Detection and quantification of nucleic acids
Patent Information
- Application Number
- EP2022899651
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-12-01
- Filing Date
- 2022-12-01
- Publication Date
- 2025-12-03
AI Technical Summary
Current nucleic acid detection methods are cumbersome, require specialized equipment, highly trained personnel, and lengthy sample preparation, making them unsuitable for resource-limited settings and inefficient for rapid diagnostics, especially in detecting specific sequences without amplification steps and prone to errors.
The method employs toehold-mediated strand displacement (TMSD) for electronic detection of single-stranded nucleic acids using a graphene field effect transistor (gFET) chip, allowing label-free, enzyme-free, and isothermal detection at room temperature, eliminating the need for amplification and reducing equipment requirements, with signal amplification through displacement of multiple oligonucleotides.
This approach enables sensitive detection of nucleic acids at attomolar concentrations without amplification, is robust, and can be miniaturized for portable use, addressing the limitations of existing methods by providing a rapid, cost-effective, and user-friendly diagnostic tool suitable for resource-limited settings.
Smart Images

Figure 000034 
Figure 000035 
Figure 000036
Abstract
Description
[0001] Detection and quantification of nucleic acids
[0002] Field of the invention
[0003] The present invention relates to processes for electronically detecting a single- stranded nucleic acid and biosensors that may be used for such processes. The present invention also relates to the use of processes and biosensors for detecting one or more single-stranded nucleic acids.
[0004] Background
[0005] The identification of specific nucleic acid sequences is an important tool in the identification of biological species as well as monitoring of chemical markers for health and disease. Biological species identification can aid in applications as diverse as medical diagnostics to identify pathogenic organisms as well as in the monitoring of different pathogen strains, monitoring for food safety or environmental research. Nucleic acids acting as messengers or indicators of health and disease, e.g., mRNA (messenger RNA) or miRNA (microRNA), can also be used for diagnostic and monitoring purposes. A multitude of nucleic acid detection methods such as PCR (polymerase chain reaction), real-time PCR and isothermal amplification and even gene sequencing are now standard diagnostic methods. Many of these methods are very sensitive and versatile bioanalytical techniques but are also cumbersome due to lengthy sample purification or assay procedures, additional equipment needed, the need for highly trained personnel and an overall long time from sample taken to reach a result.
[0006] When diagnostic methods are deployed to a large number of people, an acceptable cost should be in line with the ASSURED criteria (Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Equipment-free and Deliverable to end-users) principle according to a World Health Organization Bulletin on the selection of diagnostic tests. In this regard, deployment of diagnostic methods with high sensitivity and specificity that can operate in resource limited and remote settings at room temperature without an external power source are therefore highly desirable.
[0007] Toehold-mediated strand displacement (TMSD) as a biological detection mechanism pathway is of particular interest for addressing at least a portion or combinations of the ASSURED criteria. In TMSD, nucleic acid strands such a ribonucleic acid (RNA) or desoxyribonucleic acid (DNA) spontaneously anneal to form a duplex based on complementary Watson-Crick base pairing. A displacement of base pairs is driven by the net gain in free energy due to having bases paired rather than being single stranded. Therefore, a single stranded invading strand could deliberately displace other strands already annealed to their complement in a double stranded arrangement. This exchange can happen within a matter of seconds and minutes and requires a free single stranded complementary “toehold” domain in the nucleotide duplex. The toehold can be as short as 1 nucleotide (nt) to start the displacement. These displacements happen in solution at a wide temperature range. In the field of dynamic nucleic acid nanotechnology this principle has led to the creation of intricate cascading mechanisms including the design of logic operations and enzyme-free catalytic systems. The displacement reaction can be fine tuned to the anticipated operating temperature by choosing a suitable length and base pair composition or by introducing nucleic acid analogues not found in natural DNA or RNA but being subject to the same Watson-Crick base pairing mechanisms.
[0008] For example, TMSD has been adapted to perform tasks of nano-sized molecular machines including detection mechanisms for diagnostic purposes. Strand displacement has been demonstrated as a detection method, e.g., for tuberculosis pathogen mRNA markers with a fluorochrome-quencher reporter mechanism.
[0009] Traditionally, the detection of specific sequences of DNA and RNA has long relied on polymerase chain reaction (PCR). Primers are used to target a specific sequence of DNA or RNA, which is then amplified if it is present with the help of polymerase enzymes until the nucleic acid quantity is sufficient to be detected. Detection methods for PCR products (amplicons) traditionally include a size separation gel in combination with intercalating fluorescent dyes, with direct detection as amplicons emerge in real-time or targeted fluorescent probes.
[0010] PCR reactions often require temperature cycling and accurate and fast temperature changes in the range of 50-100°C. This requires sophisticated, cumbersome, and often expensive equipment. Isothermal amplification methods are less demanding with regards to equipment but require sophisticated sequence design and the presence of enzymes to perform the amplification, which can put limitations on the storage temperature and expiry date of reagents. Similarly, fluorochromes needed for detection of successful amplification require light and heat protected storage and frequently need sophisticated equipment to achieve detection at low concentration levels. All of the current techniques available for analysis of nucleic acid markers require specialised equipment, space and infrastructure, various reagents with specific storage conditions, highly trained personnel and lengthy test times. As most amplification techniques for nucleic acids are enzyme-mediated and require the use of primers, careful storage and handling of the enzymes and primers, other reagents and the samples themselves is required given their sensitivity to heat, light and oxidation. The current equipment used to analyse nucleic acids is often large in size, and dedicated space is required. This then means that samples must be transported to the analysis facility, which further increases the time required for results.
[0011] Amplification of the nucleic acid marker of interest first requires the use of a primer to identify the marker among the other nucleic acids present in the sample. Where errors occur at this stage, the subsequent amplification step results in the amplification of the error and incorrect results being reported. Other typical drawbacks of current techniques include false positive results, the dependence on the use of primers and enzymes and limited tuning of the process available.
[0012] There remains the need for efficient, sensitive and economical processes and devices that allow for fast and efficient detection and / or quantification of nucleic acids present in a biological sample.
[0013] Summary of the invention
[0014] The present invention relates to processes and devices that are useful in the detection and / or quantification of nucleic acid sequences. Current processes used for the detection of nucleic acids are usually enzyme -based, require separate amplification steps and use direct detection techniques, i.e. the nucleic acid of interest is detected. In contrast, the processes disclosed herein rely on the electronic detection of a displaced moiety that is mediated by the binding of the nucleic acid. Since the binding of a single unit of the nucleic acid results in the displacement of multiple moieties that are then electronically detected, a separate amplification step is not required.
[0015] In relation to the present invention the inventors disclose the electronic detection of single stranded nucleotide sequences of interest mediated by a series of strand displacement reactions that result in the release of multiple smaller charged oligonucleotides (see for instance, Figure 1). These signal nucleotides can be electronically detected by altering the electrochemical signal on a gFET (graphene field effect transistor) chip surface rather than a colorimetric or fluorescent / luminescent readout. The detection can be performed at room temperature, unless it is used downstream of another assay like PCR that uses a different temperature.
[0016] This method has the potential to be label-free, enzyme-free and isothermal at room temperature conditions with an electronic read-out. By means of combining chip feature miniaturization and microfluidics signal detection can be configured for multiple targets. This combination of advantages means that a device integrating the proposed TMSD mechanism can be miniaturised and mobile, addressing several ASSURED criteria.
[0017] Much of the previous reported detection methods rely on an optical signal readout such as a fluorescent signal of a nucleotide rather than an electronic read-out which is the subject of the present invention. For instance, some reported technology combines a readout method detecting a change in fluorescent signal and fluorescence polarisation. In contrast the present invention relies on electronic readout by a binding event on a graphene chip surface.
[0018] As used herein the term "electronically readable" in the context of an electronically readable nucleic acid sequence, refers to a nucleic sequence which is detected by altering the electrochemical signal on a gFET (graphene field effect transistor) chip surface rather than employing an optical or spectroscopic readout such as a colorimetric, fluorescent or phosphorescent (luminescent) readout. Therefore the present invention should be contrasted to similar technologies which utilise optical or spectroscopic readout methodology. Thus the invention relates to embodiments of electronically readable single-stranded nucleic acid sequences which are sequences which do not involve detecting a change in a fluorescent signal and fluorescence polarisation. Thus the invention also relates to embodiments of electronically readable single-stranded nucleic acid sequences which do not involve detecting a colorimetric change.
[0019] Since nucleic acid sequences show specific binding to a complementary sequence, the bindingdisplacement process disclosed herein can be tuned to detect a specific sequence by using a complementary sequence that is complementary to the nucleic acid sequence of interest. The processes disclosed herein rely on the use of a nucleic acid sequence that is in electronic communication with the graphene surface, where the sequence is complementary to the sequence of interest. This sequence is hybridised with an oligonucleotide that is subsequently displaced and detected in the event the nucleic acid of interest is present. This displacement of the oligonucleotide is mediated by the binding of the nucleic acid of interest through a toehold strand displacement mechanism. The toehold region in this context is a free, single-stranded domain present that is capable of binding with an incoming, complementary sequence. In the processes disclosed herein, the incoming sequence comprises the nucleic acid sequence of interest, while the toehold region discussed above is part of a sequence that may be attached to a surface. Binding of the incoming nucleic acid sequence to the toehold region results in further hybridisation of the incoming nucleic acid and concurrent displacement of the bound oligonucleotide, which is subsequently detected electronically. The binding of a single nucleic acid may result in the displacement of more than one oligonucleotide (see for example Figure 5), such that the signal that is detected appears to be amplified in relation to the incoming nucleic acid. In Figure 1, the displaced nucleic acid is starting another sequence of toehold mediated displacement. The displaced nucleic acids of this reaction are then electronically detected.
[0020] The present disclosure also relates to a process where the nucleic acid sequence that comprises the initial toehold region which may be immobilised on a surface, specifically a graphene surface that is capable of transducing a change in charge on the surface into a change in current that is subsequently detected by appropriate means.
[0021] Therefore according to a first aspect, the present invention provides a method for producing one or more electronically readable single- stranded nucleic acid sequences, said method comprising the steps of:
[0022] 1) selecting: i) a partially double- stranded detection gate nucleic acid construct (DG) which comprises of a. a single-stranded detection substrate nucleic acid sequence (DSSS) characterised with a partial region that is complementary with a partial region of the reporter nucleic acid sequence (RSS), and a toehold sequence (THS) region which is non-complementary to the RSS but is partially complementary to a partial sequence of the single-stranded invader nucleic acid sequence (ISS); and b. a single- stranded RSS characterised with a region that is complementary with a partial region of the DSSS, and a region which is complimentary to the one or more pre-electronic readable regions of the signal substrate strand (SSS) but is non- complementary to either the RSS, the DSSS or the ISS; ii) a single-stranded invader nucleic acid sequence (ISS) characterised with a region which is complementary to the THS of DSSS; iii) a partially double- stranded signal gate construct (SG) comprising of a. the SSS characterised by being the complement of the RSS, including a toehold sequence (THS) also complementary to the RSS, and b. multiple pre-electronically readable signal oligonucleotides (SO) characterised by being complementary to part of the SSS but not the THS of SSS;
[0023] 2) reacting together the DG with the ISS in a manner and under conditions such that the THS region on the DG initiates binding of the ISS and results in the displacement of the RSS; and wherein the RSS further binds to the THS of SG and liberates said one or more electronically readable single-stranded SO sequences.
[0024] According to a second aspect, the present invention provides a method for producing one or more electronically readable single- stranded nucleic acid sequences, said method comprising the steps of:
[0025] 1) selecting: a partially double-stranded detection gate nucleic acid sequence (DG) comprising a detection substrate strand (DS) and one or multiple signal oligonucleotide (SO) strand comprising pre-electronic readable sequences and wherein the DS and SO have partial complementarity, and that the DG is also characterised with a toehold sequence region (THS) and a single-stranded invader nucleic acid sequence (ISS) characterised with a region which is complementary to the THS and SO regions and
[0026] 2) reacting together the DG with the ISS in a manner and under conditions such that the THS region on the DG initiates binding of the ISS and results in the displacement of the one or more electronically readable single-stranded SO from the pre-electronically readable region, wherein the one or more electronically readable single- stranded nucleic acid sequences are the same or different. In certain embodiments and with reference to both aspects, electronically readable singlestranded nucleic acid sequences are readable on a gFET graphene surface.
[0027] The methods and devices incorporating the methods disclosed herein relate to the detection of nucleic acid sequences of interest by the displacement and subsequent detection of one or more electronic ally-readable single-stranded nucleic acid sequences. The displacement mechanism is favoured owing to the increase in entropy upon release of the bound sequences and the stable double-stranded sequences that result from the hybridisation of complementary nucleic acid strands.
[0028] In an embodiment of the first and second aspects, the single-stranded invader nucleic acid sequence is a single- stranded RNA or a single- stranded DNA. In some embodiments, the single-stranded invader nucleic acid is a messenger RNA (mRNA) or a micro RNA (miRNA).
[0029] In some embodiments of the first and second aspects, the single-stranded invader nucleic acid sequence may be a natural nucleic acid sequence. The invader nucleic acid sequence is so named as it will be of viral origin, bacterial origin, human origin or microbial origin that is based on the disease one may wish to detect. For instance, certain mRNAs could be a cancer diagnostic marker or relate to another non-communicable disease.
[0030] In other embodiments of the first and second aspects, the single- stranded invader nucleic acid sequence is a locked nucleic acid or a peptide nucleic acid.
[0031] In other embodiments of the first and second aspects, the single- stranded invader nucleic acid sequence comprises one or more inosin nucleosides.
[0032] In other embodiments of the first and second aspects, the single- stranded invader nucleic acid sequence is in the form of an aptamer.
[0033] In other embodiments of the first and second aspects, the components of DG and / or SG and / or single-stranded invader nucleic acid sequence are an unnatural nucleic acid sequence. In another embodiment of the first and second aspects, displacement of the electronically- readable single-stranded nucleic acid sequence is a result of toehold strand displacement mediated by the single stranded invader nucleic acid sequence.
[0034] In some embodiments, the single-stranded detection substrate nucleic acid sequence is an oligonucleotide.
[0035] In a further embodiment of the first and second aspects, the method includes the further step of analysing the single- stranded nucleic acid of a PCR reaction or another polymerase- mediated reaction like sequencing by synthesis.
[0036] The present inventors have found that the methods and devices disclosed herein rely on the generation in a difference in surface charge as a result that is detected as a result of the displacement of the electronically-readable single- stranded nucleic acid sequences. This change in charge on the surface is detected by an appropriate sensor.
[0037] In some embodiments, the electronically-readable single- stranded nucleic acid sequences are modified to comprise additional charged groups. In some embodiments, the charged groups may be phosphate groups. In other embodiments the sequence may comprise biotin or streptavidin or their analogues.
[0038] In a further embodiment of the first and second aspects, the electronically-readable singlestranded nucleic acid sequences displaced are detected by a field effect transistor (FET).
[0039] Since the processes and devices disclosed herein comprise a graphene surface and in certain embodiments, a field effect transistor, the processes and devices could be capable of far greater sensitivity in measurement. In contrast to detection by colorimetric or spectrophotometric means, the limit of detection that may be achieved by the processes and devices disclosed herein is much lower than currently achieved in the field. For example, the detection of nucleic acids present is as low as attomolar (IO-18) concentrations may be achieved without amplification of the signal to be detected. This is because the methods and devices disclosed herein may be modified such that the binding of a single nucleic acid strand can result in the displacement and detection of more than one electronically-readable single-stranded nucleic acid sequence. This is achieved by hybridising a detection substrate nucleic acid sequence with multiple smaller electronically-readable single- stranded nucleic acid sequences that undergo displacement, as a result of the initial binding of the single- stranded invader nucleic acid sequence at the toehold region of the single-stranded detection substrate nucleic acid sequence.
[0040] In a further embodiment of the first and second aspects, the single- stranded invader nucleic acid sequence is present at a concentration from about 1 x 10’6M to about 1 x 10’18M. In some embodiments, a single-stranded invader nucleic acid displaces one single- stranded signal oligo nucleotide sequence. This may be an indirect displacement via a reporter sequence (first aspect) or direct displacement (second aspect). In other embodiments, a single-stranded invader nucleic acid displaces more than one single- stranded signal oligo nucleotide sequence. In other embodiments, a single-stranded invader nucleic acid sequence displaces between 1 and 10 single-stranded signal oligonucleotide nucleic acid sequences, for example, 2, 3, 4, 5, 6, 7, 8, 9 or 10 single- stranded signal oligonucleotide nucleic acid sequences.
[0041] Since the methods discussed herein are not enzyme -based or require sensitive reagents, the processes are much more robust than those currently used in the field and may be performed at room temperature. Furthermore, since the methods do not require the use of enzymes, the pH of the sample to be tested comprising the single-stranded nucleic acid and the pH of the testing environment does not need to be maintained in a specific working range. The present inventors have found that the limitations in relation to salt concentration, buffer concentration and operating temperature required for comparative techniques, such as polymerase chain reaction (PCR), are not required for the methods disclosed herein. In comparison with other processes known in the art for detecting and quantifying nucleic acids in a comparable manner, the methods described herein allow for faster analysis.
[0042] The methods disclosed herein may be incorporated into a chip, for example, a silicon chip with the appropriate surface treatment. In certain embodiments, the methods disclosed herein may be incorporated on to a silicon chip comprising one or more layers of graphene. For example, the methods disclosed herein may be performed on a surface that is in contact with the nucleic acid sequences. The present inventors have found that the use of a graphene surface with an appropriate detector allows for the detection of the change in charge mediated by the displacement of one or more electronically-readable single- stranded nucleic acid sequences. Furthermore, the use of graphene avoids known chemical incompatibilities with biological samples and reagents that contain the nucleic acids and allows for lightweight and portable devices to be produced.
[0043] In some embodiments, the graphene surface discussed herein comprises one or more layers of a graphene sheet. In some embodiments, the graphene surface comprises more than one layer of a graphene sheet.
[0044] In some embodiments, the graphene sheets are further modified. In some embodiments, the graphene sheets may be modified such that the surface of the graphene sheet comprises electronic configurations that give rise to positive or negative charge, for example, phosphate groups, hydroxyl groups, carboxylate groups, carboranes, protons or electrons.
[0045] According to a third aspect, the present invention relates to a biosensor comprising a graphene surface, wherein the surface is configured to detect a change in charge associated with a method as defined in the first aspect. In certain embodiments, the biosensor comprises one or more layers of graphene.
[0046] In certain embodiments, the biosensor comprises one or more nucleic acid sequences on the graphene surface through one or more linkers.
[0047] The present inventors have found that the biosensor device disclosed herein may be modified to contain more than one nucleic acid sequence immobilised on the graphene surface. Where the different nucleic acid sequences are specific for different single-stranded nucleic acids, then the biosensor may be used to concurrently detect and / or quantify more than one single-stranded nucleic acid in a sample. Without wishing to be bound by theory, the present inventors believe that the modification of the graphene surface of the biosensor to contain various different immobilised nucleic acids means allows for a device that can detect a large number of singlestranded nucleic acids of interest. This is in contrast to current techniques, which typically only allow for the detection of a single nucleic acid in a single assay.
[0048] In certain embodiments, the biosensor comprises more than one different nucleic acid sequence immobilised on the graphene surface, wherein each different nucleic acid sequence is hybridised with a different reporter oligonucleotide. According to a fourth aspect, the present invention relates to the use of a biosensor as defined in the second aspect for detecting and / or quantifying one or more electronically-readable single-stranded nucleic acids.
[0049] In certain embodiments of the fourth aspect, more than one single- stranded nucleic acids are detected and / or quantified concurrently.
[0050] Brief description of the figures
[0051] Figure 1 shows a schematic for producing one or more electronically-readable single- stranded nucleic acid sequences (e.g. DNA or RNA) according to a method described herein.
[0052] Figures 2A and 2B show the individual components obtained from a method described herein. The components arising from the strand displacement mechanism described herein are separated and visualised by gel electrophoresis. Figure 2A depicts exposure of the gel for 100 ms. Figure 2B depicts exposure of a part of the gel for 4000 ms.
[0053] Figure 3 shows that the strand displacement reaction described herein yields stoichiometric amounts of the electronically-readable single- stranded nucleic acid sequences.
[0054] Figure 4 shows graphs with the signal strength as calculated from the gels bands for the signal oligo nucleotide (as shown in Figure 3B2 and D) when appearing in the negative reaction without invader (blue) and in the positive reaction with invader (orange). Asterisks indicate the significance of the t-test applied: *p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001
[0055] Figure 5 shows a schematic for the detection of electronically-readable single-stranded nucleic acid sequences without an intermediate reporter oligonucleotide.
[0056] Figure 6 shows a multiplex detection system constructed with microfluidics channels coated in a specific signal gate construct for the detection of electronically-readable single- stranded nucleic acid sequences. A multiplex detection system can be constructed with microfluidics channels coated in a specific signal gate construct. In a solution of multiple target sequences T and corresponding detection gates [R / D], T will displace a suitable reporter sequence R from the detection gate. The released nucleotide strand R will enter the microfluidics lanes and encounter multiple signal gates [3X / S] but only displace the signal nucleotides X of the matching substrate strand S. The released nucleotides will effect a signal on the FET chip surface.
[0057] Figure 7 - Structure of Locked Nucleic Acid Monomer and DNA monomer - Locked Nucleic Acid is a nucleic acid analogue that contains a 2'-O, 4'-C methylene bridge. This bridge-locked in the 3'-endo conformation-restricts the flexibility of the ribofuranose ring and locks the structure into a rigid bicyclic formation.
[0058] Figure 8 - Structure of Protein Nucleic Acid and DNA - In peptide nucleic acids the phosphoribose backbone of DNA is substituted with a peptide backbone. This nucleic acid analogue is resistant to nucleases and creates regular Watson-crick-base pairing with DNA or PNA but with higher specificity and melting temperatures than in DNA:DNA duplexes.
[0059] Figure 9 shows graphs depicting detection of ions and DNA on gFET. A: NaCl solutions of different concentrations (orange arrows) were pipetted on to the graphene sensing field of a gFET and rinsed with water in between (light blue arrows). Measurements of 0.5M (orange arrow 1-4) and 0.01M NaCl (orange arrow 5-8) were performed in 4 replicates. B: Salmon sperm genomic DNA was diluted in water down and transferred to the chip surface in the following order 0.0001 mg / ml, 0.01 mg / ml and lmg / ml indicated by orange arrows. The chip was rinsed with water in between the addition of DNA (light blue arrows). C: A chip was exposed to different concentrations of ssDNA in water in the following order luM, lOuM, luM, lOOuM of ssDNA (indicated by orange arrows). Between every new DNA concentration, the sensing surface was rinsed with water (light blue arrows). All current values measured for I_sd are plotted in blue and an average of the last 20 values (equal to one V_sd oscillation cycle) is shown in orange.
[0060] Detailed description
[0061] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0062] The term "about" or "approximately" as used herein means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system.
[0063] As used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes a single method, as well as two or more methods; reference to "an agent" includes a single agent, as well as two or more agents; reference to "the disclosure" includes a single and multiple aspects taught by the disclosure; and so forth. Aspects taught and enabled herein are encompassed by the term "invention". Any variants and derivatives contemplated herein are encompassed by "forms" of the invention.
[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. For the purposes of the present invention, the following terms are defined below.
[0065] As used herein, the term “graphene” refers to the allotrope of carbon having a two-dimensional structure, where the carbon atoms are present in a single layer. Multiple layers of graphene (also known as “sheets”) may be deposited sequentially on a surface, such that multiple graphene layers are obtained with no interplanar correlation. As used herein, the term “graphene” is used to mean both the single layer and multiple layer arrangements.
[0066] As used herein, the terms “nucleic acid” and “nucleotide” refer to a moiety comprising a nitrogen-containing base (i.e. a nucleobase) and a sugar moiety attached to a phosphate group. The nitrogen-containing base and the sugar moiety may together be considered a “nucleoside”. The nucleobase may be a purine or pyrimidine base, or other natural, chemically or biochemically modified, non-natural or derivatised bases. Examples of a purine base include adenine (A) and guanine (G) and examples of a pyrimidine base include cytosine (C), thymine (T) and uracil (U). The sugar in a nucleotide (or a nucleoside) may be a ribose group or a deoxyribose group. The nucleic acid may be double stranded or single stranded. References to single stranded nucleic acids include references to the sense or antisense strands. Where a ribose group is present in a nucleotide, the nucleotide may be a component of a ribonucleic acid (RNA). Where a deoxyribose group is present in a nucleotide, the nucleotide may be a component of a deoxyribonucleic acid (DNA). The nucleotide may be a canonical nucleotide, analogue thereof, naturally occurring or non-naturally occurring. A nucleotide may be an analogue and comprise one or more modifications, when compared to the natural nucleotide. Examples of such modified nucleotides (i.e. nucleotide analogues) include methylated nucleotides and nucleotide analogues. The sequence of nucleotides may be interrupted by nonnucleotide components. Other modifications include those incorporated to protect singlestranded domains from degradation by nucleases, for example, 3 ’-phosphorylation. The nucleic acids may also be peptide nucleic acids with a peptide chain instead of a phosphoribose backbone derived from a sugar and a phosphate group, thus providing a nucleic acid that undergoes standard base-pairing but is not recognised by nucleases and are therefore resistant to degradation. The terms nucleoside, nucleotide, deoxynucleoside and deoxynucleotide generally include complements, fragments and variants of the nucleoside, nucleotide, deoxynucleoside and deoxynucleotide, or analogues thereof.
[0067] As used herein, the term “nucleotide” also includes a “polynucleotide”, which refers to any suitable polynucleotide, including but not limited to cDNA, mitochondrial DNA (mtDNA), messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), nuclear RNA (nRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), small Cajal body-specific RNA (scaRNA), microRNA (miRNA), double stranded (dsRNA), ribozyme, riboswitch or viral RNA. Polynucleotides may be contained within any suitable vector, such as a plasmid, cosmid, fragment, chromosome, or genome. The polynucleotide analyte can be a nucleic acid endogenous to the cell. As another example, the polynucleotide analyte can be a nucleic acid introduced to or expressed in the cell by infection of the cell with a pathogen, for example, a viral or bacterial genomic RNA or DNA, a plasmid, a viral or bacterial mRNA, or the like.
[0068] As used herein, the term “complementary” in relation to nucleic acid sequences refers to a nucleic acid sequence that hybridises to another nucleic acid sequence. As used herein, the term “hybridisation” in relation to nucleic acid sequences generally relates to the formation of a double-stranded nucleic acid construct from two single- stranded constructs, where the singlestranded constructs are bound by base-pairing according to Watson-Crick principles. The nucleic acid sequences that hybridize in a complementary manner by nucleotides or nucleosides, or analogues thereof. Complementary nucleotides are, generally, A and T (or A and U), or C and G. The term "hybridisation" may also refer to triple- stranded hybridisation. The resulting (usually) double-stranded polynucleotide is a "hybrid". The proportion of the population of polynucleotides that forms stable hybrids is referred to herein as the "degree of hybridisation". Two single stranded RNA or DNA molecules are said to be complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100% of the nucleotides of the other strand. Alternatively, complementarity exists when an RNA or DNA strand will hybridise under selective hybridisation conditions to its complement. Typically, selective hybridisation will occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, and more preferably at least about 90% complementarity.
[0069] As used herein, the term “oligonucleotide” refers to a sequence of nucleic acid bases, wherein the sequence is shorter than about 200 nucleotides in length. Generally, an oligonucleotide is from about 15 to about 100 nucleotides in length, however the oligonucleotide also be of greater length. The oligonucleotide may be DNA-based, RNA-based or an artificial analogue thereof.
[0070] As used herein, the term “immobilisation” in relation to a nucleic acid refers to the stable attachment of said nucleic acid to a surface. The attachment and subsequent immobilisation of the nucleic acid may be achieved by any mechanism, e.g. by covalent bonding, non-covalent bonding, ionic bonding or the like. Where a single-stranded nucleic acid is immobilised on a surface, a further single-stranded nucleic acid having a complementary sequence may be attached to the immobilised nucleic acid by hybridisation, thus leading to the immobilisation of a second nucleic acid construct. Where the second single-stranded nucleic acid construct is attached to an immobilised nucleic acid by hybridisation, the attachment may be reversible, thus leading to the detachment of the single- stranded nucleic acid previously hybridised to the immobilised nucleic acid.
[0071] As used herein, the term “aptamer” refers to an oligonucleotide that binds to a specific target molecule.
[0072] As used herein, the term “biosensor” refers to an analytical device that converts a biological response into a signal that is subsequently processed. The signal may also be quantifiable, using the appropriate means. As used herein, the term “sample” includes tissues, cells, body fluids and isolates thereof etc., isolated from a subject, as well as tissues, cells and fluids etc. present within a subject (i.e. the sample is in vivo). Examples of samples include: whole blood, blood fluids (e.g. serum or plasma), lymph and cystic fluids, sputum, stool, tears, mucus, hair, skin, ascitic fluid, cystic fluid, urine, nipple exudates, nipple aspirates, sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, archival samples, explants and primary and / or transformed cell cultures derived from patient tissues etc.
[0073] As used herein, the terms “detecting”, “determining”, “measuring”, “evaluating”, “assessing” and “assaying” are used interchangeably to refer to any form of measurement, and include determining if a specific element is present (or not). These terms include both quantitative and / or qualitative determinations. Assessing may be relative or absolute. The processes defined herein may comprise measuring or visualising the levels of two or more analytes in a sample.
[0074] As used herein, the term “subject” or “patient” refers to any single subject for which therapy is desired, including humans, cattle, horses, pigs, goats, sheep, dogs, cats, guinea pigs, rabbits, chickens, insects, plants and so on. Also intended to be included as a subject are any subjects involved in clinical research trials not showing any clinical sign of disease, or subjects involved in epidemiological studies, or subjects used as controls.
[0075] As used herein, the term "probe" refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, a nucleotide transcript. Probes can be either synthesised by one skilled in the art, or derived from appropriate biological preparations.
[0076] The term “graphene” refers to pure or relatively pure carbon in the form of a relatively thin, nearly transparent sheet, which is one atom in thickness (i.e.. a monolayer sheet of carbon), or comprising multiple layers with no interplanar correlation (multilayer carbon sheets), having a plurality of interconnected hexagonal cells of carbon atoms which form a honeycomb like crystalline lattice structure. In addition to hexagonal cells, pentagonal and heptagonal cells (defects), versus hexagonal cells, may also be present in this crystal lattice. The graphene may be in any form known in the art. For example the graphene may be in a powder form, in the form of a single sheet, or a plurality of sheets. The term “functionalised graphene” may refer to graphene which has incorporated into the graphene lattice a variety chemical functional groups such as -OH, -COOH, -NH2, etc., in order to modify the properties of graphene.
[0077] In the present invention, the signal detection is mediated by a series of toehold-mediated strand displacement reactions that result in the release of multiple smaller charged oligonucleotides that could be detected as an electrochemical signal on a gFET chip surface. The presented data shows an example for a displacement mechanism with a gearing of 1:3, i.e., one reporter oligonucleotide liberates 3 charged nucleotides for signalling. This shows a successful assembly of the expected double and single stranded products in a reaction initiated by an invader strand (Figure 2). The amount of released signal oligo nucleotides increases as expected with the use of Signal gates loaded with more signal oligonucleotides (see Figure 3). However, higher gearing could be achieved by derivation. The direction of the displacement reaction is favoured by the increase in entropy due to the release of the smaller charged oligonucleotides and the favourable binding of a continuous complementary strand. This system can function at room temperature and would therefore be independent of an external power source or a cold-logistics supply chain. Compared to protein-based enzyme-dependent signal amplification systems, the present inventive demonstrated mechanism can also be more resilient to environmental conditions, including working pH range, salt concentration and temperature.
[0078] Another advantage of the present invention is an increased sensitivity compared to direct detection approaches that rely on molecules chemically bonding to the surface of a sensing device, e.g. chemical binding to an electronically gated field effect transistor. During direct detection the molecule of interest is bound by a suitable complementary sequence or antibody on a chip surface and detected in situ. This approach has been shown to be very sensitive particular down to zetamolar concentration in combination with a gFET chip even for low concentration markers of disease. In contrast the present invention can provide the successful detection of a target which releases multiple smaller molecules. Therefore, the benefits of label- free, enzyme-free direct detection would be further boosted by respective increase in signal amplification. Exemplary data of an uncoated gFET detecting charges molecules in the form salt ions (NaCl) and DNA (gDNA and ssDNA) is shown in Figure 9. PCR-based nucleic acid detection relies on enzymatic signal amplification. Since this amplification is exponential it makes these methods very sensitive. Exponential amplification enables detection of very low concentrations for nucleic acid biomarkers and to a lesser degree for proteins (e.g. immuno-PCR) but exponential amplification methods are also prone to contamination issues, false positives and in situations in which multiple competing amplicons in the reaction mix can create a bias towards some sequences over others, e.g., more easily amplified sequences with a different AT-content goes into details with issues of PCR methods).
[0079] The reliance of the present method on nucleic acids makes it more adaptable to different temperatures and less sensitive to buffer and analyte concentrations than protein-based detection methods. In the present case, the sequence of interest displaces a reporter sequence on the DNA construct. The released reporter strand contains a sequence complementary to a toehold of the target double stranded signal construct. The signal construct is made up of a substrate strand and multiple shorter complementary signal charged nucleotides which could be electronically detected, for example, by a gFET device. Every detected sequence thus creates 3 molecules for detection by the chip surface. The inventors have demonstrated an input:output ratio of 1 to 3 (Figure 3 and Figure 4), but may also be designed for greater amplification, e.g. 1 to 5, by increasing the number of complementary domains and signal oligonucleotides. The amplification can be increased and optimised by sequence design but might ultimately be limited by steric hindrance and increasing time scales to complete the displacement.
[0080] In an alternative version of the present method, it is also possible to eliminate the reporter strand step and instead hybridise multiple smaller signal oligo nucleotides to the detection substrate strand. In this design, the double stranded detection construct would contain, first, a domain conferring the specificity to the target sequence and following afterwards a series of labelled smaller oligo nucleotides that will be displaced by the invader strand (see Figure 5) and detected by a chip. This would probably allow for faster total reaction but would require optimisation for every new target. The detection substrate strand would require to be redesigned for every new target but also the signal oligonucleotides.
[0081] The nucleic acids used in this method may be RNA, DNA or a synthetic nucleic acid analogue. The nucleic acids or analogue constructs used in this mechanism may also contain modifications to tailor them to the intended purpose. Locked nucleic acids (LNA) contain an oxygen bridge across the ribose backbone and ensure greater specificity for Watson-Crick- pairing, see Figure 7. Incorporating LNA segments into regular DNA has been shown to create a higher selectivity for specific genetic mutants, e.g., single nucleotide polymorphisms (SNP) indicative of disease. Other modifications may be incorporated to protect single stranded domains from degradation by nucleases, e.g. 3’ phosphorylation. Peptide nucleic acid (PNA), is a nucleic acid analogue with a peptide bond chain instead of a phosphoribose back-bone, Figure 8. PNA is not recognised by nucleases and therefore resistant to degradation but creates Watson Crick Base pairing just like DNA or RNA albeit with higher melting temperatures and therefore greater specificity compared to equivalent sequences of double stranded DNA. This resilience and greater specificity have also made it a popular tool in biosensor research.
[0082] According to the method of the present invention some strands have been designed in such a way that they may also allow modification to selectively decrease or increase specificity. For example, to detect multiple similar mutants that differ by a few point mutations in the targeted area the substrate of the detection complex might contain positions with inosin, a so-called universal base, as this nucleoside is able to pair with G, C, A or T.
[0083] The higher melting temperatures or a greater gain of Gibbs Free Energy of base pairing might be desirable to design a shorter signal oligo nucleotide fragment to contain more signal molecules on a signal gate without increasing the length of the signal substrate strand or the reporter strand.
[0084] The sequence of interest to be detected with the present invention may be a single stranded sequence of viral, bacterial, or otherwise microbial origin, or any other sequence of interest present in the given sample. It may also be used to detect nascent PCR product to improve the detection speed and sensitivity of PCR-based assays. It could lower the number of PCR cycles needed for successful detection of target material.
[0085] If the present invention is employed in combination with a PCR system, the higher temperatures used in this environment could also require adjustment to the signal nucleotide sequence and other modifications to increase stability of the double stranded detection and signal gate at higher temperatures in the absence of a strand displacement event. The present invention could also be used to detect proteins or other antigens by using a nucleic acid sequence in the form of an aptamer. In such a case, the protein of interest would displace a nucleic acid reporter sequence bound to the aptamer by base pairing interactions . The released binding partner can then start a cascade like the one proposed for nucleic acid detection.
[0086] Microfluidics (Figure 6) or barcoded sequences or a combination thereof could be used to enable detection of multiple targets from the same sample simultaneously. Detection gate sequences could be designed to anneal with a specific target sequence, while the reporter strand would, likewise, be distinct for each target. The distinction of the presence of specific targets can be made within a microfluidics channel coated with a signal gate specific to the reporter. Any signal nucleotides generated by this displacement could be registered by a device, e.g., FET, connected only to this channel. Miniaturization and low reaction volumes would make it possible to detect multiple targets simultaneously for multiplexing applications.
[0087] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
[0088] Those skilled in the art will appreciate that the invention described herein in susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
[0089] Examples
[0090] The following examples are illustrative of the disclosure and should not be construed as limiting in any way the general nature of the disclosure of the description throughout this specification METHODS
[0091] Annealing DNA probes in thermocycler
[0092] Double stranded constructs were prepared in advance on a thermocycler (Bio-Rad) in TAE buffer (Sigma- Aldrich) with magnesium. Single stranded components were combined to yield 4uM concentration of final product, heated to 65C and cooled to 20C at a controlled rate of IC / minute.
[0093] Strand exchange reaction
[0094] For the strand displacement reaction solutions of invader strand, Detection gates (DG) and Signal gates (SG) with corresponding nucleotide sequences were combined in equimolar concentrations and incubated before separating reaction products on a gel. Constructs releasing one signal nucleotide were compared to constructs releasing two or three signal nucleotides in the strand exchange process.
[0095] Displacement reactions were made up of equal volumes (e.g., lOul) signal gate, detection gate and started by the addition of the invader strand of 4uM concentration each (1.33uM final concentration).
[0096] The negative control contained an equivalent amount of lx TAE / Mg buffer instead of invader. Displacement reactions were incubated for 40min at room temperature before being mixed with loading buffer and run on a 20% TBE PAGE for Ih at 200V.
[0097] To calculate the relative concentration of signal nucleotide released in the strand exchange a series of increasing concentrations (0, 0.5, 1, 1.5, 2, 2.0, 2.5, and 3x relative concentration) of the signal oligonucleotide by itself was included with the reactions samples on the gel to establish a standard curve for the brightness of the signal nucleotide.
[0098] Polyacrylamide gel electrophoresis (PAGE)
[0099] 12 pmole of sample were loaded per lane onto a 20% TBE gel (Invitrogen), run for Ih at 200V was stained with SYBR Green II (Invitrogen) 1:10,000 in TBE buffer (Invitrogen) for lOmin and imaged on iBright 1500 gel imager (Invitrogen) at exposure times 100ms, 2000ms and 4000ms.
[0100] Quantification of bands by densitometry
[0101] Uncompressed tiff images acquired on iBright imager for 2000ms were analysed with the gel analysis plugin of ImageJ.
[0102] A rectangle area surrounding the band of interest and the area above and below was selected on the gel image and moved only horizontally for selecting and comparing the signal between different lanes.
[0103] ImageJ then creates plots of pixel brightness for the rectangular area. The peak signal for the band is selected manually. The area under the curve is closed off, thus background is removed and the peak area is selected. The area values for each peak are used in excel for further analysis.
[0104] A slope was calculated from the standard curve for the concentration series of the signal oligo nucleotide bands. The signal values of the strand displacement reactions are divided by the slope of the standard curve to calculate the concentration of the signal nucleotide bands resulting from the exchange reaction.
[0105] Values are plotted as box and whisker plot. Results were combined from multiple assays and compared for statistical significance using t-test.
[0106] Testing gFET response to DNA
[0107] A series of DNA dilutions in water was used to test the gFET response to increasing concentrations of genomic salmon (Sigma) or short oligo nucleotide DNA (IDT). A gFET chip (Graphenea) was used to measure current changes (I_sd) over time at a constant source-drain and gate voltage (V_sd = 0.1V, V_g = 0.2V). These changes were recorded and plotted as current versus time.
[0108] Example 1 - Preparation of graphene
[0109] Graphene is grown using chemical vapour deposition (CVD). This typically entails hydrocarbons (generally alkanes or alcohols) being decomposed from the gas phase in a heated chamber to grow graphene sheets on metallic catalyst substrates. The graphene sheets then need to be transferred from these metal substrates to other silicon substrates. These substrates usually have a silicon dioxide layer of a thickness of 300nm on top of the silicon. This separates the conductive silicon and graphene layers. Back gate graphene field effect transistors (gFETs) are then possible by applying a voltage to the silicon layer. This has historically been done depositing poly methyl methacrylate (PMMA) as a sacrificial layer on top of the graphene. The graphene is then separated from the metallic substrate using a metal etchant, allowing the PMMA coated graphene to float on the surface. To fabricate gFETs, a 2-step lithographic process is used to pattern the graphene and contact electrodes, involving spin coating of a polymer resist and its heat treatment, then pattern drawing using a UV or electron source.
[0110] Example 2 - Synthesis of strand sequences and domains
[0111] Table 1 - Nucleic acid sequences for all single stranded components used in experiments of Figure 2 and Figure 3 are shown in full as well as broken down into their domain components. Domains labels a-d and a’ -d’ correspond to example in Figure 1. Domain labels and their prime counterpart are complementary to each other, e.g., a’ is the reverse complement of a and so forth. Domain d and dl, d2, d3 all have identical sequences. Short domains e and e’ on the reporter strand and signal substrate strand inbetween d and d’, respectively, are optional additions to leave room for a 5 ’-label on the signal nucleotide and prevent annealing due to steric hindrance.
[0112] Sequence 5'— > 3' Sequence domain 5'— > 3'
[0113] Reporter dl e d2 e d3 c b b c d e strand © TCCTCTGTCTCTATTCTCCTCTGTCTCTATTCTCCTCTGTCTCTATCATATCTATCTTCGCTGCTC TATCTTCGCTGCTC CATATC TCCTCTGTCTCTAT TC
[0114] Detection a' b' c' su bstrate GACCAGGAGCAGCGAAGATAGATATG GACCAG GAGCAGCGAAGATA GATATG strand @ Invader c b a a b c strand @ CATATCTATCTTCGCTGCTCCTGGTC CTGGTC TATCTTCGCTGCTC CATATC
[0115] Signal c' d' e' d' e' d' c' d' e' su bstrate GATATGATAGAGACAGAGGAGAATAGAGACAGAGGAGAATAGAGACAGAGGA GATATG ATAGAGACAGAGGA GA strand @
[0116] Signal d d = dl = d2 = d3 oligonucl- 5 ' Biotin-TCCTCTGTCTCTAT 5'Biotin- eotide ® TCCTCTGTCTCTAT
[0117] Table 1 - Strand sequences and domains
[0118]
[0119] Table 2 - Strand Sequences and domains used in experiments
[0120] Example 3 - Preparation of double stranded oligonucleotide probes
[0121] Double stranded probes were mixed in equimolar concentrations in a buffered solution comprising 40 mM Tris base, 20 mM acetic acid, 1 mM EDTA, 11.5 mM Mg(CH3COO)2 and heated up to 65 °C for 5 min and cooled to 20 °C with a cooling rate of 1 °C per minute.
[0122] Example 4 - Reaction conditions for strand displacement reactions
[0123] Oligonucleotide strand displacement reactions were performed in a buffered solution comprising 40 mM Tris base, 20 mM acetic acid, 1 mM EDTA, 11.5 mM MglCthCOO . The oligonucleotides were combined in equimolar concentrations in a concentration range of 1 nM - 10 mM.
[0124] The products from the strand displacement reactions were analysed on 20% TBE-PAGE gel in TBE running buffer (Invitrogen) with SYBR Green (Invitrogen) used at a dilution of 1:10,000 in TBE buffer and incubated with the staining solution for at least 15 min. The gel images were acquired with an iBright 1500 FL imager (Invitrogen).
[0125] Example 5 - Detection of a single-stranded nucleic acid (RNA or DNA)
[0126] As depicted in Figure 1, a partially double- stranded construct, detection gate, of a reporter (T) and substrate @ strand contains a domain a’ + b’ complementary to a conserved motif in the nucleotide sequence of interest, invader strand @. a’ is a toehold sequence that initiates the binding and the displacement. Sequence a of the invader strand binds the a’ complement in the detection substrate strand @. If further bases match with b’ the invader strand @ will replace the reporter strand (T). The newly liberated reporter strand ( ) anneals with the toehold of a partially double-stranded signal construct, consisting of a signal substrate strand (4) and multiple signal oligonucleotides @. Short signal oligonucleotides with a suitable charge i.e. label (denoted by an x in circle with a line to di, di, ds, so forth), would be detected by a device. Single stranded components are labelled with encircled numbers, double stranded constructs are labelled with the combination of corresponding encircled numbers underlined. The example shown releases 3 signal molecules for each detected invader strand, the labelling reflects this by showing 3x@ signal molecules within the signal gate construct (4 3x(5 .
[0127] Figure 5 - shows an alternative example strategy for alternative mechanism to detect single stranded DNA or RNA without an intermediate reporter - A partially double-stranded construct ft ft. detection gate, of multiple signal oligonucleotides b,c,d,e Q and substrate Q strand contains domains a’ + b’-e’ complementary to a conserved motif in the nucleotide sequence of interest, the invader strand Q. a’ is a toehold sequence that initiates the binding and the displacement. Sequence a of the invader strand binds the a’ complement in the detection substrate strand Q. If further bases match with b’ the invader strand O will replace the signal nucleotides as well Q. The sequence a’ + b’ are most important for the specificity of the interaction. Domain b’ would therefore be longer than c’, d’ and e’ . The signal oligonucleotides with a suitable label (x in circle) are detected by a chip surface.
[0128] Example 6 - Analysis of products derived from analysis of nucleic acids by a strand displacement
[0129] The nucleic acid fragments obtained from a process as described in Example 5 were analysed by gel electrophoresis (see Figures 2A and 2B). The signal oligonucleotides obtained as a result of a strand displacement reaction described herein are seen at 10 bp. Figure 2B shows the gel after a longer exposure time (4000 ms) and clearly indicates the presence of the signal oligonucleotide in 8.
[0130] Figure 2 - Strand displacement reaction yields expected bands. - Figure 2 A shows the individual components of a strand displacement reaction and the bands that are expected to be visualized on a polyacrylamide gel. - In Figure 2 Bl lanes 2-5 show the single stranded components invader, detection substrate, reporter-3, and signal substrate-3. Lanes 6,7 and 9 show the double stranded constructs detection gate-3, signal gate-3, and signal waste-3. For the strand displacement reaction products shown in lane 8 invader, detection gate-3 and signal gate-3 were mixed in equimolar concentrations and incubated for 40min at room temperature before being separated on a gel. The reaction yields a detection waste-3 band, and a signal waste-3 band. Additional bands are a result of incomplete strand displacement also showing a remainder of the detection gate-3 input. The combination of detection gate-3 and signal gate-3 releases three signal oligonucleotides for every invader strand. The signal oligonucleotide band only becomes visible at longer exposure times - shown in Figure 2B2, where overexposed areas of marker are shown as the oval region in red beside the numbering 10.
[0131] Example 7 - Increasing the stoichiometry of the signal oligonucleotides A
[0132] Strand displacement reactions with three different amounts of the signal oligonucleotide were performed and the products separated by gel electrophoresis (see Figure 3). As demonstrated here, the processes and devices disclosed herein may be modified such that each detected invader sequence produces 1, 2 or 3 oligonucleotides that are subsequently detected. Separation of the fragments by gel electrophoresis shows that increasing the stoichiometry of the signal oligonucleotides results in the expected increase in the oligonucleotides that are detected.
[0133] Figure 3 - Strand displacement reaction yields stochiometric amounts of signal oligo nucleotides. -The table A above (in combination with Figure 3A) shows samples separated on a TBE buffer poly acrylamide gel: three strand displacement reactions with increasing amounts of signal molecules, corresponding amounts of pure signal molecule for comparison as well as the bands that are expected to be visualized on a gel. - In Figure 3Error! Reference source not found. Bl, lanes 10-12 show the products of the displacement reactions 1-3. Lanes 13-15 show the corresponding amounts of signal oligonucleotides. For the strand displacement reaction products shown in lane 8 invader, detection gate-3 and signal gate-3 were mixed in equimolar concentrations and incubated for 40min at room temperature before being separated on a gel. The reaction yields a detection waste-3 band, a signal waste-3 band. Additional bands are a result of incomplete strand displacement leaving behind double stranded detection gate. The combination of detection gate-3 and signal gate-3 releases 3 signal oligonucleotides for every invader strand. The signal oligonucleotide bands only become visible at longer exposure times - as in Figure 3 B2. C shows the quantification of the band brightness and relative levels compared to 12 pmole of pure signal oligonucleotide. 12 pmole of reactants in Reaction 1, 2 and 3 can release a maximum of 12, 24 and 36 pmole of signal oligonucleotides, respectively. The quantification in C shows an increase in released signal (S) from reaction (Rx) 2 to 3. (Reaction 1 cannot be analysed due to interference with a fluorescently tagged compound in a similar size range.) Overexposed areas are shown in B2 as red oval shapes in the images beside the numbering 10. D: An example of the signal oligo nucleotide bands being used for creating a standard curve to calculate the relative concentration of signal from the gel brightness.
[0134] Example 8 - Detection of ions and DNA on gFET
[0135] Figure 9 - Detection of ions and DNA on gFET - A: NaCl solutions of different concentrations (orange arrows) were pipetted on to the graphene sensing field of a gFET and rinsed with water in between (light blue arrows). Measurements of 0.5M (orange arrow 1-4) and 0.01M NaCl (orange arrow 5-8) were performed in 4 replicates. B: Salmon sperm genomic DNA was diluted in water down and transferred to the chip surface in the following order 0.0001 mg / ml, 0.01 mg / ml and Img / ml indicated by orange arrows. The chip was rinsed with water in between the addition of DNA (light blue arrows). C: The chip was then exposed to different concentrations of ssDNA in water in the following order luM, lOuM, luM, lOOuM of ssDNA (indicated by orange arrows). Between every new DNA concentration, the sensing surface was rinsed with water (light blue arrows). All current values measured for I_sd are plotted in blue and an average of the last 20 values (equal to one V_sd oscillation cycle) is shown in orange.
Claims
The Claims Defining the Invention are as Follows:
1. A method for producing one or more electronically readable single-stranded nucleic acid sequences, said method comprising the steps of:1) selecting: i) a partially double- stranded detection gate nucleic acid construct (DG) which comprises of a. a single-stranded detection substrate nucleic acid sequence (DSSS) characterised with a partial region that is complementary with a partial region of the reporter nucleic acid sequence (RSS), and a toehold sequence (THS) region which is non-complementary to the RSS but is partially complementary to a partial sequence of the single-stranded invader nucleic acid sequence (ISS); and b. a single- stranded RSS characterised with a region that is complementary with a partial region of the DSSS, and a region which is complimentary to the one or more pre -electronic readable regions of the signal substrate strand (SSS) but is non- complementary to either the RSS, the DSSS or the ISS; ii) a single-stranded invader nucleic acid sequence (ISS) characterised with a region which is complementary to the THS of DSSS; iii) a partially double- stranded signal gate construct (SG) comprising of a. the SSS characterised by being the complement of the RSS, including a toehold sequence (THS) also complementary to the RSS, and b. multiple pre-electronically readable signal oligonucleotides (SO) characterised by being complementary to part of the SSS but not the THS of SSS;2) reacting together the DG with the ISS in a manner and under conditions such that the THS region on the DG initiates binding of the ISS and results in the displacement of the RSS; and wherein the RSS further binds to the THS of SG and liberates said one or more electronically readable single-stranded SO sequences.
2. A method for producing one or more electronically readable single-stranded nucleic acid sequences, said method comprising the steps of:1) selecting a partially double-stranded detection gate nucleic acid sequence (DG) comprising a detection substrate strand (DS) and one or multiple signal oligonucleotide (SO) strand comprising pre-electronic readable sequences and wherein the DS and SO have partial complementarity, and that the DG is also characterised with a toehold sequence region (THS) and a single- stranded invader nucleic acid sequence (ISS) characterised with a region which is complementary to the THS and SO regions and2) reacting together the DG with the ISS in a manner and under conditions such that the THS region on the DG initiates binding of the ISS and results in the displacement of the one or more electronically readable single-stranded SO from the pre-electronically readable region, wherein the one or more electronically readable single- stranded nucleic acid sequences are the same or different.
3. A method according to claim 1 or claim 2 which includes 3) electronically detecting the one or more electronically readable single-stranded nucleic acid sequences on the graphene surface of a gFET.
4. A method according to anyone of claims 1 to 3 wherein the single- stranded invader nucleic acid sequence is a single- stranded RNA or a single-stranded DNA.
5. A method according to anyone of claims 1 to 3 wherein the single- stranded invader nucleic acid is a messenger RNA (mRNA) or a micro RNA (miRNA).
6. A method according to anyone of claims 1 to 5 wherein the single- stranded invader nucleic acid sequence may be a natural nucleic acid sequence.
7. A method according to anyone of claims 1 to 6 wherein the invader nucleic acid sequence is of viral origin, bacterial origin, plant origin or microbial origin.
8. A method according to anyone of claims 1 to 7 wherein the single- stranded invader nucleic acid sequence is a locked nucleic acid or a peptide nucleic acid.
9. A method according to anyone of claims 1 to 8 wherein the single- stranded invader nucleic acid sequence comprises one or more inosin nucleosides.
10. A method according to anyone of claims 1 to 8 wherein the single- stranded invader nucleic acid sequence is in the form of an aptamer.
11. A method according to anyone of claims 1 to 10 wherein displacement of the electronic ally-readable single- stranded nucleic acid sequence is a result of toehold strand displacement mediated by the single stranded invader nucleic acid sequence.
12. A method according to anyone of claims 1 to 11 wherein the method includes the further step of analysing the single- stranded nucleic acid of a PCR reaction or another polymerase- mediated reaction like sequencing by synthesis.
13. A method according to anyone of claims 1 to 12 wherein the single- stranded invader nucleic acid sequence is present at a concentration from about 1 x 10’6M to about 1 x 10’18M.
14. A method according to anyone of claims 1 to 13 wherein a single-stranded invader nucleic acid displaces one single- stranded signal oligo nucleotide sequence.
15. A method according to anyone of claims 1 to 12 wherein the single- stranded invader nucleic acid displaces more than one single-stranded signal oligo nucleotide sequence.
16. A method according to anyone of claims 1 to 12 wherein the single-stranded invader nucleic acid sequence displaces between 1 and 10 single- stranded signal oligonucleotide nucleic acid sequences.
17. A biosensor device comprising a graphene surface, wherein the surface is configured to detect a change in charge associated with a method according to anyone of claims 1 to 16.
18. A biosensor device according to claim 17 wherein the biosensor device comprises one or more layers of graphene.
Citation Information
Patent Citations
NANO-sensors for nucleic acid detection and discrimination
US20190256897A1