising 90.6 kb of BAC14 overlapping with BAC9, 86kb encompassing IgHV5-51 to IgHV1-45, a 1.7kb synthetic fragment comprising IgHV3-43 in the centre, a 111.7kb fragment of BAC 5 comprising IgHV3-21 to IghV3-13, and a 6.1kb region which overlaps with a BAC of ii).
3. The transgenic animal according to claim 1, wherein a second artificial transgenic Ig heavy chain locus of the at least two artificial transgenic heavy chain loci is HC14 (Figure 1A) and is reconstituted in the animal's genome by overlapping regions of 3 BACs, wherein the second artificial transgenic heavy chain locus comprises: human heavy chain V gene segments IgHV4-39, IgHV3-38, IgHV3-35, IgHV4-34, IgHV3-33, IgHV4-31, IgHV3-30, IgHV4-28, IgHV2-26, IgHV1-24, IgHV3-23, IgHV3-22-2, IgHV3-11, IgHV3-9, IgHV1-8, IgHV3-7, IgHV2-5, IgHV7-4, IgHV4-4, IgHV1-3, IgHV1-2, and IgHV6-1; human heavy chain D segments; human heavy chain JH1-6; and a rat constant region spanning from Eµ to a rat 3' enhancer sequence.
4. The transgenic animal according to claim 3 wherein the 3 BACs are: i) a first BAC comprising the authentic region spanning VH4-39 to VH3-23 followed by VH3-11; ii) a second BAC comprising rat CH genes immediately downstream of human VH6-1-Ds-JHs region; iii) a third BAC comprising the authentic region spanning VH3-11 to VH6-1.
5. The transgenic animal according to claim 3 or 4 wherein the transgenic animal comprises a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO: 2.
6. The transgenic animal according to claim 5 wherein the transgenic animal comprises a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO: 11.
7. The transgenic animal according to claim 1 or 2, wherein said transgenic animal lacks a functional endogenous Ig light chain locus.
8. The transgenic animal according to claim 1 or claim 2, wherein said rat 3' enhancer comprises the sequence set forth as SEQ ID NO: 1.
9. The transgenic animal according to claim 1 or claim 2, wherein the constant region gene comprises a constant region gene selected from the group consisting of Cµ and Cγ.
10. The transgenic animal according to claim 1 or claim 2, wherein each of the human immunoglobulin variable region, the human immunoglobulin diversity region, the human immunoglobulin joining region, the immunoglobulin constant region, and the rat 3' enhancer are in the relative positions shown in FIG. 1a or FIG 1b.
11. The transgenic animal according to claim 10, wherein the transgenic animal comprises a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO: 2 or comprises a nucleic acid sequence substantially homologous to the nucleic acid sequence set forth as SEQ ID NO: 11.
12. The transgenic animal according to any one of the preceding claims, wherein said V-D-J regions are rearranged and form a complete exon encoding a heavy chain variable domain.
13. The transgenic animal according to any one of the preceding claims, wherein the animal is a rat.
14. A method for producing antibodies, comprising immunizing the transgenic animal as claimed in any one of the preceding claims with an immunogen.
15. A method for producing a monoclonal antibody, comprising: A) (i) immunizing the transgenic animal as in any of claims 1-13 with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; and (iii) using said monoclonal antibody producing cell to produce said monoclonal antibody that specifically binds to said immunogen, or using said monoclonal antibody producing cell to produce a hybridoma cell that produces said monoclonal antibody and using said hybridoma cell to produce said monoclonal antibody, preferably wherein said monoclonal antibody has a human idiotype; or B) (i) immunizing the transgenic animal as in any of claims 1-13 with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody producing cell a monoclonal antibody nucleic acid which encodes said monoclonal antibody that specifically binds to said immunogen; and (iv) using said monoclonal antibody nucleic acid to produce said monoclonal antibody that specifically binds to said immunogen, preferably wherein said monoclonal antibody has a human idiotype; or C) (i) immunizing the transgenic animal as in any of claims 1-13 with an immunogen, (ii) isolating a monoclonal antibody producing cell from said transgenic animal wherein said monoclonal antibody producing cell produces a monoclonal antibody that specifically binds to said immunogen; (iii) isolating from said monoclonal antibody producing cell a monoclonal antibody nucleic acid which encodes said monoclonal antibody that specifically binds to said immunogen; (iv) modifying said monoclonal antibody nucleic acid to produce a recombinant nucleic acid encoding a fully human monoclonal antibody; and (v) using said recombinant nucleic acid encoding a fully human monoclonal antibody to produce the encoded fully human monoclonal antibody.