Affinity binding entities directed to psma and methods of use thereof
Patent Information
- Application Number
- EP2023853406
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-11
- Filing Date
- 2023-08-11
- Publication Date
- 2025-06-18
AI Technical Summary
Current adoptive cellular therapeutic approaches targeting prostate-specific membrane antigen (PSMA) face challenges such as toxicity, graft-versus-host disease, and limited efficacy due to the high alloreactive potential of alpha beta (αβ) T cells, which can trigger complications like cytokine release syndrome and macrophage activation syndrome, and are not predictive of gamma delta (γδ) T cell function.
Development of affinity binding entities, including chimeric antigen receptors (CARs) with specific antigen binding domains that target PSMA, engineered for γδ T cells, which are designed to reduce toxicity and improve safety and efficacy by using specific HCVR/LCVR sequence pairs and epitope binding profiles, and are combined with costimulatory and intracellular signaling domains to enhance cell function.
The approach improves the safety and effectiveness of PSMA-targeted therapies by enhancing the activity, survival, and expansion of γδ T cells, reducing toxicity, and increasing the specificity and efficacy of tumor cell killing while minimizing graft-versus-host responses.
Smart Images

Figure IMGF000204_0001 
Figure IMGF000206_0001 
Figure IMGF000207_0001
Abstract
Description
AFFINITY BINDING ENTITIES DIRECTED TO PSMA AND METHODS OF USETHEREOFCROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority to U.S. Provisional Application Ser. No. 63 / 397,296 filed on August 11, 2022, the disclosure of which is expressly incorporated by reference herein in its entirety.FIELD OF DISCLOSURE
[0001] The present disclosure relates generally to affinity binding entities directed to prostate specific membrane antigen (PSMA). Chimeric antigen receptors (CARs) capable of binding PSMA, polynucleotides, host cells comprising the polynucleotides and / or CARs, and methods of treating disorders associated with PSMA in a patient are provided.BACKGROUND OF THE DISCLOSURE
[0002] Adoptive cellular therapy has undergone near constant iteration for more than thirty (30) years, from early days focusing on basic lymphokine activation and / or tumor infiltration to more recent strategies engineering immune cells to express genetically engineered antigen receptors, such as chimeric antigen receptors (CARs). While there have been some hints and indications of the curative potential of these approaches along the way, much still remains to be done. In particular, successful tumor eradication by CAR-T lymphocytes depends on CAR-T cell persistence and effector function, but an excess of either can trigger graft-versus-host (GvH) effects in the patient. Additionally, while the adoptive transfer of T cells expressing CARs has shown some success in treating haematological malignancies, only limited efficacy has been shown in other cancer types, particularly solid tumors. Compared with haematological diseases, solid tumors present unique challenges, including but not limited to highly immunosuppressive and metabolically challenging tumor microenvironments.
[0003] Prostate specific membrane antigen (PSMA), also known as glutamate carboxypeptidase II, or N-acetylated alpha-linked acidic dipeptidase 1, or folate hydrolase 1(F0LH1 ), is a dimeric type 2 transmembrane glycoprotein. PSMA is a prostate-cancer related cell membrane antigen frequently overexpressed in prostatic intraepithelial neoplasia (PIN), a condition in which some prostate cells have begun to look and behave abnormally, primary and metastatic prostate cancers and the neovasculature of other solid tumors, (e.g. breast, lung, bladder, kidney). PSMA expression correlates with disease progression and Gleason score. PSMA expression is increased in metastatic disease, hormone refractory cases, and higher-grade lesions, and it is further upregulated in androgen-insensitive tumors.
[0004] To date, adoptive cellular therapeutic approaches targeting PSMA have been associated with toxicity issues, thereby limiting the practical translation of such approaches. In August of 2020, a Phase I clinical study conducted by Poseida Therapeutics was halted following the death of a patient treated with P-PSMA-101, an autologous CAR T-cell therapy utilizing aP T cells designed to target prostate cancer cells expressing PSMA. The patient in this example developed symptoms consistent with macrophage activation syndrome (MAS), a serious and sometimes fatal over-activation of the immune system that has been associated with CAR-T therapies. In March of 2021, results were reported from a Phase I clinical trial conducted by the University of Pennsylvania testing efficacy of autologous CAR T-cells utilizing aP T cells designed to target PSMA and armed with a dominant-negative transforming growth factor (TGF)-P (Narayan et al., (2022) Nature Medicine, doi: 10.1038). The results revealed that of 13 patients that received therapy across all four dose levels, five of the 13 patients developed grade > 2 cytokine release syndrome (CRS), including the death of one patient following grade 4 CRS with concurrent sepsis. Thus, to date PSMA-targeted CARs have been examined in the context of aP T cells, where the potential efficacy appears compromised by the high alloreactive potential in general, and by their propensity to trigger complications such as CRS and MAS.
[0005] Gamma delta (y5) T cells are thymus-derived lymphocytes that differ from a0 T cells in their mechanism of activation and function, as well as in their anatomical distribution. In particular, while aP T cells function exclusively in adaptive immunity, γδ T cells are innate-like immune cells that recognize malignant cells through a repertoire of activating receptors in a MHC- independent manner, similar to NK cells (Welsh et al., Immunol Rev. 1997; 159: 79-93). As such, and in contrast to aP T cells, yo T cells can potentially be used in an allogeneic setting without the risk of causing graft versus host disease (GvHD) Moreover, recent studies have suggested thatengineered γδ-T cells may produce less proinflammatory cytokines than aP-T cells, which could thereby reduce the risk of CRS in patients (Harrer et al., BMC Cancer 2017; 17(1): 551).
[0006] Despite rapid and intense development of CAR T therapies, optimal parameters for CAR T cell-target interactions that will result in in vivo and in-human efficacy are not yet well understood. Given the differences in mechanism of action and function for a.p T cells as compared to γδ T cells, demonstration of CAR function and effectiveness in the context of a.p T cells is not predictive of CAR function and effectiveness in the context of γδ T cells. Hence, the practical translation of PSMA-targeted CAR T therapeutic approaches to γδ T cells is at best uncertain.
[0007] Accordingly, improved strategies are still clearly needed to improve the activity, survival, and / or expansion of the cells upon administration, while concurrently improving the safety of adoptive cellular therapeutic approaches targeting PSMA.SUMMARY OF DISCLOSURE
[0008] The present disclosure provides methods, cells, compositions, and kits that improve the safety and effectiveness of adoptive cellular therapeutic approaches targeting PSMA. In one aspect, provided is an affinity binding entity comprising an antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA). In embodiments, the antigen binding domain comprises a heavy chain variable region / light chain variable region (HCVR / LCVR) sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36; or the six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36. In embodiments, the numbering system used is Rabat et al.
[0009] In embodiments, the antigen binding domain comprises a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14; or the six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.
[0010] In embodiments, the antigen binding domain specifically binds to an epitope within residues 574-686 of human PSMA, residues being numbered according to SEQ ID NO: 329 in FIG. 18B. In embodiments, the antigen binding domain specifically binds to an epitope consistingof residues 574-686 of human PSMA, residues being numbered according to SEQ ID NO: 329 in FIG. 18B. In embodiments, the antigen binding domain specifically binds to an epitope comprising or consisting of residues 574-580, 644-649, and 674-686 of human PSMA, residues being numbered according to SEQ ID NO: 329 in FIG. 18B. In embodiments, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In embodiments, the antigen binding domain comprises the HCVR / LCVR sequence pair of SEQ ID NOs: 1 / 2.
[0011] In embodiments, the antigen binding domain specifically binds to an epitope within residues 150-261 of human PSMA, residues being numbered according to SEQ ID NO: 330 in FIG 18B. In embodiments, the antigen binding domain specifically binds to an epitope consisting of residues 150-261 of human PSMA, residues being numbered according to SEQ ID NO: 330 in FIG. 18B. In embodiments, the antigen binding domain specifically binds to an epitope comprising or consisting of residues 150-161, 167-172, and 256-261 of human PSMA, residues being numbered according to SEQ ID NO: 330 in FIG. 18B. In embodiments, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In embodiments, the antigen binding domain comprises a HCVR / LCVR sequence pair of SEQ ID NOs: 9 / 10.
[0012] In embodiments, the affinity binding entity is an antibody, or an antibody fragment. In embodiments, said antibody or antibody fragment is bispecific. In embodiments, said antibody or antibody fragment is chimeric, humanized, or human. In embodiments, said antibody or antibody fragment is monoclonal. In embodiments, said affinity binding entity is selected from the group consisting of scFv, Fab, Fab’, Fv, F(ab’)2, dsFv, dAb, and any combination or plurality thereof.
[0013] According to an aspect of the invention, provided is a chimeric antigen receptor (CAR) comprising an affinity binding entity comprising an antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein said antigen binding domain comprises a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14; or the six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.
[0014] In embodiments, the CAR further comprises a hinge domain. In embodiments, the hinge domain comprises a glycine polymer, glycine-serine polymer, glycine-alanine polymer, alanine-serine polymer, immunoglobulin heavy chain hinge, or receptor-derived hinge. In embodiments, the receptor-derived hinge is a CDS alpha hinge domain. In embodiments, the CDS alpha hinge domain comprises an amino acid sequence set forth as SEQ ID NO: 156.
[0015] In embodiments, the CAR further comprises a transmembrane (TM) domain. In embodiments, the TM domain comprises a TM region of 4-1BB / CD137, activating NK cell receptors, an Immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CDSalpha, CDSbeta, CD96 (Tactile), CD1 la, CD1 lb, CD11c, CD1 Id, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM- 1, Ig alpha (CD79a), IL-2Rbeta, IL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrins, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, EAT, LFA-1, a ligand that specifically binds with CD83, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen- 1 (LFA-1; CDl la / CDlS), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), Signaling Lymphocytic Activation Molecules (SLAM proteins), SLAM (SLAMF1; CD 150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB- A; LylOS), SLAMF7, SLP-76, TNF receptor proteins, TNFR2, TNFSF14, a Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or a combination thereof. In embodiments, the TM domain comprises a TM domain of CD8, preferably wherein the CD8 TM domain is a TM domain of CDS alpha. In embodiments, the TM domain comprises the amino acid sequence set forth as SEQ ID NO: 158.
[0016] In embodiments, the CAR further comprises a costimulatory domain. In embodiments, the costimulatory domain comprises a costimulatory domain of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CDSa, CD80, CDl la, CDl lb, CDl lc, CDl ld, IL2R£, IL2y, IL7Ra, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f,CD54 (ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96 (Tactile), CD100 (SEMA4D), CD103, CD134 (0X40), CD137 (4-1BB), CD152 (CTLA-4), CD160 (BY55), CD162 (SELPLG), CD244 (2B4), CD270 (HVEM), CD226 (DNAM1), CD229 (Ly9), CD278 (ICOS), ICAM-1, LFA-1 (CDl la / CD18), FcR, FcyRI, FcyRII, FcyRIII, EAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, EAT, GADS, LIGHT, HVEM (LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Lyl08), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, or TRANCE / RANKL, or a portion thereof, or combinations thereof. In embodiments, the costimulatory domain is a 4-1BB costimulatory domain. In embodiments, the 4- IBB costimulatory domain comprises an amino acid sequence set forth as SEQ ID NO: 162.
[0017] In embodiments, the CAR further comprises an intracellular signaling domain. In embodiments, the intracellular signaling domain is a CD3^ intracellular signaling domain. In embodiments, the CD3£ intracellular signaling domain comprises an amino acid sequence set forth as SEQ ID NO: 164, 166, or 167.
[0018] In embodiments, the CAR further comprises a signal peptide. In embodiments, the signal peptide comprises an amino acid sequence set forth as SEQ ID NO: 152.
[0019] In an aspect of the invention, provided is an isolated polynucleotide comprising a nucleic acid sequence encoding any one of the afore-mentioned affinity binding entities. In embodiments, an expression vector comprises said polynucleotide. In embodiments, said polynucleotide is operably linked to a cis-acting regulatory element.
[0020] According to an aspect of the invention, provided is a cell comprising any one or more of the aforementioned affinity binding entity, polynucleotide, and / or expression vector.
[0021] According to an aspect of the invention, provided is an isolated polynucleotide comprising a nucleic acid sequence encoding any one of the afore-mentioned CARs. In embodiments, said polynucleotide further comprises a nucleic acid sequence encoding at least one multi ci stronic linker region. In embodiments, said multi ci str onic region encodes a cleavage sequence. In embodiments, said cleavage sequence is selected from T2A, F2A, P2A, E2A, furin,and furin-P2A (FP2A). Tn embodiments, said multi ci stronic linker region encodes an internal ribosomal entry site (IRES).
[0022] In embodiments, said isolated polynucleotide further comprises a nucleic acid sequence encoding one or more additional polypeptides. In embodiments, the one or more additional polypeptides is selected from the group comprising or consisting of lymphotoxin beta receptor (LTBR), low-affinity nerve growth factor receptor (LNGFR), a dominant negative (dn) receptor for TGF-beta or Fas, a truncated form of the human epidermal growth factor receptor (EGFRt), and membrane-bound IL-12 (mbIL-12), or any combination thereof. In embodiments, the one or more additional polypeptides is selected from a fluorescent protein, a gamma chain cytokine, CD 19, CD20, LNGFR, EGFRt, LTBR, dnTGFpR2, and any combination thereof.
[0023] In embodiments, the one or more additional polypeptides is a dominant negative receptor for TGF-beta. In embodiments, the dominant negative receptor for TGF-beta is dnTGF0R2. In embodiments, the dnTGFpR2 comprises an amino acid sequence set forth as SEQ ID NO: 265. In embodiments, the one or more additional polypeptides is lymphotoxin beta receptor (LTBR). In embodiments, said LTBR comprises an amino acid sequence set forth as SEQ ID NO: 267. In embodiments, the one or more additional polypeptides is a truncated form of the epidermal growth factor receptor (EGFRt). In embodiments, the EGFRt comprises an amino acid sequence set forth as SEQ ID NO: 261. In embodiments, the one or more additional polypeptides is low-affinity nerve growth factor receptor (LNGFR) In embodiments, the LNGFR comprises an amino acid sequence set forth as SEQ ID NO: 273. In embodiments, the one or more additional polypeptides is a dominant negative Fas (dnFas). In embodiments, the one or more additional polypeptides is membrane-bound IL-12 (mbIL-12). In embodiments, the one or more additional polypeptides is a CAR that binds to CD70.
[0024] In embodiments, said one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide. In embodiments the signal peptide comprises an amino acid sequence selected from SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, and SEQ ID NO: 248.
[0025] In embodiments, said isolated polynucleotide comprising a nucleic acid sequence encoding a CAR comprises a nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229, or 233. In embodiments, an expression vector comprises the isolated polynucleotidecomprising a nucleic acid sequence encoding a CAR Tn embodiments, the polynucleotide is operably linked to a cis-acting regulatory element.
[0026] According to an aspect, provided herein is a γδ T cell comprising a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR), said CAR comprising an affinity binding domain that specifically binds to prostate-specific membrane antigen (PSMA); and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid sequence of (a), wherein the γδ T cell functionally expresses the binding domain of the polypeptide or nucleic acid encoded CAR on the surface of the γδ T cell. In embodiments, said γδ T cell is a 51, a 52, a 53, or a 54 γδ T cell, preferably a 52" γδ T cell, more preferably a 51 γδ T cell.
[0027] According to an aspect, provided herein is a modified immune cell comprising a CAR, isolated polynucleotide comprising a nucleic acid sequence encoding a CAR, and / or an expression vector comprising a polynucleotide comprising a nucleic acid sequence encoding a CAR, as described herein. In embodiments, said modified immune cell is a γδ T cell, a γδ NKT cell, an αβ T cell, a NK cell, a NKT cell, or a macrophage. In embodiments, said modified immune cell is a γδ T cell. In embodiments, said γδ T cell is a 51, a 52, a 53, or a 54 γδ T cell, preferably a 52" γδ T cell, more preferably a 51 γδ T cell.
[0028] In embodiments, said modified immune cell, or said γδ T cell, exhibits in vitro and / or in vivo cell killing activity against a tumor cell that exhibits cell surface expression of PSMA. In embodiments, said cell killing activity is greater than an innate level of in vitro and / or in vivo tumor cell killing activity in a control modified immune cell or control γδ T cell of the same type that does not comprise a CAR construct. In embodiments, said modified immune cell or γδ T cell proliferates in response to contact with the tumor cell that exhibits cell surface expression of PSMA. In embodiments, said modified immune cell or γδ T cell exhibits increased proliferation in response to contact with the tumor cell that exhibits cell surface expression of PSMA as compared to a control modified immune cell or γδ T cell of the same type that does not comprise a CAR construct.
[0029] In embodiments, said modified immune cell or γδ T cell proliferates in a host organism that comprises a tumor cell that exhibits cell surface expression of PSMA.
[0030] In embodiments, said modified immune cell or γδ T cell expresses pro-inflammatory cytokines after contact with a tumor cell that exhibits cell surface expression of PSMA.
[0031] In embodiments, said modified immune cell or γδ T cell comprises at least one disrupted gene. In embodiments, said at least one disrupted gene is cytokine inducible SH2- containing protein (CISH). In embodiments, the at least one disrupted endogenous gene is Cbl proto-oncogene B (CBL-B). In embodiments, the at least one disrupted endogenous gene is Zinc Finger Protein 91 (ZFP91). In embodiments, the at least one disrupted endogenous gene is Roquin. In embodiments, the at least one disrupted endogenous gene is CD58 and / or Ki AM-1 .
[0032] According to an aspect, provided is a plurality of modified immune cells as herein disclosed.
[0033] According to an aspect, provided is a plurality of γδ T cells as herein disclosed, preferably wherein said γδ T cells comprise a) a nucleic acid encoding a CAR as herein disclosed, said CAR comprising an affinity binding domain that specifically binds to PSMA; and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid of (a), wherein the γδ T cell functionally expresses the binding domain of the polypeptide or nucleic acid encoded CAR on the surface of the γδ T cell.
[0034] In embodiments, said plurality of modified immune cells or said plurality of γδ T cells comprises a composition that is at least 60%, 80%, or from about 60% or 80% to about 90% or 95% 81, 82, 83, or 84 γδ T cells, preferably 81 or 82 γδ T cells, more preferably 82" γδ T cells, most preferably 81 γδ T cells.
[0035] In embodiments, said plurality of modified immune cells or said plurality of γδ T cells comprises at least about 107modified immune cells or γδ T cells, respectively, preferably from about 108modified immune cells or γδ T cells to about 1011modified immune cells or γδ T cells, respectively.
[0036] According to an aspect, provided is a method of making the modified immune cell, the γδ T cell, the plurality of modified immune cells, or the plurality of γδ T cells, wherein said method comprises transfecting immune cell(s) or γδ T cell(s) with an expression vector comprising a nucleic acid encoding a CAR as herein disclosed, optionally wherein said cell(s) have at least one disrupted gene. In embodiments, the method comprises retroviral transduction. Inembodiments, the method comprises ex vivo expansion of the immune cell(s) or yb T cell(s), wherein the ex vivo expansion is performed before transfection and / or after transfection of the immune cell(s) or yb T cell(s).
[0037] According to aspects of the invention, provided is an antibody-drug conjugate (ADC), comprising any one of the afore-mentioned affinity binding entities.
[0038] According to aspects of the invention, provided is a pharmaceutical composition comprising any one of the afore-mentioned affinity binding entity(s), modified immune cell(s), yb T cell(s), or ADC(s), and a pharmaceutically acceptable carrier.
[0039] According to aspects of the invention, provided is a method of inhibiting the growth of a cell that exhibits cell surface expression of PSMA, comprising contacting said cell with any one of the afore-mentioned affinity binding entity(s), modified immune cell(s), yb T cell(s), ADC(s), or pharmaceutical composition(s).
[0040] According to aspects of the invention, provided is a method of killing a tumor cell that exhibits cell surface expression of PSMA, the method comprising contacting the tumor cell with a therapeutically effective amount of any one of the afore-mentioned affinity binding entity(s), modified immune cell(s), yb T cell(s), ADC(s), or pharmaceutical composition(s). In embodiments, said method comprises introducing into a host organism comprising the tumor cell the therapeutically affective amount of the affinity binding entity(s), modified immune cell(s), yb T cell(s), ADC(s), or pharmaceutical composition(s).
[0041] In embodiments of the method of killing a tumor cell, the method further comprises simultaneously or sequentially administering one or more methods to elevate common gamma chain cytokine(s). In embodiments, the administering one or more methods to elevate common gamma chain cytokine(s) comprises simultaneously or sequentially administering an amount of common gamma chain cytokine(s) effective to increase proliferation, cytotoxic activity, persistence, or the combination thereof of the introduced modified immune cell(s) or the yb T cell(s), before and / or after introducing the modified immune cell(s) or the yb T cell(s). In embodiments, the one or more methods to elevate common gamma chain cytokine(s) comprises lymphodepletion before introducing the modified immune cell(s) or the yb T cell(s). In embodiments, the one or more methods to elevate common gamma chain cytokine(s) comprisessecretion of one or more common gamma chain cytokine(s) from the introduced modified immune cell(s) or yb T cell(s).
[0042] In embodiments herein of the method of inhibiting the growth of a cell that exhibits cell surface expression of PSMA, or the method of killing a tumor cell that exhibits cell surface expression of PSMA, said method(s) reduces the in vivo tumor burden in the host organism and / or increases the mean survival time of the host organism as compared to a control organism, wherein the control organism is not treated with the affinity binding entity(s), modified immune cell(s), yb T cell(s), ADC(s), or pharmaceutical composition(s). In embodiments, the host organism is human. In embodiments, said methods are methods of treating cancer in a subject in need thereof
[0043] According to an aspect, provided is a use of any one of the afore-mentioned affinity binding entity(s), modified immune cell(s), yb T cell(s), ADC(s), or pharmaceutical composition(s), in the preparation of a medicament for the treatment of cancer.
[0044] In one aspect, provided is a method of reducing or inhibiting the graft vs. host response to an immune cell administered to a subject in need thereof, comprising administering a therapeutically effective amount of yo T cells according to the subject invention. In embodiments, the yb T cells may comprise a dual CAR binding to CD70 and PSMA, or the method may further comprise co-administering the yb T cell according to the subject invention simultaneously or sequentially with an immune cell (e.g., a T cell or NK cell) comprising a CAR binding to PSMA and a CAR binding to CD70.INCORPORATION BY REFERENCE
[0045] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS
[0046] FIG. 1 illustrates binding profiles of anti-PSMA antibodies to both PSMA-expressing 22Rvl cells as well as 22Rvl cells knocked out for PSMA expression.
[0047] FIG. 2A depicts tabulation of the EC50s of the anti-PSMA antibodies against recombinant human PSMA protein.
[0048] FIG. 2B illustrates the differential binding profiles of select anti-PSMA antibodies to the monomeric or dimeric state of recombinant human PSMA protein.
[0049] FIGS. 3A-3H are graphs illustrating in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure against PSMA-expressing cell lines (PSMA-expressing 22Rvl target cells, FIGS. 3 A, 3C; PC3 cells engineered to express PSMA, FIGS. 3E, 3G) , or corresponding negative controls (22Rvl with PSMA expression knocked out, FIGS. 3B, 3D; parental PC3 cell line which does not express PSMA, FIGS. 3F, 3H).
[0050] FIGS. 4A-4B are graphs illustrating that the in vitro cytotoxicity profile of a PSMA CAR construct modified to express dominant negative TGFp receptor II (dnTGFpRII). The modified PSMA CAR construct cytotoxicity profile is comparable to that of a similar PSMA CAR construct lacking dnTGFpRII (FIG. 4A). No cytotoxicity was seen against a PSMA knockout cell line (FIG. 4B).
[0051] FIG. 5A illustrates that the expression of a PSMA CAR construct modified to express dnTGFpRII is unchanged from the expression of a similar PSMA CAR lacking dnTGFpRII.
[0052] FIG. 5B illustrates the expression of dnTGFpRII is detected in a PSMA CAR construct modified to express dnTGFpRII, but not in a similar unmodified PSMA CAR construct.
[0053] FIG. 5C illustrates that yd T cells containing a PSMA CAR construct modified to express dnTGFpRII have decreased CD103 expression as compared to control cells including a similar PSMA CAR construct lacking dnTGFpRII.
[0054] FIG. 5D illustrates a decrease in pSMAD2 / 3 expression in γδ T cells containing a PSMA CAR construct modified to express dnTGFpRII as compared to controls cells including a similar PSMA CAR construct lacking dnTGFpRII.
[0055] FIG. 6 illustrates 15-day cell expansion profiles of anti-PSMA CAR-transduced γδ T cells.
[0056] FIGS. 7A-7B are graphs illustrating the in vivo efficacy of anti-PSMA CAR- transduced γδ T cells in a subcutaneous human xenograft 22Rvl clone E7 model in NOD scid gamma (NSG) mice.
[0057] FIG. 8 is a graph illustrating gene knockout efficiency of two different guide RNAs targeting cytokine inducible SH2 containing protein (CISH).
[0058] FIG. 9 A is a graph illustrating that V81 T cells with CISH knocked out can be enriched post-depletion of T cells.
[0059] FIG. 9B is a graph illustrating viability of V81 T cells with CISH knocked out.
[0060] FIG. 10A illustrates the binding profiles of the anti-PSMA antibodies to both PSMA- expressing 22Rvl cells as well as 22Rvl cells knocked out for PSMA expression. FIG. 10B summarizes binding profiles of anti-PSMA antibodies to 3 different PSMA+ prostate cancer (PCa) cell lines with varying levels of PSMA expression.
[0061] FIG. 11A illustrates the EC50s of the anti-PSMA antibodies against recombinant human PSMA protein. FIG. 11B illustrates the differential binding profiles of some anti-PSMA antibodies to the monomeric or dimeric state of recombinant human PSMA protein.
[0062] FIG. 12 illustrates the in vitro cytotoxicity of different PSMA CAR constructs against PSMA-expressing PCa cell lines 22Rvl and PC3-PSMA, and the corresponding knockout or parental lines, respectively, that lack PSMA expression.
[0063] FIG. 13 illustrates in vitro cytotoxicity of a PSMA CAR in the presence of TGFp 1.
[0064] FIG. 14A illustrates the expression of CAR remains unchanged in the “bolt-on” modified PSMA CAR construct from that of the naked CAR. FIG. 14B illustrates the expression of dominant negative TGFp receptor II (dnTGFpRII), in the “bolt-on” modified PSMA CAR construct when compared to that of the unmodified naked CAR. FIG. 14C illustrates the decreasein CD103 expression in the “bolt-on” modified PSMA CAR construct as compared to the naked CAR. FIG. 14D illustrates the decrease in pSMAD2 / 3 expression in the “bolt-on” modified PSMA CAR construct upon addition of exogenous TGFP as compared to the unmodified naked CAR.
[0065] FIG. 15 illustrates the cell expansion profiles of anti-PSMA CAR-transduced γδ T cells with and without a “bolt-on” as well as the Benchmark (1591) across 3 donors.
[0066] FIG. 16 illustrates the in vivo efficacy of anti-PSMA CAR-transduced γδ T cells expanded in 3 donors in a subcutaneous human xenograft 22Rvl clone E7 model in NOD scid gamma (NSG) mice, as compared to the Benchmark J591 -transduced γδ T cells.
[0067] FIG. 17 illustrates the in vivo efficacy of anti-PSMA CAR with and without the dnTGFpRII “bolt-on”, including at sub-optimal doses, in a subcutaneous human xenograft PC3- PIP model in NSG mice.
[0068] FIG. 18A illustrates the epitopes of binders in two anti-PSMA CAR-transduced γδ T cells mapped to the crystal structure of human PSMA. Predicted linear epitope of Benchmark (J591), conformational epitopes of lead 1 and lead 2 are indicated the figure. FIG. 18B lists sequences (SEQ ID NOS: 329-330) on human PSMA elucidated as epitopes for binders in Lead 1 and 2 using cross-linking mass spectrometry (XL-MS).
[0069] FIG. 19 illustrates the CAR-mbIL-12 construct designs.
[0070] FIGS. 20A-20D illustrate the expansion and expression of the CAR-mbIL-12 in V51T cells.
[0071] FIG. 21 illustrates the enhanced in vitro cytotoxicity of CAR-mbIL-12 in V81 T cells.
[0072] FIG 22. illustrates in vivo therapeutic efficacy of CAR-mbIL-12 in V81 T cells in a subcutaneous human xenograft Raji cell NSG mouse model.
[0073] FIGS. 23A-23B. illustrate CISH KO enhanced the in vitro cytotoxicity of V81 T cells.
[0074] FIGS. 24A-24B. illustrate CBL-B KO enhanced the in vitro cytotoxicity of V81 T cells.
[0075] FIGS. 25A-25B. illustrate Roquin KO enhanced the in vitro cytotoxicity of V81 T cells.
[0076] FIGS. 26A-26B. illustrates CD58 or ICAM-1 KO enhanced the in vitro cell survival of V81 T cells in an allogeneic MLR assay.DETAILED DESCRIPTIONI. Definitions
[0077] For purposes of interpreting this specification, the following definitions will apply, and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth conflicts with any document incorporated herein by reference, the definition set forth below shall control. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.
[0078] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0079] As used herein, “w / v” refers to the weight of the component in a given volume of solution.
[0080] “Ranges”: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1 , 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.*>*> cc
[0081] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal amenable to the methods described herein. In certain nonlimiting embodiments, the patient, subject or individual is a human.
[0082] The term “diagnosis”, or “diagnosing” as used herein refers to the process of identifying a disease, such as cancer, by its signs, symptoms, and / or results of various tests. A conclusion reached through such a process is a diagnosis. Forms of testing commonly performed include blood tests, medical imaging, urinalysis, biopsy, and the like.
[0083] As used herein, the term “agent” refers to any protein, nucleic acid molecule (including chemically modified nucleic acids), compound, antibody, small molecule, organic compound, inorganic compound, other molecule of interest, or cell (e.g., cell engineered to express a chimeric antigen receptor). Agent can include a therapeutic agent, a diagnostic agent or a pharmaceutical agent. A therapeutic or pharmaceutical agent is one that alone or together with an additional agent induces the desired response (such as inducing a therapeutic or prophylactic effect when administered to a subject, including treating a subject suffering from cancer, or other disease / condition.
[0084] The term "therapeutically effective amount", or simply “effective amount” refers to the amount of an agent or composition (e.g., composition comprising an agent) that will elicit a biological or medical response of a tissue, system, or subject that is being sought by the researcher, veterinarian, medical doctor or other clinician. The term "therapeutically effective amount" includes that amount of an agent, or a composition comprising an agent, that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the signs or symptoms of the disorder or disease (e.g., prostate cancer) being treated The therapeutically effective amount will vary depending on the composition, the disease and its severity and the age, weight, etc., of the subject to be treated.
[0085] The term “y6 T cells (gamma delta T cells)” as used herein refers to a subset of T cells that express a distinct T cell receptor (TCR), namely ySTCR, on their surface, composed of one y- chain and one 8-chain. The term “γδ T cells” specifically includes all subsets of γδ T cells, including, without limitation, V51 and V52, V53 γδ T cells, as well as naive, effector memory, central memory, and terminally differentiated γδ T cells. As a further example, the term “γδ T cells” includes V84, V85, V87, and V88 γδ T cells, as well as Vy2, Vy3, Vy5, Vγδ, Vy9, VylO, and Vyl l γδ T cells. In embodiments, the γδ T cells are V81", V82", or V81" and V82". Compositions and methods for making and using engineered and non-engineered γδ T cells and / or sub-types thereof include, without limitation, those described in US 2016 / 0175358; WO2017 / 197347; US 9499788; US 2018 / 0169147; US 9907820; US 2018 / 0125889 and US 2017 / 0196910, the contents of each of which are incorporated by reference for all purposes, including the said compositions and methods for making and using engineered and non-engineered γδ T cells and / or sub-types thereof. The present application further contemplates T cells, or other engineered leukocytes or lymphocytes, that express one y-chain or one 8-chain, optionally in combination with a second polypeptide to form a functional TCR. Such engineered leukocytes or lymphocytes, that express one y-chain or one 8-chain may be used in the methods or present in the compositions described herein.
[0086] The γδ T cells described herein can be 81, 82, 83, or 84 γδ T cells, or combinations thereof. In some cases, the γδ T cells are mostly (>50%), substantially (>90%), essentially all, or entirely 82 γδ T cells. In some cases, the γδ T cells are mostly (>50%), substantially (>90%), essentially all, or entirely 81 γδ T cells. In some cases, the γδ T cells are mostly (>50%), substantially (>90%), essentially all, or entirely 83 γδ T cells.
[0087] γδ T cells for use as described herein can be obtained from an allogeneic or an autologous donor. The γδ T cells can be, partially or entirely purified, or not purified, and expanded ex vivo. Methods and compositions for ex vivo expansion include, without limitation, those described in WO 2017 / 197347. The expansion may be performed before or after, or before and after, a CAR polypeptide of the present disclosure is introduced into the γδ T cell(s). Other additional or alternative methods of expansion include the use of, e.g., artificial antigen-presenting cells (aAPCs), aminobisphosphonates, cytokine cocktails, and feeder cells (Cortes- Selva, D et al., (2021) Trends Pharmacol Sci. 42(1): 45-59).
[0088] As used herein, the term “otP T cell” refers to T cells expressing a and P chains of the TCR as part of a complex with CD3 chain molecules. Each a and P chain contains one variable and one constant domain. ap T cells primarily recognize peptide antigens presented by major histocompatibility complex (MHC) class I and class II molecules, where most of the receptor diversity is contained within the third complementarity determining region (CDR3) of the TCR a and p chains.
[0089] As used herein, the term “Natural killer (NK) cell” refers to CD56+CD3 granular lymphocytes that play important roles in immunity against viruses and in the immune surveillanceof tumors, and constitute a critical cellular subset of the innate immune system (Godfrey J, et al. Leuk Lymphoma 2012 53: 1666-1676). NK cells express a remarkably diverse repertoire of inhibitory and activating receptors on their cell surface, which regulates their immune responses. NK cells can kill transformed or infected cells by the release of perforin and granzymes or by using effector molecules of the tumor necrosis factor (TNF) family, such as TNF, TNF-related apoptosis inducing ligand (TRAIL), and Fas ligand, which induce apoptosis in the target cells. Additionally, upon activation NK cells rapidly produce chemokines and cytokines, including interferon (IFN)- Y, GM-CSF, and IL-10, that recruit and affect the function of hematopoietic and nonhematopoietic cells in the host. Unlike cytotoxic CD8+T lymphocytes, NK cells launch cytotoxicity against tumor cells without the requirement for prior sensitization, and can also eradicate MHC-I-negative cells (Nami-Mancinelli E, et al. Int Immunol 2011 23:427-431). NK cells are considered fairly safe effector cells, as they may avoid the potentially lethal complications of cytokine storms (Morgan R A, et al. Mol Ther 2010 18:843-851), tumor lysis syndrome (Porter D L, et al. N Engl J Med 2011 365:725-733), and on-target, off-tumor effects.
[0090] NK cells can be obtained from an allogeneic or an autologous donor. The NK cells can be partially or entirely purified, or not purified, and expanded ex vivo. Methods and compositions for ex vivo expansion include, without limitation, those described in Becker et al., (2016) Cancer Immunol. Immunother. 65(4): 477-84). The expansion may be performed before or after, or before and after, a CAR is introduced into the NK cell(s). Briefly, and without limitation, expansion of NK cells can include the use of engineered feeder cells, cytokine cocktails (e.g., IL-2, IL-15), and / or aAPCs (Cortes-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1): 45-59).
[0091] In some examples, placental hematopoietic stem-cell derived natural killer (PNK) cells or immortalized cell lines (e.g., NK-92) may be engineered to express chimeric adaptor polypeptides of the present disclosure. In other examples, NK cells that can be used for engineering the expression of CARs herein can be differentiated from human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). As used herein, the term “Natural killer T (NKT) cells” are T lineage cells that share morphological and functional characteristics with both T cells and NK cells. NKT cells are rapid responders of the innate immune system and mediate potent immunoregulatory and effector functions in a variety of disease settings. Ligand recognition in NKT cells leads to rapid secretion of proinflammatory cytokines (such as IFN-y and TNF-a) and anti-inflammatory cytokines (such as IL-4, IL-10, and IL-13) that enhance the immuneresponse to e g., cancer by directly targeting tumor cells and by indirectly modulating the antitumor response through the release of diverse cytokines or by altering the TME. Following activation, NKT cells can immediately commence cytokine secretion without first having to differentiate into effector cells. The rapidity of their response makes NKT cells important players in the very first lines of innate defense against some types of bacterial and viral infections. In addition, many of the cytokines secreted by NKT cells have powerful effects on ap T cell differentiation and function, linking NKT cells to adaptive defense. NKT cells bridge the adaptive immune system with the innate immune system. Unlike conventional T cells that recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glycolipid antigen presented by a molecule called CD Id. NKT cells can be obtained from an allogeneic or an autologous donor. The NKT cells can be partially or entirely purified, or not purified, and expanded ex vivo. Briefly and without limitation, NKT cells can be expanded via the use of ex vivo IL-2, and / or monoclonal antibodies specific for the TCR a-chain CDR3 loop (Cortes-Selva, D et ah, (2021) Trends Pharmacol Sci. 42(1): 45-59).
[0092] As used herein, the term “γδ natural killer T cells” or “γδ NKT cells” refers to iPSC- derived cells that express γδ TCRs and NK receptors, but lack the expression of hallmark γδ T cell markers (Cortes-Selva, D et ah, (2021) Trends Pharmacol Sci. 42(1): 45-59). These cells have been shown to have anti-tumor activity against a broad number of cancer cell lines, but not against normal cells, and showed more potent killing than donor-derived γδ T cells or donor-derived NK cells (Zeng J et al., (2019) PLoS ONE 14(5): e0216815). CARs can be expressed in γδ NKT cells, in embodiments herein, for use in accordance with the methods disclosed herein.
[0093] As used herein, the term “myeloid cells” refers to a subgroup of leukocytes represented by granulocytes, monocytes, macrophages, and dendritic cells (DCs). They circulate through the blood and lymphatic system and are rapidly recruited to sites of tissue damage and infection via various chemokine receptors. Within the tissues they are activated for phagocytosis as well as secretion of inflammatory cytokines, thereby playing major roles in protective immunity. Myeloid cells can also be found in tissues under steady-state condition, where they control development, homeostasis, and tissue repair.
[0094] As used herein, the term “macrophages” refers to highly plastic innate cells with functional and phenotypic signatures that can be shaped in response to various stimuli.Macrophage polarization is broadly simplified into two different states, either a Ml phenotype (classically activated) in response to factors such as lipopolysaccharide (EPS) or IFN-y, or a M2 phenotype in response to cytokines such as IL-4, IL-5, and IL-13. An example of Ml-like macrophages express iNOS and proinflammatory cytokines such as TNF-a, IL1-P, IL-6, IL-12, and IL-23. An example of M2 macrophages exhibit increased expression of CD209, CD200R, CD la, and CD lb in humans, and have been implicated in wound healing and antitumor responses. The ability of macrophages to infiltrate solid tumors and be reprogrammed, as well as the antitumor effects associated with a switch to the Ml phenotype, render macrophages relevant to the present disclosure in terms of engineered macrophages that express a CAR described herein. For example, it has been shown that macrophages can be reprogrammed towards antitumor Ml phenotype cells that are capable of producing nitric oxide and inducing IL-12-dependent NK-mediated antitumor effects by inhibiting NK-KB signaling in a murine model of ovarian cancer (Zhang F et al., (2019) Nat Commun 10: 3974).
[0095] Macrophages can be obtained / derived from an allogeneic or an autologous donor. The macrophages can be partially or entirely purified, or not purified, and cultured ex vivo (see, e.g., Davies JQ and Gordon A (2005) Methods Mol Biol 290: 105016). In embodiments, the present disclosure encompasses macrophages derived from hESCs (Karlsson, KR et al., (2008) Exp Hematol 36: 1167-1175), or iPSC-derived macrophages (Takata K. et al., (2017) Immunity 47: 183-198).
[0096] As used herein, the term “T lymphocyte” or “T cell” refers to an immune cell that expresses or has expressed CD3 (CD3+) and a T Cell Receptor (TCR+). T cells play a central role in cell-mediated immunity. A T cell that “has expressed” CD3 and a TCR has been engineered to eliminate CD3 and / or TCR cell surface expression.
[0097] As used herein, the term “TCR” or “T cell receptor” refers to a dimeric heterologous cell surface signaling protein forming an alpha-beta or gamma-delta receptor or combinations thereof. aPTCRs recognize an antigen presented by an MHC molecule, whereas ySTCR can recognize an antigen independently of MHC presentation.
[0098] The term "MHC" (major histocompatibility complex) refers to a subset of genes that encodes cell-surface antigen-presenting proteins. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. Herein, the abbreviations MHC or HLA are used interchangeably.
[0099] As used herein, “prostate specific membrane antigen” or “PSMA” refers to any native PSMA from any vertebrate source, including mammals such as primates (e.g., humans, non-human primates, and rodents), unless otherwise indicated. The term encompasses “full-length,” unprocessed PSMA as well as any form of PSMA that results from processing in the cell. The term also encompasses naturally occurring variants of PSMA, e.g., splice variants, allelic variants, and isoforms. PSMA is a type II membrane protein originally characterized by the murine monoclonal antibody (mAb) 7E11-C5.3. The PSMA protein has a 3-part structure: a 19- aminoacid internal portion, a 24-amino-acid transmembrane portion, and a 707-amino-acid external portion (e.g., the extracellular domain). An exemplary amino acid sequence for human PSMA is set forth herein as SEQ ID NO: 150. An exemplary amino acid sequence for the extracellular domain of human PSMA is set forth as SEQ ID NO: 151.
[0100] “Activation”, as used herein, refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions. The term “activated T cells” refers to, among other things, T cells that are undergoing cell division.
[0101] The “costimulatory domain” in the context of a chimeric receptor, also referred to herein as a chimeric antigen receptor (CAR), of the present disclosure enhances cell proliferation, cell survival and development of memory cells for cytotoxic cells that express the chimeric receptor. The chimeric receptors of the invention may include one or more costimulatory domains selected from the costimulatory domains of proteins in the TNFR superfamily, CD28, CD 137 (4- 1BB), CD134 (0X40), DaplO, CD27, CD2, CD7, CD5, ICAM-1, LFA-1 (CD1 la / CD18), Lek, TNFR-I, PD-1, TNFR-II, Fas, CD30, CD40, ICOS LIGHT, NKG2C, B7-H3, or combinations thereof. If the chimeric receptor includes more than one costimulatory domain, these domains may be arranged in tandem, optionally separated by a linker. The costimulatory domain is an intracellular domain that may locate between CD70 (truncated or full length) and an intracellular signaling domain in the chimeric receptor.
[0102] The term “costimulatory domain” as used herein also encompasses any modifications thereof, examples of which are described in US Patent Application No. 20200129554; US Patent Application No. 20200317777; W02019010383; Li, W., et al., (2020) Immunity 53: 456-470; andLi, G , et al., (2017) J Immunol 198(1 Supplement): 198.4, the contents of each of which are incorporated herein in their entirety.
[0103] The “intracellular signaling domain” in the context of a chimeric receptor of the present disclosure transduces the effector function signal and directs the cytotoxic cell to perform its specialized function, i.e., harming and / or destroying the target cells. Examples of suitable intracellular signaling domains include, e.g., the £ chain of the T cell receptor complex or any of its homologs, e.g., r| chain, FcsRly and p chains, MB 1 (Iga) chain, B29 (1g) chain, etc., human CD3 £ chain, CD3 polypeptides (A, 8 and s), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lek, Fyn, Lyn, etc.) and other molecules involved in T cell transduction, such as CD2, CD5 and CD28 Tn embodiments, the intracellular signaling domain of a chimeric receptor may be human CD3 L, chain, FcyRIII, FcsRI, cytoplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (ITAM) bearing cytoplasmic receptors and combinations thereof.
[0104] The intracellular signaling domains may include intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins including CD3, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (Park et al., "Are all chimeric antigen receptors created equal?" J Clin Oncol., vol. 33, pp. 651-653, 2015). Additional intracellular signaling domains include signaling domains used by NK andNKT cells (Hermanson, et al., "Utilizing chimeric antigen receptors to direct natural killer cell activity," Front Immunol., vol. 6, p. 195, 2015) such as signaling domains of NKp30 (B7-H6) (Zhang et al., "An NKp30- based chimeric antigen receptor promotes T cell effector functions and antitumor efficacy in vivo,’1J Immunol., vol. 189, pp. 2290-2299, 2012), and DAP12 (Topfer et al., "DAP12-based activating chimeric antigen receptor for NK cell tumor immunotherapy," J Immunol., vol. 194, pp. 3201- 3212, 2015), NKG2D, NKp44, NKp46, DAP10, and CD3z. Additionally intracellular signaling domains also includes signaling domains of human Immunoglobulin receptors that contain immunoreceptor tyrosine based activation motif (ITAM) such as FcgammaRI, FcgammaRIIA, FcgammaRIIC, FcgammaRIIIA, FcRL5 (Gillis et al., "Contribution of Human Fc.gamma.Rs to Disease with Evidence from Human Polymorphisms and Transgenic Animal Studies," Front Immunol., vol. 5, p. 254, 2014).
[0105] In embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR C FcR y, FcR 0, CD3 y, CD3 5, CD3 s, CDS, CD22, CD79a, CD79b, or CD66d. In exemplary embodiments the intracellular signaling domain in the chimeric receptor includes a cytoplasmic signaling domain of human CD3 C,. The term “intracellular signaling domain” as used herein also encompasses any modifications thereof, examples of which are described in US Patent Application No. 2020 / 0317777, as well as Roda-Navarro, P., and Reyburn, HT., (2009) J Biol Chem 284(24): 16463-16472; Giurisato, E., et al., (2007) Mol Cell Biol 27(24): 8583-8599; and Wu, I., et al., (2000) J Exp Med 192(7): 1059-1068, the contents of each of which are incorporated herein in their entirety.
[0106] The term “affinity binding entity” refers to a binding moiety which binds to a specific antigen with a higher affinity than to a non-specific antigen and is endowed with an affinity of at least IO'6M, as determined by assays which are well known in the art, including surface plasmon resonance (SPR). According to a. specific embodiment, the affinity is 500 nM-0.01. nM, 100 nM- 0.01 nM, 50 nM-0.01 nM, 10 nM-0.01 nM, 5 nM-0.01 nM.
[0107] According to embodiments, the affinity binding entity is an antibody. The term “antibody” is used in the broadest sense and specifically covers, for example, single anti-PSMA monoclonal antibodies (including agonist, antagonist, neutralizing antibodies, full length or intact monoclonal antibodies), anti-PSMA antibody compositions with polyepitopic specificity, polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity), formed from at least two intact antibodies, single chain anti-PSMA antibodies, and fragments of anti-PSMA antibodies (see below), including Fab, Fab’, F(ab’)2 and Fv fragments, diabodies, single domain antibodies (sdAbs), as long as they exhibit the desired biological or immunological activity. Also included among anti-PSMA antibodies, and among fragments in particular, are portions of anti-PSMA antibodies (and combinations of portions of anti-PSMA antibodies, for example, scFv) that may be used as targeting arms, directed to e.g., a PSMA epitope, in chimeric antigenic receptors of the present disclosure. Such fragments are not necessarily proteolytic fragments but rather portions of polypeptide sequences that can confer affinity for target. The term “immunoglobulin” (Ig) is used interchangeably with antibody herein. An antibody can be, for example, human, humanized and / or affinity matured.
[0108] Methods of making antibodies and antibody fragments are known in the art. (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
[0109] Antibodies can be produced by the immunization of various animals, including mice, rats, rabbits, goats, primates, humans and chickens with a target antigen such as PSMA or peptide fragments of PSMA containing the anti-PSMA epitope of the present disclosure. Antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352: 624-8 (1991) and Marks et al., J. Mol. Biol., 222: 581-97 (1991), for example. Antibodies or antigen-binding fragment of the present invention can be purified by methods known in the art, for example, gel filtration, ion exchange, affinity chromatography, etc. Affinity chromatography or any of a number of other techniques known in the art can be used to isolate polyclonal or monoclonal antibodies from, for example, serum, ascites fluid, or hybridoma supernatants.
[0110] The terms “anti-PSMA antibody”, “PSMA antibody”, and “an antibody that binds to PSMA” are used interchangeably. Anti-PSMA antibodies are preferably capable of binding with sufficient affinity such that the antibody is useful as a diagnostic and / or therapeutic agent, whether in isolation or as part of fusion protein, cell, or cell composition.
[0111] An “isolated antibody” is one which has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
[0112] The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to a H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable domain (VH) followed by three constant domains (CH) for each of the a and y chains and four CH domains for p and £ isotypes. Each L chain has at the N-terminus, a variable domain (VL) followed by a constant domain (CL) at its other end. The VL is aligned with the VH and the CL is aligned with the first constant domain of the heavychain (CHI). Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains. The pairing of a VH and VL together forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, at page 71 and Chapter 6.
[0113] The L chain from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains (CH), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, TgD, IgE, TgG, and IgM, having heavy chains designated a, 8, £, y, and p, respectively. The y and a classes are further divided into subclasses on the basis of relatively minor differences in CH sequence and function, e.g., humans express the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2.
[0114] The “variable region” or “variable domain” of an antibody refers to the amino-terminal domains of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as “ VH” or “VH” The variable domain of the light chain may be referred to as “VL” or “VL”. These domains are generally the most variable parts of an antibody and contain the antigen-binding sites.
[0115] The term “variable” refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies. The V domain mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable domains. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called “hypervariable regions” that are each about 9-12 amino acids long. The variable domains of native heavy and light chains each comprise four FRs, largely adopting a 0-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the [3-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding siteof antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).
[0116] An “intact” antibody is one which comprises an antigen-binding site as well as a CL and at least heavy chain constant domains, CHI, CH2 and CHS. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variant thereof. Preferably, the intact antibody has one or more effector functions.
[0117] “Antibody fragments” comprise a portion of an intact antibody, preferably the antigen binding or one or more variable regions of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (see U.S. Patent No. 5,641,870, Example 2; Zapata et al., Protein Eng. 8(10): 1057-62 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. In one embodiment, an antibody fragment comprises an antigen binding site of the intact antibody and thus retains the ability to bind antigen. Also included among anti-PSMA antibody fragments are portions of anti- PSMA antibodies (and combinations of portions of anti-PSMA antibodies, for example, scFv) that may be used as targeting arms, directed to e.g., a PSMA epitope, in chimeric antigenic receptors of the present disclosure. Such fragments are not necessarily proeteolytic fragments but rather portions of polypeptide sequences that can confer affinity for target.
[0118] Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, and a residual “Fc” fragment, a designation reflecting the ability to crystallize readily. The Fab fragment consists of an entire L chain along with the variable region domain of the H chain (VH), and the first constant domain of one heavy chain (CHI). Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody yields a single large F(ab')2 fragment which roughly corresponds to two disulfide linked Fab fragments having divalent antigen-binding activity and is still capable of cross-linking antigen. Fab’ fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
[0119] The Fc fragment comprises the carb oxy -term in al portions of both H chains held together by disulfides. The effector functions of antibodies are determined by sequences in the Fc region, which region is also the part recognized by Fc receptors (FcR) found on certain types of cells.
[0120] “Fv” is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This fragment consists of a dimer of one heavy- and one light-chain variable region domain in tight, non-covalent association. In a single-chain Fv (scFv) species, one heavy - and one light-chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a “dimeric” structure analogous to that in a two-chain Fv species. From the folding of these two domains emanate six hypervariable loops (3 loops each from the H and L chain) that contribute the amino acid residues for antigen binding and confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
[0121] “Single-chain Fv” also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the VH and VL antibody domains connected into a single polypeptide chain. In embodiments, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form a desired structure for antigen binding. For a review of sFv, see, e.g., Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994); Borrebaeck 1995, infra. In one embodiment, an anti-PSMA antibody derived scFv is used as the targeting arm of a CAR-modified immune cell as disclosed herein. In terms of scFv antibody fragments, where a certain order of VH and VL region in the binding domain is explicitly or implicitly described, the present disclosure also includes the alternate embodiment in which the order of VH and VL regions are reversed, e.g., in an scFv or CAR comprising an scFv binding domain. Thus, description of a VH- VL order also describes the alternate VL-VH order, e.g., in an scFv or CAR comprising an scFv binding domain. Moreover, description of a VL-VH order also describes the alternate VH-VL order, e.g., in an scFv or a CAR comprising an scFv binding domain. VH and VL regions are either joined directly or joined by a peptide-encoding linker, which connects the N-terminus of the VH with the C -terminus of the VL, or the C -terminus of the VH with the N-terminus of the VL
[0122] The scFv linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al, Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014 / 087010, the contents of which are hereby incorporated by reference in their entireties. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 275), (GGGS)n (SEQ ID NO: 276), and (GGGGS)n (SEQ ID NO: 277), where n represents an integer of at least 1. Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), GGGGS (SEQ ID NO: 284), GGGGSGGGGSGGGGS (SEQ ID NO: 154) and the like. Those of skill in the art would be able to select the appropriate linker sequence for use in the present invention. In one embodiment, an antigen binding domain of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL is separated by the linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 154), which may be encoded by the nucleic acid sequence GGAGGCGGAGGATCTGGTGGTGGTGGATCTGGCGGCGGAGGCTCT (SEQ ID NO: 155)
[0123] The term “monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations which include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier “monoclonal” is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al., Nature, 256: 495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (e.g., U.S. Patent No. 4,816,567). The “monoclonal antibodies” may also be isolated from phageantibody libraries using the techniques described in Clackson et al., Nature, 352: 624-8 (1991) and Marks et al., J. Mol. Biol., 222: 581-97 (1991), for example.
[0124] The term “hypervariable region”, “HVR”, or “HV”, when used herein refers to the regions of an antibody variable domain which are hypervariable in sequence and / or form structurally defined loops. Generally, antibodies comprise six hypervariable regions; three in the VH (Hl, H2, H3), and three in the VL (LI, L2, L3). A number of hypervariable region delineations are in use and are encompassed herein. The Rabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (Rabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991)). Chothia refers instead to the location of the structural loops (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). The end of the Chothia CDR-H1 loop when numbered using the Rabat numbering convention varies between H32 and H34 depending on the length of the loop (this is because the Rabat numbering scheme places the insertions at H35A and H35B; if neither 35A nor 35B is present, the loop ends at 32; if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable regions represent a compromise between the Rabat CDRs and Chothia structural loops, and are used by Oxford Molecular’s AbM antibody modeling software. The “contact” hypervariable regions are based on an analysis of the available complex crystal structures. The residues from each of these hypervariable regions are noted below.H2 H50-H65 H50-H58 H52-H56 H47-H58H3 H95-H102 H95-H102 H95-H102 H93-H101
[0125] Hypervariable regions may comprise “extended hypervariable regions” as follows: 24-36 or 24-34 (LI), 46-56 or 50-56 (L2) and 89-97 (L3) in the VL and 26-35B (Hl), 50-65, 47-65 or 49-65 (H2) and 93-102, 94-102 or 95-102 (H3) in the VH. The variable domain residues are numbered according to Rabat et al., supra, for each of these definitions.
[0126] “Framework” or “FR” residues are those variable domain residues other than the hypervariable region residues herein defined.
[0127] The term “variable domain residue numbering as in Rabat” or “amino acid position numbering as in Rabat”, and variations thereof, refers to the numbering system used for heavy chain variable domains or light chain variable domains of the compilation of antibodies in Rabat et al., supra. Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insert (residue 52a according to Rabat) after residue 52 of H2 and inserted residues (e.g., residues 82a, 82b, and 82c, etc according to Rabat) after heavy chain FR residue 82. The Rabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Rabat numbered sequence.
[0128] The Rabat numbering system is generally used when referring to a residue in the variable domain (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain) (e.g, Rabat et al., supra\ The “EU numbering system” or “EU index” is generally used when referring to a residue in an immunoglobulin heavy chain constant region (e.g., the EU index reported in Rabat et al., supray The “EU index as in Rabat” refers to the residue numbering of the human IgGl EU antibody. Unless stated otherwise herein, references to residue numbers in the variable domain of antibodies means residue numbering by the Rabat numbering system.
[0129] A “blocking” antibody or an “antagonist” antibody is one which inhibits or reduces biological activity of the antigen it binds. Preferred blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen. In one embodiment, an anti-PSMA antibody is provided, which is an antagonist antibody.
[0130] An antibody that “binds” an antigen or epitope of interest is one that binds the antigen or epitope with sufficient affinity that is measurably different from a non-specific interaction. Specific binding can be measured, for example, by determining binding of a molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity.
[0131] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including proteins or peptides, can serve as an antigen.
[0132] The term "epitope" includes any protein determinant, lipid or carbohydrate determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinants usually consist of active surface groupings of molecules such as amino acids, lipids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. Exemplary epitopes for certain anti-PSMA antigen binding domains according to the subject invention are denoted in Figure 18B.
[0133] The term "specifically binds”, as used herein refers to a receptor (which can include but is not limited to an antibody or antibody fragment) which recognizes a specific molecule / ligand, but does not substantially recognize or bind other molecules in a sample. For example, a receptor that specifically binds to a molecule from one species may also bind to that molecule from one or more other species. But, such cross-species reactivity does not itself alter the classification as specific. In another example, a receptor that specifically binds to a molecule may also bind to different allelic forms of the molecule. However, such cross reactivity does not itself alter the classification as specific. In some instances, the terms "specific binding" or "specifically binding," can be used in reference to the interaction of a protein (or a peptide) with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, a receptor recognizes and binds to a specific a structure rather than to proteins generally. If receptor is specific for epitope "A", the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled "A" and the receptor, will reduce the amount of labeled A bound to the receptor.
[0134] In embodiments, specific binding can be characterized by an equilibrium dissociation constant of at least about IxlO"8M or less (e.g., a smaller KD denotes a tighter binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.
[0135] The term “anti-tumor effect” as used herein, refers to a biological effect which can be manifested by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or amelioration of various physiological symptoms associated with the cancerous condition. An “anti-tumor effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the invention in prevention of the occurrence of tumor in the first place.
[0136] The term "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma), neuroendocrine tumors, mesothelioma, schwanoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies. Cancers can include but are not limited to prostate cancer, lung cancer, liver cancer, pancreas cancer, colon cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, prostate cancer, bladder cancer, melanoma, and glioma.
[0137] As used herein, the term “autologous” is meant to refer to any material derived from an individual which is later to be re-introduced into the same individual.
[0138] As used herein, the term “allogeneic” refers to material derived from an animal which is later introduced into a different animal of the same species.
[0139] A “modification” of an amino acid residue / position, as used herein, refers to a change of a primary amino acid sequence as compared to a starting amino acid sequence, wherein the change results from a sequence alteration involving said amino acid residue / positions. For example, typical modifications include substitution of the residue (or at said position) with another amino acid (e g , a conservative or non-conservative substitution), insertion of one or more (generally fewer than 5 or 3) amino acids adjacent to said residue / position, and deletion of said residue / position. An “amino acid substitution”, or variation thereof, refers to the replacement of an existing amino acid residue in a predetermined (starting) amino acid sequence with a differentamino acid residue. Generally, the modification results in alteration in at least one physicobiochemical activity of the variant polypeptide compared to a polypeptide comprising the starting (or “wild type”) amino acid sequence. For example, in the case of an antibody, a physicobiochemical activity that is altered can be binding affinity, binding capability and / or binding effect upon a target molecule.
[0140] To “treat or prevent” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. In one example, a therapy (e.g., administration of a therapeutic agent of the present disclosure) treats a disease or condition by decreasing one or more signs or symptoms associated with the disease or condition, for example as compared to the response in the absence of the therapy. For example, administration of a therapeutic agent may provide an anti-tumor effect that decreases one or more signs or symptoms associated with cancer. Treating or preventing can refer to delaying the onset of symptoms, reducing the severity of symptoms, reducing the severity of an acute episode, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, preventing relapse to a disease, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, increasing time to sustained progression, expediting remission, inducing remission, augmenting remission, speeding recovery, or increasing efficacy of or decreasing resistance to alternative therapeutics. In one embodiment, "treating" refers to both therapeutic treatment and prophylactic or preventive measures, wherein the object is to prevent or lessen the targeted pathologic condition or disorder as described herein.
[0141] As used herein, the term “administration” means to provide or give a subject one or more agents, such as an agent that treats one or more signs or symptoms associated with a condition / disorder or disease including but not limited to cancer (e.g., lymphoma), viral infection, bacterial infection, etc., by any effective route. Exemplary routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes. Administration “in combination with ’’ one or more further therapeutic agents includes simultaneous (concurrent) and sequential administration in any order.
[0142] The term “pharmaceutically acceptable ”, as used herein, refers to a material, including but not limited, to a salt, carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional.Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition (1995), describes compositions and formulations suitable for pharmaceutical delivery of one or more agents, such as one or more modulatory agents. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations can include injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. In addition to biologically-neutral carriers, pharmaceutical agents to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride, and triethanolamine oleate. For example, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and an, e.g., y5, T cell, preferably a γδ T cell engineered to express a CAR directed to PSMA, as described herein.
[0143] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0144] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid orpeptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0145] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
[0146] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.
[0147] “Expression cassette” refers to a nucleic acid comprising expression control sequences operatively linked to a nucleic acid encoding a transcript or polypeptide to be expressed. An expression cassette comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression cassettes can be a component of a vector such as a cosmid, a plasmid (e.g., naked or contained in a liposome), or a virus (e.g., lentivirus, retrovirus, adenovirus, and adeno-associated virus). An expression cassette can be in a host cell, such as a γδ T cell.IT. Compositions and Methods of the InventionA. Anti-PSMA Antibodies
[0148] In one embodiment, the present invention provides anti-PSMA antibodies which may find use herein as therapeutic agents. Exemplary antibodies include polyclonal, monoclonal, chimeric, humanized, and human antibodies.1. Polyclonal Antibodies
[0149] Polyclonal antibodies may be raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the relevant antigen (especially when synthetic peptides are used) to a protein that is immunogenic in the species to be immunized. For example, the antigen can be conjugated to keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor, using a bifunctional or derivatizing agent, e.g., maleimidobenzoyl sulfosuccinimide ester (conjugationthrough cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOC12, or R'N=C=NR, where R and R1 are different alkyl groups.
[0150] Animals are immunized against the antigen, immunogenic conjugates, or derivatives by combining, e.g., 100 pg or 5 pg of the protein or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund’s complete adjuvant and injecting the solution intradermally at multiple sites. One month later, the animals are boosted with Vs to 1 / 10 the original amount of peptide or conjugate in Freund’s complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later, the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.2. Monoclonal Antibodies
[0151] A monoclonal antibody (mAb) to an antigen-of-interest can be prepared by using any technique known in the art. These include, but are not limited to, the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497), the human B cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4: 72), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). The Selected Lymphocyte Antibody Method (SLAM) (Babcook, J.S., et al., A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. Proc Natl Acad Sci U S A, 1996. 93 (15): p. 7843-8. ) and (McLean G et al., 2005, J Immunol. 174(8): 4768-78. Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, and IgD and any subclass thereof. The hybridoma producing the mAbs of use in this invention may be cultivated in vitro or in vivo.[00152J Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (U.S. Pat. No. 4,816,567).
[0153] In the hybridoma method, a mouse or other appropriate host animal, such as a hamster, is immunized as described above to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be immunized in vitro. After immunization, lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent, such as polyethylene glycol, to forma hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)).
[0154] The hybridoma cells thus prepared are seeded and grown in a suitable culture medium which may contain one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells (also referred to as fusion partner). For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the selective culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
[0155] Preferred fusion partner myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a selective medium that selects against the unfused parental cells. Preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA, and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the American Type Culture Collection, Manassas, Va., USA. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).
[0156] Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).
[0157] The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis described in Munson et al., Anal. Biochem. 107: 220 (1980).
[0158] Once hybridoma cells that produce antibodies of the desired specificity, affinity, and / or activity are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEMor RPMT-1640 medium. Tn addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal, e.g., by intraperitoneal injection of the cells into mice.
[0159] The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional antibody purification procedures such as, for example, affinity chromatography (e.g., using protein A or protein G-Sepharose) or ionexchange chromatography, hydroxylapatite chromatography, gel electrophoresis, dialysis, etc.
[0160] DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coll cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce antibody protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Review articles on recombinant expression in bacteria of DNA encoding the antibody include Skerra et al., Curr. Opinion in Immunol. 5: 256-62 (1993) and Pluckthun, Immunol. Rev. 130: 151- 88 (1992).
[0161] In a further embodiment, monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature, 348: 552-54 (1990). Clackson et al., Nature, 352: 624-28 (1991) and Marks et al., J. Mol. Biol, 222: 581-97 (1991) describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high affinity (nM range) human antibodies by chain shuffling (Marks et al., Bio / Technology, 10: 779-83 (1992)), as well as combinatorial infection and in vivo recombination as a strategy for constructing very large phage libraries (Waterhouse et ah, Nuc. Acids. Res. 21 : 2265-6 (1993)). Thus, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of monoclonal antibodies.
[0162] The DNA that encodes the antibody may be modified to produce chimeric or fusion antibody polypeptides, for example, by substituting human heavy chain and light chain constant domain (CH and CO sequences for the homologous murine sequences (U.S. Pat. No. 4,816,567; and Morrison, et al., Proc. Natl. Acad. Sci. USA, 81 : 6851 (1984)), or by fusing theimmunoglobulin coding sequence with all or part of the coding sequence for a nonimmunoglobulin polypeptide (heterologous polypeptide). The non-immunoglobulin polypeptide sequences can substitute for the constant domains of an antibody, or they are substituted for the variable domains of one antigen-combining site of an antibody to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for an antigen and another antigen-combining site having specificity for a different antigen.3. Chimeric, Humanized, and Human Antibodies
[0163] In embodiments, the anti-PSMA antibody is a chimeric antibody. Certain chimeric antibodies are described, e.g., in U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Set. USA, 81 : 6851-5 (1984)). In one example, a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region. In a further example, a chimeric antibody is a “class switched” antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
[0164] In embodiments, a chimeric antibody is a humanized antibody. Typically, a non-human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. Generally, a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non- human antibody, and FRs (or portions thereof) are derived from human antibody sequences. A humanized antibody optionally will also comprise at least a portion of a human constant region. In embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.
[0165] The anti-PSMA antibodies of the invention may comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine or rabbit) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat orrabbit having the desired specificity, affinity and capacity. Tn some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321 : 522-5 (1986); Riechmann et ah, Nature, 332: 323-9 (1988); and Presta, Curr. Op. Struct. Biol., T. 593-6 (1992)).
[0166] A humanized antibody of the invention may comprise one or more human and / or human consensus non-hypervariable region (e.g., framework) sequences in its heavy and / or light chain variable domain. In embodiments, one or more additional modifications are present within the human and / or human consensus non-hypervariable region sequences. In one embodiment, the heavy chain variable domain of an antibody of the invention comprises a human consensus framework sequence, which in one embodiment is the subgroup III consensus framework sequence. In one embodiment, an antibody of the invention comprises a variant subgroup III consensus framework sequence modified at at least one amino acid position.
[0167] As is known in the art, the amino acid position / boundary delineating a hypervariable region of an antibody can vary, depending on the context and the various definitions known in the art. Some positions within a variable domain may be viewed as hybrid hypervariable positions in that these positions can be deemed to be within a hypervariable region under one set of criteria while being deemed to be outside a hypervariable region under a different set of criteria. One or more of these positions can also be found in extended hypervariable regions (as further defined below). The invention provides antibodies comprising modifications in these hybrid hypervariable positions. In one embodiment, these hypervariable positions include one or more positions 26-30, 33-35B, 47-49, 57-65, 93, 94 and 101-102 in a heavy chain variable domain. In one embodiment, these hybrid hypervariable positions include one or more of positions 24-29, 35-36, 46-49, 56 and 97 in a light chain variable domain In one embodiment, an antibody of the invention comprises ahuman variant human subgroup consensus framework sequence modified at one or more hybrid hypervariable positions.
[0168] An antibody of the invention can comprise any suitable human or human consensus light chain framework sequences, provided the antibody exhibits the desired biological characteristics (e.g., a desired binding affinity). In one embodiment, an antibody of the invention comprises at least a portion (or all) of the framework sequence of human K light chain. In one embodiment, an antibody of the invention comprises at least a portion (or all) of human K subgroup I framework consensus sequence.
[0169] Methods for humanizing non-human antibodies are well known in the art. As discussed, a humanized antibody generally has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as“import” residues, which are typically taken from an “import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers (Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting rodent CDRs for CDR sequences for the corresponding sequences of a human antibody. Accordingly, such “humanized” antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
[0170] The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important to reduce antigenicity and HAMA response (human antimouse antibody) when the antibody is intended for human therapeutic use. Reduction or elimination of a HAMA response is a significant aspect of clinical development of suitable therapeutic agents (see, e.g., Khaxzaeli et al., J. Natl. Cancer Inst. (1988), 80:937; Jaffers et al., Transplantation (1986), 41 :572; Shawler et al., J. Immunol. (1985), 135: 1530; Sears et al., J. Biol. Response Mod. (1984), 3: 138; Miller et al., Blood (1983), 62:988; Hakimi et al., J. Immunol. (1991), 147: 1352; Reichmann et al., Nature (1988), 332: 323; Junghans et al., Cancer Res. (1990), 50: 1495). As described herein, the invention provides antibodies that are humanized such that HAMA response is reduced or eliminated. Variants of these antibodies can further be obtainedusing routine methods known in the art, some of which are further described below. According to the so-called “best-fit” method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human V domain sequence which is closest to that of the rodent is identified and the human framework region (FR) within it accepted for the humanized antibody (Sims et al., J. Immunol. 151 : 2296 (1993); Chothia et al., J. Mol. Biol., 196: 901 (1987)). Another method uses a particular framework region derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Set. USA, 89: 4285 (1992); Presta et al., J. Immunol. 151 : 2623 (1993)).
[0171] For example, an amino acid sequence from an antibody as described herein can serve as a starting (parent) sequence for diversification of the framework and / or hypervariable sequence(s). A selected framework sequence to which a starting hypervariable sequence is linked is referred to herein as an acceptor human framework. While the acceptor human frameworks may be from, or derived from, a human immunoglobulin (the VL and / or VH regions thereof), preferably the acceptor human frameworks are from, or derived from, a human consensus framework sequence as such frameworks that have been demonstrated to have minimal, or no, immunogenicity in human patients.
[0172] Where the acceptor is derived from a human immunoglobulin, one may optionally select a human framework sequence that is selected based on its homology to the donor framework sequence by aligning the donor framework sequence with various human framework sequences in a collection of human framework sequences, and select the most homologous framework sequence as the acceptor.
[0173] In one embodiment, human consensus frameworks herein are from, or derived from, VH subgroup III and / or VL kappa subgroup I consensus framework sequences.
[0174] While the acceptor may be identical in sequence to the human framework sequence selected, whether that be from a human immunoglobulin or a human consensus framework, the present invention contemplates that the acceptor sequence may comprise pre-existing amino acid substitutions relative to the human immunoglobulin sequence or human consensus framework sequence. These pre-existing substitutions are preferably minimal; usually four, three, two or oneamino acid differences only relative to the human immunoglobulin sequence or consensus framework sequence.
[0175] Hypervariable region residues of the non-human antibody are incorporated into the VL and / or VH acceptor human frameworks. For example, one may incorporate residues corresponding to the Kabat CDR residues, the Chothia hypervariable loop residues, the Abm residues, and / or contact residues. Optionally, the extended hypervariable region residues as follows are incorporated: 24-34 (LI), 50-56 (L2) and 89-97 (L3), 26-35B (Hl), 50-65, 47-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3).
[0176] While “incorporation” of hypervariable region residues is discussed herein, it will be appreciated that this can be achieved in various ways, for example, nucleic acid encoding the desired amino acid sequence can be generated by mutating nucleic acid encoding the mouse variable domain sequence so that the framework residues thereof are changed to acceptor human framework residues, or by mutating nucleic acid encoding the human variable domain sequence so that the hypervariable domain residues are changed to non-human residues, or by synthesizing nucleic acid encoding the desired sequence, etc.
[0177] As described herein, hypervariable region-grafted variants may be generated by Kunkel mutagenesis of nucleic acid encoding the human acceptor sequences, using a separate oligonucleotide for each hypervariable region. Kunkel et al., Methods Enzymol. 154:367-382 (1987). Appropriate changes can be introduced within the framework and / or hypervariable region, using routine techniques, to correct and re-establish proper hypervariable region-antigen interactions.
[0178] Phage(mid) display (also referred to herein as phage display in some contexts) can be used as a convenient and fast method for generating and screening many different potential variant antibodies in a library generated by sequence randomization. However, other methods for making and screening altered antibodies are available to the skilled person.
[0179] Phage(mid) display technology has provided a powerful tool for generating and selecting novel proteins which bind to a ligand, such as an antigen. Using the techniques of phage(mid) display allows the generation of large libraries of protein variants which can be rapidly sorted for those sequences that bind to a target molecule with high affinity. Nucleic acids encoding variant polypeptides are generally fused to a nucleic acid sequence encoding a viral coat protein,such as the gene ITT protein or the gene VTTT protein. Monovalent phagemid display systems where the nucleic acid sequence encoding the protein or polypeptide is fused to a nucleic acid sequence encoding a portion of the gene ITT protein have been developed. (Bass, S., Proteins, 8:309 (1990); Lowman and Wells, Methods: A Companion to Methods in Enzymology, 3:205 (1991)). In a monovalent phagemid display system, the gene fusion is expressed at low levels and wild type gene ITT proteins are also expressed so that infectivity of the particles is retained. Methods of generating peptide libraries and screening those libraries have been disclosed in many patents (e.g., U.S. Pat. No. 5,723,286, U.S. Pat. No. 5,432,018, U.S. Pat. No. 5,580,717, U.S. Pat. No. 5,427,908 and U.S. Pat. No. 5,498,530).
[0180] Libraries of antibodies or antigen binding polypeptides have been prepared in a number of ways including by altering a single gene by inserting random DNA sequences or by cloning a family of related genes. Methods for displaying antibodies or antigen binding fragments using phage(mid) display have been described in U.S. Pat. Nos. 5,750,373, 5,733,743, 5,837,242, 5,969,108, 6,172,197, 5,580,717, and 5,658,727. The library is then screened for expression of antibodies or antigen binding proteins with the desired characteristics.
[0181] Methods of substituting an amino acid of choice into a template nucleic acid are well established in the art, some of which are described herein. For example, methods for introducing modifications into nucleic acid sequences can include the use of various kits available for purchase (e.g., QuickChange Site Directed Mutagenesis Kit, Agilent, Santa Clara, CA) As another example, hypervariable region residues can be substituted using the Kunkel method (e.g., Kunkel et al., Methods Enzymol. 154:367-382 (1987)).
[0182] It is important that antibodies be humanized with retention of high binding affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influencethe ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the hypervariable region residues are directly and most substantially involved in influencing antigen binding.
[0183] Various forms of a humanized anti-PSMA antibody are contemplated. For example, the humanized antibody may be an antibody fragment, such as a Fab. Alternatively, the humanized antibody may be an intact antibody, such as an intact IgGl antibody.
[0184] As an alternative to humanization, human antibodies can be generated. For example, it is now possible to produce transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array into such germ-line mutant mice will result in the production of human antibodies upon antigen challenge (see, e.g., Jakobovits et al., Proc. Natl. Acad. Set. USA, 90: 2551 (1993); Jakobovits et al., Nature, 362: 255-8 (1993); Bruggemann et al., Year in Immuno. 7: 33 (1993); U.S. Pat. Nos. 5,545,806, 5,569,825, 5,591,669; 5,545,807; and WO 97 / 17852).
[0185] Alternatively, phage display technology (McCafferty et al., Nature 348: 552-53 (1990)) can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors. According to this technique, antibody V domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as Ml 3 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, the phage mimics some of the properties of the B-cell. Phage display can be performed in a variety of formats, reviewed in, e.g., Johnson, Kevin S, and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). Several sources of V-gene segments can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a smallrandom combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al., J. Mol. Biol. 222:581-97 (1991), or Griffith et al., EMBO J. 12: 725-34 (1993) (see also, U.S. Pat. Nos. 5,565,332 and 5,573,905).
[0186] Human antibodies may also be generated by in vitro activated B cells (see, e.g., U.S.Pat. Nos. 5,567,610 and 5,229,275).
[0187] Accordingly, in embodiments, human monocolonal antibodies directed against PSMA may be generated using transgenic or transchromosomic mice carrying parts of the human immune system rather than the mouse system.
[0188] The HuMAb Mouse™ (Medarex, Inc.) contains human immunoglobulin gene miniloci that encode unrearranged human heavy (p and y) and K light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous p and K chain loci (see e.g., Lonberg, et al. (1994) Nature 368(6474): 856-9). Accordingly, the mice exhibit reduced expression of mouse IgM or K, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high affinity human IgGx monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N. (1994) Handbook oj Experimental Pharmacology 113: 49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. 13: 65-93, and Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Set. 764: 536-46) Preparation and use of the HuMAb Mouse™, and the genomic modifications carried by such mice, is further described in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287- 6295; Chen, J. et al. (1993) International Immunology 5: 647-656; Tuaillon et al. (1993) Proc. Natl. Acad. Sci. USA 90: 3720-4; Choi et al. (1993) Nature Genetics 4: 117-23; Chen, J. et al. (1993) EMBO J. 12: 21-830; Tuaillon et al., (1994) J. Immunol. 152: 2912-20; Taylor, L. et al. (1994) International Immunology’ 6: 579-91; and Fishwild, D. et al. (1996) Nature Biotechnology 14: 845-51, the contents of all of which are hereby specifically incorporated by reference in their entirety. See further, U.S. Pat. Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; and 5,770,429; U.S. Pat. No. 5,545,807; PCT Publication Nos. WO 92 / 03918, WO 93 / 12227, WO 94 / 25585, WO 97 / 13852, WO 98 / 24884 and WO 99 / 45962; and PCT Publication No. WO 01 / 14424.
[0189] In another embodiment, human antibodies of this disclosure can be raised using a mouse referred to as “KM Mouse™” that carries human immunoglobulin sequences on transgenes and transchomosomes, as described in detail in PCT Publication WO 02 / 43478.
[0190] In another embodiment, an alternative transgenic system referred to as the Xenomouse (Abgenix, Inc.) can be used; such mice are described in, for example, U.S. Pat. Nos. 5,939,598; 6,075,181; 6,114,598; 6,150,584 and 6,162,963.
[0191] Additional rreelleevvaanntt transchromosomic aanniimmaall systems expressing human immunoglobulin genes are available in the art and can be used to raise anti-PSMA antibodies of this disclosure. For example, mice carrying both a human heavy chain transchromosome and a human light chain tranchromosome, referred to as “TC mice” can be used; such mice are described in Tomizuka et al. (2000) Proc. Natl. Acad. Sei. USA 97 : 722-7. As another example, cows carrying human heavy and light chain transchromosomes have been described in the art (e.g., Kuroiwa et al. (2002) Nature Biotechnology 20: 889-94 and PCT application No. WO 2002 / 092812) and can be used to raise anti-PSMA antibodies of this disclosure. Additional examples of transgenic animals that can be used to produce anti-PSMA antibodies include OmniRat™ and OmniMouse™ (see e.g., Osborn M., et al. (2013) Journal of Immunology 190: 1481-90; Ma B., et al. (2013) Journal of Immunological Methods 400-401 : 78-86; Geurts A., et al. (2009) Science 325: 433, U.S. Pat. No. 8,907,157; European Pat. No. 2152880B1; European Pat. No. 2336329B1). Yet another example includes the use of VELOCIMMUNE® Technology (see, for example, U.S. Pat. No. 6,596,541, Regeneron Pharmaceuticals, VELOCIMMUNE®. Briefly, the VELOCIMMUNE® technology involves generation of a transgenic mouse having a genome comprising human heavy and light chain variable regions operably linked to endogenous mouse constant region loci such that the mouse produces an antigen-binding protein, e.g., antibody, comprising a human variable region and a mouse constant region in response to antigenic stimulation. The DNA encoding the variable regions of the heavy and light chains of the antibody are isolated and operably linked to DNA encoding the human heavy and light chain constant regions. The DNA is then expressed in a cell capable of expressing the fully human antibody.4. Antibody Fragments
[0192] Embodiments of the present disclosure encompass antibody fragments.
[0193] Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-7 (1992); and Brennan et al., Science, 229: 81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of these fragments. Antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab'- SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments (Carter et al., Bio / Technology 10: 163-7 (1992)). According to another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Fab and F(ab')2 fragment with increased in vivo half-life comprising a salvage receptor binding epitope residues are described in U.S. Pat. No. 5,869,046. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner. In other embodiments, the antibody of choice is a single chain Fv fragment (scFv) (see WO 93 / 16185; U.S. Pat. No. 5,571,894; and U.S. Pat. No. 5,587,458). Fv and sFv are the only species with intact combining sites that are devoid of constant regions; thus, they are suitable for reduced nonspecific binding during in vivo use. sFv fusion proteins may be constructed to yield fusion of an effector protein at either the amino or the carboxy terminus of an sFv (see Antibody Engineering, ed. Borrebaeck, supra. The antibody fragment may also be a “linear antibody”, e.g., as described in U.S. Pat. No. 5,641,870 for example.
[0194] In one embodiment, an anti-PSMA antibody derived scFv is used in a CAR of the present disclosure. Included among anti-PSMA antibody fragments are portions of anti-PSMA antibodies (and combinations of portions of anti-PSMA antibodies, for example, scFv) that may be used as targeting arms, directed to a PSMA epitope, in CARs and CAR modified immune cells of the present disclosure. Such fragments are not necessarily proteolytic fragments but rather portions of polypeptide sequences that can confer affinity for target.5. Multispecific Antibodies
[0195] In any aspect of the present disclosure, an anti-PSMA antibody provided herein is a multispecific antibody, for example, a bispecific antibody. Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind to two different epitopes of a PSMA protein as described herein. Other such antibodiesmay combine a PSMA binding site with a binding site for another protein. Tn some examples, an anti-PSMA arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD3), or Fc receptors for IgG (FcyR), such as FcyRI (CD64), FcyRII (CD32) and Fc / RIII (CD16), so as to focus and localize cellular defense mechanisms to the PSMA-expressing cell. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express PSMA. These antibodies possess a PSMA-binding arm and an arm which binds the cytotoxic agent (e.g., saporin, anti-interferon-a, vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies).
[0196] Methods for making bispecific antibodies are known in the art. Traditional production of full length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature 305: 537-9 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93 / 08829, and in Traunecker et al., EMBO J. 10:3655-3659 (1991).
[0197] Other approaches for making bispecific antibodies are known. One approach is the “knobs-into-holes” or “protuberance-into-cavity” approach (see, e.g., U.S. Pat. No. 5,731,168). In this approach, two immunoglobulin polypeptides (e.g., heavy chain polypeptides) each comprise an interface. An interface of one immunoglobulin polypeptide interacts with a corresponding interface on the other immunoglobulin polypeptide, thereby allowing the two immunoglobulin polypeptides to associate. These interfaces may be engineered such that a “knob” or “protuberance” (these terms may be used interchangeably herein) located in the interface of one immunoglobulin polypeptide corresponds with a “hole” or “cavity” (these terms may be used interchangeably herein) located in the interface of the other immunoglobulin polypeptide. In embodiments, the hole is of identical or similar size to the knob and suitably positioned such that when the two interfaces interact, the knob of one interface is positionable in the corresponding hole of the other interface. Without wishing to be bound to theory, this is thought to stabilize the heteromultimer and favor formation of the heteromultimer over other species, for examplehomomultimers. Tn embodiments, this approach may be used to promote the heteromultimerizati on of two different immunoglobulin polypeptides, creating a bispecific antibody comprising two immunoglobulin polypeptides with binding specificities for different epitopes.
[0198] According to a different approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is typical to have the first heavychain constant region (CHI) containing the site necessary for light chain binding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are cotransfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance.
[0199] In one embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94 / 04690. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121 :210 (1986).
[0200] According to another approach described in WO96 / 27011 , the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. One interface comprises at least a part of the CH 3 domain of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory “cavities” of identical or similar size to the large side chain(s) arecreated on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
[0201] Bispecific antibodies include cross-linked or “heteroconjugate” antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (WO 91 / 00360, WO 92 / 200373, and EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques.
[0202] Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent interm olecul ar disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab’-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bi specific antibodies produced can be used as agents for the selective immobilization of enzymes. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describe the production of a fully humanized bi specific antibody F(ab')2 molecule. Each Fab' fragment was separately secreted from / :, colt and subjected to directed chemical coupling in vitro to form the bispecific antibody.
[0203] Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol., 148(5): 1547-1553 (1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The “diabody” technology described byHollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy -chain variable domain (VH) connected to a light-chain variable domain (VL) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the W and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al, J. Immunol, 152:5368 (1994).
[0204] Another technique for making bispecific antibody fragments is the “bispecific T cell engager” or BiTE® approach (see, e.g., W02004 / 106381, W02005 / 061547, W02007 / 042261 , and W02008 / 119567). This approach utilizes two antibody variable domains arranged on a single polypeptide. For example, a single polypeptide chain includes two single chain Fv (scFv) fragments, each having a variable heavy chain (VH) and a variable light chain (VL) domain separated by a polypeptide linker of a length sufficient to allow intramolecular association between the two domains. This single polypeptide further includes a polypeptide spacer sequence between the two scFv fragments. Each scFv recognizes a different epitope, and these epitopes may be specific for different cell types, such that cells of two different cell types are brought into close proximity or tethered when each scFv is engaged with its cognate epitope. One particular embodiment of this approach includes a scFv recognizing a cell-surface antigen expressed by an immune cell, e.g., a CD3 polypeptide on a T cell, linked to another scFv that recognizes a cellsurface antigen expressed by a target cell, such as a malignant or tumor cell.
[0205] As it is a single polypeptide, the bispecific T cell engager may be expressed using any prokaryotic or eukaryotic cell expression system known in the art, e.g., a CHO cell line. However, specific purification techniques (see, e.g., EP1691833) may be necessary to separate monomeric bispecific T cell engagers from other multimeric species, which may have biological activities other than the intended activity of the monomer. In one exemplary purification scheme, a solution containing secreted polypeptides is first subjected to a metal affinity chromatography, and polypeptides are eluted with a gradient of imidazole concentrations. This eluate is further purified using anion exchange chromatography, and polypeptides are eluted using with a gradient of sodium chloride concentrations. Finally, this eluate is subjected to size exclusion chromatography to separate monomers from multimeric species.
[0206] Other relevant bispecific antibody fragment formats include but are not limited to dualaffinity re-targeting proteins (DARTs) and Tandem diabodies (TandAbs). A DART is composed of two Fv fragments, with two unique antigen-binding sites formed when two Fv fragments heterodimerize (Holliger et al., Proc. Natl. Acad. Sci. USA. 90:6444-6448 (1993). Specifically, Fvl consists of a VH from antibody “A” and a VL from antibody “B”, while Fv2 is made from a VH from antibody “B” and VL from antibody “A”. Unlike BiTE antibodies which are connected by a polypeptide linker, this combination allows DART to mimic natural interaction within an IgG molecule. Adding another cysteine residue to the end of each heavy-chain improves stability by forming a C -terminal disulfide bridge. TandAbs are tetravalent bispecific antibodies provide two binding sites for each antigen to maintain the avidity of a natural bivalent antibody. Moreover, TandAbs have a molecular weight (approximately 105 kDa) exceeding the first-pass renal clearance threshold, thus offering a longer half-life compared to smaller antibody constructs (Reusch et al., Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 22:5829-5838 (2016); Reusch et al., MAbs. 6:728-739 (2014); Compte et al., Oncoimmunology. 3:e28810 (2014). For a recent review of common formats of bispecific antibodies including scFv-based and full-length IgG-like asymmetric antibodies, including methods of production thereof, see Wang et al., Antibodies (Basel), 8(3): 43 (2019).6. Antibody Variants and Modifications a) Substitution, Insertion, and Deletion Variants
[0207] In addition to the anti-PSMA antibodies described herein, it is contemplated that anti- PSMA antibody variants can be prepared. Anti-PSMA antibody variants can be prepared by introducing appropriate nucleotide changes into the encoding DNA, and / or by synthesis of the desired antibody or polypeptide. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the anti-PSMA antibody, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
[0208] Variations in the anti-PSMA antibodies described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the antibody or polypeptide that results in a change in the amino acid sequence as compared with the native sequence antibody or polypeptide. Optionallythe variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the anti-PSMA antibody. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the anti-PSMA antibody with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence.
[0209] Anti-PSMA antibody fragments are provided herein. Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared with a full-length native antibody or protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the anti-PSMA antibody.
[0210] Anti-PSMA antibody fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative approach involves generating antibody or polypeptide fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired antibody or polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR. Preferably, anti-PSMA antibody fragments share at least one biological and / or immunological activity with the native anti-PSMA antibody disclosed herein.
[0211] In particular embodiments, conservative substitutions of interest are shown in Table 1 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 1, or as further described below in reference to amino acid classes, are introduced and the products screened.Table 1
[0212] Substantial modifications in function or immunological identity of the anti-PSMA antibody are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule atthe target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side-chain properties:(1) hydrophobic: norleucine, met, ala, val, leu, ile;(2) neutral hydrophilic: cys, ser, thr;(3) acidic: asp, glu;(4) basic: asn, gin, his, lys, arg;(5) residues that influence chain orientation: gly, pro; and(6) aromatic: trp, tyr, phe.
[0213] Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.
[0214] The variations can be made using methods known in the art such as oligonucleotide- mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res., 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34: 315 (1985)), restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)) or other known techniques can be performed on the cloned DNA to produce the anti-PSMA antibody variant DNA.
[0215] Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant (Cunningham and Wells, Science, 244: 1081-5 (1989)). Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y ); Chothia, J. Mol. Biol., 150: 1 (1976)). If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.
[0216] Any cysteine residue not involved in maintaining the proper conformation of the anti- PSMA antibody also may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) may be added to the anti-PSMA antibody to improve its stability (particularly where the antibody is an antibody fragment such as an Fv fragment).
[0217] A particularly preferred type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g., a humanized or human antibody). Generally, the resulting variant(s) selected for further development will have improved biological properties relative to the parent antibody from which they are generated. A convenient way for generating such substitutional variants involves affinity maturation using phage display. Briefly, several hypervariable region sites (e.g., 6-7 sites) are mutated to generate all possible amino substitutions at each site. The antibody variants thus generated are displayed in a monovalent fashion from filamentous phage particles as fusions to the gene III product of M13 packaged within each particle. The phage-displayed variants are then screened for their biological activity (e.g., binding affinity) as herein disclosed. In order to identify candidate hypervariable region sites for modification, alanine scanning mutagenesis can be performed to identify hypervariable region residues contributing significantly to antigen binding. Alternatively, or additionally, it may be beneficial to analyze a crystal structure of the antigen-antibody complex to identify contact points between the antibody and PSMA polypeptide. Such contact residues and neighboring residues are candidates for substitution according to the techniques elaborated herein. Once such variants are generated, the panel of variants is subjected to screening as described herein and antibodies with superior properties in one or more relevant assays may be selected for further development.
[0218] Nucleic acid molecules encoding amino acid sequence variants of the anti-PSMA antibody are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of the anti-PSMA antibody. b) Modifications
[0219] Covalent modifications of anti-PSMA antibodies are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of an anti-PSMA antibody with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the anti-PSMA antibody. Derivatization with bifunctional agents is useful, for instance, for crosslinking anti-PSMA antibody to a waterinsoluble support matrix or surface for use in a method for purifying anti-PSMA antibodies, and vice-versa. Commonly used crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2- phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4- azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'- dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido-l,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate.
[0220] Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the a-amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.
[0221] Another type of covalent modification of the anti-PSMA antibody included within the scope of this invention comprises altering the native glycosylation pattern of the antibody or polypeptide. “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moi eties found in native sequence anti-PSMA antibody (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and / or enzymatic means), and / or adding one or more glycosylation sites that are not present in the native sequence anti-PSMA antibody. In addition, the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
[0222] Glycosylation of antibodies and other polypeptides is typically either N-linked or O- linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachmentof the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the attachment of one of the sugars N-aceylgalactosamine, galactose, or xylose to a hydroxy amino acid, most commonly serine or threonine, although 5-hydroxyproline or 5- hydroxylysine may also be used.
[0223] Addition of glycosylation sites to the anti-PSMA antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more of the abovedescribed tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original anti-PSMA antibody (for O-linked glycosylation sites). The anti-PSMA antibody amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the anti-PSMA antibody at preselected bases such that codons are generated that will translate into the desired amino acids.
[0224] Another means of increasing the number of carbohydrate moieties on the anti-PSMA antibody is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87 / 05330 published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev Biochem., pp. 259-306 (1981).
[0225] Removal of carbohydrate moieties present on the anti-PSMA antibody may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exoglycosidases as described by Thotakura et al., Meth. Enzymol., 138:350 (1987). c) Fc Region Variants
[0226] It may be desirable to modify the antibody of the invention with respect to effector function, e g., so as to enhance antigen-dependent cell-mediated cyotoxicity (ADCC) and / or complement dependent cytotoxicity (CDC) of the antibody. This may be achieved by introducing one or more amino acid substitutions in an Fc region of the antibody. Alternatively or additionally, cysteine residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bondformation in this region. The homodimeric antibody thus generated may have improved internalization capability and / or increased complement-mediated cell killing and antibodydependent cellular cytotoxicity (ADCC) (see Caron et al., J. Exp Med. 176: 1191-5 (1992); Shopes, B. J. Immunol. 148: 2918-22 (1992). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al., Cancer Research 53: 2560-5 (1993). Alternatively, an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-30 (1989). To increase the serum half life of the antibody, one may incorporate a salvage receptor binding epitope into the antibody (especially an antibody fragment) as described in U.S. Patent 5,739,277, for example. As used herein, the term “salvage receptor binding epitope” refers to an epitope of the Fc region of an IgG molecule (e.g., IgGl, IgG2, IgG3, or IgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule. d) Cysteine Engineered Antibody Variants
[0227] In certain embodiments, it may be desirable to create cysteine engineered antibodies, e.g.,“thioMAbs,” in which one or more residues of an antibody are substituted with cysteine residues. In particular embodiments, the substituted residues occur at accessible sites of the antibody. By substituting those residues with cysteine, reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein. Cysteine engineered antibodies can be generated as described, e.g., in U.S. Patent No. 7,521,541. e) Immunoconjugates
[0228] The presently disclosed subj ect matter also provides immunoconjugates, which include an antibody, disclosed herein, conjugated to one or more cytotoxic agents, such as chemotherapeutic agents or drugs, growth inhibitory agents, proteins, peptides, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes. For example, an antibody of the disclosed subject matter can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association orotherwise) to one or more other binding molecules, such as another antibody, antibody fragment, peptide or binding mimetic.
[0229] In certain embodiments, an immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody of the present disclosure is conjugated to one or more drugs, including but not limited to, a maytansinoid (see U.S. Patent Nos. 5,208,020, 5,416,064 and European Patent EP 0 425 235 Bl); an auristatin such as monomethyl auri statin drug moi eties DE and DE (MMAE and MMAE) (see U.S. Patent Nos. 5,635,483 and 5,780,588, and 7,498,298); a dolastatin; a calicheamicin or derivative thereof (see U.S. Patent Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701, 5,770,710, 5,773,001, and 5,877,296; Hinman et al., Cancer Res. 53:3336- 3342 (1993); and Lode et al., Cancer Res 58:2925-2928 (1998)); an anthracycline such as daunomycin or doxorubicin (see Kratz et al., Current Med. Chem. 13:477-523 (2006); Jeffrey et al., Bioorganic & Med. Chem. Letters 16:358-362 (2006); Torgov et al., Bioconj. Chem. 16:717- 721 (2005); Nagy et al., Proc. Natl. Acad. Sci. USA 97:829-834 (2000); Dubowchik et al., Bioorg. & Med. Chem. Letters 12: 1529-1532 (2002); King et al., J. Med. Chem. 45:4336-4343 (2002); and U.S. Patent No. 6,630,579); methotrexate; vindesine; a taxane such as docetaxel, paclitaxel, larotaxel, tesetaxel, and ortataxel; a trichothecene; and CC1065. In certain embodiments, an immunoconjugate includes an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
[0230] In certain embodiments, an immunoconjugate includes an antibody, as described herein, conjugated to a radioactive atom to form a radioconjugate. A variety of radioactive isotopes are available for the production of radioconjugates. Non-limiting examples include At211, Ac225, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212and radioactive isotopes of Lu. When a radioconjugate is used for detection, it can include a radioactive atom for scintigraphic studies, for example tc99m or I123, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, mri), such as iodine-123, iodine-131, indium- 1 1 1, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
[0231] Conjugates of an antibody fragment and cytotoxic agent can be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2 -pyridyldithio) propionate (SPDP), succinimidyl-4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HC1), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis- diazonium derivatives (such as bis- (p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2, 4-dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon- 14- labeled 1- isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. The linker can be a “cleavable linker” facilitating release of a cytotoxic drug in the cell. For example, an acid-labile linker, peptidase-sensitive linker, photolabile linker, dimethyl linker or disulfide-containing linker (Chari et al., Cancer Res. 52: 127-131 (1992); U. S. Patent No. 5,208,020) can be used. Nonlimiting examples of linkers are disclosed above. The immunuoconjugates disclosed herein expressly contemplate, but are not limited to such conjugates prepared with cross-linker reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo- SIAB, sulfo- SMCC, and sulfo-SMPB, and SVSB (succinimidyl-(4-vinylsulfone)benzoate) which are commercially available (e.g ., from Pierce Biotechnology, Inc., Rockford, IL., U.S.A). f) Antibody Fusions
[0232] The presently disclosed subject matter also encompasses antibody fusions, For example, proteins can be linked together either through chemical or genetic manipulation using methods known in the art. See, for example, Gillies et al., Proc. Nat’l Acad. Sci. USA 89: 1428- 1432 (1992) and US Patent No. 5,650,150.
[0233] In one example, the present disclosure encompasses an anti-PSMA antibody-cytokine fusion protein. In principle, an anti-PSMA antibody as herein disclosed can be fused to any cytokine via the use of recombinant molecular biological techniques. As one example, the anti- PSMA antibody may be fused to IL-2 (Gillies, S., Protein Engineering, Design and Selection 26(10): 561-569 (2013); Klein, C. et al., Oncolmmunology 6:3 (2017).
[0234] In another example, the present disclosure encompasses an anti-PSMA antibody -T-cell engager fusion protein. Discussed herein, anti-PSMA antibody-T-cell engager fusion proteins comprise fusions between an anti-PSMA antibody and a ligand for a receptor expressed on a T cell. Examples of such ligands include but are not limited to CD40L, OX40L, 4-1BBL, CD80 / 86, ICOSL, and the like. In embodiments, the ligand is fused to an Fc portion of an anti-PSMA antibody. In embodiments, the ligand is fused to a C -terminus of a light chain of an anti-PSMA antibody. Such an approach is described with regard to 4-1BBL (Dafne M. et al., Journal of Immunotherapy 38(8): 714-722 (2008), and a similar approach can be used for generation of other antibody-T-cell engager fusion proteins.B. Recombinant Methods and Compositions
[0235] Anti-PSMA antibodies or antigen-binding fragments of the present disclosure may be produced using recombinant methods and compositions, for example as described in US. Patent No. 4,816,567. In embodiments, the invention also provides transformed cells and progeny thereof into which a nucleic acid molecule encoding an antibody or antigen-binding fragment, has been introduced by means of recombinant DNA techniques in vitro, ex vivo or in vivo. The transformed cells, eukaryotic or prokaryotic, may be used to produce recombinant antibody or antibody fragment for purification, or for in situ or secretory expression for various purposes, such as diagnosis or therapy for tumor. The transformed cells can be propagated and the introduced nucleic acid transcribed, or encoded protein expressed. It is understood that a progeny cell may not be identical to the parental cell, since there may be mutations that occur during replication. Transformed cells include but are not limited to prokaryotic and eukaryotic cells such as bacteria, fungi, plant, insect, and animal (e.g., mammalian, including human) cells. The cells may be present in culture, in a cell, tissue or organ ex vivo or present in a sub) ect. In one embodiment, the antibody or antibody fragment is displayed on yeast cell surface; in another embodiment, the antibody or antibody fragment is coated on nanoparticle surface; in another embodiment, the antibody or antibody fragment is displayed on mammalian cell surface, such as T cells, NK cells or other human or other mammalian cells; in another embodiment, the antibody or antibody fragment is produced as secretory protein by yeast, E.coli or mammalian cells.
[0236] Typically cell transformation employs a vector. The term "vector," refers to, e.g., a plasmid, virus, such as a viral vector, or other vehicle known in the art that can be manipulated byinsertion or incorporation of a nucleic acid, for genetic manipulation (i.e., "cloning vectors"), or can be used to transcribe or translate the inserted polynucleic acid (i.e., "expression vectors"). Such vectors are useful for introducing nucleic acids, including a nucleic acid that encodes an antibody or antibody antigen-binding fragment operably linked with an expression control element, and expressing the encoded protein in vitro (e.g., in solution or in solid phase), in cells or in vivo.
[0237] In one embodiment, the expression vector(s) is(are) transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody or antigen-binding fragment of the invention. Thus, the invention includes host cells containing polynucleic acid(s) encoding an antibody of the invention (e.g., whole antibody, a heavy or light chain thereof, or portion thereof, or a single chain antibody, or a fragment or variant thereof), operably linked to a heterologous promoter. In other embodiments, for the expression of entire antibody molecules, vectors encoding both the heavy and light chains are coexpressed in the host cell for expression of the entire immunoglobulin molecule.
[0238] A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleic acid coding sequences, express an antibody molecule of the invention in situ. These include, but are not limited to, bacteriophage particles engineered to express antibody fragments or variants thereof (single chain antibodies), microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter; CMV promoter or EFla promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably,eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Poecking et al., Gene 45: 101 (1986); Cockett et al., Bio / Technology 8:2 (11990); B ebbington et al., Bio / Techniques 10: 169 (1992); Keen and Hale, Cytotechnology 18:207 (1996)). These references are incorporated in their entireties by reference herein.
[0239] A vector used to transform a cell or a host-expression vector generally contains at least an origin of replication for propagation in the cell. Control elements, including expression control elements as set forth herein, present within a vector, are included to facilitate transcription and translation. The term "expression control element" is intended to include, at a minimum, one or more components whose presence can influence expression, and can include components other than or in addition to promoters or enhancers, for example, leader sequences and fusion partner sequences, internal ribosome binding sites (IRES) elements for the creation of multigene, or polycistronic, messages, splicing signal for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA, polyadenylation signal to provide proper poly adenylation of the transcript of a gene of interest, stop codons, etc.
[0240] Vectors can include a selection marker. As is known in the art, "selection marker" means a gene that allows for the selection of cells containing the gene. "Positive selection" refers to a process whereby only cells that contain the selection marker will survive upon exposure to the positive selection. Drug resistance is one example of a positive selection marker; cells containing the marker will survive in culture medium containing the selection drug, and cells which do not contain the marker will die. Such markers include drug resistance genes such as neo, which confers resistance to G418, hygr, which confers resi stance to hygromycin, or puro which confers resistance to puromycin, among others. Other positive selection marker genes include genes that allow identification or screening of cells containing the marker. These genes include genes for fluorescent proteins (GFP), the lacZ gene, the alkaline phosphatase gene, and surface markers such as CD8, among others.
[0241] Vectors can contain negative selection markers. "Negative selection" refers to a process whereby cells containing a negative selection marker are killed upon exposure to an appropriatenegative selection agent. For example, cells which contain the herpes simplex virus-thymidine kinase (HSV-tk) gene (Wigler et al., Cell 11:223 (1977)) are sensitive to the drug gancyclovir (GANG). Similarly, the gpt gene renders cells sensitive to 6-thioxanthine.
[0242] Mammalian expression systems further include vectors specifically designed for in vivo and ex vivo expression. Such systems include adeno-associated virus (AAV) vectors (U.S. Pat. No. 5,604,090). AAV vectors have previously been shown to provide expression of Factor IX in humans and in mice at levels sufficient for therapeutic benefit (Kay et al., Nat. Genet. 24:257 (2000); Nakai et al., Blood 91 :4600 (1998)). Adenoviral vectors (U.S. Pat. Nos. 5,700,470, 5,731,172 and 5,928,944), herpes simplex virus vectors (U.S. Pat. No. 5,501,979) and retroviral (e g , lentivirus vectors are useful for infecting dividing as well as non-dividing cells and foamy virues) vectors (U.S. Pat. Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516 and 5,674,703 and WIPO publications WO92 / 05266 and W092 / 14829) and papilloma virus vectors (e.g., human and bovine papillomavirus) have all been employed in gene therapy (U.S. Pat. No. 5,719,054). Vectors also include cytomegalovirus (CMV) based vectors (U.S. Pat. No. 5,561,063). Vectors that efficiently deliver genes to cells of the intestinal tract have been developed and also may be used (see, e.g., U.S. Pat. Nos. 5,821,235, 5,786,340 and 6,110,456). In yeast, vectors that facilitate integration of foreign nucleic acid sequences into a chromosome, via homologous recombination, for example, are known in the art and can be used. Yeast artificial chromosomes (YAC) are typically used when the inserted nucleic acids are too large for more conventional vectors (e.g., greater than about 12 kb).
[0243] In one embodiment, phagemid vectors for use in the invention include any available in the art suitable for the production of the antibodies / antibody templates / FR libraries of the present invention and include phagemid vectors pCB04, pITl, pIT2, CANTAB 6, pComb 3 HS. Filamentous vectors and methods of phagemid construction are described in, for example, U.S. Pat. No. 6,054,312 and U.S. Pat. No. 6,803,230, each incorporated herein by reference. Bacteriophage display systems involving non-filamentous bacteriophage vectors known as cytoplasmic bacteriophage or lytic phage can also be utilized as described in for example, U.S. Pat. No. 5,766,905, incorporated herein by reference.
[0244] Suitable bacterial expression constructs for use with the present invention include, but are not limited to the pCAL, pUC, pET, pETBlue™ (Novagen), pBAD, pLEX, pTrcHis2, pSE280,pSE380, pSE420 (Tnvitrogen), pKK223-2 (Clontech), pTrc99A, pKK223-3, pRIT2T, pMC1871 , pEZZ 18 (Pharmacia), pBluescript II SK (Stratagene), pALTER-Exl, pALTER- Ex2, pGEMEX (Promega), pFivE (MB I), pQE (Qiagen) commercially available expression constructs, and their derivatives, and others known in the art. In embodiments of the present invention the construct may also include, a virus, a plasmid, a bacmid, a phagemid, a cosmid, or a bacteriophage.
[0245] The use of liposomes for introducing various compositions into cells, including nucleic acids, is known to those skilled in the art (see, e.g., U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282). A carrier comprising a natural polymer, or a derivative or a hydrolysate of a natural polymer, described in WO 94 / 20078 and U.S. Pat. No. 6,096,291, is suitable for mucosal delivery of molecules, such as polypeptides and polynucleic acids, piperazine based amphilic cationic lipids useful for gene therapy also are known (see, e.g., U.S. Pat. No. 5,861,397). Cationic lipid systems also are known (see, e.g., U.S. Pat. No. 5,459,127). Accordingly, viral and non-viral vector means of delivery into cells or tissue, in vitro, in vivo and ex vivo are included.
[0246] In one embodiment, nucleic acid sequences can be "operably linked", i.e., positioned, to ensure the functioning of an expression control sequence. These expression constructs are typically replicable in the cells either as episomes or as integral parts of the cell's chromosomal DNA, and may contain appropriate origins of replication for the respective prokaryotic strain employed for expression. Commonly, expression constructs contain selection markers, such as for example, tetracycline resistance, ampicillin resistance, kanamycin resistance or chlormaphenicol resistance, facilitating detection and / or selection of those bacterial cells transformed with the desired nucleic acid sequences (see, e.g., U.S. Pat. No. 4,704,362). These markers, however, are not exclusionary, and numerous others may be employed, as known to those skilled in the art. In another embodiment of the present invention expression constructs contain both positive and negative selection markers.
[0247] Similarly, reporter genes may be incorporated within expression constructs to facilitate identification of transcribed products. Accordingly, in one embodiment of the present invention, reporter genes utilized are selected from the group consisting of [3-galactosidase, chloramphenicol acetyl transferase, luciferase and a fluorescent protein.
[0248] Prokaryotic promoter sequences regulate expression of the encoded polynucleic acid sequences, and in some embodiments of the present invention, are operably linked to polynucleicacids encoding the polypeptides of this invention. Tn additional embodiments of the present invention, these promoters are either constitutive or inducible, and provide a means of high and low levels of expression of the polypeptides of this invention, and in some embodiments, for regulated expression of multiple polypeptides of the invention, which in some embodiments are expressed as a fusion protein.
[0249] Many well-known bacterial promoters, including the T7 promoter system, the lactose promoter system, tryptophan (Trp) promoter system, Trc / Tac Promoter Systems, beta-lactamase promoter system, tetA Promoter systems, arabinose regulated promoter system, Phage T5 Promoter, or a promoter system from phage lambda, may be employed, and others, as well, and comprise embodiments of the present invention. The promoters will typically control expression, optionally with an operator sequence and may include ribosome binding site sequences for example, for initiating and completing transcription and translation. According to additional embodiments, the vector may also contain expression control sequences, enhancers that may regulate the transcriptional activity of the promoter, appropriate restriction sites to facilitate cloning of inserts adjacent to the promoter and other necessary information processing sites, such as RNA splice sites, polyadenylation sites and transcription termination sequences as well as any other sequence which may facilitate the expression of the inserted nucleic acid.C. Purification of Anti-PSMA Antibody
[0250] Forms of anti-PSMA antibody may be recovered from culture medium or from host cell lysates. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells employed in expression of anti- PSMA antibody can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
[0251] It may be desired to purify anti-PSMA antibody from recombinant cell proteins or polypeptides. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS- PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the anti-PSMA antibody. Various methods of protein purification may beemployed and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular anti-PSMA antibody produced.
[0252] When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, are removed, for example, by centrifugation or ultrafiltration. Carter et al., Bio / Technology 10: 163-7 (1992) describe a procedure for isolating antibodies which are secreted to the periplasmic space of E. coll. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min. Cell debris can be removed by centrifugation. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.
[0253] The antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody. Protein A can be used to purify antibodies that are based on human yl, y2 or y4 heavy chains (Lindmark et al., J. Immunol. Meth. 62: 1-13 (1983)). Protein G is recommended for all mouse isotypes and for human y3 (Guss et aL,EMBO J. 5: 15671575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such aass controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises a CH3 domain, the Bakerbond ABX™resin (J. T. Baker, Phillipsburg, NJ) is useful for purification. Other techniques for protein purification such as fractionation on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE™ chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also available depending on the antibody to be recovered.
[0254] Following any preliminary purification step(s), the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2.5-4.5, and generally at low salt concentrations (e.g., from about 0-0.25M salt).D. Assays
[0255] The antibody of the present invention may be employed in any known assay method, such as ELISA, competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, (1987) Monoclonal Antibodies: A Manual of Techniques, pp.147-158, CRC Press, Inc.).
[0256] A detection label may be useful for localizing, visualizing, and quantitating a binding or recognition event. The labelled antibodies of the invention can detect cell-surface receptors or antigens. Another use for detectably labelled antibodies is a method of bead-based immunocapture comprising conjugating a bead with a fluorescent labelled antibody and detecting a fluorescence signal upon binding of a ligand. Similar binding detection methodologies utilize the surface plasmon resonance (SPR) effect to measure and detect antibody-antigen interactions.
[0257] Detection labels such as fluorescent dyes and chemiluminescent dyes (Briggs et al (1997) J. Chem. Soc., Perkin-Trans. 1 : 1051-8) provide a detectable signal and are generally applicable for labelling antibodies, preferably with the following properties: (i) the labelled antibody should produce a very high signal with low background so that small quantities of antibodies can be sensitively detected in both cell-free and cell-based assays; and (ii) the labelled antibody should be photostable so that the fluorescent signal may be observed, monitored and recorded without significant photo bleaching. For applications involving cell surface binding of labelled antibody to membranes or cell surfaces, especially live cells, the labels preferably (iii) have good water-solubility to achieve effective conjugate concentration and detection sensitivity and (iv) are non-toxic to living cells so as not to disrupt the normal metabolic processes of the cells or cause premature cell death.
[0258] Direct quantification of cellular fluorescence intensity and enumeration of fluorescently labelled events, e.g., cell surface binding of peptide-dye conjugates may be conducted on a system (FMAT® 8100 HTS System, Applied Biosystems, Foster City, Calif.) that automates mix-and-read, non-radioactive assays with live cells or beads (Miraglia, “Homogeneous cell- and bead-based assays for high throughput screening using fluorometric microvolume assay technology”, (1999) J. of Biomolecular Screening 4: 193-204). Uses of labelled antibodies also include cell surface receptor binding assays, inmmunocapture assays, fluorescence linked immunosorbent assays (FLISA), caspase-cleavage (Zheng, “Caspase-3 controls both cytoplasmic and nuclear events associated with Fas-mediated apoptosis in vivo”, (1998) Proc. Natl. Acad. Sci. USA 95:618-23; US 6372907), apoptosis (Vermes, “A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V” (1995) J. Immunol. Methods 184:39-51) and cytotoxicity assays. Fluorometric microvolume assay technology can be used to identify the up or down regulation by a molecule that is targeted to the cell surface (Swartzman, “A homogeneous and multiplexed immunoassay for high-throughput screening using fluorometric microvolume assay technology”, (1999) Anal. Biochem. 271 : 143-51).
[0259] Labelled antibodies of the invention are useful as imaging biomarkers and probes by the various methods and techniques of biomedical and molecular imaging such as: (i) MRI (magnetic resonance imaging); (ii) MicroCT (computerized tomography); (iii) SPECT (single photon emission computed tomography); (iv) PET (positron emission tomography) Chen et al Bioconjugate Chem. 15: 41-9 (2004); (v) bioluminescence; (vi) fluorescence; and (vii) ultrasound. Immunoscintigraphy is an imaging procedure in which antibodies labeled with radioactive substances are administered to an animal or human patient and a picture is taken of sites in the body where the antibody localizes (US 6528624). Imaging biomarkers may be objectively measured and evaluated as an indicator of normal biological processes, pathogenic processes, or pharmacological responses to a therapeutic intervention.
[0260] Peptide labelling methods are well known (e.g., Haugland, 2003, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc.; Brinkley, 1992, Bioconjugate Chem. 3:2; Garman, (1997) Non-Radioactive Labelling: A Practical Approach, Academic Press, London; Means (1990) Bioconjugate Chem. 1 :2; Glazer et al (1975) Chemical Modification of Proteins. Laboratory Techniques in Biochemistry and MolecularBiology (T. S. Work and E Work, Eds.) American Elsevier Publishing Co., New York; Lundblad, R. L. and Noyes, C. M. (1984) Chemical Reagents for Protein Modification, Vols. I and II, CRC Press, New York; Pfleiderer, G. (1985) “Chemical Modification of Proteins”, Modern Methods in Protein Chemistry, H. Tschesche, Ed., Walter DeGryter, Berlin and New York; and Wong (1991) Chemistry of Protein Conjugation and Cross-linking, CRC Press, Boca Raton, Fla.); De Leon- Rodriguez et al. (2004) Chem.Eur. J. 10: 1149-1155; Lewis et al. (2001) Bioconjugate Chem. 12:320-324; Li et al. (2002) Bioconjugate Chem. 13: 110-115; Mier et al. (2005) Bioconjugate Chem. 16:240-237).
[0261] Peptides and proteins labelled with two moieties, a fluorescent reporter and quencher in sufficient proximity undergo fluorescence resonance energy transfer (FRET). Reporter groups are typically fluorescent dyes that are excited by light at a certain wavelength and transfer energy to an acceptor, or quencher, group, with the appropriate Stokes shift for emission at maximal brightness. Fluorescent dyes include molecules with extended aromaticity, such as fluorescein and rhodamine, and their derivatives. The fluorescent reporter may be partially or significantly quenched by the quencher moiety in an intact peptide. Upon cleavage of the peptide by a peptidase or protease, a detectable increase in fluorescence may be measured (Knight, C. (1995) “Fluorimetric Assays of Proteolytic Enzymes”, Methods in Enzymology, Academic Press, 248: 18- 34).
[0262] The labelled antibodies of the invention may also be used as an affinity purification agent. In this process, the labelled antibody is immobilized on a solid phase such a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is contacted with a sample containing the antigen to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the antigen to be purified, which is bound to the immobilized polypeptide variant. Finally, the support is washed with another suitable solvent, such as glycine buffer, pH 5.0, that will release the antigen from the polypeptide variant.1. Activity assays
[0263] In one aspect, assays are provided for identifying anti-PSMA antibodies thereof having biological activity. Biological activity may include, e.g., the ability to inhibit cell growth or proliferation (e.g., “cell killing” activity), or the ability to induce cell death, including programmedcell death (apoptosis). Antibodies having such biological activity in vivo and / or in vitro are also provided.
[0264] In certain embodiments, an anti-PSMA antibody is tested for its ability to inhibit cell growth or proliferation in vitro. Assays for inhibition of cell growth or proliferation are well known in the art. Certain assays for cell proliferation, for example “cell killing” assays, measure cell viability. One such assay is the CellTiter-GloTM Luminescent Cell Viability Assay, which is commercially available from Promega (Madison, WI). That assay determines the number of viable cells in culture based on quantitation of ATP present, which is an indication of metabolically active cells. See Crouch et al (1993) J. Immunol. Meth. 160: 81-8, US Pat. No. 6602677. The assay may be conducted in 96- or 384-well format, making it amenable to automated high-throughput screening (HTS) (see Cree et al (1995) AntiCancer Drugs 6: 398-404). The assay procedure involves adding a single reagent (CellTiter-Glo® Reagent) directly to cultured cells. This results in cell lysis and generation of a luminescent signal produced by a luciferase reaction. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in culture. Data can be recorded by luminometer or CCD camera imaging device. The luminescence output is expressed as relative light units (RLU).
[0265] Another assay for cell proliferation is the “MTT” assay, a colorimetric assay that measures the oxidation of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to formazan by mitochondrial reductase. Like the CellTiter-GloTM assay, this assay indicates the number of metabolically active cells present in a cell culture (see, e.g., Mosmann (1983) J. Immunol. Meth. 65:55-63, and Zhang et al. (2005) Cancer Res. 65: 3877-82).
[0266] In one aspect, an anti-PSMA antibody is tested for its ability to induce cell death in vitro. Assays for induction of cell death are well known in the art. In embodiments, such assays measure, e.g., loss of membrane integrity as indicated by uptake of propidium iodide (PI), trypan blue (see Moore et al. Cytotechnology, 17: 1-11 (1995)), or 7AAD. In an exemplary PI uptake assay, cells are cultured in Dulbecco’s Modified Eagle Medium (D-MEM):Ham’s F-12 (50:50) supplemented with 10% heat-inactivated FBS (Hy clone) and 2 mM L-glutamine. Thus, the assay is performed in the absence of complement and immune effector cells. Cells are seeded at a density of 3 x 106per dish in 100 x 20 mm dishes and allowed to attach overnight. The medium is removed and replaced with fresh medium alone or medium containing various concentrations of theantibody. The cells are incubated for a 3-day time period Following treatment, monolayers are washed with PBS and detached by trypsinization. Cells are then centrifuged at 1200 rpm for 5 minutes at 4 °C, the pellet resuspended in 3 mL cold Ca2+ binding buffer (10 mM Hepes, pH 7.4, 140 mM NaCl, 2.5 mM CaC12) and aliquoted into 35 mm strainer-capped 12 x 75 mm tubes (1 mL per tube, 3 tubes per treatment group) for removal of cell clumps. Tubes then receive PI (10 pg / mL). Samples are analyzed using a FACSCAN™ flow cytometer and FACSCONVERT™ CellQuest software (Becton Dickinson). Antibodies which induce statistically significant levels of cell death as determined by PI uptake are thus identified.
[0267] In one aspect, an anti-PSMA antibody is tested for its ability to induce apoptosis (programmed cell death) in vitro. An exemplary assay for antibodies that induce apoptosis is an annexin binding assay. In an exemplary annexin binding assay, cells are cultured and seeded in dishes as discussed in the preceding paragraph. The medium is removed and replaced with fresh medium alone or medium containing 0.001 to 10 pg / mL of the antibody. Following a three-day incubation period, monolayers are washed with PBS and detached by trypsinization. Cells are then centrifuged, resuspended in Ca2+ binding buffer, and aliquoted into tubes as discussed in the preceding paragraph. Tubes then receive labeled annexin (e.g., annexin V-FITC) (1 pg / mL). Samples are analyzed using a FACSCAN™ flow cytometer and FACSCONVERT™ CellQuest software (BD Biosciences). Antibodies that induce statistically significant levels of annexin binding relative to control are thus identified. Another exemplary assay for antibodies that induce apoptosis is a histone DNA ELISA colorimetric assay for detecting intemucleosomal degradation of genomic DNA. Such an assay can be performed using, e.g., the Cell Death Detection ELISA kit (Roche, Palo Alto, CA).
[0268] Cells for use in any of the above in vitro assays include cells or cell lines that naturally express PSMA or that have been engineered to express PSMA Such cells include tumor cells that overexpress PSMA relative to normal cells of the same tissue origin. Such cells also include cell lines (including tumor cell lines) that express PSMA and cell lines that do not normally express PSMA but have been transfected with nucleic acid encoding PSMA.
[0269] In one aspect, an anti-PSMA antibody thereof is tested for its ability to inhibit cell growth or proliferation in vivo. In certain embodiments, an anti-PSMA antibody thereof is tested for its ability to inhibit tumor growth in vivo. In vivo model systems, such as xenograft models,can be used for such testing. In an exemplary xenograft system, human tumor cells are introduced into a suitably immunocompromised non-human animal, e.g., a SCID mouse. An antibody of the invention is administered to the animal. The ability of the antibody to inhibit or decrease tumor growth is measured. In certain embodiments of the above xenograft system, the human tumor cells are tumor cells from a human patient. In certain embodiments, the human tumor cells are introduced into a suitably immunocompromised non-human animal by subcutaneous injection or by transplantation into a suitable site, such as a mammary fat pad.2. Binding assays and other assays
[0270] In one aspect, an anti-PSMA antibody is tested for its antigen binding activity. For example, in certain embodiments, an anti-PSMA antibody is tested for its ability to bind to PSMA expressed on the surface of a cell. A FACS assay may be used for such testing.
[0271] In one aspect, competition assays may be used to identify a monoclonal antibody that competes with a monoclonal antibody comprising a HCVR / LCVR sequence pair of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36; or that competes with a monoclonal antibody comprising the six CDRs of a HCVR / LCVR sequence pair selected from SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36.
[0272] In certain embodiments, such a competing antibody binds to the same epitope (e g., a linear or a conformational epitope) that is bound by a monoclonal antibody comprising a HCVR / LCVR sequence pair of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36; or a monoclonal antibody comprising the six CDRs of a HCVR / LCVR sequence pair selected from SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36. Exemplary competition assays include, but are not limited to, routine assays such as those provided in Harlow and Lane (1988) Antibodies: A Laboratory Manual ch.14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Detailed exemplary methods for mapping an epitope to which an antibody binds are provided in Morris (1996) “Epitope Mapping Protocols,” in Methods in Molecular Biology vol. 66 (Humana Press, Totowa, NJ). Two antibodies are said to bind to the same epitope if each blocks binding of the other by 50% or more.
[0273] In an exemplary competition assay, immobilized PSMA is incubated in a solution comprising a first labeled antibody that binds to PSMA and a second unlabeled antibody that is being tested for its ability to compete with the first antibody for binding to PSMA. The second antibody may be present in a hybridoma supernatant. As a control, immobilized PSMA is incubated in a solution comprising the first labeled antibody but not the second unlabeled antibody. After incubation under conditions permissive for binding of the first antibody to PSMA, excess unbound antibody is removed, and the amount of label associated with immobilized PSMA is measured. If the amount of label associated with immobilized PSMA is substantially reduced in the test sample relative to the control sample, then that indicates that the second antibody is competing with the first antibody for binding to PSMA. In certain embodiments, immobilized PSMA is present on the surface of a cell or in a membrane preparation obtained from a cell expressing PSMA on its surface.
[0274] In one aspect, purified anti-PSMA antibodies can be further characterized by a series of assays including, but not limited to, N-terminal sequencing, amino acid analysis, non-denaturing size exclusion high pressure liquid chromatography (HPLC), mass spectrometry, ion exchange chromatography and papain digestion.E. Methods of Epitope Identification
[0275] In one aspect, the present disclosure provides a method for identifying the epitope of an anti-PSMA antibody or antigen-binding fragment thereof.
[0276] An epitope can include at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in a unique spatial conformation. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids can be typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding can be typically lost on treatment with denaturing solvents.
[0277] Epitope mapping can be performed to identify the linear or non-linear, discontinuous amino acid sequence(s), i.e. the epitope, that is (e g., specifically) recognized by an anti-PSMA antibody or antigen-binding fragment thereof. A general approach for epitope mapping can require the expression of the full-length polypeptide sequence that is recognized by an antibody or ligand of interest, as well as various fragments, i.e., truncated forms of the polypeptide sequence,generally in a heterologous expression system. These various recombinant polypeptide sequences or fragments thereof (e.g., fused with an N-terminal protein (e.g., GFP)) can then be used to determine if the antibody or ligand of interest is capable of binding to one or more of the truncated forms of the polypeptide sequence.
[0278] Through the use of reiterative truncation and the generation of recombinant polypeptide sequences with overlapping amino acid regions, it is possible to identify the region of the polypeptide sequence that is recognized by the antibody of interest (see, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed (1996)). The methods rely on the ability of an agent such as an antibody of interest to bind to sequences that have been recreated from epitope libraries, such as epitope libraries derived from, synthetic peptide arrays on membrane supports, combinatorial phage display peptide libraries. The epitope libraries then provide a range of possibilities that are screened against an antibody. Additionally, site specific mutagenesis, or random Ala scan, targeting one or more residues of an epitope can be pursued to confirm the identity of an epitope.
[0279] A library of epitopes can be created by synthetically designing various portions of PSMA as constructs and expressing them in a suitable system. In other cases, portions of PSMA can be amplified out of Total RNA extracted from PSMA-expressing-cells isolated from human normal and / or malignant tissue.
[0280] The host system can be any suitable expression system such as 293 cells, insect cells, or a suitable in-vitro translation system. The binding of an anti-PSMA antibody or antigen-binding fragment thereof to one of the epitopes in the above-described library can be detected by contacting a labeled PSMA antibody of the present disclosure with an epitope of the library and detecting a signal from the label.
[0281] For epitope mapping, computational algorithms have also been developed which have been shown to map conformational discontinuous epitopes. Conformational epitopes can be identified by determining spatial conformation of amino acids with methods that include, e.g., x- ray crystallography and 2-dimensional nuclear magnetic resonance. Some epitope mapping methods, such as, x-ray analyses of crystals of antigen: antibody complexes can provide atomic resolution of the epitope. In other cases, computational combinatorial methods for epitope mapping can be employed to model a potential epitope based on the sequence of the anti-PSMAor antigen-binding fragment thereof. Tn such cases, the antigen binding portion of the antibody is sequenced, and computation models are used to reconstruct and predict a potential binding site of the antibody.
[0282] In some cases the disclosure provides a method of determining a PSMA epitope, comprising: (a) preparing a library of epitopes from the PSMA receptor; (b) contacting the library of epitopes with an anti-PSMA antibody; and (b) identifying the amino acid sequence of at least one epitope in the library of epitopes that is bound by the antibody. In one instance, the antibody is attached to a solid support. The library of epitopes can comprise sequences that correspond to continuous and discontinuous epitopes of PSMA. In some cases, the library of epitopes comprises fragments from PSMA receptor ranging from about 10 amino acids to about 30 amino acids in length, from about 10 amino acids to about 20 amino acids in length, or from about 5 amino acids to about 12 amino acids in length. In some cases, the anti-PSMA antibody or antigen-binding fragment thereof is labeled and the label is a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin.
[0283] Phage panning may be used to identify PMSA-binding molecules that bind to PMSA or one or more epitopes on PMSA. In embodiments, phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads is performed on highly diverse synthetic scFv phage display libraries using multiple (e.g., 5) rounds of selection, each with decreasing antigen concentration (e.g., starting at 100 pmol to 2 pmol) but increasing wash stringency. Tn embodiments, an alternate panning strategy with alternating rounds of selection with le8 PSMA+ cells or antigen (e.g., 100 pmol and 25 pmol, respectively) may be used. Antigen-bound phage may then be pulled down, eluted, amplified and screened using ELISAs for binder confirmation and selection. Following NGS and / or Sanger clone sequencing, the selected scFvs may be reformatted into IgGs, expressed, purified and characterized.
[0284] In embodiments, PMSA-binding molecules may be generated using an epitope comprising or consisting of residues 574-580, 644-649, and 674-686 of human PSMA, residues being numbered according to SEQ ID NO: 329 in FIG. 18B. In embodiments, PMSA-binding molecules may be generated using an epitope comprising or consisting of residues 150-161, 167- 172, and 256-261 of human PSMA, residues being numbered according to SEQ ID NO: 330 in FIG. 18B.F. Chimeric Antigen Receptor (CAR) Constructs
[0285] Aspects of the invention include nucleic acids encoding CARs, and constructs and vectors containing such nucleic acids. In some cases, the nucleic acid is a, e.g., heterologous, component of an expression cassette. In embodiments, the nucleic acid is a, e.g., heterologous, component of a retroviral vector. In embodiments, the nucleic acid is a, e.g., heterologous, component of an a|3 or γδ T cell, and preferably a γδ T cell. In embodiments, the nucleic acid is a, e.g., heterologous, component of an y+T cell and / or a 8+T cell. In embodiments, the nucleic acid is a, e.g., heterologous, component of an a" T cell and / or a 0" T cell.
[0286] A subject CAR of the invention comprises an antigen binding domain capable of specifically binding to PSMA. The antigen binding domain may be operably linked to another domain of the CAR, for example a transmembrane domain, a costimulatory domain and / or an intracellular signaling domain, as described herein. The antigen binding domains described herein can be combined with any of the transmembrane, costimulatory, and / or intracellular signaling domain(s) described herein, and / or any of the other domains described herein that may be included in a CAR of the present invention. A subject CAR of the present invention may also include a hinge domain as described herein. A subject CAR of the present invention may also include at least one spacer domain as described herein.1. Antigen Binding Domain
[0287] The antigen binding domain can include any domain that binds to PSMA and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. In embodiments, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. The choice of antigen binding domain may depend upon the type and number of antigens that are present on the surface of a target cell.
[0288] In embodiments, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single-chain variable fragment (scFv).
[0289] The present disclosure provides antibodies and CARs with “substantial identity” or “substantial similarity” to the sequences provided herein in the CDR or framework regions. The term "substantial identity" or "substantially identical," when referring to a nucleic acid or fragmentthereof, indicates that, when optimally aligned with another nucleic acid (or the complementary strand of the other nucleic acid), there is nucleotide sequence identity in %, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or GAP, as discussed below. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.
[0290] As applied to polypeptides, the term "substantial similarity" or “substantially similar” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity. In some aspects, residue positions, which are not identical, differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson (1994) Methods Mol. Biol. 24: 307-331, which is herein incorporated by reference. Examples of groups of amino acids that have side chains with similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine and isoleucine; 2) aliphatic-hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartate and glutamate, and 7) sulfur-containing side chains: cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine. Alternatively, a conservative replacement is any change having a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet etal. (1992) Science 256: 1443 45, herein incorporated by reference. A "moderately conservative" replacement is any change having a nonnegative value in the PAM250 log-likelihood matrix.
[0291] Sequence identity and / or similarity for polypeptides is typically measured using sequence analysis software. Protein analysis software matches similar sequences using measures of similarity assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG software contains programs such as GAP and BESTFTT which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutein thereof. See, e.g., GCG Version 6.1. Polypeptide sequences also can be compared using FASTA with default or recommended parameters; a program in GCG Version 6.1. FASTA (e.g., FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson (2000) supra). Sequences also can be compared using the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. Another preferred algorithm when comparing a sequence disclosed herein to a database containing a large number of sequences from different organisms is the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. See, e.g., Altschul etal. (1990) J. Mol. Biol. 215: 403-410 and (1997) Nucleic Acids Res. 25:3389-3402, each of which is herein incorporated by reference.
[0292] Provided herein are anti-PSMA CARs comprising variants of any of the HCVR, LCVR, and / or CDR amino acid sequences disclosed herein having one or more substitutions (e.g., conservative substitutions). For example, the present disclosure includes anti-PSMA CARs having HCVR, LCVR, and / or CDR amino acid sequences with, e.g., 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid substitutions relative to any of the HCVR, LCVR, and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3) amino acid sequences disclosed herein. For example, an anti-PSMA CAR can comprise 20, 19, 18, 17, 16, 15, 14 13, 12, 11, 10, 9, 8, 7,6, 5, 4, 3, 2, or 1 amino acid substitutions (e g., conservative amino acid substitutions) relative to any of the HCVR, LCVR, and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3) amino acid sequences disclosed herein.
[0293] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1-36. In embodiments, the anti-PSMA binding domain binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35. In embodiments, the anti-PSMA binding domain binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, and 36. In embodiments, the anti-PSMA binding domain binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 13. In embodiments, the anti-PSMA binding domain binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, and 14.
[0294] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 37- 54; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 55-72; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 73-90. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 91-108; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 109-126; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 127-144.
[0295] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVRcomprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 37- 43; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 55-61; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 73-79. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 91-97; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 109-115; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 127-133.
[0296] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 1, and a LCVR amino acid sequence set forth at SEQ ID NO: 2. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 3, and a LCVR amino acid sequence set forth at SEQ ID NO: 4. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 5, and a LCVR amino acid sequence set forth at SEQ ID NO: 6. In embodiments, an isolated nucleic acid encodes an anti- PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 7, and a LCVR amino acid sequence set forth at SEQ ID NO: 8. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 9, and a LCVR amino acid sequence set forth at SEQ ID NO: 10. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 11, and a LCVR amino acid sequence set forth at SEQ ID NO: 12. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 13, and a LCVR amino acid sequence set forth at SEQ ID NO: 14. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as,competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 15, and a LCVR amino acid sequence set forth at SEQ ID NO: 16. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 17, and a LCVR amino acid sequence set forth at SEQ ID NO: 18. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 19, and a LCVR amino acid sequence set forth at SEQ ID NO: 20. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 21, and a LCVR amino acid sequence set forth at SEQ ID NO: 22. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 23, and a LCVR amino acid sequence set forth at SEQ ID NO: 24. In embodiments, an isolated nucleic acid encodes an anti- PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 25, and a LCVR amino acid sequence set forth at SEQ ID NO: 26. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 27, and a LCVR amino acid sequence set forth at SEQ ID NO: 28. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 29, and a LCVR amino acid sequence set forth at SEQ ID NO: 30. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 31, and a LCVR amino acid sequence set forth at SEQ ID NO: 32. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 33, and a LCVR amino acid sequence set forth at SEQ ID NO: 34. In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the sameepitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 35, and a LCVR amino acid sequence set forth at SEQ ID NO: 36.
[0297] Preferred embodiments include those in which an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence set forth as SEQ ID NO: 1, and a LCVR amino acid sequence set forth at SEQ ID NO: 2; a HCVR amino acid sequence set forth as SEQ ID NO: 3, and a LCVR amino acid sequence set forth at SEQ ID NO: 4; a HCVR amino acid sequence set forth as SEQ ID NO: 5, and a LCVR amino acid sequence set forth at SEQ ID NO: 6; a HCVR amino acid sequence set forth as SEQ ID NO: 7, and a LCVR amino acid sequence set forth at SEQ ID NO: 8; a HCVR amino acid sequence set forth as SEQ ID NO: 9, and a LCVR amino acid sequence set forth at SEQ ID NO: 10; a HCVR amino acid sequence set forth as SEQ ID NO: 11, and a LCVR amino acid sequence set forth at SEQ ID NO: 12; or a HCVR amino acid sequence set forth as SEQ ID NO: 13, and a LCVR amino acid sequence set forth at SEQ ID NO: 14.
[0298] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 37, a CDR2 sequence set forth as SEQ ID NO: 55, and a CDR3 sequence set forth as SEQ ID NO: 73; and / or comprising a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 91 , a CDR2 sequence set forth as SEQ ID NO: 109, and a CDR3 sequence set forth as SEQ ID NO: 127.
[0299] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 38, a CDR2 sequence set forth as SEQ ID NO: 56, and a CDR3 sequence set forth as SEQ ID NO: 74; and / or comprising a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 92, a CDR2 sequence set forth as SEQ ID NO: 110, and a CDR3 sequence set forth as SEQ ID NO: 128.100300] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 39, a CDR2 sequence set forth as SEQ ID NO: 57, and a CDR3 sequence set forth as SEQ ID NO: 75; and / or comprising a LCVR comprisinga CDRI sequence set forth as SEQ TD NO: 93, a CDR2 sequence set forth as SEQ ID NO: 1 11 , and a CDR3 sequence set forth as SEQ ID NO: 129.
[0301] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 40, a CDR2 sequence set forth as SEQ ID NO: 58, and a CDR3 sequence set forth as SEQ ID NO: 76; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 94, a CDR2 sequence set forth as SEQ ID NO: 112, and a CDR3 sequence set forth as SEQ ID NO: 130.
[0302] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 41, a CDR2 sequence set forth as SEQ ID NO: 59, and a CDR3 sequence set forth as SEQ ID NO: 77; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 95, a CDR2 sequence set forth as SEQ ID NO: 113, and a CDR3 sequence set forth as SEQ ID NO: 131.
[0303] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 42, a CDR2 sequence set forth as SEQ ID NO: 60, and a CDR3 sequence set forth as SEQ ID NO: 78; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 96, a CDR2 sequence set forth as SEQ ID NO: 114, and a CDR3 sequence set forth as SEQ ID NO: 132.
[0304] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 43, a CDR2 sequence set forth as SEQ ID NO: 61, and a CDR3 sequence set forth as SEQ ID NO: 79; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 97, a CDR2 sequence set forth as SEQ ID NO: 115, and a CDR3 sequence set forth as SEQ ID NO: 133.
[0305] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 44, a CDR2 sequence set forth as SEQ ID NO: 62, and a CDR3 sequence set forth as SEQ ID NO: 80; and / or comprising a EC VR comprisinga CDRI sequence set forth as SEQ TD NO: 98, a CDR2 sequence set forth as SEQ ID NO: 1 16, and a CDR3 sequence set forth as SEQ ID NO: 134.
[0306] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 45, a CDR2 sequence set forth as SEQ ID NO: 63, and a CDR3 sequence set forth as SEQ ID NO: 81; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 99, a CDR2 sequence set forth as SEQ ID NO: 117, and a CDR3 sequence set forth as SEQ ID NO: 135.
[0307] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 46, a CDR2 sequence set forth as SEQ ID NO: 64, and a CDR3 sequence set forth as SEQ ID NO: 82; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 100, a CDR2 sequence set forth as SEQ ID NO: 118, and a CDR3 sequence set forth as SEQ ID NO: 136.
[0308] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 47, a CDR2 sequence set forth as SEQ ID NO: 65, and a CDR3 sequence set forth as SEQ ID NO: 83; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 101, a CDR2 sequence set forth as SEQ ID NO: 119, and a CDR3 sequence set forth as SEQ ID NO: 137.
[0309] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 48, a CDR2 sequence set forth as SEQ ID NO: 66, and a CDR3 sequence set forth as SEQ ID NO: 84; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 102, a CDR2 sequence set forth as SEQ ID NO: 120, and a CDR3 sequence set forth as SEQ ID NO: 138.
[0310] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 49, a CDR2 sequence set forth as SEQ ID NO: 67, and a CDR3 sequence set forth as SEQ ID NO: 85; and / or comprising a EC VR comprisinga CDRI sequence set forth as SEQ ID NO: 103, a CDR2 sequence set forth as SEQ ID NO: 121 , and a CDR3 sequence set forth as SEQ ID NO: 139.
[0311] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 50, a CDR2 sequence set forth as SEQ ID NO: 68, and a CDR3 sequence set forth as SEQ ID NO: 86; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 104, a CDR2 sequence set forth as SEQ ID NO: 122, and a CDR3 sequence set forth as SEQ ID NO: 140.
[0312] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 51, a CDR2 sequence set forth as SEQ ID NO: 69, and a CDR3 sequence set forth as SEQ ID NO: 87; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 105, a CDR2 sequence set forth as SEQ ID NO: 123, and a CDR3 sequence set forth as SEQ ID NO: 141.
[0313] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 52, a CDR2 sequence set forth as SEQ ID NO: 70, and a CDR3 sequence set forth as SEQ ID NO: 88; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 106, a CDR2 sequence set forth as SEQ ID NO: 124, and a CDR3 sequence set forth as SEQ ID NO: 142.
[0314] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 53, a CDR2 sequence set forth as SEQ ID NO: 71, and a CDR3 sequence set forth as SEQ ID NO: 89; and / or comprising a EC VR comprising a CDRI sequence set forth as SEQ ID NO: 107, a CDR2 sequence set forth as SEQ ID NO: 125, and a CDR3 sequence set forth as SEQ ID NO: 143.
[0315] In embodiments, an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDRI sequence set forth as SEQ ID NO: 54, a CDR2 sequence set forth as SEQ ID NO: 72, and a CDR3 sequence set forth as SEQ ID NO: 90; and / or comprising a EC VR comprisinga CDR1 sequence set forth as SEQ ID NO: 108, a CDR2 sequence set forth as SEQ ID NO: 126, and a CDR3 sequence set forth as SEQ ID NO: 144.
[0316] Preferred embodiments include those in which an isolated nucleic acid encodes an anti-PSMA binding domain that binds the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 37, a CDR2 sequence set forth as SEQ ID NO: 55, and a CDR3 sequence set forth as SEQ ID NO: 73, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 91, a CDR2 sequence set forth as SEQ ID NO: 109, and a CDR3 sequence set forth as SEQ ID NO: 127; a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 38, a CDR2 sequence set forth as SEQ ID NO: 56, and a CDR3 sequence set forth as SEQ ID NO: 74, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 92, a CDR2 sequence set forth as SEQ ID NO: 110, and a CDR3 sequence set forth as SEQ ID NO: 128; a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 39, a CDR2 sequence set forth as SEQ ID NO: 57, and a CDR3 sequence set forth as SEQ ID NO: 75, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 93, a CDR2 sequence set forth as SEQ ID NO: 111, and a CDR3 sequence set forth as SEQ ID NO: 129; a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 40, a CDR2 sequence set forth as SEQ ID NO: 58, and a CDR3 sequence set forth as SEQ ID NO: 76, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 94, a CDR2 sequence set forth as SEQ ID NO: 112, and a CDR3 sequence set forth as SEQ ID NO: 130; a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 41, a CDR2 sequence set forth as SEQ ID NO: 59, and a CDR3 sequence set forth as SEQ ID NO: 77, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 95, a CDR2 sequence set forth as SEQ ID NO: 113, and a CDR3 sequence set forth as SEQ ID NO: 131; a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 42, a CDR2 sequence set forth as SEQ ID NO: 60, and a CDR3 sequence set forth as SEQ ID NO: 78, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 96, a CDR2 sequence set forth as SEQ ID NO: 114, and a CDR3 sequence set forth as SEQ ID NO: 132; or a HCVR comprising a CDR1 sequence set forth as SEQ ID NO: 43, a CDR2 sequence set forth as SEQ ID NO: 61, and a CDR3 sequence set forth as SEQ ID NO: 79, and a LCVR comprising a CDR1 sequence set forth as SEQ ID NO: 97, a CDR2 sequence set forth as SEQ ID NO: 1 15, and a CDR3 sequence set forth as SEQ ID NO: 133.
[0317] Other anti-PSMA binding domains and anti-PSMA CARs are known and can be used in accordance with the teachings of the present disclosure. See, for example, W02017180713,WO2019245991 Al , W02002098897, WO2001009192, WO2016179534, WO2019224718, WO2021 / 188599, WO2016111344, WO2017027325, WO2018098354, WO2017212250, WO 2021 / 050656, and Narayan et ah, (2022) Nature Medicine, doi: 10.1038, the contents of each of which is expressly hereby incorporated by reference herein in their entireties. In preferred embodiments, such anti-PSMA binding domains are incorporated into CARs as herein described, or the known CARs are used as such or modified in accordance with the present disclosure, wherein said CARs are expressed in γδ T cells for use in the methods as herein described.2. Transmembrane Domain
[0318] CARs of the present disclosure may comprise a transmembrane domain that couples the antigen binding domain of the CAR to one or more intracellular domains of the CAR. The transmembrane domain of a CAR of the present disclosure is a region that is capable of spanning the plasma membrane of a cell (e.g., a γδ T cell). In embodiments, the transmembrane domain is interposed between the antigen binding domain and the one or more intracellular domains of a CAR.
[0319] In embodiments, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In embodiments, the transmembrane domain can e selected or modified by one or more amino acid substitutions to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, to minimize interactions with other members of the receptor complex.
[0320] For example and without limitation, a transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. Transmembrane regions of particular use in this invention may be derived from (i.e. comprise at least the transmembrane region(s) of) 4- 1BB / CD137, activating NK cell receptors, an Immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CDSalpha, CD8beta, CD96 (Tactile), CDl la, CDl lb, CDl lc, CDl ld, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS,GITR, HVEM (LTGHTR), TA4, TCAM-1, Tg alpha (CD79a), TL-2R beta, TL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrins, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, a ligand that specifically binds with CD83, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CDl la / CD18), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death- 1 (PD-1), PSGL1, SELPLG (CD162), Signaling Lymphocytic Activation Molecules (SLAM proteins), SLAM (SLAMF1; CD 150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF receptor proteins, TNFR2, TNFSF14, a Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or a combination thereof. Alternatively, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
[0321] In certain embodiments, the transmembrane domain comprises a transmembrane domain of CD8. In certain embodiments, the transmembrane domain of CD8 is a transmembrane domain of CD8a. In certain embodiments, the transmembrane domain of CD8 comprises the amino acid sequence set forth in SEQ ID NO: 158. In certain embodiments, the transmembrane domain comprises a transmembrane domain of CD28. In certain embodiments, the transmembrane domain of CD28 comprises the amino acid sequence set forth in SEQ ID NO: 285. In certain embodiments, the transmembrane domain comprises a transmembrane domain of ICOS. In certain embodiments, the transmembrane domain of ICOS comprises the amino acid sequence set forth in SEQ ID NO: 286.
[0322] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the intracellular domains described herein, or any of the other domains described herein that may be included in a subject CAR.
[0323] In embodiments, the transmembrane domain further comprises a hinge region. A subject CAR of the present invention may also include a hinge region. The hinge region of the CAR is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In embodiments, this domain facilitates proper protein folding for the CAR. The hinge region is an optional component for the CAR. The hinge region may include adomain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof Examples of hinge regions include, without limitation, a CD8a hinge, CD80 hinge, CD28 hinge, 4-1BB hinge, CD7 hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly), as well as CHI and CHS domains of IgGs (such as human IgG4). Naturally- occurring hinge domains may be used as wild-type hinge regions or the molecules may be altered.
[0324] In embodiments, a subject CAR of the present disclosure includes a hinge region that couples the antigen binding domain with the transmembrane domain, which, in turn, couples to one or more intracellular domain(s). The hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135). In embodiments, the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell (Hudecek et al., supra). The flexibility of the hinge region permits the hinge region to adopt many different conformations. In embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region).
[0325] The hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 aa to about 10 aa, from about 10 aa to about 15 aa, from about 15 aa to about 20 aa, from about 20 aa to about 25 aa, from about 25 aa to about 30 aa, from about 30 aa to about 40 aa, or from about 40 aa to about 50 aa. In embodiments, the hinge region can have a length of greater than 5 aa, greater than 10 aa, greater than 15 aa, greater than 20 aa, greater than 25 aa, greater than 30 aa, greater than 35 aa, greater than 40 aa, greater than 45 aa, greater than 50 aa, greater than 55 aa, or more.
[0326] Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids. Suitable hinge regions can have a length of greater than 20 amino acids (e.g., 30, 40, 50, 60 or more amino acids).
[0327] For example, hinge regions include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 275) and (GGGS)n (SEQ ID NO: 276), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components. Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), and the like.
[0328] In embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et ah, Proc. Natl. Acad. Sci. USA (1990) 87(1): 162-166; and Huck et ah, Nucleic Acids Res. (1986) 14(4): 1779-1789. As non-limiting examples, an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 287); CPPC (SEQ ID NO: 288); CPEPKSCDTPPPCPR (SEQ ID NO: 289) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 290); KSCDKTHTCP (SEQ ID NO: 291); KCCVDCP (SEQ ID NO: 292); KYGPPCP (SEQ ID NO: 293); EPKSCDKTHTCPPCP (SEQ ID NO: 294) (human IgGl hinge); ERKCCVECPPCP (SEQ ID NO: 295) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 296) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 297) (human IgG4 hinge); and the like.
[0329] The hinge region can comprise an amino acid sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region. In one embodiment, the hinge region can include one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally-occurring) hinge region. For example, His229 of human IgGl hinge can be substituted with Tyr, so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 298); see, e.g., Van et al., J. Biol. Chem. (2012) 287: 5891-5897.
[0330] In certain embodiments, the hinge region can comprise an amino acid sequence derived from human CDS, or a variant thereof. In certain embodiments, the CAR comprises a CDS alphahinge sequence comprising the amino acid sequence set forth in SEQ ID NO: 156. In certain embodiments, the CAR comprises a hinge and transmembrane domain sequence comprising the amino acid sequence set forth in SEQ ID NO: 160.3. Costimulatory Domain
[0331] In embodiments, a CAR encoded by a nucleic acid may further comprise at least one costimulatory domain, wherein the costimulatory domain comprises functional costimulatory signaling domain derived from e.g., a MHC class I molecule, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, and the like. For example, it is within the scope of this disclosure that the CAR can include 2, 3, 4 or more costimulatory domains. It is also within the scope of this disclosure that when more than one costimulatory domain is included, the costimulatory domains may be the same, or they may be different. In embodiments, the costimulatory domains are derived from one or more of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8a, CD8p, CDl la, CDl lb, CDl lc, CDl ld, IL2Rp, IL2y, lL7Ra, IL4R, 1L7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54 (ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96 (Tactile), CD100 (SEMA4D), CD103, CD134 (0X40), CD137 (4-1BB), CD152 (CTLA-4), CD160 (BY55), CD162 (SELPLG), CD244 (2B4), CD270 (HVEM), CD226 (DNAM1), CD229 (Ly9), CD278 (ICOS), ICAM-1, LFA-1 (CDl la / CD18), FcR, FcyRI, FcyRII, FcyRIII, EAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, EAT, GADS, LIGHT, HVEM (LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, LyI08), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, and TRANCE / RANKL, or a portion thereof, and combinations thereof.
[0332] In embodiments, a nucleic acid encoding a CAR encodes at least one 4- IBB costimulatory domain, and optionally a second costimulatory domain selected from 4- IBB, 2B4, ICOS, CD28, 0X40, and CD27 costimulatory domains, or any of the above-mentioned costimulatory domains. In embodiments, the nucleic acid encodes at least two 4-1BBcostimulatory domains, or at least two 4-1 BB costimulatory domains in combination with one, two, three, or four, or more, costimulatory domains selected from 4- IBB, ICOS, CD28, 0X40, and CD27, or any of the above-mentioned costimulatory domains. In embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence set forth as SEQ ID NO: 162. In embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least one, at least two, or at least three or more modifications of an amino acid sequence of SEQ ID NO: 162. In embodiments, the 4-1BB costimulatory domain is substantially similar to the 4-1BB costimulatory domain comprising SEQ ID NO: 162.
[0333] In embodiments, a nucleic acid encoding a CAR encodes at least one CD27 costimulatory domain, and optionally at least one second costimulatory domain selected from 4- 1BB, ICOS, CD28, 0X40, 2B4, and CD27 costimulatory domains, or any of the above-mentioned costimulatory domains. In embodiments, the nucleic acid encodes at least one CD27 costimulatory domain, and a 4-IBB costimulatory domain. In embodiments, the nucleic acid encodes two CD27 costimulatory domains, and at least one second costimulatory domain selected from a 4- IBB, ICOS, CD28, and CD27. In embodiments, the CD27 costimulation domain comprises SEQ ID NO: 39. In embodiments, the CD27 costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three or more modifications of an amino acid sequence of SEQ ID NO: 300. In embodiments, the CD27 costimulatory domain is substantially similar to the CD27 costimulatory domain comprising SEQ ID NO: 300.
[0334] In embodiments, a nucleic acid encoding a CAR encodes at least one CD28 costimulatory domain, and optionally a second costimulatory domain selected from 4- IBB, 2B4, ICOS, CD28, 0X40, and CD27 costimulatory domains, or any of the above-mentioned costimulatory domains. In embodiments, the nucleic acid encodes at least two CD28 costimulatory domains, or at least two CD28 costimulatory domains in combination with one, two, three, or four, or more, costimulatory domains selected from a 4- IBB, ICOS, CD28, 0X40, and CD27, or any of the above-mentioned costimulatory domains. In embodiments, the CD28 costimulatory domain comprises SEQ ID NO: 254. In embodiments, the CD28 costimulatory domain comprises SEQ ID NO: 301. Included in SEQ ID NO: 254 and SEQ ID NO: 301 are three subdomains YMNM, PRRP, and PYAP, that are capable to regulate signaling pathways. In embodiments, a disclosed CAR comprises mutation or deletion of one or more of said subdomains (see e.g., W02019010383). In embodiments, the CD28 costimulatory domain comprises an amino acidsequence having at least one, at least two, at least three or more modifications of an amino acid sequence of SEQ ID NO: 254, or an amino acid sequence of SEQ ID NO: 301. In embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 254. In embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 301.
[0335] In embodiments, a nucleic acid encoding a CAR encodes at least one ICOS costimulatory domain, and optionally a second costimulatory domain selected from 4- IBB, 2B4, ICOS, CD28, 0X40, and CD27 costimulatory domains, or any of the above-mentioned costimulatory domains. In embodiments, the nucleic acid encodes at least two ICOS costimulatory domains, or at least two ICOS costimulatory domains in combination with one, two, three, or four, or more, costimulatory domains selected from 4-1BB, ICOS, CD28, 0X40, and CD27, or any of the above-mentioned costimulatory domains. In embodiments, the ICOS costimulatory domain comprises SEQ ID NO: 255. In embodiments, the ICOS costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three or more modifications of an amino acid sequence of SEQ ID NO: 255 (see e.g., US20170209492). In embodiments, the ICOS costimulatory domain is substantially similar to the ICOS costimulatory domain comprising SEQ ID NO: 255.
[0336] In embodiments, a nucleic acid encoding a CAR encodes at least one 0X40 costimulatory domain, and optionally a second costimulatory domain selected from 4-1BB, 2B4, ICOS, CD28, 0X40, and CD27 costimulatory domains, or any of the above-mentioned costimulatory domains. In embodiments, the nucleic acid encodes at least two 0X40 costimulatory domains, or at least two 0X40 costimulatory domains in combination with one, two, three, or four, or more, costimulatory domains selected from 4-1BB, ICOS, CD28, 0X40, and CD27, or any of the above-mentioned costimulatory domains. In embodiments, the 0X40 costimulatory domain comprises SEQ ID NO: 256. In embodiments, the 0X40 costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three or more modifications of an amino acid sequence of SEQ ID NO: 256. In embodiments, the 0X40 costimulatoiy domain is substantially similar to the 0X40 costimulatory domain comprising SEQ ID NO: 256.4. Intracellular Signaling Domain
[0337] In embodiments, a nucleic acid encoding a CAR encodes at least one intracellular signaling domain. In embodiments, the at least one intracellular signaling domain is additional to one or more costimulatory domains. In embodiments, the one or more intracellular signaling domains are included to increase proliferation, persistence, and / or cytotoxic activity of the host cell, preferably a γδ cell, harboring the CAR as herein disclosed. For example, in some embodiments, the intracellular signaling domain(s) comprise CD3C, repeat (e.g., 2-5) DAP10 YINM motifs, signaling domains derived from LFA-1, DAP12, FcRy, FcRp, CD3y, CD38, CD3s, CD79a, CD79b, CD5, CD22, FcsRI, CD66d, and the like. It is within the scope of this disclosure that the endodomain of a disclosed CAR can include a plurality (e.g., 2, 3, 4, or more) of intracellular signaling domains. In a case where more than one intracellular signaling domain is included, the intracellular signaling domains may be the same, or they may be different.
[0338] In embodiments, an intracellular signaling domain of a disclosed CAR is or comprises a CD3(^ signaling domain. In embodiments, a CD3(^ signaling domain is or comprises the amino acid sequence set forth in SEQ ID NO: 164, 166, or 167.5. Additional Polypeptides
[0339] In embodiments, an isolated nucleic acid encoding a CAR of the subject invention can also encode for one or more multi ci str onic linker region(s) configured to facilitate translation of the CAR polypeptide and one or more additional polypeptides. In embodiments, nucleic acids encoding the one or more additional polypeptides and associated linker region can be positioned at the 3’ end of the isolated nucleic acid, or at the 5’ end of the isolated nucleic acid, or in some examples at both the 5’ end and the 3’ end of the isolated nucleic acid. In some examples, the linker region(s) can encode a self-cleavage and / or a cleavage polypeptide sequence. In some examples, the self-cleavage sequence is a 2A self-cleaving sequence (e.g., T2A, P2A, E2A, F2A) which can induce ribosomal skipping during translation of the CAR. In embodiments, the cleavage sequence is a furin sequence. In some examples, the cleavage sequence (e.g., furin cleavage sequence as set forth in SEQ ID NO: 242) is amino terminal to a self-cleavage sequence, for example furin-P2A (FP2A). In embodiments, the multicistronic linker region encodes an internal ribosome entry site. In embodiments, the addition of an optional linker “GSG” or “SGSG” and the like can improve cleavage efficiency. In this way, the one or more additional polypeptides can be release from the CAR and directed to the secretory pathway.
[0340] In embodiments, the cleavage sequence is the FP2A amino acid sequence as set forth in SEQ ID NO: 236. In embodiments, the cleavage sequence is a P2A amino acid sequence as set forth in SEQ ID NO: 238, or SEQ ID NOs: 240-241. In embodiments, the cleavage sequence is a furin amino acid sequence as set forth in SEQ ID NO: 242. In embodiments, the cleavage sequence is a F2A amino acid sequence as set forth in SEQ ID NO: 243. In embodiments, the cleavage sequence is a E2A amino acid sequence as set forth in SEQ ID NO: 244. In embodiments, the cleavage sequence is a T2A amino acid sequence as set forth in SEQ ID NO: 245. In certain aspects, multiple cleavage and / or self-cleavage sequences can be encoded carb oxy -terminal to signaling and / or costimulatory domain(s) and amino-terminal to an encoded one or more additional polypeptide. In certain aspects, one or more self-cleavage sequences and one or more sequences cleaved by an endogenous protease are encoded in a construct described herein. In certain embodiments, an endogenous protease recognition site is encoded amino terminal to a selfcleavage sequence.
[0341] In embodiments, the multi-cistronic linker region encodes an internal ribosome entry site. An exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 246. Another exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 247. Further suitable internal ribosome entry sites include, but are not limited to, those disclosed e.g., in Nucleic Acids Res. 2010 Jan;38(Database issue):D131- 6. doi: 10.1093 / nar / gkp981. Epub 2009 Nov 16, those described at iresite.org, those described in WO 2018 / 215787, the sequence described in GenBank accession No. KP019382.1, and the IRES element disclosed in GenBank accession No. LT727339.1. Additional multi-cistronic linker regions, including cleavage self-cleavage, and IRES elements, are disclosed in US 2018 / 0360992 and U.S. 8,865,467.
[0342] In embodiments, the one or more additional polypeptides include one or more soluble gamma chain cytokines expressed as separate polypeptides from the CAR. The one or more soluble common gamma chain cytokines can include but are not limited to IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, IL-23. In embodiments, the common gamma chain cytokine is selected from IL-2, IL-7, and IL-15. In embodiments, the common gamma chain cytokine is IL-15. IL-15 sequences, including codon optimized nucleic acid sequences encoding soluble IL-15 (sIL-15) are disclosed herein and in WO 2007 / 037780.
[0343] In embodiments, the one or more additional polypeptides include one or more labels or markers, for example to facilitate an ability to monitor CAR expression level, serve as an internal control, and the like. In embodiments, an isolated nucleic acid encoding a CAR encodes for a fluorescent protein, examples of which include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), enhanced GFP (EGFP), enhanced cyan fluorescent protein (ECFP), enhanced yellow fluorescent protein (EYFP), and the like. Other examples can include but are not limited to chloramphenicol acetyltransferase, beta-galactosidase, beta-glucuronidase, beta-lactamase, luciferase, and the like.
[0344] In embodiments, the one or more additional polypeptides include a protein that is expressed on a cell surface to facilitate detection and / or isolation of cells expressing said protein, e.g., via fluorescent activated cell sorting (FACS); or for enrichment through positive selection using an antibody specific to the encoded protein, e.g., use of an antibody to purify or enrich the cells product on a column or apparatus; or for in vivo binding of an antibody to the protein to enhance or eliminate activity, e.g., to facilitate removal of cells expressing the protein in patients as a safety consideration. Exemplary proteins useful for these purposes include, e.g., CDI9, CD20 (Rituxumab recognition domain), RQR8, LNGFR, a truncated form of the human epidermal growth factor receptor (EGFRt), and the like. By way of example, EGFRt can be targeted by a clinical stage antibody, where such treatment of a patient with said antibody results in elimination of cells containing an isolated nucleic acid encoding a CAR and / or said CAR as disclosed herein. See, e.g. , Wang et al. A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells; Blood 2011 118(5): 1255-63 ; Philip et al., A highly compact epitope-based marker / suicide gene for easier and safer T-cell therapy; Blood 2014 124(8): 1277- 87; Smith J. et al., UCART19, an allogeneic “off-the-shelf’ adoptive T-cell immunotherapy against CD19+ B-cell leukemias, DOI: 10.1200 / jco.2015.33.15_suppl.3069 Journal of Clinical Oncology 33, no. 15_suppl (May 20, 2015) 3069-3069; Gouble A. et al., In Vivo Proof of Concept of Activity and Safety of UCART19, an Allogeneic “Off-the-Shelf’ Adoptive T-Cell Immunotherapy Against CD19+ B-Cell Leukemias, Blood (2014) 124 (21): 4689, doi.org / 10.1182 / blood.V124.21.4689.4689, each of which is incorporated by reference in its entirety.
[0345] In embodiments, the one or more additional polypeptides include a protein that functions to increase resistance to exhaustion and activation-induced apoptosis and / or upregulateone or more proinflammatory cytokines, costimulatory molecules and / or antigen presentation machinery. A representative example includes but is not limited to lymphotoxin beta receptor (LTBR). LTBR is typically expressed in a subset of myeloid cells but is absent in lymphocytes. When expressed in T cells, LTBR may induce transcriptional remodeling that imparts the T cell with one or more of the above-mentioned advantageous functions (Legut et al., Blood. (2021); 138(1): 1726).[00346J In embodiments, the one or more additional polypeptides include a polypeptide that imparts host cells with the capability to resist tumor antigen-specific cellular immunity, for example that mediated by transforming growth factor beta (TGF-P). For example, an isolated nucleic acid may encode a dominant negative receptor for TGF-beta (dnTGFpR2), e g., as described in Foster et al., J Immunother. (2008); 31 : 500-505, WO2019 / 173324A1, W02020 / 183131A1, and W02020042647A1. Incorporation of such a dominant negative receptor for TGF-beta may provide a functional advantage over control cells that lack such a dominant negative receptor for TGF-beta in the presence of a TGF-beta- secreting tumor, including enhanced anti-tumor activity.[00347J In embodiments, an isolated nucleic acid encodes a signal peptide operably linked to facilitate directing of the one or more additional polypeptides to the secretory pathway. Such one or more additional polypeptides can be those that reside inside certain organelles, are secreted from the host cell, or are inserted into cellular membranes. Tn embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 152. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 248. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 259. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 263. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 267. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth as SEQ ID NO: 271.
[0348] In embodiments, the one or more additional polypeptides comprise or consist of the EGFRt amino acid sequence as set forth in SEQ ID NO: 261. In embodiments, the one or more additional polypeptides comprise or consist of the GMCSFR amino acid sequence as set forth in SEQ ID NO: 260. In embodiments, the signal peptide comprising or consisting of the amino acidsequence set forth as SEQ TD NO: 259 is operably linked to SEQ ID NO: 260. Tn embodiments, the one or more additional polypeptides comprise or consist of the dominant-negative TGFp receptor II (dnTGF0R2) amino acid sequence as set forth in SEQ ID NO: 265. In embodiments, the signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 263 is operably linked to SEQ ID NO: 265. In embodiments, the one or more additional polypeptides includes the full-length LTBR amino acid sequence as set forth in SEQ ID NO: 269. In embodiments, the signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 267 is operably linked to SEQ ID NO: 269. In embodiments, the one or more additional polypeptides includes the LNGFR amino acid sequence as set forth in SEQ ID NO: 273. In embodiments, the signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 271 is operably linked to SEQ ID NO: 273. In embodiments, the one or more additional polypeptides includes the sIL-15 amino acid sequence as set forth in SEQ ID NO: 249. In embodiments, the signal peptide comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 248 is operably linked to SEQ ID NO: 249.
[0349] In embodiments, the one or more additional polypeptides includes a chimeric switch receptor comprising an extracellular domain of a TGFp receptor for binding to TGFp (e.g., TGFpRI and / or TGFpRII), and an intracellular domain of a cytokine receptor. The chimeric switch receptors can convert a TGFP signal into a cytokine signal that promotes cytotoxicity. Examples of such chimeric switch receptors include those descried in WO2012138858, WO2016122738, WO2018094244, WO2014172584, W02019109980, and WO2022037562, each of which is incorporated by reference in its entirety.
[0350] In embodiments, the one or more additional polypeptides includes a dominant negative Fas (dnFas). Incorporation of such a dominant negative Fas in a T cell may provide a functional advantage over control cells that lack such a dominant negative Fas in the prevention of Fas ligand- induced apoptosis and allowing for T cell persistence and antitumor efficacy. Examples of the dnFas include that described in Yamamoto TN et al., T cells genetically engineered to overcome death signaling enhance adoptive cancer immunotherapy, J Clin Invest. 2019 Feb 25; 129(4): 1551- 1565, which is incorporated by reference herein in its entirety.
[0351] In embodiments, the one or more additional polypeptides includes a membrane-bound IL-12 (mbIL-12). Incorporation of such a mbIL-12 in a T cell may provide a functional advantageover control cells that lack such a mbIL-12 in enhancing effector functions of the T cells and / or limiting the systemic toxicity associated with IL-12. Examples of the mbIL-12 include those described in Hu J. et al., Cell membrane-anchored and tumor-targeted IL- 12 (attIL12)-T cell therapy for eliminating large and heterogeneous solid tumors, J Immunother Cancer. 2022 Jan;10(l):e003633; Hornbach A. et al., IL12 integrated into the CAR exodomain converts CD8+ T cells to poly-functional NK-like cells with superior killing of antigen-loss tumors, Mol Ther. 2022 Feb 2;30(2):593-605; and Lee EH et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023 Jan 7;2023.01.06.522784, each of which is incorporated by reference herein in its entirety.
[0352] In embodiments, the one or more additional polypeptides includes an antibody or fragment thereof that bind to CD70, or a CAR comprising such antibody or fragment. Incorporation of such a CD70-binding molecule in a T cell may provide a functional advantage over control cells that lack the CD70-binding molecule in reducing HvG alloreactivity by targeting CD70+ activated T cells. Examples of such CD70-binding molecules include those described in PCT / US2023 / 29047, which is incorporated by reference herein in its entirety.6. Exemplary CARs
[0353] The present invention provides nucleic acid molecules encoding one or more CAR constmcts described herein. In one aspect, the nucleic acid molecule is provided as a messenger RNA transcript. In one aspect, the nucleic acid molecule is provided as a DNA constmct.
[0354] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 204, a CAR polypeptide PL805 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3^ signaling domain.
[0355] In embodiments, a nucleic acid encoding a PL805 CAR comprises the sequence of SEQ ID NO: 205. Table 2 below provides annotation of the nucleotide sequence of SEQ ID NO: 205.
[0356] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 208, a CAR polypeptide PL880 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3£ signaling domain.
[0357] In embodiments, a nucleic acid encoding a PL880 CAR comprises the sequence of SEQ ID NO: 209. Table 3 below provides annotation of the nucleotide sequence of SEQ ID NO: 209.
[0358] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 212, a CAR polypeptide PL 1027 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3^ signaling domain.
[0359] In embodiments, a nucleic acid encoding a PL1027 CAR comprises the sequence of SEQ ID NO: 213. Table 4 below provides annotation of the nucleotide sequence of SEQ ID NO: 213.
[0360] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 216, a CAR polypeptide PL 1028 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3£ signaling domain.
[0361] In embodiments, a nucleic acid encoding a PL1028 CAR. comprises the sequence of SEQ ID NO: 217. Table 5 below provides annotation of the nucleotide sequence of SEQ ID NO: 217.
[0362] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 220, a CAR polypeptide PL 1042 comprising the following domains in order: a signal peptide, a PSMA-binding domain, aCDS hinge and transmembrane domain, a 4-1 BB costimulatory domain, and a CD3£ signaling domain.
[0363] In embodiments, a nucleic acid encoding a PL1042 CAR comprises the sequence of SEQ ID NO: 221. Table 6 below provides annotation of the nucleotide sequence of SEQ ID NO: 221.
[0364] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 224, a CAR polypeptide PL 1045 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1 BB costimulatory domain, and a CD3£ signaling domain.
[0365] In embodiments, a nucleic acid encoding a PL1045 CAR comprises the sequence of SEQ ID NO: 225. Table 7 below provides annotation of the nucleotide sequence of SEQ ID NO: 225.
[0366] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 228, a CAR polypeptide PL 1049 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3^ signaling domain.
[0367] In embodiments, a nucleic acid encoding a PL1049 CAR comprises the sequence of SEQ ID NO: 229. Table 8 below provides annotation of the nucleotide sequence of SEQ ID NO: 229.
[0368] In embodiments, an isolated nucleic acid encodes SEQ ID NO: 232, a CAR polypeptide PL 1062 comprising the following domains in order: a signal peptide, a PSMA-binding domain, a CDS hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3^ signaling domain.
[0369] In embodiments, a nucleic acid encoding a PL1062 CAR comprises the sequence of SEQ ID NO: 233. Table 9 below provides annotation of the nucleotide sequence of SEQ ID NO: 233.
[0370] The above-mentioned CARs and nucleic acids encoding the same include specific signal peptides. In embodiments, it may be desirable to substitute one signal peptide for another in a CAR of the present disclosure. Accordingly, in embodiments, an isolated nucleic acid comprising SEQ ID NO: 207 encodes SEQ ID NO: 206 comprising PL805 minus signal peptide, an isolated nucleic acid comprising SEQ ID NO: 211 encodes SEQ ID NO: 210 comprising PL880 minus signal peptide; an isolated nucleic acid comprising SEQ ID NO: 215 encodes SEQ ID NO: 214 comprising PL1027 minus signal peptide; an isolated nucleic acid comprising SEQ ID NO: 219 encodes SEQ ID NO: 218 comprising PL1028 minus signal peptide; a nucleic acid comprising SEQ ID NO: 223 encodes SEQ ID NO: 222 comprising PL1042 minus signal peptide; an isolated nucleic acid comprising SEQ ID NO: 227 encodes SEQ ID NO: 226 comprising PL1045 minus signal peptide; a nucleic acid comprising SEQ ID NO: 231 encodes SEQ ID NO: 230 comprising PL1049 minus signal peptide; or an isolated nucleic acid comprising SEQ ID NO: 235 encodes SEQ ID NO: 234 comprising PL1062 minus signal peptide.
[0371] Any of the above-mentioned isolated nucleic acids encoding the particular CAR polypeptides can further encode one or more additional polypeptides, as discussed herein. For example and without limitation, any of the above-mentioned nucleic acids encoding the particular CARs can include at least one multi ci stronic linker and a polynucleic acid encoding a dnTGFpR2 polypeptide.7. Vectors
[0372] The present invention encompasses a DNA construct comprising sequences of a CAR. The nucleic acid sequences coding for the desired molecules can be obtained using recombinant methods known in the art, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include the same, or by isolating directly fromcells and tissues containing the same, using standard techniques. Alternatively, the gene of interest can be produced synthetically, rather than cloned.
[0373] The present invention provides vectors in which a DNA of the present invention is inserted. Vectors derived from retroviruses such as the lentivirus are suitable tools to achieve longterm gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from onco- retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.
[0374] In another embodiment, the vector comprising the nucleic acid encoding the desired CAR of the invention is an adenoviral vector (A5 / 35). In another embodiment, the expression of nucleic acids encoding CARs can be accomplished using of transposons such as sleeping beauty, crisper, CAS9, and zinc finger nucleases.
[0375] In brief summary, the expression of natural or synthetic nucleic acids encoding CARs is typically achieved by operably linking a nucleic acid encoding the CAR polypeptide or portions thereof to a promoter and incorporating the construct into an expression vector. The vectors can be suitable for replication and integration eukaryotes. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.
[0376] The expression constructs of the present invention may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols. Methods for gene delivery are known in the art (e.g., U.S. Pat. Nos. 5,399,346, 5,580,859, 5,589,466, incorporated by reference herein in their entireties). In another embodiment, the invention provides a gene therapy vector.
[0377] The nucleic acid can be cloned into a number of types of vectors. For example, the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
[0378] Further, the expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al.(2001 , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193). A number of viral based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. A number of retroviral systems are known in the art. In embodiments, adenovirus vectors are used. A number of adenovirus vectors are known in the art. In one embodiment, lentivirus vectors are used.
[0379] Additional promoter elements, e.g., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.
[0380] One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable promoter is Elongation Growth Factor-la (EF-la). However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the invention should not belimited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
[0381] In order to assess the expression of a CAR polypeptide or portions thereof, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. Tn other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic-resistance genes, such as neo and the like.
[0382] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEES Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.
[0383] Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means.
[0384] Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well- known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). One method for the introduction of a polynucleotide into a host cell is calcium phosphate transfection.
[0385] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno- associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
[0386] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0387] In the case where a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid, lipid / DNA or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the classof compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
[0388] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, Mo.; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, N.Y.); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20. degree. C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
[0389] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.8. Host Cells
[0390] CAR polypeptides of the present disclosure may be expressed via their corresponding nucleic acid constructs in a wide variety of host cells. In embodiments, the host cells are mammalian cells. Host cells, as described herein, can be stored, e.g., cryopreserved, for use in adoptive cell transfer. In embodiments, the host cells are stored prior to engineering the cells to express a CAR polypeptide. In embodiments, the cells are engineered to express a CAR polypeptide and then the cells are stored.
[0391] Preferred host cells for use with the CAD polypeptides and chimeric receptors of the present disclosure comprise immune cells. Such cells may be obtained from the subject to be treated (i.e. are autologous) or, alternatively, immune cell lines or donor immune cells (allogeneic, syngeneic) can be used. Immune cells can be obtained from a number of sources, including from peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Immune cells can be obtained from blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll™ separation. For example, cells from the circulating blood of an individual may be obtained by apheresis. In embodiments, immune cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient or by counterflow centrifugal elutriation. A specific subpopulation of immune cells can be further isolated by positive or negative selection techniques. For example, immune cells can be isolated using a combination of antibodies directed to surface markers unique to the positively selected cells, e.g., by incubation with antibody-conjugated beads for a time period sufficient for positive selection of the desired immune cells. Alternatively, enrichment of immune cell populations can be accomplished by negative selection using a combination of antibodies directed to surface markers unique to the negatively selected cells. Other specific manners of isolation and / or enrichment are disclosed herein.
[0392] In embodiments, the immune cells comprise any leukocyte involved in defending the body against infectious disease and foreign materials. For example, the immune cells can comprise lymphocytes, monocytes, macrophages, dendritic cells, mast cells, neutrophils, basophils, eosinophils, or any combinations thereof. For example, immune cells relevant to the present disclosure can include but are not limited to ap T cells, γδ T cells, NK cells, NKT cells, γδ NKT cells, B cells, innate lymphoid cells (ILCs), cytokine induced killer (CIK) cells, cytotoxicT lymphocytes (CTLs), lymphokine activated killer (LAK) cells, regulatory T cells, and the like. In embodiments, preferred immune cells comprise aP T cells, γδ T cells, NK cells, NKT cells, γδ NKT cells, and / or, in some examples, macrophages. In embodiments, preferred immune cells comprise γδ T cells. In embodiments, the immune cells relevant to the present disclosure comprise allogeneic cells, autologous cells, or syngeneic cells.
[0393] Accordingly, aspects of the invention include host cells, γδ T cells in some preferred embodiments, that functionally express an isolated nucleic acid described herein, and thereby express a CAR on the surface of the cell.
[0394] Aspects of the invention can additionally or alternatively include host cells, preferably γδ T cells, having in vitro or in vivo cytotoxic activity against a tumor cell that exhibits cell surface expression of PSMA.
[0395] In some cases, the cytotoxic activity is innate activity. In some cases, the cytotoxicity is at least in part, significantly (> about 25%), or entirely, due to the presence of a CAR construct having a binding domain that specifically binds PSMA expressed on the surface of the tumor cell. In some cases, the host cells, preferably γδ T cells, exhibit tumor cell killing activity that is greater than an innate level of in vitro and / or in vivo tumor cell killing activity in a control cell of the same cell type. In some cases, the control cell does not comprise a CAR construct. In some cases, the control cell comprises a CAR construct lacking a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a costimulation endodomain described herein.
[0396] In some cases, the cytotoxicity is at least in part, significantly (> about 25%), or entirely, due to the presence of a CAR construct having a binding domain that specifically binds PSMA or an epitope within PSMA. In some cases, the host cells, preferably γδ T cells, functionally express a PSMA-specific CAR encoded by an isolated nucleic acid described herein.
[0397] In embodiments where the host cells are γδ T cells, the γδ T cells can exhibit HLA- restricted (e.g., HLA class I restricted) cytotoxicity. In other embodiments, most (>50%), substantially all (>90%), or all of the cytotoxic activity is not HLA-restricted (e.g., HLA class I restricted). HLA-restricted cytotoxic activity can be assessed by comparing in vitro cytotoxicity against an HLA (e.g., HLA class I) (null) tumor cell line versus in vitro cytotoxicity against anHLA+ (e.g., HLA class T+) tumor cell line. Tn embodiments, the HLA-restricted cytotoxic activity is at least in part, significantly (>25%), or entirely, provided by the use of a T cell Receptor-like binding domain. T cell receptor like binding domains are binding domains that specifically recognize the antigen when presented on the surface of a cell in complex with an MHC molecule. T cell Receptor-like binding domains are further described, e.g., in WO 2016 / 199141.
[0398] Host cells described herein, preferably γδ T cells, can exhibit robust and / or persistent tumor cell killing activity. In some cases, the tumor cell killing activity can persist for at least about 6 days to 120 days, or for at least about 6 days to 180 days, from first contact with a tumor cell. In some cases, the tumor cell killing activity of a host cell described herein, preferably a γδ T cell, or a progeny thereof, can persist for at least about 6 days to 120 days, or for at least about 6 days to 180 days, from first contact with a tumor cell, or from administration of the host cell. This persistent tumor cell killing activity can be exhibited in vitro, in vivo, or both in vitro and in vivo.
[0399] Aspects of the invention can additionally or alternatively include host cells, preferably γδ T cells, that proliferate in response to contact with cells that exhibit cell surface expression, or overexpression, of PSMA. The cells that exhibit cell surface expression, or overexpression, of PSMA can be tumor cells or can be non-tumor cells. In some cases, the proliferation is an innate activity. In some cases, the proliferation is at least in part, significantly (> about 20% or > about 25%), or entirely, due to the presence of a CAR construct having a binding domain that specifically binds PSMA expressed on the surface of a tumor cell. In some cases, the host cells, preferably γδ T cells, exhibit a greater level of in vitro and / or in vivo proliferation as compared to a control cell of the same type. In some cases, the control cell does not comprise a CAR construct. In some cases, the control cell comprises a CAR construct lacking a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a costimulation endodomain described herein.
[0400] Host cells as described herein, preferably γδ T cells, can exhibit robust and / or persistent proliferation in a host organism that comprises a cell, for example a tumor cell, that exhibits cell surface expression, or overexpression, of PSMA. In some cases, the proliferation can persist for at least about 6 days to 120 days, or for at least about 6 days to 180 days, from first contact with a tumor cell or from a date of administration of the host cell, preferably a γδ T cell, to the hostorganism In some cases, the proliferation of a host cell, preferably a yd T cell described herein, or a progeny thereof, in the host organism that comprises the cell that exhibits cell surface expression, or overexpression, of PSMA can persist for at least about 6 days to 120 days, or for at least about 6 days to 180 days, from first contact with a PSMA-expressing cell or from the date of first administration of the host cell, preferably a yd T cell, to the host organism. In some cases, the proliferation in the host organism is at least in part, significantly (> about 20% or > about 25%), or entirely, due to the presence of a CAR construct having a binding domain that specifically binds PSMA or an epitope within PSMA. In some cases, host cells, preferably yd T cells, exhibiting proliferation in the host organism comprising a cell that exhibits cell surface expression of PSMA functionally express a PSMA specific CAR encoded by an isolated nucleic acid described herein.
[0401] In embodiments, the host cells, preferably yd T cells described herein, express, or persistently express, pro-inflammatory cytokines such as tumor necrosis factor alpha or interferon gamma after contact with a PSMA-expressing cell. In embodiments, the host cells described herein, or progeny thereof, express, or persistently express, pro-inflammatory cytokines such as tumor necrosis factor alpha or interferon gamma after contact with the PSMA-expressing cell, e.g. , in a host organism comprising the PSMA-expressing cell.
[0402] In embodiments, a yd T cell, or a pharmaceutical composition containing the yd T cell, exhibits essentially no, or no graft versus host response when introduced into an allogeneic host. In embodiments, the yd T cell, or a pharmaceutical composition containing the yd T cell, exhibits a clinically acceptable level of graft versus host response when introduced into an allogeneic host. In embodiments, a clinically acceptable level is an amount of graft versus host response that does not require cessation of a yd T cell treatment to achieve a therapeutically effective treatment. In embodiments, a clinically acceptable level of graft versus host response (GvHD) is an acute response that is less severe than Grade C according to an applicable IBMTR grading scale. The severity of acute graft versus host response is determined by an assessment of the degree of involvement of the skin, liver, and gastrointestinal tract. The stages of individual organ involvement are combined to produce an overall grade, which has prognostic significance. Grade 1(A) GvHD is characterized as mild disease, grade 11(B) GvHD as moderate, grade III(C) as severe, and grade IV(D) life-threatening. The IBMTR grading system defines the severity of acute GvHD as follows (Rowlings et al., Br J Haematol 1997; 97:855):eGrade A - Stage 1 skin involvement alone (maculopapular rash over <25 percent of the body) with no liver or gastrointestinal involvement eGrade B - Stage 2 skin involvement; Stage 1 to 2 gut or liver involvement eGrade C - Stage 3 involvement of any organ system (generalized erythroderma; bilirubin6.1 to 15.0 mg / dL; diarrhea 1500 to 2000 mL / day) eGrade D Stage 4 involvement of any organ system (generalized erythroderma with bullous formation; bilirubin >15 mg / dL; diarrhea >2000 mL / day OR pain OR ileus).See also, Schoemans et al., Bone Marrow Transplantation volume 53, pagesl401-1415 (2018), e.g., at Tables 1 and 2, which discloses criteria for assessing and grading acute GvHD.
[0403] In embodiments, a γδ T cell, or a pharmaceutical composition containing the γδ T cell, exhibits reduced or substantially reduced graft versus host response when introduced into an allogeneic host as compared to a graft versus host response exhibited by control ap T cells, or a control pharmaceutical composition comprising the control ap T cells, administered to an allogeneic host. In some cases, the control ap T cell is an allogeneic non-engineered control ap T cell. In some cases, the control ap T cell does not comprise a CAR or does not comprise the same CAR as a reference γδ T cell.
[0404] In embodiments, host cells, preferably γδ T cells, described herein can be modified to comprise one or more gene edits. Discussed herein, gene editing is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) is / are inserted, deleted, and / or substituted in a DNA sequence, such as the genome of a γδ T cell. Targeted gene editing enables insertion, deletion, and / or substitution at pre-selected sites in the genome of a targeted cell. When a sequence of an endogenous gene is edited, for example by deletion, insertion, or substitution of nucleotide(s) / nucleic acid(s), the endogenous gene comprising the affected sequence may be knocked-out or knocked-down due to the sequence alteration. Therefore, targeted editing may be used to disrupt endogenous gene expression. Discussed herein, a “disrupted gene” refers to a gene comprising an insertion, deletion or substitution relative to an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. As used herein, “disrupting a gene” refers to a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid in an endogenous gene such that expression of a functional protein fromthe endogenous gene is reduced or inhibited. Methods of disrupting a gene are known to those of skill in the art, and described, e.g., in United States Patent No. 11254912, incorporated herein by reference in its entirety.
[0405] In embodiments, a nuclease-dependent approach can be used to conduct targeted gene editing of a T cell. Such a nuclease-dependent approach can achieve targeted editing through the specific introduction of double strand breaks (DSBs) by specific endonucleases. Such nucleasedependent targeted editing utilizes DNA repair mechanisms, for example, non-homologous end joining (NHEJ), which occurs in response to DSBs DNA repair by NHEJ often leads to random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ mediated repair, repair can also occur by a homology directed repair (HDR) When a donor template containing exogenous genetic material flanked by a pair of homology arms is present, the exogenous genetic material can be introduced into the genome by HDR, which results in targeted integration of the exogenous genetic material. Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and RNA-guided CRISPR-Cas9 nuclease (CRISPR / Cas9; Clustered Regular Interspaced Short Palindromic Repeats Associated 9). Discussed herein, a CRISPR system, or CRISPR nuclease system can include a non-coding RNA molecule (e.g., guide RNA) that binds DNA and Cas proteins (e.g., Cas9) with nuclease functionality (Sander et al., Nature Biotechnology (2014); 32:347-355; Hsu et al., Cell (2014); 157(6): 1262-1278).
[0406] In embodiments, a host cell, preferably a γδ T cell, comprises one or more disrupted genes. For example, one or more genes whose expression is disrupted can comprise adenosine A2a receptor (ADORA), CD276, V-set domain containing T cell activation inhibitor 1 (VTCN1), B and T lymphocyte associated (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDO1), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), lymphocyte-activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cellular receptor 2 (HAVCR2), V-domain immunoglobulin suppressor of T-cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine inducible SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVS SITE (E G AAVS1, AAVS2, ETC.)), or chemokine (C — C motif) receptor 5 (gene / pseudogene) (CCR5), CD 160 molecule (CD 160), T-cell immunoreceptor with Ig and ITEM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T-cell molecule (CRT AM), leukocyte associated immunoglobulin like receptor l(LAIRl), sialic acid binding Ig like lectin 7 (SIGLEC7), sialic acid binding Ig like lectin 9 (SIGLEC9), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member 10a (TNFRSF10A), caspase 8 (CASP8), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas associated via death domain (FADD), Fas cell surface death receptor (FAS), transforming growth factor beta receptor II (TGFBRII), transforming growth factor beta receptor I (TGFBR1), SMAD family member 2 (SMAD2), SMAD family member 3 (SMAD3), SMAD family member 4 (SMAD4), SKI protooncogene (SKI), SKI-like proto-oncogene (SKIL), TGFB induced factor homeobox 1 (TGIF1), interleukin 10 receptor subunit alpha (IL 1 ORA), interleukin 10 receptor subunit beta (IL 1 ORB), heme oxygenase 2 (HM0X2), interleukin 6 receptor (IL6R), interleukin 6 signal transducer (IL6ST), c-src tyrosine kinase (CSK), phosphoprotein membrane anchor with glycosphingolipid microdomains 1(PAG1), signaling threshold regulating transmembrane adaptor 1 (SIT1), forkhead box P3 (FOXP3), PR domain 1 (PRDM1), basic leucine zipper transcription factor, ATF-like (BATF), guanylate cyclase 1, soluble, alpha 2 (GUCY1A2), guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), guanylate cyclase 1, soluble, beta 2 (GUCY1B2), guanylate cyclase 1, soluble, beta 3 (GUCY1B3), cytokine inducible SH2-containing protein (CISH), prolyl hydroxylase domain (PHD1, PHD2, PHD3) family of proteins, or Cbl proto-oncogene B (CBL-B), Zinc Finger Protein 91 (ZFP91), Roquin, CD58, ICAM-1 or any combination thereof.
[0407] In embodiments, a gene whose expression is disrupted is CISH, a negative regulator of TCR signaling. Disruption of the CISH gene may provide a functional advantage over control cells that have an intact CISH gene in improving the sensitivity to certain cytokines (e.g., IL-2 / IL-15), increasing T cell proliferation, and / or limiting T cell exhaustion. In some examples, the CISH gene may be disrupted by methods described in Daher M. et al, Targeting a cytokine checkpoint enhances the fitness of armored cord blood CAR-NK cells, Blood. 2021 Feb 4, 137(5):624-636, which is incorporated by reference herein in its entirety. In some examples, the CISH gene is disrupted by gene editing using an RNA-guided nuclease system comprising one or more guide RNAs comprising the sequences of any one of SEQ ID NOs: 250-253 and 315-316.
[0408] In embodiments, a gene whose expression is disrupted is CBL-B, a negative regulator of T cell activation. Disruption of the CBL-B gene may provide a functional advantage over controlcells that have an intact CBL-B gene in enhancing T cell activation. In some examples, the CBL- B gene may be disrupted by methods described in Augustin R. et ah, Targeting Cbl-b in cancer immunotherapy, J Immunother Cancer. 2023 Feb;l l(2):e006007; Hooper K. et ah, Knockout of CBLB Greatly Enhances Anti-Tumor Activity of CAR T Cells, Blood (2018) 132 (Supplement 1): 338; and Guo X et ah, CBLB ablation with CRISPR / Cas9 enhances cytotoxicity of human placental stem cell-derived NK cells for cancer immunotherapy, J Immunother Cancer. 2021 Mar; 9(3 ):e001975, each of which is incorporated by reference herein in its entirety. In one example, the CBL-B gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising the sequence of any one of SEQ ID NOs: 317-320.
[0409] In embodiments, a gene whose expression is disrupted is Roquin (e.g., Roquin-1). Disruption of the Roquin gene may provide a functional advantage over control cells that have an intact Roquin gene in increasing T cell proliferation and enhancing antitumor activity. In some examples, the Roquin gene may be disrupted by methods described in Mai D et ah, Combined disruption of T cell inflammatory regulators Regnase-1 and Roquin-1 enhances antitumor activity of engineered human T cells, Proc Natl Acad Sci U S A. 2023 Mar 21;120(12):e2218632120, which is incorporated by reference herein in its entirety.
[0410] In embodiments, a gene whose expression is disrupted is ZFP91. Disruption of the ZFP91 gene may provide a functional advantage over control cells that have an intact ZFP91 gene in improving T cell glycolytic fitness and effector function. In some examples, the ZFP91 gene may be disrupted by method described in Wang F. et ah, J Clin Invest. 2021 Oct 1; 131(19):eI44318, which is incorporated by reference herein in its entirety.
[0411] In embodiments, a gene whose expression is disrupted is CD58. In embodiments, a gene whose expression is disrupted is ICAM-1. In embodiments, both CD58 and 1CAM-1 are disrupted. Disruption of the CD58 and / or ICAM-1 genes may provide a functional advantage over control cells that have an intact CD58 and / or ICAM-1 gene in disrupting T cell adhesion and costimulatory interactions to reduce Host vs Graft allocytotoxicity. In...
Claims
CLAIMS:What is claimed is:
1. An affinity binding entity comprising an antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the antigen binding domain comprises: a heavy chain variable region / light chain variable region (HCVR / LCVR) sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36; or the six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36.
2. The affinity binding entity of claim 1, wherein said antigen binding domain comprises: a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14; or the six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.
3. The affinity binding entity of claim 1 or claim 2, wherein said affinity binding entity is an antibody, or an antibody fragment; optionally wherein said affinity binding entity is selected from the group consisting of scFv, Fab, Fab’, Fv, F(ab’)2, dsFv, dAb, and any combination or plurality thereof.
4. The affinity binding entity of claim 3, wherein said antibody or antibody fragment is bispecific, or monoclonal.
5. The affinity binding entity of claim 3 or claim 4, wherein said antibody or antibody fragment is chimeric, humanized, or human.
6. A chimeric antigen receptor (CAR), wherein said CAR comprises the affinity binding entity of any one of claims 2-5.
7. The CAR of claim 6, wherein said CAR further comprises a hinge domain; optionally wherein said hinge domain comprises a glycine polymer, glycine-serine polymer, glycine-alanine polymer, alanine-serine polymer, immunoglobulin heavy chain hinge, or a receptor-derived hinge.
8. The CAR of claim 7, wherein said receptor-derived hinge is a CDS alpha hinge domain, optionally wherein said CDS alpha hinge domain comprises an amino acid sequence set forth as SEQ ID NO: 156.
9. The CAR of any one of claims 6-8, further comprising a transmembrane (TM) domain; optionally wherein said TM domain comprises a TM region of 4-1BB / CD137, activating NK cell receptors, an Immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD 134, CD 137, or CD 154, CD 100 (SEMA4D), CD 103, CD 160 (BY55), CD 18, CD 19, CD 19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CDS, CDSalpha, CDSbeta, CD96 (Tactile), CDl la, CDl lb, CDl lc, CDl ld, CDS, CEACAM1, CRT AM, cytokine receptor, DAP 10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Ig alpha (CD79a), IL-2R beta, IL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrins, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, EAT, LFA-1, a ligand that specifically binds with CD83, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen- 1 (LFA-1; CD1 la / CD18), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death- 1 (PD-1), PSGL1, SELPLG (CD 162), Signaling Lymphocytic Activation Molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; LylOS), SLAMF7, SLP-76, TNF receptor proteins, TNFR2, TNFSF14, a Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or a combination thereof.
10. The CAR of claim 9, wherein said TM domain comprises a TM domain of CDS, preferably wherein said CDS TM domain is a TM domain of CDS alpha; optionally wherein said TM domain comprises the amino acid sequence set forth as SEQ ID NO: 158.
11. The CAR of any one of claims 6-10, further comprising at least one costimulatory domain; optionally wherein said costimulatory domain comprises a costimulatory domain of TERI, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CDSa, CDSp, CDl la, CDl lb, CDl lc, CDl ld, IL2Rp, IL2y, IL7Ra, IL4R, IL7R, IL15R, IL21R, GDIS, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54 (ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96 (Tactile), CD100 (SEMA4D), CD103, CD134 (0X40), CD137 (4-1BB), CD 152 (CTLA-4), CD 160 (BY55), CD 162 (SELPLG), CD244 (2B4), CD270 (HVEM), CD226 (DNAM1), CD229 (Ly9), CD278 (ICOS), ICAM-1, LFA-1 (CD 11 a / CD 18), FcR, FcyRI, FcyRII, FcyRIII, EAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, EAT, GADS, LIGHT, HVEM (LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, LylOS), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKpSO (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, or TRANCE / RANKL, or a portion thereof, or combinations thereof.
12. The CAR of claim 11, wherein said costimulatory domain is a 4-1BB costimulatory domain; optionally wherein said 4-1BB costimulatory domain comprises an amino acid sequence set forth as SEQ ID NO: 162.
13. The CAR of any one of claims 6-12, further comprising one or more intracellular signaling domains, preferably wherein said intracellular signaling domain is a CD3^ intracellular signaling domain, optionally wherein the CD3^ intracellular signaling domain comprises an amino acid sequence set forth as SEQ ID NO: 164, 166, or 167.
14. The CAR of any one of claims 6-13, further comprising a signal peptide; optionally wherein said signal peptide comprises an amino acid sequence set forth as SEQ ID NO: 152.
15. An isolated polynucleotide comprising a nucleic acid sequence encoding the affinity binding entity of any one of claims 1-5.
16. An expression vector comprising the polynucleotide of claim 15, operably linked to a cisacting regulatory element.
17. A cell comprising the affinity binding entity of any one of claims 1-5, the isolated polynucleotide of claim 15, and / or the expression vector of claim 16.
18. An isolated polynucleotide comprising a nucleic acid sequence encoding the CAR of any one of claims 6-14.
19. The isolated polynucleotide of claim 18, further comprising a nucleic acid sequence encoding at least one multi ci stronic linker region; optionally multi ci stronic region encodes a cleavage sequence and / or an internal ribosomal entry site (IRES).
20. The isolated polynucleotide of claim 19, wherein the cleavage sequence is selected from T2A, F2A, P2A, E2A, furin, and furin-P2A (FP2A).
21. The isolated polynucleotide of any one of claims 18-20, further comprising a nucleic acid sequence encoding one or more additional polypeptides.
22. The isolated polynucleotide of claim 21, wherein the one or more additional polypeptides is selected from the group consisting of lymphotoxin beta receptor (LTBR), low-affinity nerve growth factor receptor (LNGFR), a dominant negative (dn) receptor for TGF-beta or Fas, a truncated form of the human epidermal growth factor receptor (EGFRt), membrane-bound IL- 12 (mbIL-12), a fluorescent protein, a gamma chain cytokine, CD 19, CD20, , a CAR that binds to CD70, and any combination thereof.
23. The isolated polynucleotide of claim 22, wherein the one or more additional polypeptides is dnTGF0R2, optionally wherein said dnTGFpR2 comprises an amino acid sequence set forth as SEQ ID NO: 265.
24. The isolated polynucleotide of claim 22, wherein the additional polypeptide is LTBR, wherein said LTBR comprises an amino acid sequence set forth as SEQ ID NO: 267.
25. The isolated polynucleotide of claim 22, wherein the additional polypeptide is EGFRt, wherein said EGFRt comprises an amino acid sequence set forth as SEQ ID NO: 261.
26. The isolated polynucleotide of claim 22, wherein the additional polypeptide is LNGFR, wherein said LNGFR comprises an amino acid sequence set forth as SEQ ID NO: 273.
27. The isolated polynucleotide of any one of claims 22-26, wherein the one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide; optionally wherein the signal peptide comprises an amino acid sequence selected from SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, and SEQ ID NO: 248.
28. The isolated polynucleotide of any one of claims 18-27, comprising a nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229, or 233.
29. An expression vector comprising the isolated polynucleotide of any one of claims 18-28, operably linked to a cis-regulatory element.
30. A γδ T cell comprising:(a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR), said CAR comprising an affinity binding domain that specifically binds to prostate-specific membrane antigen (PSMA); and / or(b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid of (a);wherein the γδ T cell functionally expresses the binding domain of the polypeptide or nucleic acid encoded CAR on the surface of the γδ T cell.
31. The γδ T cell of claim 30, wherein the CAR comprises the affinity binding entity according to any one of claims 2-5; or wherein the nucleic acid sequence comprises the isolated polynucleotide of any one of claims 18-28, or the expression vector of claim 29.
32. A modified immune cell, comprising the CAR of any one of claims 6-14, the polynucleotide of any one of claims 18-28, or the expression vector of claim 29.
33. The modified immune cell of claim 32, wherein said modified immune cell is a γδ T cell, a γδ NKT cell, an αβ T cell, a NK cell, aNKT cell, or a macrophage.
34. The modified immune cell of claim 33, wherein said modified immune cell is a γδ T cell, optionally wherein said γδ T cell is a 81, a 82, a 83, or a 84 γδ T cell, preferably a 82" γδ T cell, more preferably a 81 γδ T cell.
35. The modified immune cell of any one of claims 32-34, or the γδ T cell of claim 30 or claim 31, wherein said modified immune cell or said γδ T cell exhibits in vitro and / or in vivo cell killing activity against a tumor cell that exhibits cell surface expression of PSMA.
36. The modified immune cell or γδ T cell of claim 35, wherein said modified immune cell or γδ T cell proliferates in response to contact with the tumor cell that exhibits cell surface expression of PSMA; optionally wherein the modified immune cell or γδ T cell proliferates in a host organism that comprises a tumor cell that exhibits cell surface expression of PSMA.
37. The modified immune cell of any one of claims 32-36, or the γδ T cell of any one of claims 30-31 or 35-36, wherein the modified immune cell or the γδ T cell expresses pro-inflammatory cytokines after contact with a tumor cell that exhibits cell surface expression of PSMA.
38. The modified immune cell of any one of claims 32-37, or the γδ T cell of any one of claims 30-31 or 35-37, further comprising at least one disrupted gene; optionally wherein said at least one disrupted gene is cytokine inducible SH2-containing protein (CISH), Cbl proto-oncogene B (CBL-B), Zinc Finger Protein 91 (ZFP91), CD58, ICAM-1, or any combination thereof.
39. A method of making the modified immune cell of any one of claims 32-38, or the γδ T cell of any one of claims 30-31 or 35-38, wherein the method comprises transfecting immune cell(s) or γδ T cell(s) with the expression vector of claim 29, optionally wherein said cell(s) have at least one disrupted gene.
40. The method of claim 39, wherein the method comprises retroviral transduction.
41. The method of claim 39 or 40, wherein the method comprises ex vivo expansion of the immune cell(s) or γδ T cell(s), wherein the ex vivo expansion is performed before transfection and / or after transfection of the expression vector.
42. An antibody-drug conjugate (ADC), comprising the affinity binding entity of any one of claims 1-5.
43. A pharmaceutical composition comprising the affinity binding entity of any one of claims 1- 5, or an ADC of claim 42, and a pharmaceutically acceptable carrier.
44. A pharmaceutical composition comprising a plurality of modified immune cells according to any one of claims 32-38, or a plurality of γδ T cells according to any one of claims 30-31 or 35-38; optionally wherein the plurality comprises a composition that is at least 60%, 80%, or from about 60% or 80% to about 90% or 95% 81, 82, 83, or 84 γδ T cells, preferably 81 or 82 γδ T cells, more preferably 82- γδ T cells, most preferably 81 γδ T cells, and a pharmaceutically acceptable carrier.
45. The pharmaceutical composition of claim 44, wherein the plurality comprises at least about 107modified immune cells or γδ T cells, respectively, preferably from about 108modified immune cells or γδ T cells to about 1011modified immune cells or γδ T cells, respectively.
46. A method of inhibiting the growth of a cell that exhibits cell surface expression of PSMA, comprising contacting said cell with the affinity binding entity of any one of claims 1-5, the modified immune cell(s) of any one of claims 32-38, the γδ T cell(s) of any one of claims 30-31 or 35-38, the ADC of claim 42, or the pharmaceutical composition of any one of claims 43-45.
47. A method of killing a tumor cell that exhibits cell surface expression of PSMA, the method comprising contacting the tumor cell with a therapeutically effective amount of the affinity binding entity of any one of claims 1-5, the modified immune cell(s) of any one of claims 32-38, the γδ T cell(s) of any one of claims 30-31 or 35-38, ADC of claim 42, or the pharmaceutical composition of any one of claims 43-45.
48. The method of claim 47, wherein the method comprises introducing into a host organism comprising the tumor cell the therapeutically affective amount of the affinity binding entity, the modified immune cell(s), the γδ T cell(s), the ADC, or the pharmaceutical composition.
49. The method of claim 48, further comprising simultaneously or sequentially administering one or more methods to elevate common gamma chain cytokine(s); optionally wherein the administering one or more methods to elevate common gamma chain cytokine(s) comprises simultaneously or sequentially administering an amount of common gamma chain cytokine(s), lymphodepletion before introducing the modified immune cell(s) or the γδ T cell(s), and / or secretion of one or more common gamma chain cytokine(s) from the introduced modified immune cell(s) or γδ T cell(s).
50. The method of any one of claims 46-49, wherein the host organism is human, and the method is a method of treating cancer in a subject in need thereof.51 . Use of the affinity binding entity of any one of claims 1 -5, the modified immune cell(s) of any one of claims 32-38, the γδ T cell(s) of any one of claims 30-31, 35-38, the ADC of claim 42, or the pharmaceutical composition of any one of claims 43-45, in the preparation of a medicament for the treatment of cancer.c23 / 5140 / 5142 / 5143 / 5144 / 5150 / 51