Compounds and methods for reducing mecp2 expression

Abstract

Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of methyl CpG binding protein 2 (MECP2) RNA in a cell or animal, and in certain instances reducing the amount of MECP2 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodevelopmental disease or disorder associated with MECP2. Such neurodevelopmental diseases or disorders include MECP2 duplication syndrome. Such symptoms or hallmarks include autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recunent respiratory tract infections, epileptic encephalopathy, and early death.

Description

[0001] COMPOUNDS AND METHODS FOR REDUCING MECP2 EXPRESSION Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0428SEQ.xml, created on September 13, 2023, which is 2,195 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of methyl CpG binding protein 2 (MECP2) RNA in a cell or animal, and in certain instances, reducing MECP2 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include MECP2 duplication syndrome. Such symptoms or hallmarks include autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. Background Methyl CpG binding protein 2 (MECP2) is located on chromosome Xq28 and plays a fundamental role in epigenetics, controlling chromatin states, and expression of thousands of genes (Chahrour et al., Science, 2008, 320:1224-1229; Nan et al., Nature, 1998, 393:386-389; Jones et al., Nat. Genet., 1998, 19:187-191). MECP2 duplication syndrome caused by overexpression of MECP2 is characterized by autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death, typically in males (Ramocki et al., Am J Med Genet A, 2010, 152A:1079-1088). Currently there is a lack of acceptable options for treating such neurological disorders. It is therefore an object herein to provide compounds and pharmaceutical compositions for the treatment of such diseases and disorders. Summary Oligomeric agents, oligomeric compounds, and pharmaceutical compositions of certain embodiments described herein are useful for reducing or inhibiting MECP2 expression in a cell or animal. In certain embodiments, MECP2 RNA or protein levels can be reduced in a cell or animal. Also provided are methods of treating MECP2 Duplication Syndrome. Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included” is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, ENSEMBL, and NCBI reference sequence records, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety. DEFINITIONS Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety. Unless otherwise indicated, the following terms have the following meanings: As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). As used herein, “2’-MOE” means a OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-MOE sugar moiety” or a “2’-O-methoxyethyl sugar moiety” or “2’-MOE ribosyl sugar moiety” means a sugar moiety with a OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the β-D-ribosyl configuration. “MOE” means O-methoxyethyl. As used herein, “2’-MOE nucleoside” means a nucleoside comprising a 2’-MOE sugar moiety. As used herein, “2’-OMe” means a 2’-OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-O-methyl sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH3group in place of the 2’- OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the β-D-ribosyl configuration. As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety. As used herein, “2’-F” means a 2’-fluoro group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’- F sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the β-D ribosyl stereochemical configuration. As used herein, “2’-F nucleoside” means a nucleoside comprising a 2’-F sugar moiety. As used herein “2’-NMA” means a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2-NMA sugar moiety” or “2'-O-[2-(methylamino)-2-oxoethyl] sugar moiety” means a sugar moiety with a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. “2’-NMA sugar moiety” means the sugar moiety of a 2’-NMA nucleoside. As used herein, “2’-substituted nucleoside” means a nucleoside comprising a 2’-substituted furanosyl sugar moiety. As used herein, “2’-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2'- substituent group other than H or OH. As used herein, “3’ target site” refers to the 3’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid. As used herein, “5’ target site” refers to the 5’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase. As used herein, “abasic sugar moiety” means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.” As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark. In certain embodiments, the symptom or hallmark is one or more of autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety. Examples of bicyclic sugar moieties include LNA (locked nucleic acid) sugar moiety and cEt sugar moiety as defined herein. As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex formed by two oligonucleotides mean that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt. As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that is capable of binding to a particular cell type or particular cell types. As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. As used herein, “chirally controlled” in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration. As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human. As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. “Complementary region” in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases mean nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise. For example, inosine can pair, but is not considered complementary, with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length. As used herein, “complementary region” in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid. As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that modifies one or more properties of a molecule compared to the identical molecule lacking the conjugate moiety, wherein such properties include, but are not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon of the β- D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a β-D-2’-deoxyribosyl sugar moiety. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap of a gapmer. As used herein, “diluent” means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution. As used herein, “double-stranded” in reference to a region or an oligonucleotide, means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure). As used herein, “duplex” or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another. As used herein, “gapmer” means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, the internal region is a “deoxy region”. In certain embodiments, each nucleoside of the gap is a 2’-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’-β-D-deoxynucleosides and wings comprising 2’-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications. As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, modified oligonucleotide, antisense compound, or antisense agent. As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target. As used herein, “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. As used herein, “inverted nucleoside” means a nucleotide having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage, as shown herein. As used herein, “inverted sugar moiety” means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage. As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide. As used herein, “mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions. As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification. As used herein, “the nucleobase sequence of” a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO. As used herein, “nucleoside” means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “oligomeric agent” means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds. As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.” As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide or it may be unpaired. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double- stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide. As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid. As used herein “pharmaceutically acceptable salt(s)” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines. As used herein, “population” means a plurality of molecules of identical molecular formula. As used herein, “prodrug” means an inactive or less active form of a compound which, when administered to a subject, is metabolized to form the active, or more active, compound. In certain embodiments, a prodrug comprises a cell-targeting moiety and at least one active compound. As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are single- stranded. In certain embodiments, RNase H agents are double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2. As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H- mediated nucleic acid reduction. As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mediated nucleic acid reduction. As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. As used herein, “single-stranded” means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. As used herein, “stabilized phosphate group” refers to a 5’-chemical moiety that results in stabilization of a 5’- phosphate moiety of the 5’-terminal nucleoside of an oligonucleotide, relative to the stability of an unmodified 5’- phosphate of an unmodified nucleoside under biologic conditions. Such stabilization of a 5’-phosphate group includes but is not limited to resistance to removal by phosphatases. Stabilized phosphate groups include, but are not limited to, 5’-vinyl phosphonates and 5’-cyclopropyl phosphonate. As used herein, “standard cell assay” means the in vitro assays described in Examples 1 and 2 and reasonable variations thereof. As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. In certain embodiments, a stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoroamidate internucleoside linkage. As used herein, “subject” means a human or non-human animal. The terms “subject”, “animal”, and “individual” are used interchangeably. In certain embodiments, the subject is human. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2’-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide, but which is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluoro hexitol nucleic acid), morpholino, and other structures described herein and known in the art. As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. In certain embodiments, a hallmark is apparent on a brain MRI scan. In certain embodiments, symptoms and hallmarks include autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified. As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize. As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. As used herein, “treating” means improving a subject’s disease or condition by administering an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom. As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease. As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. In certain embodiments, antisense activity is the modulation of splicing of a target pre-mRNA. As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound. As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group. As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group. As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides. As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. CERTAIN EMBODIMENTS The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a MECP2 nucleic acid, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. Embodiment 2. The oligomeric compound of embodiment 1, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340. Embodiment 3. The oligomeric compound of embodiment 1 or embodiment 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 10858-10885, 11534-11588, 11597-11620, 12936-12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941-18975, 19046-19091, 20216-20271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202 of SEQ ID NO: 1. Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32588-32671 of SEQ ID NO: 1. Embodiment 5. The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32611-32630 of SEQ ID NO: 1. Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the MECP2 nucleic acid. Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 18-2339, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar and a modified internucleoside linkage. Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 18-2339. Embodiment 9. The oligomeric compound of embodiment 7 or embodiment 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 18-2339. Embodiment 10. The oligomeric compound of any of embodiments 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of` SEQ ID NOs: 18-2335. Embodiment 11. The oligomeric compound of any of embodiments 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 2336- 2339. Embodiment 12. The oligomeric compound of any of embodiments 7-10, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1197. Embodiment 13. The oligomeric compound of any of embodiments 7-10, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 1197. Embodiment 14. The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340. Embodiment 15. The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. Embodiment 16. The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide consists of 18 linked nucleosides. Embodiment 17. The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide consists of 20 linked nucleosides. Embodiment 18. The oligomeric compound of any of embodiments 1-17, wherein the modified oligonucleotide comprises at least one modified nucleoside. Embodiment 19. The oligomeric compound of embodiment 18, wherein the at least one modified nucleoside comprises a modified sugar moiety. Embodiment 20. The oligomeric compound of embodiment 19, wherein the modified sugar moiety comprises a bicyclic sugar moiety. Embodiment 21. The oligomeric compound of embodiment 20, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-. Embodiment 22. The oligomeric compound of embodiment 19, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety. Embodiment 23. The oligomeric compound of embodiment 22, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-OMe sugar moiety. Embodiment 24. The oligomeric compound of any of embodiments 1-23, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate. Embodiment 25. The oligomeric compound of embodiment 24, wherein the sugar surrogate is a morpholino or a PNA. Embodiment 26. The oligomeric compound of any of embodiments 1-25, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. Embodiment 27. The oligomeric compound of embodiment 26, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 28. The oligomeric compound of embodiment 26, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage. Embodiment 29. The oligomeric compound of embodiment 26 or embodiment 27, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage. Embodiment 30. The oligomeric compound of any of embodiments 26 or 28-29, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage. Embodiment 31. The oligomeric compound of any of embodiments 26 or 28-30, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. Embodiment 32. The oligomeric compound of any of embodiments 26-28 or 30-31, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. Embodiment 33. The oligomeric compound of any of embodiments 26 or 28-31, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from 5’-soooossssssssssooss-3’ and 5’- sooosssssssssooss -3’; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. Embodiment 34. The oligomeric compound of any of embodiments 1-33, wherein the modified oligonucleotide comprises at least one modified nucleobase. Embodiment 35. The oligomeric compound of embodiment 34, wherein the modified nucleobase is 5- methylcytosine. Embodiment 36. The oligomeric compound of embodiment 35, wherein each cytosine is a 5-methylcytosine. Embodiment 37. The oligomeric compound of any of embodiments 1-36, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-20, 18- 22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof. Embodiment 38. The oligomeric compound of any of embodiments 1-37, wherein the modified oligonucleotide comprises a deoxy region. Embodiment 39. The oligomeric compound of embodiment 38, wherein each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. Embodiment 40. The oligomeric compound of embodiment 38 or embodiment 39, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. Embodiment 41. The oligomeric compound of any of embodiments 38-40, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. Embodiment 42. The oligomeric compound of any of embodiments 38-41, wherein the deoxy region is flanked on the 5’-side by a 5’-external region consisting of 1-6 linked 5’-external region nucleosides and on the 3’-side by a 3’- external region consisting of 1-6 linked 3’-external region nucleosides; wherein the 3’-most nucleoside of the 5’ external region nucleosides comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ external region nucleosides comprises a modified sugar moiety. Embodiment 43. The oligomeric compound of embodiment 41 or embodiment 42, wherein each of the 3’ external region nucleosides comprises a modified sugar moiety. Embodiment 44. The oligomeric compound of embodiment 43, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3’ external region consisting of 5 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside. Embodiment 45. The oligomeric compound of embodiment 42 or embodiment 43, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked 5’-external region nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3’ external region consisting of 5 linked 3’-external region nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside. Embodiment 46. The oligomeric compound of embodiment 42 or embodiment 43, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ external -region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’ external region consisting of 1-6 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a cEt nucleoside or a 2’-MOE nucleoside, and each of the deoxy region nucleosides is a 2’-β-D-deoxynucleoside. Embodiment 47. The oligomeric compound of any of embodiments 1-46, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from eeeeeddddddddddeeeee and eeeeeddddddddeeeee, wherein T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage. Embodiment 49. The oligomeric compound of any of embodiments 1-48, consisting of the modified oligonucleotide. Embodiment 50. The oligomeric compound of any of embodiments 1-48, wherein the oligomeric compound comprises a conjugate group. Embodiment 51. The oligomeric compound of embodiment 50, wherein the conjugate group comprises a conjugate linker and a conjugate moiety. Embodiment 52. The oligomeric compound of embodiment 51, wherein the conjugate linker consists of a single bond. Embodiment 53. The oligomeric compound of any of embodiments 51-52, wherein the conjugate linker is cleavable. Embodiment 54. The oligomeric compound of embodiment 51 or embodiment 53, wherein the conjugate linker comprises 1-3 linker-nucleosides. Embodiment 55. The oligomeric compound of any of embodiments 51-53, wherein the conjugate linker does not comprise any linker nucleosides. Embodiment 56. The oligomeric compound of any of embodiments 50-55, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide. Embodiment 57. The oligomeric compound of any of embodiments 50-55, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide. Embodiment 58. The oligomeric compound of any of embodiments 1 to 57, wherein the oligomeric compound comprises a terminal group. Embodiment 59. The oligomeric compound of embodiment 58, wherein the terminal group is an abasic sugar moiety. Embodiment 60. The oligomeric compound of any of embodiments 1-59, wherein the oligomeric compound is a singled-stranded oligomeric compound. Embodiment 61. A modified oligonucleotide according to the following chemical structure:

[0002] (SEQ ID NO: 2341), or a pharmaceutically acceptable salt thereof. Embodiment 62. The modified oligonucleotide of embodiment 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium. Embodiment 63. The modified oligonucleotide of embodiment 61, which is the sodium salt or the potassium salt. Embodiment 64. A modified oligonucleotide according to the following chemical structure:

[0003] (SEQ ID NO: 2341), or a pharmaceutically acceptable salt thereof. Embodiment 65. A chirally enriched population of oligomeric compounds of any of embodiments 1-60 or a chirally enriched population of modified oligonucleotides of any of embodiments 61-64, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. Embodiment 66. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration. Embodiment 67. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. Embodiment 68. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. Embodiment 69. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction. Embodiment 70. A population of oligomeric compounds of any of embodiments 1-60 or a population of modified oligonucleotides of any of embodiments 61-64, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. Embodiment 71. An oligomeric duplex, comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-60. Embodiment 72. The oligomeric duplex of embodiment 71, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. Embodiment 73. The oligomeric duplex of any of embodiments 71-72, wherein the first modified oligonucleotide comprises a 5’-stabilized phosphate group. Embodiment 74. The oligomeric duplex of embodiment 73, wherein the 5’-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate. Embodiment 75. The oligomeric duplex of any of embodiments 71-74, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate. Embodiment 76. The oligomeric duplex of any of embodiments 71-74, wherein the first modified oligonucleotide comprises a 2’-NMA sugar moiety. Embodiment 77. The oligomeric duplex of any of embodiments 71-76, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety. Embodiment 78. The oligomeric duplex of embodiment 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. Embodiment 79. The oligomeric duplex of embodiment 78, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-. Embodiment 80. The oligomeric duplex of embodiment 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety. Embodiment 81. The oligomeric duplex of embodiment 80, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-OMe sugar moiety. Embodiment 82. The oligomeric duplex of any of embodiments 71-81, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. Embodiment 83. The oligomeric duplex of any of embodiments 71-82, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage. Embodiment 84. The oligomeric duplex of embodiment 83, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 85. The oligomeric duplex of any of embodiments 71-84, wherein at least one internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage. Embodiment 86. The oligomeric duplex of any of embodiments 71-85, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage. Embodiment 87. The oligomeric duplex of any of embodiments 71-86, wherein the second modified oligonucleotide comprises at least one modified nucleobase. Embodiment 88. The oligomeric duplex of embodiment 87, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine. Embodiment 89. The oligomeric duplex of any of embodiments 71-88, wherein the second modified oligonucleotide comprises a conjugate group. Embodiment 90. The oligomeric duplex of embodiment 89, wherein the conjugate group comprises a conjugate linker and a conjugate moiety. Embodiment 91. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 5’-end of the second modified oligonucleotide. Embodiment 92. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 3’-end of the second modified oligonucleotide. Embodiment 93. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide. Embodiment 94. The oligomeric duplex of any of embodiments 89-93, wherein the conjugate group comprises a lipid. Embodiment 95. The oligomeric duplex of any of embodiments 71-94, wherein the second modified oligonucleotide comprises a terminal group. Embodiment 96. The oligomeric duplex of embodiment 95, wherein the terminal group is an abasic sugar moiety. Embodiment 97. The oligomeric duplex of any of embodiments 71-96, wherein the second modified oligonucleotide consists of 10 to 25, 10 to 30, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. Embodiment 98. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-60 or the modified oligonucleotide of any of embodiments 61-64. Embodiment 99. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 71-97. Embodiment 100. The antisense agent of embodiment 98 or embodiment 99, wherein the antisense agent is: i. an RNase H agent capable of reducing the amount of MECP2 nucleic acid through the activation of RNase H; or ii. an RNAi agent capable of reducing the amount of MECP2 nucleic acid through the activation of RISC / Ago2. Embodiment 101. The antisense agent of any of embodiments 98-100, wherein the antisense agent comprises a conjugate group, wherein the conjugate group is a cell-targeting moiety. Embodiment 102. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61-64, a population of any of embodiments 65-70, an oligomeric duplex of any of embodiments 71-97, or an antisense agent of any of embodiments 98-101, and a pharmaceutically acceptable diluent. Embodiment 103. The pharmaceutical composition of embodiment 102, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline or artificial cerebrospinal fluid. Embodiment 104. The pharmaceutical composition of embodiment 103, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent and the phosphate-buffered saline or the artificial cerebrospinal fluid. Embodiment 105. A method comprising administering to a subject an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61-64, a population of any of embodiments 65- 70, an oligomeric duplex of any of embodiments 71-97, an antisense agent of any of embodiments 98-101, or a pharmaceutical composition of any of embodiments 102-104. Embodiment 106. The method of embodiment 105, wherein the subject has a disease or disorder associated with MECP2. Embodiment 107. The method of embodiment 106, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder. Embodiment 108. The method of embodiment 105 or embodiment 106, wherein the disease or disorder associated with MECP2 is MECP2 Duplication Syndrome. Embodiment 109. A method of treating a disease or disorder associated with MECP2 comprising administering to a subject having or at risk for developing a disease or disorder associated with MECP2 a therapeutically effective amount of an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61- 64, a population of any of embodiments 65-70, an oligomeric duplex of any of embodiments 71-97, an antisense agent of any of embodiments 98-101, or a pharmaceutical composition of any of embodiments 102-104; and thereby treating the disease or disorder associated with MECP2. Embodiment 110. The method of embodiment 109, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder. Embodiment 111. The method of embodiment 109 or embodiment 110, wherein the disease or disorder associated with MECP2 is MECP2 Duplication Syndrome. Embodiment 112. The method of any of embodiments 109-111, wherein at least one symptom or hallmark of the disease or disorder associated with MECP2 is ameliorated. Embodiment 113. The method of embodiment 112, wherein the symptom or hallmark is autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, or early death. Embodiment 114. The method of embodiments 109-113, wherein the disease or disorder is associated with an elevated level of MECP2 in the subject. Embodiment 115. The method of any of embodiments 105-114, wherein administering the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disabilities, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in the subject; or improves motor function, motor development, muscle tone, cognitive development, speech, or social skill development in the subject. Embodiment 116. The method of any of embodiments 105-115, wherein the subject is human. Embodiment 117. A method of reducing expression of MECP2 in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61-64, a population of any of embodiments 65-70, an oligomeric duplex of any of embodiments 71-97, an antisense agent of any of embodiments 98-101, or a pharmaceutical composition of any of embodiments 102-104. Embodiment 118. The method of embodiment 117, wherein the cell is a neuron. Embodiment 119. The method of embodiment 117 or embodiment 118, wherein the cell is a human cell. Embodiment 120. Use of an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61-64, a population of any of embodiments 65-70, an oligomeric duplex of any of embodiments 71- 97, an antisense agent of any of embodiments 98-101, or a pharmaceutical composition of any of embodiments 102-104 for treating a disease or disorder associated with MECP2. Embodiment 121. Use of an oligomeric compound of any of embodiments 1-60, a modified oligonucleotide of any of embodiments 61-64, a population of any of embodiments 65-70, an oligomeric duplex of any of embodiments 71- 97, or an antisense agent of any of embodiments 98-101, or a pharmaceutical composition of any of embodiments 102- 104 in the manufacture of a medicament for treating a disease or disorder associated with MECP2. Embodiment 122. The use of embodiment 120 or embodiment 121, wherein the disease or disorder is associated with an elevated level of MECP2. Embodiment 123. The use of any of embodiments 120-122, wherein the disease or disorder is MECP2 duplication syndrome. Certain Oligomeric Agents and Oligomeric Compounds Certain embodiments provide oligomeric agents targeted to a MECP2 nucleic acid. In certain embodiments, the MECP2 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11 truncated from nucleosides 154019001 to 154101000) or SEQ ID NO: 2 (GenBank Accession No. NM_004992.3) or SEQ ID NO: 2340 (the complement of GenBank Accession No. NT_167198.1 truncated from nucleosides 4203000 to 4283000), each of which is incorporated by reference in its entirety. In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is an oligomeric duplex. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a MECP2 nucleic acid, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 2055-2074, 2267-2286, 2321-2340, 2411-2430, 2485- 2504, 2536-2555, 2547-2566, 2553-2572, 2683-2702, 2840-2859, 3060-3079, 3075-3094, 3701-3719, 3703-3722, 4286- 4305, 4302-4321, 4327-4346, 4456-4475, 4482-4501, 4509-4528, 4511-4530, 4531-4550, 4550-4569, 4560-4579, 4574- 4593, 4575-4594, 4659-4678, 4820-4839, 4823-4842, 4825-4844, 4847-4866, 4858-4877, 4876-4895, 4877-4896, 4879- 4898, 4880-4899, 4884-4903, 4941-4960, 4964-4983, 4967-4986, 5044-5063, 5053-5072, 5107-5126, 5173-5192, 5177- 5196, 5213-5232, 5243-5262, 5253-5272, 5263-5282, 5271-5290, 5272-5291, 5273-5292, 5293-5312, 5303-5322, 5310- 5329, 5355-5374, 5363-5382, 5365-5384, 5371-5390, 5539-5558, 5642-5661, 5643-5662, 5644-5663, 5764-5783, 5795- 5814, 5802-5821, 5809-5828, 5844-5863, 5858-5877, 5864-5883, 5871-5890, 5879-5898, 5994-6013, 5995-6014, 6003- 6022, 6036-6055, 6113-6132, 6114-6133, 6115-6134, 6116-6135, 6120-6139, 6130-6149, 6172-6191, 6216-6235, 6229- 6248, 6315-6334, 6363-6382, 6555-6574, 6556-6575, 6557-6576, 6629-6648, 6673-6692, 6674-6693, 6675-6694, 6676- 6695, 6695-6714, 6696-6715, 6697-6716, 6698-6717, 6744-6763, 6747-6766, 6790-6809, 6805-6824, 6806-6825, 6919- 6938, 7066-7085, 7514-7533, 7539-7558, 7545-7564, 7593-7612, 7594-7613, 7595-7614, 7596-7615, 7626-7645, 7629- 7648, 7630-7649, 7631-7650, 7712-7731, 7713-7732, 7723-7742, 7729-7748, 7746-7765, 7777-7796, 7781-7800, 7792- 7811, 7852-7871, 7901-7920, 7902-7921, 7916-7935, 7924-7943, 7926-7945, 7927-7946, 7975-7994, 8036-8055, 8042- 8061, 8043-8062, 8045-8064, 8052-8071, 8054-8073, 8090-8109, 8091-8110, 8115-8134, 8117-8136, 8130-8149, 8131- 8150, 8132-8151, 8146-8165, 8157-8176, 8234-8253, 8272-8291, 8280-8299, 8324-8343, 8325-8344, 8368-8387, 8370- 8389, 8382-8401, 8385-8404, 8386-8405, 8388-8407, 8389-8408, 8391-8410, 8394-8413, 8456-8475, 8466-8485, 8477- 8496, 8478-8497, 8504-8523, 8571-8590, 8573-8592, 8575-8594, 8581-8600, 8629-8648, 8630-8649, 8631-8650, 8632- 8651, 8633-8652, 8690-8709, 8694-8713, 8719-8738, 8721-8740, 8782-8801, 8783-8802, 8784-8803, 8797-8816, 8809- 8828, 8810-8829, 8906-8925, 8927-8946, 8929-8948, 8951-8970, 8952-8971, 8953-8972, 9007-9026, 9008-9027, 9010- 9029, 9012-9031, 9014-9033, 9016-9035, 9123-9142, 9175-9194, 9181-9200, 9185-9204, 9191-9210, 9196-9215, 9213- 9232, 9215-9234, 9227-9246, 9229-9248, 9230-9249, 9238-9257, 9239-9258, 9253-9272, 9266-9285, 9267-9286, 9270- 9289, 9271-9290, 9275-9294, 9308-9327, 9335-9354, 9339-9358, 9341-9360, 9342-9361, 9344-9363, 9369-9388, 9371- 9390, 9372-9391, 9377-9396, 9378-9397, 9390-9409, 9391-9410, 9392-9411, 9424-9443, 9425-9444, 9431-9450, 9457- 9476, 9483-9502, 9494-9513, 9495-9514, 9497-9516, 9516-9535, 9538-9557, 9539-9558, 9636-9655, 9666-9685, 9672- 9691, 9691-9710, 9692-9711, 9699-9718, 9700-9719, 9828-9847, 9829-9848, 9836-9855, 9837-9856, 9838-9857, 9839- 9858, 9843-9862, 9856-9875, 9873-9892, 9901-9920, 9903-9922, 9905-9924, 9907-9926, 9909-9928, 9911-9930, 9939- 9958, 9953-9972, 9967-9986, 9971-9990, 9988-10007, 9989-10008, 9990-10009, 9991-10010, 9994-10013, 9996- 10015, 10049-10068, 10054-10073, 10071-10090, 10081-10100, 10083-10102, 10084-10103, 10088-10107, 10090- 10109, 10091-10110, 10116-10135, 10117-10136, 10118-10137, 10132-10151, 10133-10152, 10134-10153, 10135- 10154, 10238-10257, 10240-10259, 10249-10268, 10250-10269, 10252-10271, 10258-10277, 10281-10300, 10288- 10307, 10290-10309, 10293-10312, 10306-10325, 10338-10357, 10354-10373, 10364-10383, 10366-10385, 10375- 10394, 10378-10397, 10379-10398, 10419-10438, 10456-10475, 10697-10716, 10707-10726, 10854-10873, 10856- 10875, 10857-10876, 10858-10877, 10859-10878, 10860-10879, 10861-10880, 10862-10881, 10863-10882, 10864- 10883, 10866-10885, 10869-10888, 10909-10928, 10919-10938, 10929-10948, 10959-10978, 11305-11324, 11390- 11409, 11402-11421, 11435-11454, 11437-11456, 11452-11471, 11455-11474, 11467-11486, 11475-11494, 11477- 11496, 11478-11497, 11479-11498, 11485-11504, 11495-11514, 11497-11516, 11499-11518, 11500-11519, 11505- 11524, 11507-11526, 11508-11527, 11534-11553, 11535-11554, 11539-11558, 11540-11559, 11556-11575, 11565- 11584, 11567-11586, 11568-11587, 11569-11588, 11570-11589, 11571-11590, 11574-11593, 11578-11597, 11589- 11608, 11597-11616, 11598-11617, 11599-11618, 11600-11619, 11601-11620, 11605-11624, 11607-11626, 11609- 11628, 11615-11634, 11617-11636, 11618-11637, 11619-11638, 11629-11648, 11633-11652, 11635-11654, 11636- 11655, 11638-11657, 11641-11660, 11647-11666, 11648-11667, 11657-11676, 11658-11677, 11659-11678, 11667- 11686, 11744-11763, 12563-12582, 12587-12606, 12617-12636, 12618-12637, 12620-12639, 12621-12640, 12644- 12663, 12657-12676, 12715-12734, 12836-12855, 12877-12896, 12878-12897, 12909-12928, 12914-12933, 12915- 12934, 12936-12955, 12937-12956, 12940-12959, 12941-12960, 12943-12962, 12952-12971, 12971-12990, 12997- 13016, 13025-13044, 13027-13046, 13028-13047, 13041-13060, 13055-13074, 13056-13075, 13171-13190, 13172- 13191, 13229-13248, 13246-13265, 13247-13266, 13248-13267, 13249-13268, 13374-13393, 13488-13507, 13490- 13509, 13503-13522, 13529-13548, 13549-13568, 13559-13578, 13582-13601, 13594-13613, 13596-13615, 13597- 13616, 13598-13617, 13599-13618, 13600-13619, 13601-13620, 13602-13621, 13604-13623, 13612-13631, 13619- 13638, 13622-13641, 13629-13648, 13632-13651, 13639-13658, 13649-13668, 13662-13681, 13667-13686, 13669- 13688, 13670-13689, 13671-13690, 13672-13691, 13679-13698, 13689-13708, 13690-13709, 13691-13710, 13692- 13711, 13699-13718, 13702-13721, 14337-14356, 14339-14358, 14342-14361, 14393-14412, 14716-14735, 14717- 14736, 14718-14737, 14719-14738, 14720-14739, 14722-14741, 14724-14743, 14725-14744, 14726-14745, 14727- 14746, 14728-14747, 14729-14748, 14731-14750, 14734-14753, 14764-14783, 14766-14785, 15192-15211, 15600- 15619, 15827-15846, 15854-15873, 15855-15874, 15859-15878, 15883-15902, 15884-15903, 15885-15904, 15886- 15905, 15892-15911, 15895-15914, 15896-15915, 15901-15920, 15902-15921, 15904-15923, 15971-15990, 15988- 16007, 16004-16023, 16039-16058, 16048-16067, 16082-16101, 16110-16129, 16112-16131, 16113-16132, 16115- 16134, 16116-16135, 16165-16184, 16227-16246, 16228-16247, 16229-16248, 16230-16249, 16236-16255, 16242- 16261, 16248-16267, 16250-16269, 16263-16282, 16264-16283, 16277-16296, 16287-16306, 16307-16326, 16317- 16336, 16330-16349, 16337-16356, 16357-16376, 16359-16378, 16362-16381, 16373-16392, 16374-16393, 16375- 16394, 16377-16396, 16397-16416, 16402-16421, 16408-16427, 16409-16428, 16411-16430, 16425-16444, 16426- 16445, 16428-16447, 16431-16450, 16437-16456, 16439-16458, 16445-16464, 16447-16466, 16457-16476, 16459- 16478, 16469-16488, 16470-16489, 16487-16506, 16499-16518, 16554-16573, 16555-16574, 16562-16581, 16565- 16584, 16567-16586, 16588-16607, 16589-16608, 16590-16609, 16591-16610, 16606-16625, 16608-16627, 16615- 16634, 16625-16644, 16632-16651, 16635-16654, 16636-16655, 16656-16675, 16729-16748, 17271-17290, 17342- 17361, 17348-17367, 17362-17381, 17443-17462, 17449-17468, 17450-17469, 17457-17476, 17459-17478, 17683- 17702, 17693-17712, 17703-17722, 17720-17739, 17723-17742, 17733-17752, 17743-17762, 17757-17776, 17768- 17787, 17771-17790, 17772-17791, 17773-17792, 17775-17794, 17818-17837, 17894-17913, 17911-17930, 17912- 17931, 17914-17933, 17942-17961, 17945-17964, 17955-17974, 17959-17978, 17993-18012, 18008-18027, 18009- 18028, 18028-18047, 18043-18062, 18053-18072, 18065-18084, 18068-18087, 18073-18092, 18075-18094, 18077- 18096, 18079-18098, 18080-18099, 18081-18100, 18082-18101, 18083-18102, 18084-18103, 18085-18104, 18086- 18105, 18093-18112, 18113-18132, 18117-18136, 18120-18139, 18143-18162, 18183-18202, 18203-18222, 18248- 18267, 18289-18308, 18291-18310, 18293-18312, 18304-18323, 18306-18325, 18307-18326, 18366-18385, 18367- 18386, 18372-18391, 18736-18755, 18738-18757, 18740-18759, 18741-18760, 18742-18761, 18743-18762, 18744- 18763, 18753-18772, 18758-18777, 18768-18787, 18778-18797, 18788-18807, 18798-18817, 18808-18827, 18828- 18847, 18848-18867, 18851-18870, 18871-18890, 18873-18892, 18881-18900, 18885-18904, 18886-18905, 18887- 18906, 18901-18920, 18911-18930, 18921-18940, 18941-18960, 18946-18965, 18949-18968, 18951-18970, 18952- 18971, 18954-18973, 18956-18975, 18961-18980, 18962-18981, 18963-18982, 18965-18984, 18980-18999, 18981- 19000, 19001-19020, 19016-19035, 19021-19040, 19026-19045, 19032-19051, 19036-19055, 19046-19065, 19048- 19067, 19049-19068, 19051-19070, 19052-19071, 19054-19073, 19056-19075, 19060-19079, 19062-19081, 19064- 19083, 19066-19085, 19072-19091, 19082-19101, 19086-19105, 19091-19110, 19092-19111, 19093-19112, 19094- 19113, 19095-19114, 19096-19115, 19097-19116, 19098-19117, 19099-19118, 19101-19120, 19106-19125, 19112- 19131, 19115-19134, 19116-19135, 19122-19141, 19125-19144, 19126-19145, 19127-19146, 19128-19147, 19129- 19148, 19131-19150, 19132-19151, 19133-19152, 19138-19157, 19148-19167, 19152-19171, 19154-19173, 19158- 19177, 19165-19184, 19166-19185, 19176-19195, 19178-19197, 19192-19211, 19205-19224, 19208-19227, 19210- 19229, 19212-19231, 19213-19232, 19214-19233, 19215-19234, 19217-19236, 19218-19237, 19220-19239, 19221- 19240, 19224-19243, 19225-19244, 19228-19247, 19232-19251, 19235-19254, 19237-19256, 19238-19257, 19239- 19258, 19240-19259, 19241-19260, 19242-19261, 19243-19262, 19244-19263, 19247-19266, 19248-19267, 19249- 19268, 19251-19270, 19252-19271, 19253-19272, 19254-19273, 19256-19275, 19257-19276, 19258-19277, 19387- 19406, 19388-19407, 19389-19408, 19390-19409, 19393-19412, 19398-19417, 19408-19427, 19458-19477, 19468- 19487, 20039-20058, 20041-20060, 20054-20073, 20059-20078, 20064-20083, 20093-20112, 20096-20115, 20100- 20119, 20121-20140, 20131-20150, 20141-20160, 20151-20170, 20211-20230, 20216-20235, 20220-20239, 20221- 20240, 20222-20241, 20224-20243, 20226-20245, 20231-20250, 20251-20270, 20252-20271, 20261-20280, 20262- 20281, 20282-20301, 20291-20310, 20318-20337, 20320-20339, 20321-20340, 20324-20343, 20327-20346, 20337- 20356, 20340-20359, 20341-20360, 20342-20361, 20343-20362, 20344-20363, 20345-20364, 20347-20366, 20352- 20371, 20362-20381, 20390-20409, 20391-20410, 20393-20412, 20402-20421, 20412-20431, 20414-20433, 20539- 20558, 20583-20602, 20586-20605, 20594-20613, 20606-20625, 20616-20635, 20646-20665, 20656-20675, 20670- 20689, 20671-20690, 20675-20694, 20676-20695, 20677-20696, 20679-20698, 20706-20725, 20716-20735, 20726- 20745, 20741-20760, 20746-20765, 21082-21101, 21084-21103, 21086-21105, 21105-21124, 21448-21467, 21458- 21477, 21468-21487, 21478-21497, 21479-21498, 21498-21517, 21499-21518, 21503-21522, 21505-21524, 21506- 21525, 21507-21526, 21508-21527, 21509-21528, 21510-21529, 21511-21530, 21513-21532, 21528-21547, 21529- 21548, 21538-21557, 21539-21558, 21543-21562, 21558-21577, 21559-21578, 21564-21583, 21566-21585, 21567- 21586, 21569-21588, 21915-21934, 21916-21935, 21925-21944, 21926-21945, 21935-21954, 21945-21964, 21946- 21965, 21948-21967, 21951-21970, 21953-21972, 21954-21973, 21955-21974, 21956-21975, 21957-21976, 21959- 21978, 21960-21979, 21961-21980, 21962-21981, 21963-21982, 21964-21983, 21965-21984, 21966-21985, 21967- 21986, 21968-21987, 21970-21989, 21976-21995, 21985-22004, 21995-22014, 21996-22015, 22005-22024, 22006- 22025, 22016-22035, 22020-22039, 22042-22061, 22055-22074, 22056-22075, 22065-22084, 22094-22113, 22130- 22149, 22208-22227, 22237-22256, 22285-22304, 22349-22368, 23004-23023, 23043-23062, 23044-23063, 23579- 23598, 23589-23608, 23659-23678, 23662-23681, 23663-23682, 23664-23683, 23665-23684, 23666-23685, 23679- 23698, 23687-23706, 23689-23708, 23690-23709, 23691-23710, 23692-23711, 23693-23712, 23694-23713, 23739- 23758, 23749-23768, 23753-23772, 23769-23788, 23779-23798, 23863-23882, 23865-23884, 23867-23886, 23870- 23889, 23872-23891, 23974-23993, 23975-23994, 24004-24023, 24005-24024, 24021-24040, 24029-24048, 24032- 24051, 24045-24064, 24052-24071, 24061-24080, 24062-24081, 24063-24082, 24064-24083, 24065-24084, 24067- 24086, 24129-24148, 24132-24151, 24150-24169, 24151-24170, 24152-24171, 24159-24178, 24161-24180, 24162- 24181, 24165-24184, 24169-24188, 24225-24244, 24226-24245, 24227-24246, 24229-24248, 24231-24250, 24233- 24252, 24234-24253, 24236-24255, 24241-24260, 24261-24280, 24271-24290, 24293-24312, 24299-24318, 24358- 24377, 24368-24387, 24375-24394, 24378-24397, 24408-24427, 24423-24442, 24427-24446, 24428-24447, 24431- 24450, 24528-24547, 24531-24550, 24548-24567, 24550-24569, 24552-24571, 24553-24572, 24557-24576, 24590- 24609, 24591-24610, 24693-24712, 24704-24723, 24708-24727, 24709-24728, 24710-24729, 24711-24730, 24731- 24750, 24741-24760, 24751-24770, 24752-24771, 24781-24800, 24783-24802, 24791-24810, 24801-24820, 24811- 24830, 24814-24833, 24861-24880, 24871-24890, 24873-24892, 24882-24901, 24883-24902, 24901-24920, 24902- 24921, 24903-24922, 24911-24930, 24912-24931, 24913-24932, 24922-24941, 24923-24942, 24932-24951, 24942- 24961, 24943-24962, 24952-24971, 24953-24972, 24955-24974, 24968-24987, 24970-24989, 24971-24990, 24972- 24991, 24973-24992, 24974-24993, 24975-24994, 24976-24995, 24977-24996, 24980-24999, 24981-25000, 24982- 25001, 24983-25002, 24984-25003, 24985-25004, 24987-25006, 25013-25032, 25355-25374, 25385-25404, 25395- 25414, 25445-25464, 25450-25469, 25452-25471, 25453-25472, 25455-25474, 25456-25475, 25458-25477, 25475- 25494, 25494-25513, 25495-25514, 25535-25554, 25545-25564, 25567-25586, 25580-25599, 25600-25619, 25602- 25621, 25728-25747, 25899-25918, 26032-26051, 26034-26053, 26079-26098, 26092-26111, 26093-26112, 26095- 26114, 26104-26123, 26110-26129, 26111-26130, 26112-26131, 26113-26132, 26114-26133, 26115-26134, 26116- 26135, 26117-26136, 26181-26200, 26215-26234, 26217-26236, 26230-26249, 26268-26287, 26320-26339, 26323- 26342, 26324-26343, 26325-26342, 26327-26346, 26433-26452, 26435-26454, 26544-26563, 26555-26574, 26571- 26590, 26583-26602, 26620-26639, 26627-26646, 26628-26647, 26633-26652, 26766-26785, 26768-26787, 26827- 26846, 26991-27010, 27449-27468, 27503-27522, 27507-27526, 27509-27528, 27525-27544, 27537-27556, 27555- 27574, 27557-27576, 27565-27584, 27567-27586, 27577-27596, 27585-27604, 27595-27614, 27604-27623, 27605- 27624, 27607-27626, 27608-27627, 27610-27629, 27612-27631, 27614-27633, 27615-27634, 27647-27666, 27655- 27674, 27657-27676, 27665-27684, 27677-27696, 27687-27706, 27695-27714, 27715-27734, 27804-27823, 28177- 28196, 28269-28288, 28280-28299, 28283-28302, 28460-28479, 28465-28484, 28483-28502, 28488-28507, 28496- 28515, 28497-28516, 28502-28521, 28509-28528, 28528-28547, 28529-28548, 28544-28563, 28550-28569, 28626- 28645, 28636-28655, 28688-28707, 28691-28710, 28701-28720, 28709-28728, 28710-28729, 28711-28730, 28731- 28750, 28751-28770, 28761-28780, 28774-28793, 28786-28805, 28790-28809, 28791-28810, 28796-28815, 28811- 28830, 28814-28833, 28851-28870, 28861-28880, 28871-28890, 28881-28900, 28889-28908, 28924-28943, 28952- 28971, 28983-29002, 28993-29012, 29001-29020, 29002-29021, 29003-29022, 29013-29032, 29023-29042, 29043- 29062, 29080-29099, 29081-29100, 29082-29101, 29083-29102, 29084-29103, 29085-29104, 29088-29107, 29123- 29142, 29143-29162, 29153-29172, 29163-29182, 29183-29202, 29243-29262, 29260-29279, 29296-29315, 29478- 29497, 29999-30018, 30020-30039, 30023-30042, 30174-30193, 30219-30238, 30522-30541, 30542-30561, 30602- 30621, 30617-30636, 30622-30641, 30623-30642, 30624-30643, 30625-30644, 30630-30649, 30632-30651, 30702- 30721, 31466-31485, 31534-31553, 31535-31554, 31544-31563, 31623-31642, 31673-31692, 31688-31707, 31689- 31708, 31690-31709, 31708-31727, 31709-31728, 31746-31765, 31747-31766, 31814-31833, 32013-32032, 32019- 32038, 32127-32146, 32128-32147, 32129-32148, 32130-32149, 32131-32150, 32133-32152, 32133-32152, 32133- 32150, 32134-32151, 32135-32154, 32135-32152, 32136-32155, 32138-32157, 32143-32162, 32145-32164, 32163- 32182, 32203-32222, 32205-32224, 32213-32232, 32223-32242, 32224-32243, 32230-32249, 32235-32254, 32236- 32255, 32237-32256, 32239-32258, 32241-32260, 32243-32262, 32244-32263, 32283-32302, 32284-32303, 32285- 32304, 32286-32305, 32290-32309, 32300-32319, 32307-32326, 32309-32328, 32312-32331, 32313-32332, 32314- 32333, 32316-32335, 32318-32337, 32320-32339, 32350-32369, 32360-32379, 32362-32381, 32368-32387, 32369- 32388, 32370-32389, 32372-32391, 32373-32392, 32380-32399, 32385-32404, 32387-32406, 32388-32407, 32390- 32409, 32391-32410, 32392-32411, 32393-32412, 32395-32414, 32410-32429, 32420-32439, 32430-32449, 32440- 32459, 32447-32466, 32450-32469, 32460-32479, 32470-32489, 32480-32499, 32483-32502, 32484-32503, 32485- 32504, 32489-32508, 32490-32509, 32491-32510, 32499-32518, 32501-32520, 32521-32540, 32531-32550, 32541- 32560, 32546-32565, 32548-32567, 32550-32569, 32551-32570, 32556-32575, 32560-32579, 32561-32580, 32562- 32581, 32571-32590, 32576-32595, 32580-32599, 32581-32600, 32582-32601, 32588-32607, 32589-32608, 32590- 32609, 32591-32610, 32592-32611, 32593-32612, 32594-32613, 32596-32615, 32606-32625, 32611-32630, 32612- 32631, 32613-32632, 32614-32633, 32616-32635, 32620-32639, 32630-32649, 32645-32664, 32646-32665, 32648- 32667, 32649-32668, 32650-32669, 32651-32670, 32652-32671, 32653-32672, 32654-32673, 32655-32674, 32656- 32675, 32661-32680, 32666-32685, 32672-32691, 32679-32698, 32680-32699, 32681-32700, 32686-32705, 32691- 32710, 32692-32711, 32700-32719, 32702-32721, 32712-32731, 32716-32735, 32720-32739, 32722-32741, 32726- 32745, 32740-32759, 32746-32765, 32752-32771, 32782-32801, 32785-32804, 33090-33109, 33093-33112, 33110- 33129, 33128-33147, 33130-33149, 33132-33151, 33133-33152, 33136-33155, 33138-33157, 33140-33159, 33142- 33161, 33143-33162, 33144-33163, 33145-33164, 33146-33165, 33148-33167, 33149-33168, 33150-33169, 33151- 33170, 33152-33171, 33153-33172, 33155-33174, 33163-33182, 33170-33189, 33171-33190, 33173-33192, 33183- 33202, 33193-33212, 33205-33224, 33223-33242, 33224-33243, 33225-33244, 33228-33247, 33230-33249, 33233- 33252, 33250-33269, 33255-33274, 33256-33275, 33257-33276, 33350-33369, 33642-33661, 33644-33663, 33646- 33665, 33648-33667, 33649-33668, 33650-33669, 33652-33671, 33653-33672, 33656-33675, 33662-33681, 33676- 33695, 33686-33705, 33691-33710, 33708-33727, 33716-33735, 33718-33737, 33736-33755, 33887-33906, 33888- 33907, 33973-33992, 34024-34043, 34042-34061, 34476-34495, 34484-34503, 34490-34509, 34491-34510, 34572- 34591, 34600-34619, 34608-34627, 34612-34631, 34675-34694, 34679-34698, 35038-35057, 35048-35067, 35056- 35075, 35076-35095, 35082-35101, 35086-35105, 35106-35125, 35116-35135, 35126-35145, 35135-35154, 35136- 35155, 35137-35156, 35138-35157, 35139-35158, 35176-35195, 35596-35615, 35768-35787, 35867-35886, 35968- 35987, 36285-36304, 36341-36360, 36383-36402, 36393-36412, 36403-36422, 36409-36428, 36410-36429, 36413- 36432, 36443-36462, 36444-36463, 36446-36465, 36457-36476, 36463-36482, 36473-36492, 36480-36499, 36481- 36500, 36482-36501, 36483-36502, 36488-36507, 36513-36532, 36514-36533, 36515-36534, 36516-36535, 36518- 36537, 36521-36540, 36542-36561, 36553-36572, 36573-36592, 36583-36602, 36678-36697, 36801-36820, 36860- 36879, 36904-36923, 36935-36954, 36937-36956, 36994-37013, 37240-37259, 37346-37365, 37415-37434, 37425- 37444, 37433-37452, 37455-37474, 37475-37494, 37485-37504, 37490-37509, 37492-37511, 37494-37513, 37495- 37514, 37496-37515, 37497-37516, 37498-37517, 37500-37519, 37505-37524, 37515-37534, 37557-37576, 37575- 37594, 37605-37624, 37611-37630, 37729-37748, 38088-38107, 38461-38480, 38605-38624, 38824-38843, 38953- 38972, 38981-39000, 39153-39172, 39294-39313, 39518-39537, 39522-39541, 39523-39542, 39646-39665, 39860- 39879, 40096-40115, 40122-40141, 40148-40167, 40224-40243, 40246-40265, 40312-40331, 40527-40546, 40603- 40622, 40614-40633, 40615-40634, 40617-40636, 40619-40638, 40648-40667, 40662-40681, 40690-40709, 40692- 40711, 40693-40712, 40699-40718, 40711-40730, 40722-40741, 40723-40742, 40733-40752, 40735-40754, 40749- 40768, 40781-40800, 40816-40835, 40904-40923, 40910-40929, 40911-40930, 40996-41015, 41061-41080, 41075- 41094, 41231-41250, 41309-41328, 41329-41348, 41330-41349, 41331-41350, 41418-41437, 41426-41445, 41437- 41456, 41488-41507, 41698-41717, 41699-41718, 41700-41719, 41701-41720, 41702-41721, 41703-41722, 41732- 41751, 41738-41757, 41745-41764, 41802-41821, 41817-41836, 41828-41847, 41829-41848, 41830-41849, 41837- 41856, 41839-41858, 41878-41897, 41879-41898, 41889-41908, 41902-41921, 41906-41925, 41909-41928, 41911- 41930, 41913-41932, 41950-41969, 42062-42081, 42092-42111, 42093-42112, 42110-42129, 42177-42196, 42180- 42199, 42182-42201, 42183-42202, 42187-42206, 42212-42231, 42222-42241, 42250-42269, 42252-42271, 42262- 42281, 42272-42291, 42274-42293, 42275-42294, 42276-42295, 42282-42301, 42379-42398, 42399-42418, 42436- 42455, 42439-42458, 42440-42459, 42441-42460, 42626-42645, 42642-42661, 42648-42667, 42649-42668, 42654- 42673, 42656-42675, 42662-42681, 42794-42813, 42884-42903, 42902-42921, 42939-42958, 42955-42974, 42997- 43016, 43005-43024, 43010-43029, 43013-43032, 43044-43063, 43148-43167, 43151-43170, 43171-43190, 43181- 43200, 43191-43210, 43196-43215, 43201-43220, 43213-43232, 43214-43233, 43220-43239, 43226-43245, 43227- 43246, 43228-43247, 43246-43265, 43248-43267, 43249-43268, 43250-43269, 43251-43270, 43252-43271, 43254- 43273, 43281-43300, 43283-43302, 43301-43320, 43311-43330, 43321-43340, 43331-43350, 43434-43453, 43451- 43470, 43476-43495, 43512-43531, 43513-43532, 43515-43534, 43587-43606, 43589-43608, 43599-43618, 43612- 43631, 43618-43637, 43619-43638, 43620-43639, 43640-43659, 43664-43683, 43703-43722, 43705-43724, 43706- 43725, 43713-43732, 43743-43762, 43744-43763, 43746-43765, 43751-43770, 43763-43782, 43791-43810, 43792- 43811, 43793-43812, 43794-43813, 43803-43822, 43809-43828, 43813-43832, 43818-43837, 43819-43838, 43820- 43839, 43821-43840, 43823-43842, 43827-43846, 43830-43849, 43840-43859, 43843-43862, 43847-43866, 43853- 43872, 43856-43875, 43857-43876, 43858-43877, 43861-43880, 43863-43882, 43873-43892, 43880-43899, 43883- 43902, 43893-43912, 43900-43919, 43901-43920, 43902-43921, 43903-43922, 43904-43923, 43905-43924, 43906- 43925, 43908-43927, 43940-43959, 43941-43960, 43942-43961, 43943-43962, 43950-43969, 43963-43982, 43973- 43992, 43974-43993, 43993-44012, 44003-44022, 44134-44153, 44144-44163, 44160-44179, 44161-44180, 44165- 44184, 44194-44213, 44205-44224, 44272-44291, 44367-44386, 44480-44499, 44485-44504, 45056-45075, 45134- 45153, 45154-45173, 45174-45193, 45204-45223, 45209-45228, 45211-45230, 45212-45231, 45213-45232, 45214- 45233, 45215-45234, 45216-45235, 45217-45236, 45219-45238, 45530-45549, 45540-45559, 45542-45561, 45557- 45576, 45560-45579, 45569-45588, 45570-45589, 45603-45622, 45627-45646, 45638-45657, 45640-45659, 45642- 45661, 45643-45662, 45660-45679, 45664-45683, 45665-45684, 45913-45932, 46333-46352, 47060-47079, 47066- 47085, 47100-47119, 47130-47149, 47140-47159, 47156-47175, 47158-47177, 47160-47179, 47162-47181, 47210- 47229, 47211-47230, 47213-47232, 47217-47236, 47362-47381, 47363-47382, 47364-47383, 47365-47384, 47415- 47434, 47425-47444, 47435-47454, 47465-47484, 47577-47596, 47579-47598, 47609-47628, 47631-47650, 47640- 47659, 47643-47662, 47661-47680, 47842-47861, 47843-47862, 47852-47871, 47863-47882, 47910-47929, 48689- 48708, 48718-48737, 48774-48793, 48963-48982, 49038-49057, 49067-49086, 49184-49203, 49188-49207, 49197- 49216, 49200-49219, 49276-49295, 49298-49317, 49308-49327, 49329-49348, 49334-49353, 49335-49354, 49338- 49357, 49407-49426, 49600-49619, 49614-49633, 49800-49819, 49822-49841, 49825-49844, 49826-49845, 49925- 49944, 50144-50163, 50248-50267, 50437-50456, 50492-50511, 50545-50564, 50660-50679, 50807-50826, 51074- 51093, 51426-51445, 51428-51447, 51435-51454, 51489-51508, 51490-51509, 51491-51510, 51557-51576, 51644- 51663, 51724-51743, 51735-51754, 51805-51824, 51835-51854, 51890-51909, 51891-51910, 51892-51911, 51988- 52007, 52079-52098, 52176-52195, 52252-52271, 52334-52353, 52472-52491, 53035-53054, 53054-53073, 53059- 53078, 53628-53647, 53710-53729, 53712-53731, 53716-53735, 53725-53744, 53805-53824, 53895-53914, 54096- 54115, 54204-54223, 54235-54254, 54283-54302, 54402-54421, 54470-54489, 54560-54579, 54572-54591, 54663- 54682, 54914-54933, 54915-54934, 54989-55008, 54996-55015, 55004-55023, 55023-55042, 55136-55155, 55150- 55169, 55770-55789, 55806-55825, 55882-55901, 55886-55905, 55938-55957, 55983-56002, 55985-56004, 56069- 56088, 56071-56090, 56086-56105, 56123-56142, 56124-56143, 56128-56147, 56140-56159, 56194-56213, 56195- 56214, 56198-56217, 56206-56225, 56237-56256, 56239-56258, 56245-56264, 56285-56304, 56295-56314, 56305- 56324, 56315-56334, 56334-56353, 56335-56354, 56351-56370, 56355-56374, 56356-56375, 56362-56381, 56365- 56384, 56375-56394, 56380-56399, 56381-56400, 56385-56404, 56395-56414, 56401-56420, 56402-56421, 56405- 56424, 56415-56434, 56416-56435, 56419-56438, 56421-56440, 56444-56463, 56445-56464, 56447-56466, 56448- 56467, 56449-56468, 56460-56479, 56462-56481, 56464-56483, 56467-56486, 56486-56505, 56582-56601, 56617- 56636, 56628-56647, 56631-56650, 56941-56960, 57020-57039, 57022-57041, 57040-57059, 57043-57062, 57044- 57063, 57097-57116, 57134-57153, 57154-57173, 57157-57176, 57174-57193, 57184-57203, 57224-57243, 57231- 57250, 57233-57252, 57234-57253, 57235-57254, 57236-57255, 57237-57256, 57239-57258, 57249-57268, 57274- 57293, 57289-57308, 57302-57321, 57304-57323, 57314-57333, 57324-57343, 57334-57353, 57471-57490, 57697- 57716, 58089-58108, 58113-58132, 58302-58321, 58459-58478, 58493-58512, 58494-58513, 58570-58589, 58620- 58639, 58622-58641, 58744-58763, 58761-58780, 58810-58829, 58918-58937, 58919-58938, 58941-58960, 58956- 58975, 58990-59009, 58993-59012, 58997-59016, 59000-59019, 59002-59021, 59003-59022, 59006-59025, 59128- 59147, 59180-59199, 59193-59212, 59200-59219, 59246-59265, 59308-59327, 59320-59339, 59378-59397, 59519- 59538, 59521-59540, 59560-59579, 59577-59596, 59578-59597, 59614-59633, 59685-59704, 59812-59831, 59830- 59849, 59834-59853, 60224-60243, 60258-60277, 60260-60279, 60310-60329, 60311-60330, 60314-60333, 60328- 60347, 60375-60394, 60376-60395, 60405-60424, 60411-60430, 60414-60433, 60424-60443, 60477-60496, 60634- 60653, 60664-60683, 60694-60713, 60876-60895, 60957-60976, 61141-61160, 61175-61194, 61333-61352, 61688- 61707, 61689-61708, 61692-61711, 61695-61714, 61838-61857, 61840-61859, 61921-61940, 61952-61971, 62015- 62034, 62018-62037, 62019-62038, 62021-62040, 62060-62079, 62079-62098, 62241-62260, 62801-62820, 62821- 62840, 62950-62969, 63158-63177, 63285-63304, 63291-63310, 63374-63393, 63388-63407, 63667-63686, 63668- 63687, 63913-63932, 64179-64198, 64180-64199, 64181-64200, 64182-64201, 64183-64202, 64191-64210, 64206- 64225, 64241-64260, 64251-64270, 64281-64300, 64679-64698, 64723-64742, 64730-64749, 64955-64974, 64968- 64987, 65307-65326, 65573-65592, 65654-65673, 65661-65680, 65662-65681, 65665-65684, 65983-66002, 66092- 66111, 66108-66127, 66115-66134, 66121-66140, 66129-66148, 66144-66163, 66235-66254, 66331-66350, 66394- 66413, 66457-66476, 66698-66717, 66824-66843, 66857-66876, 66912-66931, 66914-66933, 66990-67009, 67010- 67029, 67012-67031, 67054-67073, 67123-67142, 67218-67237, 67249-67268, 67489-67508, 67578-67597, 67672- 67691, 67834-67853, 67835-67854, 67838-67857, 67839-67858, 67840-67859, 67841-67860, 67843-67862, 67867- 67886, 67869-67888, 67870-67889, 67872-67891, 67962-67981, 67977-67996, 67984-68003, 67995-68014, 68082- 68101, 68140-68159, 68154-68173, 68310-68329, 68357-68376, 68439-68458, 68492-68511, 68506-68525, 68508- 68527, 68736-68755, 68743-68762, 68763-68782, 68788-68807, 68789-68808, 68892-68911, 68893-68912, 68908- 68927, 68920-68939, 68921-68940, 68923-68942, 68925-68944, 69037-69056, 69093-69112, 69170-69189, 69223- 69242, 69806-69825, 69807-69826, 70508-70527, 70512-70531, 70542-70561, 70544-70563, 70550-70569, 70615- 70634, 70616-70635, 70661-70680, 70662-70681, 70700-70719, 70702-70721, 70704-70723, 70706-70725, 70708- 70727, 70710-70729, 70787-70806, 70831-70850, 70853-70872, 70855-70874, 70859-70878, 70860-70879, 70997- 71016, 71117-71136, 71141-71160, 71142-71161, 71336-71355, 71413-71432, 71595-71614, 71603-71622, 71633- 71652, 71643-71662, 71649-71668, 71663-71682, 71665-71684, 71673-71692, 71698-71717, 71700-71719, 71703- 71722, 71706-71725, 71708-71727, 71713-71732, 71723-71742, 71733-71752, 71743-71762, 71749-71768, 71753- 71772, 71766-71785, 71773-71792, 71797-71816, 71931-71950, 71946-71965, 72236-72255, 72247-72266, 72260- 72279, 72340-72359, 72371-72390, 72500-72519, 72536-72555, 72553-72572, 72718-72737, 72719-72738, 72720- 72739, 72732-72751, 72740-72759, 72752-72771, 72753-72772, 72754-72773, 72755-72774, 72756-72775, 72770- 72789, 72861-72880, 72875-72894, 72885-72904, 73042-73061, 73043-73062, 73086-73105, 73089-73108, 73091- 73110, 73092-73111, 73093-73112, 73094-73113, 73338-73357, 73507-73526, 73853-73872, 73866-73885, 73979- 73998, 74487-74506, 74499-74518, 74500-74519, 74516-74535, 74518-74537, 74521-74540, 74527-74546, 74547- 74566, 74557-74576, 74577-74596, 74587-74606, 74597-74616, 74603-74622, 74704-74723, 74935-74954, 75211- 75230, 75212-75231, 75213-75232, 75228-75247, 75309-75328, 75319-75338, 75927-75946, 75972-75991, 76228- 76247, 76488-76507, 76846-76865, 76856-76875, 76950-76969, 76952-76971, 76953-76972, 77215-77234, 77374- 77393, 77377-77396, 77488-77507, 77489-77508, 77490-77509, 77526-77545, 77641-77660, 77810-77829, 77843- 77862, 77847-77866, 77949-77968, 78009-78028, 78010-78029, 78014-78033, 78015-78034, 78254-78273, 78432- 78451, 78626-78645, 78986-79005, 78987-79006, 78988-79007, 79008-79027, 79009-79028, 79010-79029, 79090- 79109, 79091-79110, 79092-79111, 79228-79247, 79254-79273, 79298-79317, 79314-79333, 79315-79334, 79317- 79336, 79318-79337, 79319-79338, 79513-79532, 79517-79536, 79656-79675, 79910-79929, 80109-80128, 80262- 80281, 80314-80333, 80372-80391, 80496-80515, 80559-80578, 80569-80588, 80573-80592, 80666-80685, 80675- 80694 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the equal length portion of the MECP2 nucleic acid. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 129-148, 154-173, 156-175, 217-236, 218-237, 219-238, 232-251, 301-320, 315-334, 317-336, 545-564, 552-571, 572-591, 859-878, 860-879, 1561-1580, 1565-1584, 1595- 1614, 1597-1616, 1603-1622, 1668-1687, 1669-1688, 1714-1733, 1715-1734, 1753-1772, 1755-1774, 1757-1776, 1759- 1778, 1761-1780, 1763-1782, 1840-1859, 1884-1903, 1906-1925, 1908-1927, 1912-1931, 1913-1932, 2050-2069, 2170- 2189, 2194-2213, 2195-2214, 2389-2408, 2466-2485, 2648-2667, 2656-2675, 2686-2705, 2696-2715, 2702-2721, 2716- 2735, 2718-2737, 2726-2745, 2751-2770, 2753-2772, 2756-2775, 2759-2778, 2761-2780, 2766-2785, 2776-2795, 2786- 2805, 2796-2815, 2802-2821, 2806-2825, 2819-2838, 2826-2845, 2850-2869, 2984-3003, 2999-3018, 3289-3308, 3300- 3319, 3313-3332, 3393-3412, 3424-3443, 3553-3572, 3589-3608, 3606-3625, 3771-3790, 3772-3791, 3773-3792, 3785- 3804, 3793-3812, 3805-3824, 3806-3825, 3807-3826, 3808-3827, 3809-3828, 3823-3842, 3914-3933, 3928-3947, 3938- 3957, 4095-4114, 4096-4115, 4139-4158, 4142-4161, 4144-4163, 4145-4164, 4146-4165, 4147-4166, 4391-4410, 4560- 4579, 4906-4925, 4919-4938, 5032-5051, 5540-5559, 5552-5571, 5553-5572, 5569-5588, 5571-5590, 5574-5593, 5580- 5599, 5600-5619, 5610-5629, 5630-5649, 5640-5659, 5650-5669, 5656-5675, 5757-5776, 5988-6007, 6264-6283, 6265- 6284, 6266-6285, 6281-6300, 6362-6381, 6372-6391, 6980-6999, 7025-7044, 7281-7300, 7541-7560, 7899-7918, 7909- 7928, 8003-8022, 8005-8024, 8006-8025, 8268-8287, 8427-8446, 8430-8449, 8541-8560, 8542-8561, 8543-8562, 8579- 8598, 8694-8713, 8863-8882, 8896-8915, 8900-8919, 9002-9021, 9062-9081, 9063-9082, 9067-9086, 9068-9087, 9307- 9326, 9485-9504, 9679-9698, 10039-10058, 10040-10059, 10041-10060, 10061-10080, 10062-10081, 10063-10082, 10143-10162, 10144-10163, or 10145-10164 of SEQ ID NO: 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the equal length portion of the MECP2 nucleic acid. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 2305-2324 of SEQ ID NO: 2340. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 10858-10885, 11534-11588, 11597-11620, 12936-12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941-18975, 19046-19091, 20216-20271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508,  32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32588-32671 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32611-32630 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the equal length portion of the MECP2 nucleic acid. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of SEQ ID NOs: 18-2339. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 18-2339. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 18-2339. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 18-2335. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 18-2335. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 2336-2339. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 2336-2339. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO: 1197. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 1197. In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2. In any of the oligomeric compounds provided herein, the modified oligonucleotide can consist of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide can comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a bicyclic sugar moiety, such as a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety or 2’-OMe sugar moiety. In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound can comprise a sugar surrogate. In any of the oligomeric compounds provided herein, at least one internucleoside linkage of the modified oligonucleotide can comprise a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide can be a modified internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide can be a phosphorothioate internucleoside linkage. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide can be a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide can be independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of the modified oligonucleotide can be phosphodiester internucleoside linkages. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages. In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine. In any of the oligomeric compounds provided herein, the modified oligonucleotide can comprise a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’-external region consisting of 1- 6 linked 5’-external region nucleosides and on the 3’-side by a 3’-external region consisting of 1-6 linked 3’-external region nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety, and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3’- region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5’-region comprises a modified sugar moiety. Compound No.1435454 In certain embodiments, Compound No.1435454 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of GCAACATTTTCAGTTTCAGC (SEQ ID NO: 1197), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2’- β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine. In certain embodiments, Compound No.1435454 is represented by the following chemical notation: GesmCeoAeoAeomCeoAdsTdsTdsTdsTdsmCdsAdsGdsTdsTdsTeomCeoAesGesmCe(SEQ ID NO: 2341), wherein A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage. In certain embodiments Compound No.1435454 is represented by the following chemical structure:

[0004] (SEQ ID NO: 2341). Structure 1. Compound 1435454. In certain embodiments, the oligomeric compound comprises a pharmaceutically acceptable salt of the modified oligonucleotide represented by Structure 1 comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments the sodium salt of Compound No.1435454 is represented by the following chemical structure:

[0005] (SEQ ID NO: 2341). Structure 2. The sodium salt of Compound 1435454. Certain Oligomeric Duplexes Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length portion within nucleobases 2055-2074, 2267-2286, 2321-2340, 2411-2430, 2485-2504, 2536-2555, 2547-2566, 2553-2572, 2683-2702, 2840-2859, 3060-3079, 3075-3094, 3701-3719, 3703-3722, 4286-4305, 4302-4321, 4327-4346, 4456-4475, 4482-4501, 4509-4528, 4511-4530, 4531-4550, 4550-4569, 4560-4579, 4574-4593, 4575-4594, 4659-4678, 4820-4839, 4823-4842, 4825-4844, 4847-4866, 4858-4877, 4876-4895, 4877-4896, 4879-4898, 4880-4899, 4884-4903, 4941-4960, 4964-4983, 4967-4986, 5044-5063, 5053-5072, 5107-5126, 5173-5192, 5177-5196, 5213-5232, 5243-5262, 5253-5272, 5263-5282, 5271-5290, 5272-5291, 5273-5292, 5293-5312, 5303-5322, 5310-5329, 5355-5374, 5363-5382, 5365-5384, 5371-5390, 5539-5558, 5642-5661, 5643-5662, 5644-5663, 5764-5783, 5795-5814, 5802-5821, 5809-5828, 5844-5863, 5858-5877, 5864-5883, 5871-5890, 5879-5898, 5994-6013, 5995-6014, 6003-6022, 6036-6055, 6113-6132, 6114-6133, 6115-6134, 6116-6135, 6120-6139, 6130-6149, 6172-6191, 6216-6235, 6229-6248, 6315-6334, 6363-6382, 6555-6574, 6556-6575, 6557-6576, 6629-6648, 6673-6692, 6674-6693, 6675-6694, 6676-6695, 6695-6714, 6696-6715, 6697-6716, 6698-6717, 6744-6763, 6747-6766, 6790-6809, 6805-6824, 6806-6825, 6919-6938, 7066-7085, 7514-7533, 7539-7558, 7545-7564, 7593-7612, 7594-7613, 7595-7614, 7596-7615, 7626-7645, 7629-7648, 7630-7649, 7631-7650, 7712-7731, 7713-7732, 7723-7742, 7729-7748, 7746-7765, 7777-7796, 7781-7800, 7792-7811, 7852-7871, 7901-7920, 7902-7921, 7916-7935, 7924-7943, 7926-7945, 7927-7946, 7975-7994, 8036-8055, 8042-8061, 8043-8062, 8045-8064, 8052-8071, 8054-8073, 8090-8109, 8091-8110, 8115-8134, 8117-8136, 8130-8149, 8131-8150, 8132-8151, 8146-8165, 8157-8176, 8234-8253, 8272-8291, 8280-8299, 8324-8343, 8325-8344, 8368-8387, 8370-8389, 8382-8401, 8385-8404, 8386-8405, 8388-8407, 8389-8408, 8391-8410, 8394-8413, 8456-8475, 8466-8485, 8477-8496, 8478-8497, 8504-8523, 8571-8590, 8573-8592, 8575-8594, 8581-8600, 8629-8648, 8630-8649, 8631-8650, 8632-8651, 8633-8652, 8690-8709, 8694-8713, 8719-8738, 8721-8740, 8782-8801, 8783-8802, 8784-8803, 8797-8816, 8809-8828, 8810-8829, 8906-8925, 8927-8946, 8929-8948, 8951-8970, 8952-8971, 8953-8972, 9007-9026, 9008-9027, 9010-9029, 9012-9031, 9014-9033, 9016-9035, 9123-9142, 9175-9194, 9181-9200, 9185-9204, 9191-9210, 9196-9215, 9213-9232, 9215-9234, 9227-9246, 9229-9248, 9230-9249, 9238-9257, 9239-9258, 9253-9272, 9266-9285, 9267-9286, 9270-9289, 9271-9290, 9275-9294, 9308-9327, 9335-9354, 9339-9358, 9341-9360, 9342-9361, 9344-9363, 9369-9388, 9371-9390, 9372-9391, 9377-9396, 9378-9397, 9390-9409, 9391-9410, 9392-9411, 9424-9443, 9425-9444, 9431-9450, 9457-9476, 9483-9502, 9494-9513, 9495-9514, 9497-9516, 9516-9535, 9538-9557, 9539-9558, 9636-9655, 9666-9685, 9672-9691, 9691-9710, 9692-9711, 9699-9718, 9700-9719, 9828-9847, 9829-9848, 9836-9855, 9837-9856, 9838-9857, 9839-9858, 9843-9862, 9856-9875, 9873-9892, 9901-9920, 9903-9922, 9905-9924, 9907-9926, 9909-9928, 9911-9930, 9939-9958, 9953-9972, 9967-9986, 9971-9990, 9988-10007, 9989-10008, 9990-10009, 9991-10010, 9994-10013, 9996- 10015, 10049-10068, 10054-10073, 10071-10090, 10081-10100, 10083-10102, 10084-10103, 10088-10107, 10090- 10109, 10091-10110, 10116-10135, 10117-10136, 10118-10137, 10132-10151, 10133-10152, 10134-10153, 10135- 10154, 10238-10257, 10240-10259, 10249-10268, 10250-10269, 10252-10271, 10258-10277, 10281-10300, 10288- 10307, 10290-10309, 10293-10312, 10306-10325, 10338-10357, 10354-10373, 10364-10383, 10366-10385, 10375- 10394, 10378-10397, 10379-10398, 10419-10438, 10456-10475, 10697-10716, 10707-10726, 10854-10873, 10856- 10875, 10857-10876, 10858-10877, 10859-10878, 10860-10879, 10861-10880, 10862-10881, 10863-10882, 10864- 10883, 10866-10885, 10869-10888, 10909-10928, 10919-10938, 10929-10948, 10959-10978, 11305-11324, 11390- 11409, 11402-11421, 11435-11454, 11437-11456, 11452-11471, 11455-11474, 11467-11486, 11475-11494, 11477- 11496, 11478-11497, 11479-11498, 11485-11504, 11495-11514, 11497-11516, 11499-11518, 11500-11519, 11505- 11524, 11507-11526, 11508-11527, 11534-11553, 11535-11554, 11539-11558, 11540-11559, 11556-11575, 11565- 11584, 11567-11586, 11568-11587, 11569-11588, 11570-11589, 11571-11590, 11574-11593, 11578-11597, 11589- 11608, 11597-11616, 11598-11617, 11599-11618, 11600-11619, 11601-11620, 11605-11624, 11607-11626, 11609- 11628, 11615-11634, 11617-11636, 11618-11637, 11619-11638, 11629-11648, 11633-11652, 11635-11654, 11636- 11655, 11638-11657, 11641-11660, 11647-11666, 11648-11667, 11657-11676, 11658-11677, 11659-11678, 11667- 11686, 11744-11763, 12563-12582, 12587-12606, 12617-12636, 12618-12637, 12620-12639, 12621-12640, 12644- 12663, 12657-12676, 12715-12734, 12836-12855, 12877-12896, 12878-12897, 12909-12928, 12914-12933, 12915- 12934, 12936-12955, 12937-12956, 12940-12959, 12941-12960, 12943-12962, 12952-12971, 12971-12990, 12997- 13016, 13025-13044, 13027-13046, 13028-13047, 13041-13060, 13055-13074, 13056-13075, 13171-13190, 13172- 13191, 13229-13248, 13246-13265, 13247-13266, 13248-13267, 13249-13268, 13374-13393, 13488-13507, 13490- 13509, 13503-13522, 13529-13548, 13549-13568, 13559-13578, 13582-13601, 13594-13613, 13596-13615, 13597- 13616, 13598-13617, 13599-13618, 13600-13619, 13601-13620, 13602-13621, 13604-13623, 13612-13631, 13619- 13638, 13622-13641, 13629-13648, 13632-13651, 13639-13658, 13649-13668, 13662-13681, 13667-13686, 13669- 13688, 13670-13689, 13671-13690, 13672-13691, 13679-13698, 13689-13708, 13690-13709, 13691-13710, 13692- 13711, 13699-13718, 13702-13721, 14337-14356, 14339-14358, 14342-14361, 14393-14412, 14716-14735, 14717- 14736, 14718-14737, 14719-14738, 14720-14739, 14722-14741, 14724-14743, 14725-14744, 14726-14745, 14727- 14746, 14728-14747, 14729-14748, 14731-14750, 14734-14753, 14764-14783, 14766-14785, 15192-15211, 15600- 15619, 15827-15846, 15854-15873, 15855-15874, 15859-15878, 15883-15902, 15884-15903, 15885-15904, 15886- 15905, 15892-15911, 15895-15914, 15896-15915, 15901-15920, 15902-15921, 15904-15923, 15971-15990, 15988- 16007, 16004-16023, 16039-16058, 16048-16067, 16082-16101, 16110-16129, 16112-16131, 16113-16132, 16115- 16134, 16116-16135, 16165-16184, 16227-16246, 16228-16247, 16229-16248, 16230-16249, 16236-16255, 16242- 16261, 16248-16267, 16250-16269, 16263-16282, 16264-16283, 16277-16296, 16287-16306, 16307-16326, 16317- 16336, 16330-16349, 16337-16356, 16357-16376, 16359-16378, 16362-16381, 16373-16392, 16374-16393, 16375- 16394, 16377-16396, 16397-16416, 16402-16421, 16408-16427, 16409-16428, 16411-16430, 16425-16444, 16426- 16445, 16428-16447, 16431-16450, 16437-16456, 16439-16458, 16445-16464, 16447-16466, 16457-16476, 16459- 16478, 16469-16488, 16470-16489, 16487-16506, 16499-16518, 16554-16573, 16555-16574, 16562-16581, 16565- 16584, 16567-16586, 16588-16607, 16589-16608, 16590-16609, 16591-16610, 16606-16625, 16608-16627, 16615- 16634, 16625-16644, 16632-16651, 16635-16654, 16636-16655, 16656-16675, 16729-16748, 17271-17290, 17342- 17361, 17348-17367, 17362-17381, 17443-17462, 17449-17468, 17450-17469, 17457-17476, 17459-17478, 17683- 17702, 17693-17712, 17703-17722, 17720-17739, 17723-17742, 17733-17752, 17743-17762, 17757-17776, 17768- 17787, 17771-17790, 17772-17791, 17773-17792, 17775-17794, 17818-17837, 17894-17913, 17911-17930, 17912- 17931, 17914-17933, 17942-17961, 17945-17964, 17955-17974, 17959-17978, 17993-18012, 18008-18027, 18009- 18028, 18028-18047, 18043-18062, 18053-18072, 18065-18084, 18068-18087, 18073-18092, 18075-18094, 18077- 18096, 18079-18098, 18080-18099, 18081-18100, 18082-18101, 18083-18102, 18084-18103, 18085-18104, 18086- 18105, 18093-18112, 18113-18132, 18117-18136, 18120-18139, 18143-18162, 18183-18202, 18203-18222, 18248- 18267, 18289-18308, 18291-18310, 18293-18312, 18304-18323, 18306-18325, 18307-18326, 18366-18385, 18367- 18386, 18372-18391, 18736-18755, 18738-18757, 18740-18759, 18741-18760, 18742-18761, 18743-18762, 18744- 18763, 18753-18772, 18758-18777, 18768-18787, 18778-18797, 18788-18807, 18798-18817, 18808-18827, 18828- 18847, 18848-18867, 18851-18870, 18871-18890, 18873-18892, 18881-18900, 18885-18904, 18886-18905, 18887- 18906, 18901-18920, 18911-18930, 18921-18940, 18941-18960, 18946-18965, 18949-18968, 18951-18970, 18952- 18971, 18954-18973, 18956-18975, 18961-18980, 18962-18981, 18963-18982, 18965-18984, 18980-18999, 18981- 19000, 19001-19020, 19016-19035, 19021-19040, 19026-19045, 19032-19051, 19036-19055, 19046-19065, 19048- 19067, 19049-19068, 19051-19070, 19052-19071, 19054-19073, 19056-19075, 19060-19079, 19062-19081, 19064- 19083, 19066-19085, 19072-19091, 19082-19101, 19086-19105, 19091-19110, 19092-19111, 19093-19112, 19094- 19113, 19095-19114, 19096-19115, 19097-19116, 19098-19117, 19099-19118, 19101-19120, 19106-19125, 19112- 19131, 19115-19134, 19116-19135, 19122-19141, 19125-19144, 19126-19145, 19127-19146, 19128-19147, 19129- 19148, 19131-19150, 19132-19151, 19133-19152, 19138-19157, 19148-19167, 19152-19171, 19154-19173, 19158- 19177, 19165-19184, 19166-19185, 19176-19195, 19178-19197, 19192-19211, 19205-19224, 19208-19227, 19210- 19229, 19212-19231, 19213-19232, 19214-19233, 19215-19234, 19217-19236, 19218-19237, 19220-19239, 19221- 19240, 19224-19243, 19225-19244, 19228-19247, 19232-19251, 19235-19254, 19237-19256, 19238-19257, 19239- 19258, 19240-19259, 19241-19260, 19242-19261, 19243-19262, 19244-19263, 19247-19266, 19248-19267, 19249- 19268, 19251-19270, 19252-19271, 19253-19272, 19254-19273, 19256-19275, 19257-19276, 19258-19277, 19387- 19406, 19388-19407, 19389-19408, 19390-19409, 19393-19412, 19398-19417, 19408-19427, 19458-19477, 19468- 19487, 20039-20058, 20041-20060, 20054-20073, 20059-20078, 20064-20083, 20093-20112, 20096-20115, 20100- 20119, 20121-20140, 20131-20150, 20141-20160, 20151-20170, 20211-20230, 20216-20235, 20220-20239, 20221- 20240, 20222-20241, 20224-20243, 20226-20245, 20231-20250, 20251-20270, 20252-20271, 20261-20280, 20262- 20281, 20282-20301, 20291-20310, 20318-20337, 20320-20339, 20321-20340, 20324-20343, 20327-20346, 20337- 20356, 20340-20359, 20341-20360, 20342-20361, 20343-20362, 20344-20363, 20345-20364, 20347-20366, 20352- 20371, 20362-20381, 20390-20409, 20391-20410, 20393-20412, 20402-20421, 20412-20431, 20414-20433, 20539- 20558, 20583-20602, 20586-20605, 20594-20613, 20606-20625, 20616-20635, 20646-20665, 20656-20675, 20670- 20689, 20671-20690, 20675-20694, 20676-20695, 20677-20696, 20679-20698, 20706-20725, 20716-20735, 20726- 20745, 20741-20760, 20746-20765, 21082-21101, 21084-21103, 21086-21105, 21105-21124, 21448-21467, 21458- 21477, 21468-21487, 21478-21497, 21479-21498, 21498-21517, 21499-21518, 21503-21522, 21505-21524, 21506- 21525, 21507-21526, 21508-21527, 21509-21528, 21510-21529, 21511-21530, 21513-21532, 21528-21547, 21529- 21548, 21538-21557, 21539-21558, 21543-21562, 21558-21577, 21559-21578, 21564-21583, 21566-21585, 21567- 21586, 21569-21588, 21915-21934, 21916-21935, 21925-21944, 21926-21945, 21935-21954, 21945-21964, 21946- 21965, 21948-21967, 21951-21970, 21953-21972, 21954-21973, 21955-21974, 21956-21975, 21957-21976, 21959- 21978, 21960-21979, 21961-21980, 21962-21981, 21963-21982, 21964-21983, 21965-21984, 21966-21985, 21967- 21986, 21968-21987, 21970-21989, 21976-21995, 21985-22004, 21995-22014, 21996-22015, 22005-22024, 22006- 22025, 22016-22035, 22020-22039, 22042-22061, 22055-22074, 22056-22075, 22065-22084, 22094-22113, 22130- 22149, 22208-22227, 22237-22256, 22285-22304, 22349-22368, 23004-23023, 23043-23062, 23044-23063, 23579- 23598, 23589-23608, 23659-23678, 23662-23681, 23663-23682, 23664-23683, 23665-23684, 23666-23685, 23679- 23698, 23687-23706, 23689-23708, 23690-23709, 23691-23710, 23692-23711, 23693-23712, 23694-23713, 23739- 23758, 23749-23768, 23753-23772, 23769-23788, 23779-23798, 23863-23882, 23865-23884, 23867-23886, 23870- 23889, 23872-23891, 23974-23993, 23975-23994, 24004-24023, 24005-24024, 24021-24040, 24029-24048, 24032- 24051, 24045-24064, 24052-24071, 24061-24080, 24062-24081, 24063-24082, 24064-24083, 24065-24084, 24067- 24086, 24129-24148, 24132-24151, 24150-24169, 24151-24170, 24152-24171, 24159-24178, 24161-24180, 24162- 24181, 24165-24184, 24169-24188, 24225-24244, 24226-24245, 24227-24246, 24229-24248, 24231-24250, 24233- 24252, 24234-24253, 24236-24255, 24241-24260, 24261-24280, 24271-24290, 24293-24312, 24299-24318, 24358- 24377, 24368-24387, 24375-24394, 24378-24397, 24408-24427, 24423-24442, 24427-24446, 24428-24447, 24431- 24450, 24528-24547, 24531-24550, 24548-24567, 24550-24569, 24552-24571, 24553-24572, 24557-24576, 24590- 24609, 24591-24610, 24693-24712, 24704-24723, 24708-24727, 24709-24728, 24710-24729, 24711-24730, 24731- 24750, 24741-24760, 24751-24770, 24752-24771, 24781-24800, 24783-24802, 24791-24810, 24801-24820, 24811- 24830, 24814-24833, 24861-24880, 24871-24890, 24873-24892, 24882-24901, 24883-24902, 24901-24920, 24902- 24921, 24903-24922, 24911-24930, 24912-24931, 24913-24932, 24922-24941, 24923-24942, 24932-24951, 24942- 24961, 24943-24962, 24952-24971, 24953-24972, 24955-24974, 24968-24987, 24970-24989, 24971-24990, 24972- 24991, 24973-24992, 24974-24993, 24975-24994, 24976-24995, 24977-24996, 24980-24999, 24981-25000, 24982- 25001, 24983-25002, 24984-25003, 24985-25004, 24987-25006, 25013-25032, 25355-25374, 25385-25404, 25395- 25414, 25445-25464, 25450-25469, 25452-25471, 25453-25472, 25455-25474, 25456-25475, 25458-25477, 25475- 25494, 25494-25513, 25495-25514, 25535-25554, 25545-25564, 25567-25586, 25580-25599, 25600-25619, 25602- 25621, 25728-25747, 25899-25918, 26032-26051, 26034-26053, 26079-26098, 26092-26111, 26093-26112, 26095- 26114, 26104-26123, 26110-26129, 26111-26130, 26112-26131, 26113-26132, 26114-26133, 26115-26134, 26116- 26135, 26117-26136, 26181-26200, 26215-26234, 26217-26236, 26230-26249, 26268-26287, 26320-26339, 26323- 26342, 26324-26343, 26325-26342, 26327-26346, 26433-26452, 26435-26454, 26544-26563, 26555-26574, 26571- 26590, 26583-26602, 26620-26639, 26627-26646, 26628-26647, 26633-26652, 26766-26785, 26768-26787, 26827- 26846, 26991-27010, 27449-27468, 27503-27522, 27507-27526, 27509-27528, 27525-27544, 27537-27556, 27555- 27574, 27557-27576, 27565-27584, 27567-27586, 27577-27596, 27585-27604, 27595-27614, 27604-27623, 27605- 27624, 27607-27626, 27608-27627, 27610-27629, 27612-27631, 27614-27633, 27615-27634, 27647-27666, 27655- 27674, 27657-27676, 27665-27684, 27677-27696, 27687-27706, 27695-27714, 27715-27734, 27804-27823, 28177- 28196, 28269-28288, 28280-28299, 28283-28302, 28460-28479, 28465-28484, 28483-28502, 28488-28507, 28496- 28515, 28497-28516, 28502-28521, 28509-28528, 28528-28547, 28529-28548, 28544-28563, 28550-28569, 28626- 28645, 28636-28655, 28688-28707, 28691-28710, 28701-28720, 28709-28728, 28710-28729, 28711-28730, 28731- 28750, 28751-28770, 28761-28780, 28774-28793, 28786-28805, 28790-28809, 28791-28810, 28796-28815, 28811- 28830, 28814-28833, 28851-28870, 28861-28880, 28871-28890, 28881-28900, 28889-28908, 28924-28943, 28952- 28971, 28983-29002, 28993-29012, 29001-29020, 29002-29021, 29003-29022, 29013-29032, 29023-29042, 29043- 29062, 29080-29099, 29081-29100, 29082-29101, 29083-29102, 29084-29103, 29085-29104, 29088-29107, 29123- 29142, 29143-29162, 29153-29172, 29163-29182, 29183-29202, 29243-29262, 29260-29279, 29296-29315, 29478- 29497, 29999-30018, 30020-30039, 30023-30042, 30174-30193, 30219-30238, 30522-30541, 30542-30561, 30602- 30621, 30617-30636, 30622-30641, 30623-30642, 30624-30643, 30625-30644, 30630-30649, 30632-30651, 30702- 30721, 31466-31485, 31534-31553, 31535-31554, 31544-31563, 31623-31642, 31673-31692, 31688-31707, 31689- 31708, 31690-31709, 31708-31727, 31709-31728, 31746-31765, 31747-31766, 31814-31833, 32013-32032, 32019- 32038, 32127-32146, 32128-32147, 32129-32148, 32130-32149, 32131-32150, 32133-32152, 32133-32152, 32133- 32150, 32134-32151, 32135-32154, 32135-32152, 32136-32155, 32138-32157, 32143-32162, 32145-32164, 32163- 32182, 32203-32222, 32205-32224, 32213-32232, 32223-32242, 32224-32243, 32230-32249, 32235-32254, 32236- 32255, 32237-32256, 32239-32258, 32241-32260, 32243-32262, 32244-32263, 32283-32302, 32284-32303, 32285- 32304, 32286-32305, 32290-32309, 32300-32319, 32307-32326, 32309-32328, 32312-32331, 32313-32332, 32314- 32333, 32316-32335, 32318-32337, 32320-32339, 32350-32369, 32360-32379, 32362-32381, 32368-32387, 32369- 32388, 32370-32389, 32372-32391, 32373-32392, 32380-32399, 32385-32404, 32387-32406, 32388-32407, 32390- 32409, 32391-32410, 32392-32411, 32393-32412, 32395-32414, 32410-32429, 32420-32439, 32430-32449, 32440- 32459, 32447-32466, 32450-32469, 32460-32479, 32470-32489, 32480-32499, 32483-32502, 32484-32503, 32485- 32504, 32489-32508, 32490-32509, 32491-32510, 32499-32518, 32501-32520, 32521-32540, 32531-32550, 32541- 32560, 32546-32565, 32548-32567, 32550-32569, 32551-32570, 32556-32575, 32560-32579, 32561-32580, 32562- 32581, 32571-32590, 32576-32595, 32580-32599, 32581-32600, 32582-32601, 32588-32607, 32589-32608, 32590- 32609, 32591-32610, 32592-32611, 32593-32612, 32594-32613, 32596-32615, 32606-32625, 32611-32630, 32612- 32631, 32613-32632, 32614-32633, 32616-32635, 32620-32639, 32630-32649, 32645-32664, 32646-32665, 32648- 32667, 32649-32668, 32650-32669, 32651-32670, 32652-32671, 32653-32672, 32654-32673, 32655-32674, 32656- 32675, 32661-32680, 32666-32685, 32672-32691, 32679-32698, 32680-32699, 32681-32700, 32686-32705, 32691- 32710, 32692-32711, 32700-32719, 32702-32721, 32712-32731, 32716-32735, 32720-32739, 32722-32741, 32726- 32745, 32740-32759, 32746-32765, 32752-32771, 32782-32801, 32785-32804, 33090-33109, 33093-33112, 33110- 33129, 33128-33147, 33130-33149, 33132-33151, 33133-33152, 33136-33155, 33138-33157, 33140-33159, 33142- 33161, 33143-33162, 33144-33163, 33145-33164, 33146-33165, 33148-33167, 33149-33168, 33150-33169, 33151- 33170, 33152-33171, 33153-33172, 33155-33174, 33163-33182, 33170-33189, 33171-33190, 33173-33192, 33183- 33202, 33193-33212, 33205-33224, 33223-33242, 33224-33243, 33225-33244, 33228-33247, 33230-33249, 33233- 33252, 33250-33269, 33255-33274, 33256-33275, 33257-33276, 33350-33369, 33642-33661, 33644-33663, 33646- 33665, 33648-33667, 33649-33668, 33650-33669, 33652-33671, 33653-33672, 33656-33675, 33662-33681, 33676- 33695, 33686-33705, 33691-33710, 33708-33727, 33716-33735, 33718-33737, 33736-33755, 33887-33906, 33888- 33907, 33973-33992, 34024-34043, 34042-34061, 34476-34495, 34484-34503, 34490-34509, 34491-34510, 34572- 34591, 34600-34619, 34608-34627, 34612-34631, 34675-34694, 34679-34698, 35038-35057, 35048-35067, 35056- 35075, 35076-35095, 35082-35101, 35086-35105, 35106-35125, 35116-35135, 35126-35145, 35135-35154, 35136- 35155, 35137-35156, 35138-35157, 35139-35158, 35176-35195, 35596-35615, 35768-35787, 35867-35886, 35968- 35987, 36285-36304, 36341-36360, 36383-36402, 36393-36412, 36403-36422, 36409-36428, 36410-36429, 36413- 36432, 36443-36462, 36444-36463, 36446-36465, 36457-36476, 36463-36482, 36473-36492, 36480-36499, 36481- 36500, 36482-36501, 36483-36502, 36488-36507, 36513-36532, 36514-36533, 36515-36534, 36516-36535, 36518- 36537, 36521-36540, 36542-36561, 36553-36572, 36573-36592, 36583-36602, 36678-36697, 36801-36820, 36860- 36879, 36904-36923, 36935-36954, 36937-36956, 36994-37013, 37240-37259, 37346-37365, 37415-37434, 37425- 37444, 37433-37452, 37455-37474, 37475-37494, 37485-37504, 37490-37509, 37492-37511, 37494-37513, 37495- 37514, 37496-37515, 37497-37516, 37498-37517, 37500-37519, 37505-37524, 37515-37534, 37557-37576, 37575- 37594, 37605-37624, 37611-37630, 37729-37748, 38088-38107, 38461-38480, 38605-38624, 38824-38843, 38953- 38972, 38981-39000, 39153-39172, 39294-39313, 39518-39537, 39522-39541, 39523-39542, 39646-39665, 39860- 39879, 40096-40115, 40122-40141, 40148-40167, 40224-40243, 40246-40265, 40312-40331, 40527-40546, 40603- 40622, 40614-40633, 40615-40634, 40617-40636, 40619-40638, 40648-40667, 40662-40681, 40690-40709, 40692- 40711, 40693-40712, 40699-40718, 40711-40730, 40722-40741, 40723-40742, 40733-40752, 40735-40754, 40749- 40768, 40781-40800, 40816-40835, 40904-40923, 40910-40929, 40911-40930, 40996-41015, 41061-41080, 41075- 41094, 41231-41250, 41309-41328, 41329-41348, 41330-41349, 41331-41350, 41418-41437, 41426-41445, 41437- 41456, 41488-41507, 41698-41717, 41699-41718, 41700-41719, 41701-41720, 41702-41721, 41703-41722, 41732- 41751, 41738-41757, 41745-41764, 41802-41821, 41817-41836, 41828-41847, 41829-41848, 41830-41849, 41837- 41856, 41839-41858, 41878-41897, 41879-41898, 41889-41908, 41902-41921, 41906-41925, 41909-41928, 41911- 41930, 41913-41932, 41950-41969, 42062-42081, 42092-42111, 42093-42112, 42110-42129, 42177-42196, 42180- 42199, 42182-42201, 42183-42202, 42187-42206, 42212-42231, 42222-42241, 42250-42269, 42252-42271, 42262- 42281, 42272-42291, 42274-42293, 42275-42294, 42276-42295, 42282-42301, 42379-42398, 42399-42418, 42436- 42455, 42439-42458, 42440-42459, 42441-42460, 42626-42645, 42642-42661, 42648-42667, 42649-42668, 42654- 42673, 42656-42675, 42662-42681, 42794-42813, 42884-42903, 42902-42921, 42939-42958, 42955-42974, 42997- 43016, 43005-43024, 43010-43029, 43013-43032, 43044-43063, 43148-43167, 43151-43170, 43171-43190, 43181- 43200, 43191-43210, 43196-43215, 43201-43220, 43213-43232, 43214-43233, 43220-43239, 43226-43245, 43227- 43246, 43228-43247, 43246-43265, 43248-43267, 43249-43268, 43250-43269, 43251-43270, 43252-43271, 43254- 43273, 43281-43300, 43283-43302, 43301-43320, 43311-43330, 43321-43340, 43331-43350, 43434-43453, 43451- 43470, 43476-43495, 43512-43531, 43513-43532, 43515-43534, 43587-43606, 43589-43608, 43599-43618, 43612- 43631, 43618-43637, 43619-43638, 43620-43639, 43640-43659, 43664-43683, 43703-43722, 43705-43724, 43706- 43725, 43713-43732, 43743-43762, 43744-43763, 43746-43765, 43751-43770, 43763-43782, 43791-43810, 43792- 43811, 43793-43812, 43794-43813, 43803-43822, 43809-43828, 43813-43832, 43818-43837, 43819-43838, 43820- 43839, 43821-43840, 43823-43842, 43827-43846, 43830-43849, 43840-43859, 43843-43862, 43847-43866, 43853- 43872, 43856-43875, 43857-43876, 43858-43877, 43861-43880, 43863-43882, 43873-43892, 43880-43899, 43883- 43902, 43893-43912, 43900-43919, 43901-43920, 43902-43921, 43903-43922, 43904-43923, 43905-43924, 43906- 43925, 43908-43927, 43940-43959, 43941-43960, 43942-43961, 43943-43962, 43950-43969, 43963-43982, 43973- 43992, 43974-43993, 43993-44012, 44003-44022, 44134-44153, 44144-44163, 44160-44179, 44161-44180, 44165- 44184, 44194-44213, 44205-44224, 44272-44291, 44367-44386, 44480-44499, 44485-44504, 45056-45075, 45134- 45153, 45154-45173, 45174-45193, 45204-45223, 45209-45228, 45211-45230, 45212-45231, 45213-45232, 45214- 45233, 45215-45234, 45216-45235, 45217-45236, 45219-45238, 45530-45549, 45540-45559, 45542-45561, 45557- 45576, 45560-45579, 45569-45588, 45570-45589, 45603-45622, 45627-45646, 45638-45657, 45640-45659, 45642- 45661, 45643-45662, 45660-45679, 45664-45683, 45665-45684, 45913-45932, 46333-46352, 47060-47079, 47066- 47085, 47100-47119, 47130-47149, 47140-47159, 47156-47175, 47158-47177, 47160-47179, 47162-47181, 47210- 47229, 47211-47230, 47213-47232, 47217-47236, 47362-47381, 47363-47382, 47364-47383, 47365-47384, 47415- 47434, 47425-47444, 47435-47454, 47465-47484, 47577-47596, 47579-47598, 47609-47628, 47631-47650, 47640- 47659, 47643-47662, 47661-47680, 47842-47861, 47843-47862, 47852-47871, 47863-47882, 47910-47929, 48689- 48708, 48718-48737, 48774-48793, 48963-48982, 49038-49057, 49067-49086, 49184-49203, 49188-49207, 49197- 49216, 49200-49219, 49276-49295, 49298-49317, 49308-49327, 49329-49348, 49334-49353, 49335-49354, 49338- 49357, 49407-49426, 49600-49619, 49614-49633, 49800-49819, 49822-49841, 49825-49844, 49826-49845, 49925- 49944, 50144-50163, 50248-50267, 50437-50456, 50492-50511, 50545-50564, 50660-50679, 50807-50826, 51074- 51093, 51426-51445, 51428-51447, 51435-51454, 51489-51508, 51490-51509, 51491-51510, 51557-51576, 51644- 51663, 51724-51743, 51735-51754, 51805-51824, 51835-51854, 51890-51909, 51891-51910, 51892-51911, 51988- 52007, 52079-52098, 52176-52195, 52252-52271, 52334-52353, 52472-52491, 53035-53054, 53054-53073, 53059- 53078, 53628-53647, 53710-53729, 53712-53731, 53716-53735, 53725-53744, 53805-53824, 53895-53914, 54096- 54115, 54204-54223, 54235-54254, 54283-54302, 54402-54421, 54470-54489, 54560-54579, 54572-54591, 54663- 54682, 54914-54933, 54915-54934, 54989-55008, 54996-55015, 55004-55023, 55023-55042, 55136-55155, 55150- 55169, 55770-55789, 55806-55825, 55882-55901, 55886-55905, 55938-55957, 55983-56002, 55985-56004, 56069- 56088, 56071-56090, 56086-56105, 56123-56142, 56124-56143, 56128-56147, 56140-56159, 56194-56213, 56195- 56214, 56198-56217, 56206-56225, 56237-56256, 56239-56258, 56245-56264, 56285-56304, 56295-56314, 56305- 56324, 56315-56334, 56334-56353, 56335-56354, 56351-56370, 56355-56374, 56356-56375, 56362-56381, 56365- 56384, 56375-56394, 56380-56399, 56381-56400, 56385-56404, 56395-56414, 56401-56420, 56402-56421, 56405- 56424, 56415-56434, 56416-56435, 56419-56438, 56421-56440, 56444-56463, 56445-56464, 56447-56466, 56448- 56467, 56449-56468, 56460-56479, 56462-56481, 56464-56483, 56467-56486, 56486-56505, 56582-56601, 56617- 56636, 56628-56647, 56631-56650, 56941-56960, 57020-57039, 57022-57041, 57040-57059, 57043-57062, 57044- 57063, 57097-57116, 57134-57153, 57154-57173, 57157-57176, 57174-57193, 57184-57203, 57224-57243, 57231- 57250, 57233-57252, 57234-57253, 57235-57254, 57236-57255, 57237-57256, 57239-57258, 57249-57268, 57274- 57293, 57289-57308, 57302-57321, 57304-57323, 57314-57333, 57324-57343, 57334-57353, 57471-57490, 57697- 57716, 58089-58108, 58113-58132, 58302-58321, 58459-58478, 58493-58512, 58494-58513, 58570-58589, 58620- 58639, 58622-58641, 58744-58763, 58761-58780, 58810-58829, 58918-58937, 58919-58938, 58941-58960, 58956- 58975, 58990-59009, 58993-59012, 58997-59016, 59000-59019, 59002-59021, 59003-59022, 59006-59025, 59128- 59147, 59180-59199, 59193-59212, 59200-59219, 59246-59265, 59308-59327, 59320-59339, 59378-59397, 59519- 59538, 59521-59540, 59560-59579, 59577-59596, 59578-59597, 59614-59633, 59685-59704, 59812-59831, 59830- 59849, 59834-59853, 60224-60243, 60258-60277, 60260-60279, 60310-60329, 60311-60330, 60314-60333, 60328- 60347, 60375-60394, 60376-60395, 60405-60424, 60411-60430, 60414-60433, 60424-60443, 60477-60496, 60634- 60653, 60664-60683, 60694-60713, 60876-60895, 60957-60976, 61141-61160, 61175-61194, 61333-61352, 61688- 61707, 61689-61708, 61692-61711, 61695-61714, 61838-61857, 61840-61859, 61921-61940, 61952-61971, 62015- 62034, 62018-62037, 62019-62038, 62021-62040, 62060-62079, 62079-62098, 62241-62260, 62801-62820, 62821- 62840, 62950-62969, 63158-63177, 63285-63304, 63291-63310, 63374-63393, 63388-63407, 63667-63686, 63668- 63687, 63913-63932, 64179-64198, 64180-64199, 64181-64200, 64182-64201, 64183-64202, 64191-64210, 64206- 64225, 64241-64260, 64251-64270, 64281-64300, 64679-64698, 64723-64742, 64730-64749, 64955-64974, 64968- 64987, 65307-65326, 65573-65592, 65654-65673, 65661-65680, 65662-65681, 65665-65684, 65983-66002, 66092- 66111, 66108-66127, 66115-66134, 66121-66140, 66129-66148, 66144-66163, 66235-66254, 66331-66350, 66394- 66413, 66457-66476, 66698-66717, 66824-66843, 66857-66876, 66912-66931, 66914-66933, 66990-67009, 67010- 67029, 67012-67031, 67054-67073, 67123-67142, 67218-67237, 67249-67268, 67489-67508, 67578-67597, 67672- 67691, 67834-67853, 67835-67854, 67838-67857, 67839-67858, 67840-67859, 67841-67860, 67843-67862, 67867- 67886, 67869-67888, 67870-67889, 67872-67891, 67962-67981, 67977-67996, 67984-68003, 67995-68014, 68082- 68101, 68140-68159, 68154-68173, 68310-68329, 68357-68376, 68439-68458, 68492-68511, 68506-68525, 68508- 68527, 68736-68755, 68743-68762, 68763-68782, 68788-68807, 68789-68808, 68892-68911, 68893-68912, 68908- 68927, 68920-68939, 68921-68940, 68923-68942, 68925-68944, 69037-69056, 69093-69112, 69170-69189, 69223- 69242, 69806-69825, 69807-69826, 70508-70527, 70512-70531, 70542-70561, 70544-70563, 70550-70569, 70615- 70634, 70616-70635, 70661-70680, 70662-70681, 70700-70719, 70702-70721, 70704-70723, 70706-70725, 70708- 70727, 70710-70729, 70787-70806, 70831-70850, 70853-70872, 70855-70874, 70859-70878, 70860-70879, 70997- 71016, 71117-71136, 71141-71160, 71142-71161, 71336-71355, 71413-71432, 71595-71614, 71603-71622, 71633- 71652, 71643-71662, 71649-71668, 71663-71682, 71665-71684, 71673-71692, 71698-71717, 71700-71719, 71703- 71722, 71706-71725, 71708-71727, 71713-71732, 71723-71742, 71733-71752, 71743-71762, 71749-71768, 71753- 71772, 71766-71785, 71773-71792, 71797-71816, 71931-71950, 71946-71965, 72236-72255, 72247-72266, 72260- 72279, 72340-72359, 72371-72390, 72500-72519, 72536-72555, 72553-72572, 72718-72737, 72719-72738, 72720- 72739, 72732-72751, 72740-72759, 72752-72771, 72753-72772, 72754-72773, 72755-72774, 72756-72775, 72770- 72789, 72861-72880, 72875-72894, 72885-72904, 73042-73061, 73043-73062, 73086-73105, 73089-73108, 73091- 73110, 73092-73111, 73093-73112, 73094-73113, 73338-73357, 73507-73526, 73853-73872, 73866-73885, 73979- 73998, 74487-74506, 74499-74518, 74500-74519, 74516-74535, 74518-74537, 74521-74540, 74527-74546, 74547- 74566, 74557-74576, 74577-74596, 74587-74606, 74597-74616, 74603-74622, 74704-74723, 74935-74954, 75211- 75230, 75212-75231, 75213-75232, 75228-75247, 75309-75328, 75319-75338, 75927-75946, 75972-75991, 76228- 76247, 76488-76507, 76846-76865, 76856-76875, 76950-76969, 76952-76971, 76953-76972, 77215-77234, 77374- 77393, 77377-77396, 77488-77507, 77489-77508, 77490-77509, 77526-77545, 77641-77660, 77810-77829, 77843- 77862, 77847-77866, 77949-77968, 78009-78028, 78010-78029, 78014-78033, 78015-78034, 78254-78273, 78432- 78451, 78626-78645, 78986-79005, 78987-79006, 78988-79007, 79008-79027, 79009-79028, 79010-79029, 79090- 79109, 79091-79110, 79092-79111, 79228-79247, 79254-79273, 79298-79317, 79314-79333, 79315-79334, 79317- 79336, 79318-79337, 79319-79338, 79513-79532, 79517-79536, 79656-79675, 79910-79929, 80109-80128, 80262- 80281, 80314-80333, 80372-80391, 80496-80515, 80559-80578, 80569-80588, 80573-80592, 80666-80685, or 80675- 80694 of SEQ ID NO: 1; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the MECP2 nucleic acid. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length portion within nucleobases 10858-10885, 11534-11588, 11597-11620, 12936- 12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941-18975, 19046-19091, 20216- 20271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447- 32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202 of SEQ ID NO: 1; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2339, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2339, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2335, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16, at least 17, or 18 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 2336-2339, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the MECP2 nucleic acid. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide can comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’-F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe. In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide can comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA. In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or at least one internucleoside linkage of the second modified oligonucleotide can comprise a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5’ end and / or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5’ end and / or the 3’ end of the second modified oligonucleotide comprises a phosphorothioate linkage. In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or at least one internucleoside linkage of the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage. In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or each internucleoside linkage of the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage. In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or at least one nucleobase of the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine. In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5’-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate. In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5’-end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3’- end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds. In any of the oligomeric duplexes described herein, the second modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5’-end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3’-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds. In certain embodiments, an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein. In certain embodiments, an antisense agent, which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of MECP2 nucleic acid through the activation of RISC / Ago2. In certain embodiments, an antisense agent, which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAse H agent capable of reducing the amount of MECP2 nucleic acid through the activation of RNAse H. Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3’ ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described in, e.g., Alterman, et al., Nature Biotech., 37:844-894, 2019. I. Certain Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below. A. Certain Modified Nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified oligonucleotides. 1. Certain Sugar Moieties In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and / or 5’ positions. In certain embodiments one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modifed sugar moieties comprise a substituent group at the 2’-position. Examples of substituent groups suitable for the 2’-position of non-bicyclic modified sugar moieties include but are not limited to: -F, -OCH3(“OMe” or “O-methyl”), and -O(CH2)2OCH3(“MOE” or “O-methoxyethyl”). In certain embodiments, 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O- C1-C10alkoxy, O-C1-C10substituted alkoxy, O-C1-C10alkyl, O-C1-C10substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O- alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, -O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and the 2’-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3’-position. Examples of substituent groups suitable for the 3’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4’-position. Examples of 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5’-position. Examples of 5’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: methyl (R or S), vinyl, ethyl, and methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836. In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, O(CH2)2OCH3,, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCF3,OCH3, O(CH2)2OCH3(MOE), O(CH2)2SCH3, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019 / 157531. A 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2’-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified. In naturally occurring nucleic acids, sugars are linked to one another 3’ to 5’. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ or inverted 5’ to 3’. For example, where the linkage is at the 2’ position, the 2’-substituent groups may instead be at the 3’-position. Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides (LNA), or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No.2013 / 0190383 and PCT publication WO 2013 / 036868. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.7,399,845, Bhat et al., U.S.7,569,686, Swayze et al., U.S.7,741,457, and Swayze et al., U.S.8,022,193), 4'- C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S.8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S.8,278,425), 4'-CH2-O-N(CH3)-2' (see, e.g., Allerson et al., U.S.7,696,345 and Allerson et al., U.S.8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem.,2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see e.g., Seth et al., U.S.8,278,426), 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4'-CH2-O- N(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl (see, e.g. Imanishi et al., U.S.7,427,672). In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, - Si(Ra)2-, -S(=O)x-, and N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12alkyl, C2- C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12aminoalkyl, substituted C1-C12aminoalkyl, or a protecting group. Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035- 10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S.7,053,207, Imanishi et al., U.S.6,268,490, Imanishi et al. U.S.6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S.6,794,499, Wengel et al., U.S.6,670,461; Wengel et al., U.S.7,034,133, Wengel et al., U.S. 8,080,644; Wengel et al., U.S.8,034,909; Wengel et al., U.S.8,153,365; Wengel et al., U.S.7,572,582; and Ramasamy et al., U.S.6,525,191, Torsten et al., WO 2004 / 106356, Wengel et al., WO 1999 / 014226; Seth et al.,WO 2007 / 134181; Seth et al., U.S.7,547,684; Seth et al., U.S.7,666,854; Seth et al., U.S.8,088,746; Seth et al., U.S.7,750,131; Seth et al., U.S.8,030,467; Seth et al., U.S.8,268,980; Seth et al., U.S.8,546,556; Seth et al., U.S.8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S.8,501,805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β- D configuration. α-L-methyleneoxy (4’-CH2-O-2’) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research, 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther., 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research, 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified. In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S.7,939,677) and / or the 5’ position. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem.2002, 10, 841-854), fluoro HNA: (“F-HNA”, see e.g., Swayze et al., U.S.8,088,904; Swayze et al., U.S.8,440,803; Swayze et al., U.S.8,796,437; and Swayze et al., U.S.9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:q1 q2T3Oq O3wherein, modified THP nucleoside: Bx is a T3and T4are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3and T4is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3and T4is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6and q7are each, independently, H, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, or substituted C2-C6alkynyl; and each of R1and R2is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3is, independently, H or C1-C6alkyl. In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6and q7are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6and q7is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1and R2is F. In certain embodiments, R1is F and R2is H, in certain embodiments, R1is methoxy and R2is H, and in certain embodiments, R1is methoxyethoxy and R2is H. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S.5,698,685; Summerton et al., U.S.5,166,315; Summerton et al., U.S.5,185,444; and Summerton et al., U.S.5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure: O OBx. morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO 2011 / 133876. In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US 2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S.8,314,227; U.S.2013 / 0096289; U.S.2013 / 0011922; and U.S.2011 / 0313020. In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: (S)-GNA Bx where Bx represents Many other bicyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides. 2. Certain Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. In certain embodiments, modified adenine has structure (I): I      wherein: R2Ais H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1-C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais selected from H, C1-C6alkyl, or CN(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais selected from H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine). In certain embodiments, modified guanine has structure (II): II and R1Gis H, or R6Gis selected from O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Ais absent or is C1-C6alkyl; or Y7Gis C and R7Gis selected from H, C1-C6alkyl, or CN(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis selected from H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =O (unmodified guanosine). In certain embodiments, modified thymine or modified uracil has structure (III): X or S and R5Uis selected from H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively). In certain embodiments, modified cytosine has structure (IV): R4C O or S, R4Cis N(Ra)(Rb); R5Cis selected from H, OH, halogen, O-C1-C12alkyl, O- C1-C12substituted alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; Raand Rbare independently selected from H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2and R5Cis H (unmodified cytosine). In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5- hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2- propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C ^C-CH3) uracil, 5-propynylcytosine, 6- azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7- deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N- benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Further nucleobases include those disclosed in Merigan et al., U.S.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, without limitation, Manoharan et al., US 2003 / 0158403; Manoharan et al., US 2003 / 0175906; Dinh et al., U.S.4,845,205; Spielvogel et al., U.S.5,130,302; Rogers et al., U.S.5,134,066; Bischofberger et al., U.S.5,175,273; Urdea et al., U.S.5,367,066; Benner et al., U.S.5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S.5,457,187; Cook et al., U.S.5,459,255; Froehler et al., U.S.5,484,908; Matteucci et al., U.S.5,502,177; Hawkins et al., U.S.5,525,711; Haralambidis et al., U.S.5,552,540; Cook et al., U.S.5,587,469; Froehler et al., U.S.5,594,121; Switzer et al., U.S.5,596,091; Cook et al., U.S.5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S.5,681,941; Cook et al., U.S.5,811,534; Cook et al., U.S.5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S.5,587,470; Cook et al., U.S.5,457,191; Matteucci et al., U.S.5,763,588; Froehler et al., U.S.5,830,653; Cook et al., U.S.5,808,027; Cook et al., U.S.6,166,199; and Matteucci et al., U.S.6,005,096. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U,mC, or hypoxanthine. In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U. 3. Certain Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous- containing internucleoside linkages are well known to those skilled in the art. In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778. In certain embodiments, a modified internucleoside linkage comprises the formula: wherein for each internucleoside linking group of the modified oligonucleotide: X is or S; R1is selected from H, a C1-C6alkyl, and a substituted C1-C6alkyl; and T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, wherein: R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, a C1-C6alkyl, a C1-C6alkenyl, a C1- C6alkynyl, a substituted C1-C6alkyl, a substituted C1-C6alkenyl, a substituted C1-C6alkynyl, and a conjugate group; R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4is selected from OCH3, OH, a C1-C6alkyl, a substituted C1-C6alkyl, and a conjugate group; and R5is selected from OCH3, OH, a C1-C6alkyl, and a substituted C1-C6alkyl. In certain embodiments, a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having a formula: In certain embodiments, a mesyl phosphoramidate internucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase: . but are not limited to alkylphosphonates and linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

[0006] Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.   Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'- CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below: , wherein any nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide. In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below. , wherein B. Certain Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. Unless otherwise indicated, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). 1. Certain Sugar Motifs In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, modified oligonucleotides comprise a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’-region consisting of linked 5’-region nucleosides and on the 3’-side by a 3’-region consisting of linked 3’-region nucleosides; wherein the 3’-most nucleoside of the 5’-region is a modified nucleoside and the 5’-most nucleoside of the 3’-region is a modified nucleoside. At least one nucleoside of the 5’-region comprises a modified sugar moiety; and at least one nucleoside of the 3’-region comprises a modified sugar moiety. The three regions (the 5’-region, the deoxy region, and the 3’-region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3’-most nucleoside of the 5’-region and the sugar moiety of the 5’-most nucleoside of the 3’-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5’-region, the deoxy region, and the 3’- region. In certain embodiments, each nucleoside of the 5’-region and each nucleoside of the 3’-region comprises a modified sugar moiety. In certain embodiments, the nucleosides within the 5’-region comprise the same sugar modification. In certain embodiments, the nucleosides within the 5’-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides within the 3’-region comprise the same sugar modification. In certain embodiments, the nucleosides within the 3’-region comprise two or more different sugar modifications. In certain embodiments, the 5’-region and the 3’-region of a modified oligonucleotide each comprises 1-8 nucleosides. In certain embodiments, the 5’-region comprises 1-7 nucleosides. In certain embodiments, the 5’-region comprises 1-6 nucleosides. In certain embodiments, the 5’-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3’-region comprises 1-7 nucleosides. In certain embodiments, the 3’-region comprises 1-6 nucleosides. In certain embodiments, the 3’-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer). In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction comprise 2’- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing / gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety. Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] – [# of nucleosides in the gap] – [# of nucleosides in the 3’-wing]. Thus, a 3- 10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’- β-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing. A 5-8-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 8 linked 2’- β-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing. In certain embodiments, modified oligonucleotides disclosed herein are modified by a specific sugar modification. In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides have a sugar motif of (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’- MOE ribosyl sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of (from 5’ to 3’): eeeeeddddddddeeeee; wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE ribosyl sugar moiety. 2. Certain Nucleobase Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from a 2-thiopyrimidine and a 5-propynepyrimidine. 3. Certain Internucleoside Linkage Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (from 5’ to 3’) soooossssssssssooss and sooosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs described herein is substituted with a mesyl phosphoramidate internucleoside linkage. C. Certain Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides. D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence. E. Certain Populations of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration. F. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid. II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and / or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides. A. Certain Conjugate Groups In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g., fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620). In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds. In certain embodiments, a conjugate group has the following structure: . 1. Conjugate Moieties Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes. In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. 2. Conjugate Linkers Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, a conjugate linker comprises pyrrolidine. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 1-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise 1-3 linker- nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker- nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N- benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker- nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, and a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine. 3. Cell-Targeting Moieties In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula: wherein n is from 1 to 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257. In certain embodiments, conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, a conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in WO 1991 / 004753; WO2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; U.S.7,208,174; U.S.9,034,329; and U.S.10,550,188. In certain embodiments, a fragment of an anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; and U.S.10,138,483. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art including but not limited to those described in WO 2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198. B. Certain Terminal Groups In certain embodiments, oligomeric compounds comprise one or more terminal groups. Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. In some embodiments, oligomeric compounds comprise a stabilized 5’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides or sugar moieties. In certain such embodiments, the 2’-linked group is an abasic sugar moiety. III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense agents. In certain embodiments, antisense agents have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense agents selectively affect one or more target nucleic acid. Such antisense agents comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain antisense activities, hybridization of an antisense agents or a portion of an antisense agent to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense agents comprising antisense oligomeric compounds comprising antisense oligonucleotidesthat are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non- DNA-like nucleoside in the gap of a gapmer is tolerated. In certain antisense activities, an antisense agent or a portion of an antisense agent is loaded into an RNA- induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense agents result in cleavage of the target nucleic acid by Argonaute. Antisense agents that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi). In certain embodiments, hybridization of an antisense agent or portion thereof to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense agent or portion thereof to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense agent or a portion thereof to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense agent or a portion thereof to a target nucleic acid results in alteration of translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or animal. IV. Certain Target Nucleic Acids In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre- mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule. A. Complementarity / Mismatches to the Target Nucleic Acid and Duplex Complementarity In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length. It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides. In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region. B. MECP2 In certain embodiments, oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is a MECP2 nucleic acid. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11 truncated from nucleosides 154019001 to 154101000) or SEQ ID NO: 2 (GenBank Accession No. NM_004992.3), or SEQ ID NO: 2340 (the complement of GenBank Accession No. NT_167198.1 truncated from nucleosides 4203000 to 4283000. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 RNA, and in certain embodiments reduces the amount of MECP2 protein. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide and a conjugate group. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 reduces the amount of MECP2 RNA in a cell. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 reduces the amount of MECP2 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell in a subject with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 ameliorates one or more symptoms or hallmarks of a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the neurodegenerative disease or disorder associated with MECP2 is MECP duplication syndrome. In certain embodiments, the symptom or hallmark is any of autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. In certain embodiments, administering the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disabilities, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in the subject; or improves motor function, motor development, muscle tone, cognitive development, speech, or social skill development in the subject. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 is capable of reducing the detectable amount of MECP2 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard cell assay. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 is capable of reducing the detectable amount of MECP2 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 is capable of reducing the detectable amount of MECP2 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340 is capable of reducing the detectable amount of MECP2 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340, is capable of reducing the detectable amount of MECP2 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1, SEQ ID NO: 2, , or SEQ ID NO: 2340, is capable of reducing the detectable amount of MECP2 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. C. Certain Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in a pharmacologically relevant cell. In certain embodiments the pharmacologically relevant cell is a MECP2-expressing cell. In certain embodiments the pharmacologically relevant cell is a neuron or glial cell. In certain embodiments, the pharmacologically relevant cell is a neuronal cell. In certain embodiments, the pharmacologically relevant cell is an astrocyte, an oligodendrocyte or a microglial cell. IV. Certain Methods and Uses Certain embodiments provided herein relate to methods of reducing or inhibiting MECP2 expression or activity, which can be useful for treating, preventing, or ameliorating a disease or disorder associated with overexpression of MECP2 in a subject, by administration of an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprise a modified oligonucleotide having a nucleobase sequence complementary to a MECP2 nucleic acid. In certain embodiments, the disease or disorder associated with overexpression of MECP2 is a neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease or disorder is MECP2 Duplication Syndrome. In certain embodiments, a method comprises administering to a subject an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a MECP2 nucleic acid. In certain embodiments, the subject has or is at risk for developing a disease or disorder associated with MECP2. In certain embodiments, the subject has or is at risk for developing MECP2 Duplication Syndrome. In certain embodiments, a method of treating a neurodegenerative disease or disorder associated with MECP2 comprises administering to a subject a therapeutically effective amount of an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the disease or disorder is associated with an elevated level of MECP2 in the subject. In certain embodiments, the subject has or is at risk for developing MECP2 Duplication Syndrome. In certain embodiments, at least one symptom or hallmark of the neurodegenerative disease or disorder associated with MECP2 Duplication Syndrome is ameliorated. Exemplary symptoms or hallmarks include, but are not limited to, autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. In certain embodiments, a method of reducing expression of MECP2 nucleic acid, for example RNA, or reducing the expression of MECP2 protein in a cell comprises administering to the subject an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby inhibiting expression of MECP2 nucleic acid in the subject. In certain embodiments, administering the oligomeric agent, the oligomeric compound, the oligomeric duplex, or the antisense agent inhibits expression of MECP2 in the brain or the spinal cord of the subject. In certain embodiments, the subject has or is at risk for developing a neurological disease or condition associated with MECP2. In certain embodiments, the subject has or is at risk for developing MECP2 Duplication Syndrome. In certain embodiments, a method of inhibiting expression of MECP2 nucleic acid in a cell comprises contacting the cell with an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a MECP2 nucleic acid, thereby inhibiting expression of MECP2 nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron or a glial cell (e.g., an astrocyte, an oligodendrocyte, a microglial cell). In certain embodiments, the cell is obtained from a subject, e.g., a subject, that has or is at risk for developing a disease or disorder associated with MECP2. In certain embodiments, the cell is in a subject having or at risk for developing a disease or condition associated with MECP2, such as MECP2 Duplication Syndrome. In certain embodiments, a method of reducing expression of MECP2, for example RNA, or reducing the expression of MECP2 protein in a cell comprises contacting the cell with an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an ATN1 nucleic acid. In certain embodiments, the subject has or is at risk for developing MECP2 Duplication Syndrome (MDS). In certain embodiments, the subject has MDS. In certain embodiments, the cell is a neuron or glial cell. In certain embodiments, the cell is a human cell. Certain embodiments are drawn to an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an MECP2 nucleic acid, for use in treating a disease or disorder associated with elevated MECP2 signaling, or with over-expression of MECP2. In certain embodiments, the disease or disorder is MECP2 Duplication Syndrome. In certain embodiments, an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent is for use in improving a symptom or hallmark of a disease or condition associated with MECP2 Duplication Syndrome. In certain embodiments, the symptom or hallmark is selected from autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. In certain embodiments, an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent is for use in reducing MECP2 expression in a subject. Certain embodiments are drawn to an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an MECP2 nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with MECP2. In certain embodiments, the disease is MECP2 Duplication Syndrome. In certain embodiments, an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent is for the manufacture or preparation of a medicament for improving symptoms or hallmarks associated with MECP2 Duplication Syndrome. In certain embodiments, the symptom or hallmark is selected from autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, and early death. In certain embodiments, an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent is for the manufacture or preparation of a medicament for use in reducing MECP2 expression in a subject. In any of the methods or uses described herein, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex can be any described herein. V. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises an oligomeric compound and PBS. In certain embodiments, a pharmaceutical composition consists of an oligomeric compound and PBS. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric compound and PBS. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH- adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more modified oligonucleotide, upon administration to an subject, including a human subject, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body. In certain embodiments, oligomeric compounds are lyophilized and isolated as sodium salts. In certain embodiments, the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of an oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of an oligomeric compound is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric compound is a sodium salt of a modified oligonucleotide. Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue. In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or salt thereof” or “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de- protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve a desired pH. Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No.1435454 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No.1435454. In certain embodiments, where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose. In certain embodiments, when an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. VI. Certain Hotspot Regions 1. Nucleobases 10,858-10,885 of SEQ ID NO: 1 In certain embodiments, nucleobases 10,858-10,885 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 188, 673, 1893, 2012, 2031, 2104, 2233, and 2311 are complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985840, 1434926, 1435030, 1435374, 1435535, 1436154, 1436207, and 1436353 are complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1 achieve at least 68% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1 achieve an average of 84.5% reduction of MECP2 RNA in a standard cell assay. 2. Nucleobases 11,534-11,588 of SEQ ID NO: 1 In certain embodiments, nucleobases 11,534-11,588 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’) soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 35, 342, 419, 496, 573, 870, 975, 1030, and 1130 are complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985842, 985843, 985844, 985845, 985846, 1434938, 1435167, 1435529, and 1435649 are complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1 achieve at least 58% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1 achieve an average of 84.3% reduction of MECP2 RNA in a standard cell assay. 3. Nucleobases 11,597-11,620 of SEQ ID NO: 1 In certain embodiments, nucleobases 11,597-11,620 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’) soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 1589, 1652, 1780, 1823, and 1882 are complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1435121, 1435143, 1435440, 1435634, and 1436258 are complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1 achieve at least 76% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1 achieve an average of 84% reduction of MECP2 RNA in a standard cell assay. 4. Nucleobases 12,936-12,962 of SEQ ID NO: 1 In certain embodiments, nucleobases 12,936-12,962 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 964, 1058, 1106, 1192, and 1276 are complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1434953, 1435202, 1435393, 1435409, and 1435737 are complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1 achieve at least 82% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1 achieve an average of 88.2% reduction of MECP2 RNA in a standard cell assay. 5. Nucleobases 13,599-13,641 of SEQ ID NO: 1 In certain embodiments, nucleobases 13,599-13,641 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 344, 1303, 1333, 1407, 1545, 1561, 1724, and 1648 are complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985858, 1434886, 1434892, 1434988, 1435017, 1435123, 1435927, and 1436211 are complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1 achieve at least 67% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1 achieve an average of 87.9% reduction of MECP2 RNA in a standard cell assay. 6. Nucleobases 13,669-13,711 of SEQ ID NO: 1 In certain embodiments, nucleobases 13,669-13,711 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 421, 663, 765, 835, 912, 990, 1042, 1096, and 2291 are complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985859, 1434822, 1435372, 1435404, 1435762, 1435891, 1435913, 1435934, and 1436156 are complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1 achieve at least 61% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1 achieve an average of 79.1% reduction of MECP2 RNA in a standard cell assay. 7. Nucleobases 14,716-14,746 of SEQ ID NO: 1 In certain embodiments, nucleobases 14,716-14,746 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 191, 268, 345, 422, 499, 1335, 1425, 1539, 1573, and 1705 are complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985864, 985865, 985866, 985867, 985868, 1435005, 1435124, 1435310, 1436093, and 1436367 are complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1 achieve at least 57% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1 achieve an average of 76.1% reduction of MECP2 RNA in a standard cell assay. 8. Nucleobases 15,883-15,905 of SEQ ID NO: 1 In certain embodiments, nucleobases 15,883-15,905 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 840, 914, 977, and 1085 are complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1435682, 1435914, 1435974, and 1436202 are complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1 achieve at least 85% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1 achieve an average of 94.8% reduction of MECP2 RNA in a standard cell assay. 9. Nucleobases 16,362-16,396 of SEQ ID NO: 1 In certain embodiments, nucleobases 16,362-16,396 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 346, 1954, 2046, 2135, and 2183 are complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985874, 1435003, 1435056, 1435298, and 1435688 are complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1 achieve at least 64% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1 achieve an average of 88.8% reduction of MECP2 RNA in a standard cell assay. 10. Nucleobases 18,941-18,975 of SEQ ID NO: 1 In certain embodiments, nucleobases 18,941-18,975 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 580, 1806, 1869, 1949, 2054, 2111, and 2199 are complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985901, 1434874, 1434934, 1435116, 1435198, 1435424, and 1435426 are complementary to a portion of nucleobases 18,941- 18,975 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1 achieve at least 65% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1 achieve an average of 91% reduction of MECP2 RNA in a standard cell assay. 11. Nucleobases 19,046-19,091 of SEQ ID NO: 1 In certain embodiments, nucleobases 19,046-19,091 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 1428, 1518, 1591, 1677, 1736, 1790, 1914, 2016, 2045, 2161, 2189, and 2313 are complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1434868, 1435190, 1435276, 1435308, 1435328, 1435475, 1435622, 1435650, 1435969, 1436193, 1436230, and 1436403 are complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1 achieve at least 62% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1 achieve an average of 80% reduction of MECP2 RNA in a standard cell assay. 12. Nucleobases 20,216-20,271 of SEQ ID NO: 1 In certain embodiments, nucleobases 20,216-20,271 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 428, 1710, 1741, 1834, 1904, 1953, 2062, 2149, and 2175 are complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985915, 1434860, 1434986, 1435359, 1435559, 1435747, 1435855, 1435956, and 1436440 are complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1 achieve at least 75% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1 achieve an average of 88.2% reduction of MECP2 RNA in a standard cell assay. 13. Nucleobases 21,505-21,532 of SEQ ID NO: 1 In certain embodiments, nucleobases 21,505-21,532 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 430, 650, 733, 817, 2071, 2134, 2224, and 2316 are complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985930, 1435139, 1435251, 1435453, 1435687, 1435800, 1435885, and 1436303 are complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1 achieve at least 73% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1 achieve an average of 85% reduction of MECP2 RNA in a standard cell assay. 14. Nucleobases 21,945-21,976 of SEQ ID NO: 1 In certain embodiments, nucleobases 21,945-21,976 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 46, 653, 770, 831, 1962, 2055, 2157, 2186, and 2327 are complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985933, 1435150, 1435185, 1435243, 1435431, 1435756, 1436047, 1436210, and 1436478 are complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1 achieve at least 58% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1 achieve an average of 85.2% reduction of MECP2 RNA in a standard cell assay. 15. Nucleobases 23,689-23,713 of SEQ ID NO: 1 In certain embodiments, nucleobases 23,689-23,713 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 278, 1687, 1756, 1855, 1932, and 1952 are complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985943, 1434976, 1435679, 1435846, 1436265, and 1436330 are complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1 achieve at least 76% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1 achieve an average of 89.3% reduction of MECP2 RNA in a standard cell assay. 16. Nucleobases 24,791-24,833 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,791-24,833 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 434, 1647, 1749, and 1801 are complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985961, 1435051, 1435091, and 1435574 are complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1 achieve at least 69% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1 achieve an average of 79.8% reduction of MECP2 RNA in a standard cell assay. 17. Nucleobases 24,901-24,930 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,901-24,930 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 635, 760, 807, and 2293 are complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1434808, 1435218, 1435824, and 1436028 are complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1 achieve at least 83% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1 achieve an average of 84.5% reduction of MECP2 RNA in a standard cell assay. 18. Nucleobases 24,970-24,995 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,970-24,995 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 509, 1769, 1837, 1897, 1964, 2026, and 2150 are complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 985962, 1434946, 1435273, 1435478, 1435902, 1435958, and 1436004 are complementary to a portion of nucleobases 24,970- 24,995 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1 achieve at least 71% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1 achieve an average of 86.1% reduction of MECP2 RNA in a standard cell assay. 19. Nucleobases 32,385-32,414 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,385-32,414 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 441, 919, 944, 1034, 1159, 1232, 1270, and 1361 are complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 986016, 1434812, 1435204, 1435287, 1435503, 1436016, 1436137, and 1436175 are complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1 achieve at least 63% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1 achieve an average of 77.5% reduction of MECP2 RNA in a standard cell assay. 20. Nucleobases 32,447-32,508 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,447-32,508 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 699, 1774, 1847, 1867, 1983, 2044, 2125, 2241, and 2312 are complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 1434836, 1435240, 1435495, 1435763, 1436075, 1436111, 1436217, 1436232, and 1436289 are complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1 achieve at least 67% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1 achieve an average of 84.6% reduction of MECP2 RNA in a standard cell assay. 21. Nucleobases 32,588-32,671 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,588-32,671 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 57, 134, 211, 516, 595, 640, 751, 795, 931, 980, 1073, 1120, 1197, 1266, 1341, 1448, 1500, 1582, 1663, 1722, 1814, 1881, and 2320 are complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 986017, 986018, 986019, 986020, 986021, 1434897, 1434978, 1435012, 1435088, 1435101, 1435118, 1435267, 1435319, 1435334, 1435366, 1435412, 1435454, 1435755, 1435757, 1435879, 1435987, 1436284, and 1436337 are complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1 achieve at least 44% reduction of MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1 achieve an average of 81.1% reduction of MECP2 RNA in a standard cell assay. 22. Nucleobases 35,116-35,158 of SEQ ID NO: 1 In certain embodiments, nucleobases 35,116-35,158 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric compounds or antisense oligonucleotides are complementary to a portion of nucleobases 35,116-35,158 of SEQ ID NO: 1. In certain embodiments, the oligomeric compounds or antisense oligonucleotides are 20 nucleobases in length. In certain embodiments, oligomeric compounds or antisense oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the MOE gapmers are 5-10-5 MOE gapmers. In certain embodiments, the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compounds or antisense oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif for the gapmers is (from 5’ to 3’): soooossssssssssooss, wherein each “o” represents a phosphodiester internucleoside linkage, and each “s” represents a phosphorothioate internucleoside linkage. The nucleobase sequences of SEQ ID NOs: 599, 1070, 1145, 1210, 1320, 1402, and 1427 are complementary to a portion of nucleobases 35,116-35,158 of SEQ ID NO: 1. The nucleobase sequences of Compound Nos: 986050, 1435325, 1435773, 1435831, 1435930, 1436357, and 1436420 are complementary to a portion of nucleobases 35,116- 35,158 of SEQ ID NO: 1. In certain embodiments, oligomeric compounds or antisense oligonucleotides...

Claims

CLAIMS:

1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a MECP2 nucleic acid, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. The oligomeric compound of claim 1, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340.

3. The oligomeric compound of claim 1 or claim 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 10858-10885, 11534- 11588, 11597-11620, 12936-12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941- 18975, 19046-19091, 20216-20271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970- 24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202 of SEQ ID NO:

1.

4. The oligomeric compound of any of claims 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32588-32671 of SEQ ID NO:

1.

5. The oligomeric compound of any of claims 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32611-32630 of SEQ ID NO:

1.

6. The oligomeric compound of any of claims 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the MECP2 nucleic acid.

7. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 18-2339, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar and a modified internucleoside linkage.

8. The oligomeric compound of claim 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 18-2339.

9. The oligomeric compound of claim 7 or claim 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 18-2339.

10. The oligomeric compound of any of claims 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of`SEQ ID NOs: 18-2335.

11. The oligomeric compound of any of claims 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 2336-2339.

12. The oligomeric compound of any of claims 7-10, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1197.

13. The oligomeric compound of any of claims 7-10, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 1197.

14. The oligomeric compound of any of claims 1-13, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340.

15. The oligomeric compound of any of claims 1-14, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

16. The oligomeric compound of any of claims 1-15, wherein the modified oligonucleotide consists of 18 linked nucleosides.

17. The oligomeric compound of any of claims 1-15, wherein the modified oligonucleotide consists of 20 linked nucleosides.

18. The oligomeric compound of any of claims 1-17, wherein the modified oligonucleotide comprises at least one modified nucleoside.

19. The oligomeric compound of claim 18, wherein the at least one modified nucleoside comprises a modified sugar moiety.

20. The oligomeric compound of claim 19, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

21. The oligomeric compound of claim 20, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-.

22. The oligomeric compound of claim 19, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

23. The oligomeric compound of claim 22, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-OMe sugar moiety.

24. The oligomeric compound of any of claims 1-23, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate.

25. The oligomeric compound of claim 24, wherein the sugar surrogate is a morpholino or a PNA.

26. The oligomeric compound of any of claims 1-25, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

27. The oligomeric compound of claim 26, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

28. The oligomeric compound of claim 26, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

29. The oligomeric compound of claim 26 or claim 27, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.

30. The oligomeric compound of any of claims 26 or 28-29, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

31. The oligomeric compound of any of claims 26 or 28-30, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

32. The oligomeric compound of any of claims 26-28 or 30-31, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

33. The oligomeric compound of any of claims 26 or 28-31, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from 5’-soooossssssssssooss-3’ and 5’- sooosssssssssooss -3’; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.

34. The oligomeric compound of any of claims 1-33, wherein the modified oligonucleotide comprises at least one modified nucleobase.

35. The oligomeric compound of claim 34, wherein the modified nucleobase is 5-methylcytosine.

36. The oligomeric compound of claim 35, wherein each cytosine is a 5-methylcytosine.

37. The oligomeric compound of any of claims 1-36, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-20, 18-22, 18-25, 18-20, 20- 25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof.

38. The oligomeric compound of any of claims 1-37, wherein the modified oligonucleotide comprises a deoxy region.

39. The oligomeric compound of claim 38, wherein each nucleoside of the deoxy region is a 2’-β-D- deoxynucleoside.

40. The oligomeric compound of claim 38 or claim 39, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

41. The oligomeric compound of any of claims 38-40, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

42. The oligomeric compound of any of claims 38-41, wherein the deoxy region is flanked on the 5’-side by a 5’- external region consisting of 1-6 linked 5’-external region nucleosides and on the 3’-side by a 3’-external region consisting of 1-6 linked 3’-external region nucleosides; wherein the 3’-most nucleoside of the 5’ external region nucleosides comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ external region nucleosides comprises a modified sugar moiety.

43. The oligomeric compound of claim 41 or claim 42, wherein each of the 3’ external region nucleosides comprises a modified sugar moiety.

44. The oligomeric compound of claim 43, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked 5’-external region nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3’ external region consisting of 5 linked 3’-external region nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside.

45. The oligomeric compound of claim 42 or claim 43, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3’ external region consisting of 5 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside.

46. The oligomeric compound of claim 42 or claim 43, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ external -region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’ external region consisting of 1-6 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a cEt nucleoside or a 2’-MOE nucleoside, and each of the deoxy region nucleosides is a 2’-β-D-deoxynucleoside.

47. The oligomeric compound of any of claims 1-46, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from eeeeeddddddddddeeeee and eeeeeddddddddeeeee, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE sugar moiety.

48. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: GesmCeoAeoAeomCeoAdsTdsTdsTdsTdsmCdsAdsGdsTdsTdsTeomCeoAesGesmCe(SEQ ID NO: 2341), wherein A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

49. The oligomeric compound of any of claims 1-48, consisting of the modified oligonucleotide.

50. The oligomeric compound of any of claims 1-48, wherein the oligomeric compound comprises a conjugate group.

51. The oligomeric compound of claim 50, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

52. The oligomeric compound of claim 51, wherein the conjugate linker consists of a single bond.

53. The oligomeric compound of any of claims 51-52, wherein the conjugate linker is cleavable.

54. The oligomeric compound of claim 51 or claim 53, wherein the conjugate linker comprises 1-3 linker- nucleosides.

55. The oligomeric compound of any of claims 51-53, wherein the conjugate linker does not comprise any linker nucleosides.

56. The oligomeric compound of any of claims 50-55, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide.

57. The oligomeric compound of any of claims 50-55, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide.

58. The oligomeric compound of any of claims 1 to 57, wherein the oligomeric compound comprises a terminal group.

59. The oligomeric compound of claim 58, wherein the terminal group is an abasic sugar moiety.

60. The oligomeric compound of any of claims 1-59, wherein the oligomeric compound is a singled-stranded oligomeric compound.

61. A modified oligonucleotide according to the following chemical structure:

62. The modified oligonucleotide of claim 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

63. The modified oligonucleotide of claim 61, which is the sodium salt or the potassium salt.

64. A modified oligonucleotide according to the following chemical structure:

65. A chirally enriched population of oligomeric compounds of any of claims 1-60 or a chirally enriched population of modified oligonucleotides of any of claims 61-64, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

66. The chirally enriched population of claim 65, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

67. The chirally enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

68. The chirally enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

69. The chirally enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.

70. A population of oligomeric compounds of any of claims 1-60 or a population of modified oligonucleotides of any of claims 61-64, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

71. An oligomeric duplex, comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of claims 1-60.

72. The oligomeric duplex of claim 71, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

73. The oligomeric duplex of any of claims 71-72, wherein the first modified oligonucleotide comprises a 5’- stabilized phosphate group.

74. The oligomeric duplex of claim 73, wherein the 5’-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.

75. The oligomeric duplex of any of claims 71-74, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.

76. The oligomeric duplex of any of claims 71-74, wherein the first modified oligonucleotide comprises a 2’-NMA sugar moiety.

77. The oligomeric duplex of any of claims 71-76, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

78. The oligomeric duplex of claim 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

79. The oligomeric duplex of claim 78, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from –O-CH2- and –O-CH(CH3)-.

80. The oligomeric duplex of claim 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

81. The oligomeric duplex of claim 80, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-OMe sugar moiety.

82. The oligomeric duplex of any of claims 71-81, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

83. The oligomeric duplex of any of claims 71-82, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.

84. The oligomeric duplex of claim 83, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

85. The oligomeric duplex of any of claims 71-84, wherein at least one internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage.

86. The oligomeric duplex of any of claims 71-85, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

87. The oligomeric duplex of any of claims 71-86, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

88. The oligomeric duplex of claim 87, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

89. The oligomeric duplex of any of claims 71-88, wherein the second modified oligonucleotide comprises a conjugate group.

90. The oligomeric duplex of claim 89, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

91. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 5’-end of the second modified oligonucleotide.

92. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 3’-end of the second modified oligonucleotide.

93. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

94. The oligomeric duplex of any of claims 89-93, wherein the conjugate group comprises a lipid.

95. The oligomeric duplex of any of claims 71-94, wherein the second modified oligonucleotide comprises a terminal group.

96. The oligomeric duplex of claim 95, wherein the terminal group is an abasic sugar moiety.

97. The oligomeric duplex of any of claims 71-96, wherein the second modified oligonucleotide consists of 10 to 25, 10 to 30, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

98. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of claims 1-60 or the modified oligonucleotide of any of claims 61-64.

99. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of claims 71-97.

100. The antisense agent of claim 98 or claim 99, wherein the antisense agent is: i. an RNase H agent capable of reducing the amount of MECP2 nucleic acid through the activation of RNase H; or ii. an RNAi agent capable of reducing the amount of MECP2 nucleic acid through the activation of RISC / Ago2.

101. The antisense agent of any of claims 98-100, wherein the antisense agent comprises a conjugate group, wherein the conjugate group is a cell-targeting moiety.

102. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71- 97, or an antisense agent of any of claims 98-101, and a pharmaceutically acceptable diluent.

103. The pharmaceutical composition of claim 102, wherein the pharmaceutically acceptable diluent is phosphate- buffered saline or artificial cerebrospinal fluid.

104. The pharmaceutical composition of claim 103, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent and the phosphate-buffered saline or the artificial cerebrospinal fluid.

105. A method comprising administering to a subject an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71- 97, an antisense agent of any of claims 98-101, or a pharmaceutical composition of any of claims 102-104.

106. The method of claim 105, wherein the subject has a disease or disorder associated with MECP2.

107. The method of claim 106, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

108. The method of claim 105 or claim 106, wherein the disease or disorder associated with MECP2 is MECP2 Duplication Syndrome.

109. A method of treating a disease or disorder associated with MECP2 comprising administering to a subject having or at risk for developing a disease or disorder associated with MECP2 a therapeutically effective amount of an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71-97, an antisense agent of any of claims 98-101, or a pharmaceutical composition of any of claims 102-104; and thereby treating the disease or disorder associated with MECP2.

110. The method of claim 109, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

111. The method of claim 109 or claim 110, wherein the disease or disorder associated with MECP2 is MECP2 Duplication Syndrome.

112. The method of any of claims 109-111, wherein at least one symptom or hallmark of the disease or disorder associated with MECP2 is ameliorated.

113. The method of claim 112, wherein the symptom or hallmark is autism, intellectual disability, motor dysfunction, hypotonia, global developmental delays, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infections, epileptic encephalopathy, or early death.

114. The method of any of claims 109-113, wherein the disease or disorder is associated with an elevated level of MECP2 in the subject.

115. The method of any of claims 105-114, wherein administering the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disabilities, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in the subject; or improves motor function, motor development, muscle tone, cognitive development, speech, or social skill development in the subject.

116. The method of any of claims 105-115, wherein the subject is human.

117. A method of reducing expression of MECP2 in a cell comprising contacting the cell with an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71-97, an antisense agent of any of claims 98-101, or a pharmaceutical composition of any of claims 102-104.

118. The method of claim 117, wherein the cell is a neuron.

119. The method of claim 117 or claim 118, wherein the cell is a human cell.

120. Use of an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71-97, an antisense agent of any of claims 98- 101, or a pharmaceutical composition of any of claims 102-104 for treating a disease or disorder associated with MECP2.

121. Use of an oligomeric compound of any of claims 1-60, a modified oligonucleotide of any of claims 61-64, a population of any of claims 65-70, an oligomeric duplex of any of claims 71-97, or an antisense agent of any of claims 98-101, or a pharmaceutical composition of any of claims 102-104 in the manufacture of a medicament for treating a disease or disorder associated with MECP2.

122. The use of claim 120 or claim 121, wherein the disease or disorder is associated with an elevated level of MECP2.

123. The use of any of claims 120-122, wherein the disease or disorder associated is MECP2 duplication syndrome.

Images