Methods of treatment of melanocytic disease

Abstract

Provided herein are novel compositions and methods for treating melanocytic disease. Provided herein are novel compositions and methods of treating diseases arising from gain-of-function NRAS and BRAF variants including cancer, in particular melanoma, as well as congenital melanocytic naevi (CMN) and acquired melanocytic naevi (AMN).

Description

METHODS OF TREATMENT OF MELANOCYTIC DISEASEFIELD OF THE INVENTIONThe present invention relates to novel compositions and methods of treating melanocytic disease. The present invention relates to novel compositions and methods of treating diseases arising from gain-of-function NRAS and BRAF variants including cancer, in particular melanoma, congenital melanocytic nevi (CMN) and acquired melanocytic nevi (AMN).BACKGROUNDNRAS

[0001] The NRAS gene codes for a protein called N-Ras that is primarily involved in regulating cell division. Signals transduced by NRAS instruct the cell to proliferate or to differentiate. The N-Ras protein is a GTPase. To transmit signals, the N-Ras protein must be activated by binding to a molecule of GTP. The N-Ras protein is inactivated by converting GTP to GDP. When the N-Ras protein is bound to GDP, it does not transmit signals to the nucleus.

[0002] The NRAS gene belongs to a class of genes known as oncogenes. When mutated, oncogenes have the potential to cause normal cells to become cancerous. The NRAS gene is in the Ras family of oncogenes, which also includes many other genes, including two others very commonly mutated in cancers, namely HRAS and KRAS. These three proteins all play important roles in cell division, cell differentiation, apoptosis and other processes. Inherited mutations in gene NRAS can cause a variety of “RASopathy” syndromes, most commonly Noonan syndrome. Somatic mutations in this gene have been found in many cancers.BRAF

[0003] BRAF is a human gene that encodes a protein called B-Raf. The gene is also referred to as proto-oncogene B-Raf and v-Raf murine sarcoma viral oncogene homolog B. The protein is also known as serine / threonine-protein kinase B-Raf. B-Raf is a member of the Raf kinase family of growth signal transduction protein kinases. This protein plays a role in regulating the MAP kinase / ERKs signaling pathway, which affects cell division, differentiation, apoptosis, secretion and other processes.

[0004] Inherited mutations in BRAF can cause cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Somatic mutations in this gene have been found in cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, papillary thyroid carcinoma, non-small-cell lung carcinoma, adenocarcinoma of the lung, brain tumors including glioblastoma and pleomorphic xanthoastrocytoma as well as inflammatory diseases like Erdheim-Chester disease.Congenital melanocytic nevi (CMN)

[0005] Congenital melanocytic nevi (CMN) can cover up to 80% of the body surface area and large CMN, which occur in 1 in 20,000 births, are usually associated with multiple smaller nevi. CMN can be associated with neurological abnormalities, sometimes termed neurocutaneous melanosis, although many of the abnormalities are not melanocytic and this term therefore is nowadays often replaced with CMN syndrome. The commonest finding in the central nervous system (CNS) is foci of melaninproducing cells within the brain parenchyma, found on magnetic resonance imaging in ~20% of children with multiple CMN Other neurological associations comprise communicating hydrocephalus, arachnoid cysts, syringomyelia, tumours (including astrocytoma, choroid plexus papilloma, ependymoma, and pineal germinoma), and malformations such as Dandy-Walker or Arnold-Chiari. Neurological symptoms in patients with CMN can be present without radiological abnormality which may be due to lesions below the resolution of MRI. . Risk of neurological symptoms is most strongly correlated to MRI CNS findings rather than to the cutaneous phenotype.

[0006] In addition to the developmental abnormalities, CMN are a known risk factor for melanoma in postnatal life. The absolute risk is associated with the severity of the neurocutaneous phenotype, in particular related to the presence MRI CNS findings more than to the cutaneous phenotype. For those with severe cutaneous phenotypes, the risk peaks in childhood, at an age when melanoma is otherwise extremely rare. Importantly, in cases where melanoma does arise, the primary tumour is not necessarily within the skin, but often within the central nervous system (CNS), and occasionally elsewhere. Melanoma in these children is usually highly aggressive and refractory to therapy. MEK inhibition has been shown to reduce symptoms in neurological melanoma, possibly also prolonging life, but is not curative, and does not make the cutaneous lesions disappear.

[0007] Congenital melanocytic naevi are caused by post-zygotic NRAS missense mutations (somatic mutations occurring in utero) in approximately 67% of cases (where all severities of naevus are grouped together), and by BRAF missense mutations occurring in utero in approximately 7% of cases. The disease phenotype is extremely similar, having the same clinical diagnosis, the same clinical appearance, and the same clinical management. There are minor differences in phenotype with a slightly higher chance of multiple adipocytic nodules in BRAF-CMN than NRAS-CMN but this does not lead to any differences in clinical outcomes including risk of melanoma in childhood.Acquired melanocytic naevi

[0008] Acquired melanocytic naevi (AMN) are caused by the same oncogenic mutations as congenital melanocytic naevi, although there is an inversion of the frequencies with BRAF mutations being commoner than NRAS, and are clinically indistinguishable in appearance, histology and outcomes. Acquired naevi are caused by somatic mutations (i.e. occurring after birth), to a melanocyte or melanocytic stem cell in the skin. The mechanisms of naevogenesis are likely to be very similar betweenCMN and AMN, as the mutations are the same, and there is enormous histological overlap between congenital and acquired naevi, in particular the abnormal cells are called naevus cells in both cases. In both cases the naevi predispose to melanoma formation, with 50% of melanomas in the normal population estimated to develop from acquired melanocytic naevi. The proposed therapies can therefore be seen as and be used not only to reverse / treat a naevus but for prevention of melanoma development. Furthermore, there is a potential use of these therapies in the cosmetic industry, where naevi could be reversed for cosmetic reasons if wished.Sporadic melanoma

[0009] Melanoma in the normal population are most commonly driven by the same BRAF mutations and NRAS mutations in that order of frequency. These can occur either de novo to a melanocyte or melanocytic stem cell in the skin, producing a new melanocytic lesion, or arising out of an existing congenital or more commonly acquired melanocytic naevus. Melanoma itself requires more than just the BRAF or NRAS missense mutation, needing additional genetic mutations (potentially before or after the NRAS or BRAF mutation) to become cancer. Nonetheless, the driver mutation is fundamental to the process and to the disease development.SUMMARY OF THE INVENTION

[0010] The present invention provides a nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS or BRAF.

[0011] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS or BRAF. In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS. In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS. In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding BRAF. In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of BRAF.

[0012] In some embodiments the first strand consists of 10 to 40 linked nucleosides. In some embodiments the first strand consists of 10 to 30 linked nucleosides. In some embodiments the first strand consists of 15 to 30 linked nucleosides. In some embodiments the first strand consists of 15 to 25 linked nucleosides. In some embodiments the first strand consists of 15 to 20 linked nucleosides. Insome embodiments the first strand consists of 10 to 20 linked nucleosides. In some embodiments the first strand consists of 20 to 30 linked nucleosides. In some embodiments the first strand consists of 20 to 25 linked nucleosides. In some embodiments the first strand consists of 21 linked nucleosides.

[0013] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D). In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D). In some embodiments the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G60RA / / E / D) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments the nucleic acid molecule inhibits the expression of variant NRAS p.(G60RA / / E / D) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro. In some embodiments the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G60R / V / E / D).

[0014] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P). In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P). In some embodiments the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(Q61 K / R / H / L / P) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments the nucleic acid molecule inhibits the expression of variant NRAS p.(Q61 K / R / H / L / P) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro. In some embodiments the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(Q61 K / R / H / L / P).

[0015] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G12R / S / D / P / C / AA / ) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments the nucleic acid molecule inhibits the expression of variant NRAS p.(G12R / S / D / P / C / AA / ) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro. In someembodiments the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G12R / S / D / P / C / A / V).

[0016] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y). In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y). In some embodiments the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments the nucleic acid molecule inhibits the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro. In some embodiments the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G13V / D / A / S / C / R / F / Y).

[0017] In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments the nucleic acid molecule is capable of inhibiting the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments the nucleic acid molecule inhibits the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro to a greater extent relative to inhibition of the expression of wild type BRAF in vitro. In some embodiments the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant BRAF p.(V600G / M / D / R / K / E).

[0018] In some embodiments the nucleic acid molecule is a single stranded nucleic acid molecule. In some embodiments the nucleic acid molecule is a double stranded nucleic acid molecule.

[0019] In some embodiments the double stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand. In some embodiments the second strand is at least 80% complementary to the first strand. In some embodiments the second strand is at least 90% complementary to the first strand. In some embodiments the second strand is at least 95% complementary to the first strand. In some embodiments the second strand is fully complementary to the first strand.

[0020] In some embodiments the second strand consists of 10 to 50 linked nucleosides. In some embodiments the second strand consists of 10 to 40 linked nucleosides. In some embodiments the second strand consists of 10 to 30 linked nucleosides. In some embodiments the second strand consists of 15 to 30 linked nucleosides. In some embodiments the second strand consists of 15 to 25 linked nucleosides. In some embodiments the second strand consists of 15 to 20 linked nucleosides. In some embodiments the second strand consists of 10 to 20 linked nucleosides. In some embodiments the second strand consists of 20 to 30 linked nucleosides. In some embodiments the second strand consists of 20 to 25 linked nucleosides. In some embodiments the second strand consists of 21 linked nucleosides.

[0021] In some embodiments the first strand is longer than the second strand. In some embodiments the nucleic acid molecule comprises an overhang at the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 3’ end of the first strand of 2 nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 5’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 5’ end of the first strand of 2 nucleosides. In some embodiments the nucleic acid molecule comprises the second strand is longer than the first strand. In some embodiments the nucleic acid molecule comprises an overhang at the 3’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 3’ end of the second strand of 2 nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 5’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at the 5’ end of the second strand of 2 nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at both the 5’ end and the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments the nucleic acid molecule comprises an overhang at both the 5’ end and the 3’ end of the first strand of 2 nucleosides.

[0022] In some embodiments the overhang comprises two thymine nucleotides (TT). In some embodiments the overhang consists of two thymine nucleotides (TT).

[0023] In some embodiments the second strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the groups consisting of:SEQ ID NOs: 92-110; SEQ ID NOs: 130-148; SEQ ID NOs: 168-186; SEQ ID NOs: 206-224; SEQ ID NOs: 244-262; SEQ ID NOs: 282-300; SEQ ID NOs: 320-338; SEQ ID NOs: 358-376; SEQ ID NOs: 396-414; SEQ ID NOs: 434-452; SEQ ID NOs: 472-490; SEQ ID NOs: 510-528; SEQ ID NOs: 548-566; SEQ ID NOs: 587-606; SEQ ID NOs: 626-644; SEQ ID NOs: 664-682; SEQ ID NOs: 702-720; SEQ ID NOs: 740-758; SEQ ID NOs: 778-796; SEQ ID NOs: 817-836; SEQ ID NOs: 857-876; SEQ ID NOs: 896-914; SEQ ID NOs: 934-952; SEQ ID NOs: 972-990; SEQ ID NOs: 1011-1030; SEQ ID NOs: 1052-1072; SEQ ID NOs: 1092-1 110; SEQ ID NOs: 1130-1148; SEQ ID NOs: 1 168-1186; SEQ ID NOs: 1207- 1226; SEQ ID NOs: 1247-1266; SEQ ID NOs: 1287-1306; or SEQ ID NOs: 1326-1344.

[0024] In some embodiments the second strand comprises a sequence selected from the groups consisting of:SEQ ID NOs: 92-110; SEQ ID NOs: 130-148; SEQ ID NOs: 168-186; SEQ ID NOs: 206-224; SEQ ID NOs: 244-262; SEQ ID NOs: 282-300; SEQ ID NOs: 320-338; SEQ ID NOs: 358-376; SEQ ID NOs: 396-414; SEQ ID NOs: 434-452; SEQ ID NOs: 472-490; SEQ ID NOs: 510-528; SEQ ID NOs: 548-566; SEQ ID NOs: 587-606; SEQ ID NOs: 626-644; SEQ ID NOs: 664-682; SEQ ID NOs: 702-720; SEQ ID NOs: 740-758; SEQ ID NOs: 778-796; SEQ ID NOs: 817-836; SEQ ID NOs: 857-876; SEQ ID NOs: 896-914; SEQ ID NOs: 934-952; SEQ ID NOs: 972-990; SEQ ID NOs: 1011-1030; SEQ ID NOs: 1052- 1072; SEQ ID NOs: 1092-1 110; SEQ ID NOs: 1130-1148; SEQ ID NOs: 1 168-1186; SEQ ID NOs: 1207- 1226; SEQ ID NOs: 1247-1266; SEQ ID NOs: 1287-1306; or SEQ ID NOs: 1326-1344.

[0025] In some embodiments the second strand consists of a sequence selected from the groups consisting of:SEQ ID NOs: 92-110; SEQ ID NOs: 130-148; SEQ ID NOs: 168-186; SEQ ID NOs: 206-224; SEQ ID NOs: 244-262; SEQ ID NOs: 282-300; SEQ ID NOs: 320-338; SEQ ID NOs: 358-376; SEQ ID NOs: 396-414; SEQ ID NOs: 434-452; SEQ ID NOs: 472-490; SEQ ID NOs: 510-528; SEQ ID NOs: 548-566; SEQ ID NOs: 587-606; SEQ ID NOs: 626-644; SEQ ID NOs: 664-682; SEQ ID NOs: 702-720; SEQ ID NOs: 740-758; SEQ ID NOs: 778-796; SEQ ID NOs: 817-836; SEQ ID NOs: 857-876; SEQ ID NOs: 896-914; SEQ ID NOs: 934-952; SEQ ID NOs: 972-990; SEQ ID NOs: 1011-1030; SEQ ID NOs: 1052- 1072; SEQ ID NOs: 1092-1 110; SEQ ID NOs: 1130-1148; SEQ ID NOs: 1 168-1186; SEQ ID NOs: 1207- 1226; SEQ ID NOs: 1247-1266; SEQ ID NOs: 1287-1306; or SEQ ID NOs: 1326-1344.

[0026] In some embodiments the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO:7 (A / RAS_c.178G>C_p.G60R), SEQ ID NO:9 (A / RAS_c.179G>T_p.G60V), SEQ ID NO:11 (A / RAS_c.179G>A_p.G60E), SEQ ID NO:13(A / RAS_c.181 C>A_p.Q61 K), SEQ ID NO:15 (A / RAS_c.182A>G_p.Q61 R), SEQ ID NO:17(A / RAS_c.182A>T_p.Q61 L), SEQ ID NO:19 (A / RAS_c.182A>C_p.Q61 P), SEQ ID NO:21(A / RAS_c.183A>C_p.Q61 H), SEQ ID NO:23 (A / RAS_c.183A>T_p.Q61 H), SEQ ID NO:25(A / RAS_c.35G>T_p.G12V), SEQ ID NO:27 (A / RAS_c.34G>C_p.G12R), SEQ ID NO:29(A / RAS_c.35G>A_p.G12D), SEQ ID NO:31 (A / RAS_c.34G>A_p.G12S), SEQ ID NO:33(A / RAS_c.34_35G>C_ p.G12P), SEQ ID NO:35 (A / RAS_c.34G>T_p.G12C), SEQ ID NO:37 (A / RAS_c.35G>C_p.G12A), SEQ ID NO:39 (A / RAS_c.37G>A_p.G13S), SEQ ID NO:41(A / RAS_c.37G>T_p.G13C), SEQ ID NO:43 (A / RAS_c.37G>C_p.G13R), SEQ ID NO:45(A / RAS_c.37_38delinsTT_ p.G13F), SEQ ID NO:47 (A / RAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO:49 (A / RAS_c.38G>T_p.G13V), SEQ ID NO:51 (A / RAS_c.38G>A_p.G13D ), SEQ ID NO:53(A / RAS_c.38G>C_p.G13A), SEQ ID NO:55 (A / RAS_c.180_181delinsTA), SEQ ID NO:57 (A / RAS_c.181_183delinsAAG), SEQ ID NO:59 (BRAF_c.1799T>G.p.V600G), SEQ ID N0:61 (BRAF_c.1798G>A.p.V600M), SEQ ID NO:63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO:65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO:67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO:69 (BRAF_c.1799_1800delisAA_p.V600E) and SEQ ID N0:71 (BRAF_c.1799T>A.p.V600E).

[0027] The present invention provides a compound comprising a nucleic acid molecule according to the invention and a targeting moiety. In some embodiments the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof. In some embodiments the targeting moiety comprises a conjugate group, and wherein the conjugate group comprises one or more carbohydrates.

[0028] In some cases, the present invention provides a compound comprising a nucleic acid molecule according to the invention and a nanoparticle. The nanoparticle may be a receptor-targeted nanoparticle (RTNP). A receptor-targeted nanoparticle generally shows specificity for a particular receptor, cell type, tissue, organ, or other. Receptor-targeted nanoparticles therefore allow targeted delivery of the nucleic acid molecule of the invention. The nucleic acid molecule may be encapsulated within the nanoparticle or receptor-targeted nanoparticle. Receptor-targeted nanoparticles useful in the present invention may comprise a peptide sequence which binds to a receptor. The receptor may be a KIT receptor. For example, the receptor-targeted nanoparticle may comprise a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity to the sequence ISVYMM (SEQ ID NO: 1349). The receptor-targeted nanoparticle may comprise a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity to the sequence NRVTNN (SEQ ID NO: 1350). The receptor may be an integrin. For example, the receptor-targeted nanoparticle may comprise a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity to the sequence CRGDCL (SEQ ID NO: 1351). The receptor-targeted nanoparticle may comprise a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity to the sequence CDGRCL (SEQ ID NO: 1352).

[0029] In some embodiments the conjugate group comprises a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-Mannopyranose, D- Arabinose, L-Galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-Galactose, L- Galactose, a-D-Mannofuranose, p-D-Mannofuranose, a-D-Mannopyranose, p-D-Mannopyranose, a-D- Glucopyranose, p-D-Glucopyranose, a-D-Glucofuranose, p-D-Glucofuranose, a-D-fructofuranose, a-D- fructopyranose, a-D-Galactopyranose, p -D-Galactopyranose, a-D-Galactofuranose, p -D- Galactofuranose, glucosamine, sialic acid, a-D-galactosamine, N-Acetylgalactosamine, 2-Amino-3-O- [(R)-1 -carboxyethyl]-2-deoxy-p-D-glucopyranose, 2-Deoxy-2-methy lamino-L-glucopyranose, 4,6- Dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-Deoxy-2-sulfoamino-D-glucopyranose, N-Glycoloyl-a-neuraminic acid, 5-thio-p-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-a-D- glucopyranoside, 4-Thio-p-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1 ,5-dithio-a-D- gluco-heptopyranoside, 2,5-Anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose or L-4- thioribose.

[0030] In some embodiments the targeting moiety is linked to the 3’ end of the second strand. In some embodiments the targeting moiety is linked to the 5’ end of the second strand. In some embodiments the targeting moiety is linked to the 5’ end of the first strand. In some embodiments the targeting moiety is linked to the 3’ end of the first strand.

[0031] In some embodiments at least one nucleoside comprises a modified sugar. In some embodiments at least one internucleoside linkage is a modified internucleoside linkage. In some embodiments the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. In some embodiments the nucleic acid molecule comprises 1 to 40 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments the nucleic acid molecule comprises 1 to 30 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments the nucleic acid molecule comprises 1 to 20 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments the nucleic acid molecule comprises 1 to 10 phosphorothioate or phosphorodithioate internucleoside linkages.

[0032] The present invention provides a composition comprising the single-stranded nucleic acid molecule or compound according to the invention or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. The present invention provides a prodrug comprising the nucleic acid molecule or compound of the invention.

[0033] The present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with a target sequence in a cell and wherein the target sequence encodes a variant allele of NRAS or BRAF.

[0034] The present invention provides a CRISPR nuclease system comprising one or more vectors comprising:(a) a promoter operably linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes a target DNA sequence in a cell of the subject, and wherein the target sequence encodes a variant allele of NRAS or BRAF; and(b) a nucleotide sequence encoding a nuclease, for example a Cas nuclease, wherein components (a) and (b) are located on the same or different vectors of the system, wherein the gRNA targets and hybridizes with the target DNA sequence and the nuclease cleaves the target sequence to alter expression of the variant allele of NRAS or BRAF.

[0035] In some embodiments the CRISPR nuclease system is packaged into a single adeno- associated virus (AAV) particle. In some embodiments the nuclease is codon optimized for expression in the cell. In some embodiments the promoter is operably linked to at least one, two, three, four, five, six, seven, eight, nine, or ten gRNA.

[0036] In some embodiments the gRNA targets a DNA sequence encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D). In some embodiments the gRNA targets a DNA sequence encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P). In some embodiments the gRNA targets a DNA sequence encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments the gRNA targets a DNA sequence encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y). In some embodiments the gRNA targets a DNA sequence encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments the gRNA comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the groups consisting of: SEQ ID NOs: 1345-1347. In some embodiments the gRNA comprises a sequence selected from the groups consisting of: SEQ ID NOs: 1345-1347. In some embodiments the gRNA consists of a sequence selected from the groups consisting of: SEQ ID NOs: 1345-1347.

[0037] In some embodiments the target DNA sequence is selected from the group consisting of SEQcombinations thereof.

[0038] The present invention provides a method of treating a patient having a disease or disorder associated with or driven by overexpression of NRAS, the method comprising administering to thepatient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides a method of treating a patient having a disease or disorder associated with or driven by variants in NRAS, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0039] The present invention provides a method of treating a patient having a disease or disorder associated with or driven by overexpression of BRAF, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides a method of treating a patient having a disease or disorder associated with or driven by variants in BRAF, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0040] The present invention provides a method of treating a patient having a melanocytic disease, disorder or lesion, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0041] The present invention provides a method of treating a patient having congenital melanocytic naevi (CMN), the method comprising administering to the patient nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides a method of treating a patient having acquired melanocytic naevi (AMN), the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0042] The present invention provides a method of treating a patient having a mosaic disorder, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides a method of treating a patient having cancer, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0043] In some embodiments the cancer is selected from the list consisting of: Melanoma, Adrenal gland cancer, Autonomic ganglia cancer, Biliary tract cancer, Bone cancer, Breast cancer, Central nervous system cancer, Cervix cancer, Endometrium cancer, Eye cancer, Fallopian tube cancer, Female genital tract cancer, Gastrointestinal tract cancer, Genital tract cancer, Haematopoietic cancer, lymphoid cancer, Kidney cancer, Large intestine cancer, Liver cancer, Lung cancer, Meninges cancer, Oesophagus cancer, Ovary cancer, Pancreas cancer, Parathyroid cancer, Penis cancer, Perineum cancer, Peritoneum cancer, Pituitary cancer, Placenta cancer, Pleura cancer, Prostate cancer, Salivary gland cancer, Skin cancer, Small intestine cancer, Soft tissue cancer, Stomach cancer, Testis cancer, Thymus cancer, Thyroid cancer, Upper aerodigestive tract cancer, Urinary tract cancer, Uterine adnexacancer, Vagina cancer and Vulva cancer. In some embodiments the cancer is melanoma. In some embodiments the cancer is a haematological cancer, meninges cancer, adrenal gland cancer or thyroid cancer.

[0044] The present invention provides a method of treating a benign tumour in a subject, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. Benign lesions, particularly benign tumours such as colonic polyps and thyroid nodules, have been shown to be associated with mutations in NRAS and BRAF (Marotta, V., Bifulco, M. & Vitale, M. Significance of RAS Mutations in Thyroid Benign Nodules and Non-Medullary Thyroid Cancer. Cancers (Basel) 13 (2021); Dos Santos, W. et al. Somatic targeted mutation profiling of colorectal cancer precursor lesions. BMC Med Genomics 15, 143 (2022)). The benign tumour may be associated with or driven by variants in NRAS, and / or by overexpression of NRAS. In some cases, the method comprises administering to the subject a compound or composition that specifically targets a variant allele of NRAS. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(Q61 K / R / H / L / P) substitution. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(G12R / S / D / P / C / A / V) substitution. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(G60R / E / D / V) substitution. The benign tumour may be associated with or driven by variants in BRAF, and / or by overexpression of BRAF. In some cases, the method comprises administering to the subject a compound or composition that specifically targets a variant allele of BRAF.

[0045] The present invention provides a method of treating a polyp in a subject, such as a colonic polyp, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0046] The present invention provides a method of treating a thyroid nodule in a subject, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.

[0047] In some embodiments the nucleic acid molecule, compound, composition or prodrug according to the invention is administered in combination with a second therapeutic agent.

[0048] The present invention provides a method of treating a patient having congenital melanocytic nevi (CMN) the method comprising administering to the patient a compound or composition that specifically targets a variant allele of NRAS. The present invention provides a method of treating a patient having cancer, the method comprising administering to the patient a compound or composition that specifically targets a variant allele of NRAS. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(Q61 K / R / H / L / P) substitution. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(G12R / S / D / P / C / A / V) substitution. In someembodiments the variant allele of NRAS comprises a mutation that causes a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments the variant allele of NRAS comprises a mutation that causes a p.(G60R / E / D / V) substitution.

[0049] The present invention provides a method of treating a patient having congenital melanocytic nevi (CMN) the method comprising administering to the patient a compound or composition that specifically targets a variant allele of BRAF. The present invention provides a method of treating a patient having cancer, the method comprising administering to the patient a compound or composition that specifically targets a variant allele of BRAF. In some embodiments the variant allele of BRAF comprises a mutation that causes a p.(V600G / M / D / R / K / E) substitution.

[0050] The present invention provides an expression construct comprising a nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides an isolated nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention. The present invention provides a vector comprising the isolated nucleic acid molecule of the invention. In some embodiments the vector is a viral vector, retroviral vector, expression cassette, or plasmid. In some embodiments the vector further comprises an RNA Polymerase III or RNA Polymerase II promoter. In some embodiments the RNA Polymerase III promoter is the U6 or H1 promoter.

[0051] The present invention provides a host cell comprising the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention, the isolated nucleic acid molecule according to the invention or vector according to the invention. In some embodiments the host cell is a mammalian host cell. In some embodiments the host cell is a human host cell.

[0052] In some embodiments the nucleic acid molecule, compound, composition or prodrug is formulated for delivery with a lipid-based nanoparticle, a liposome, an exosome, a polymeric nanoparticle, an inorganic nanoparticle or a ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplex (RTNP). In some embodiments the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is not packaged for delivery (gymnotic delivery). In some embodiments the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered by injection. In some embodiments the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is injected using a microneedle. In some embodiments the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered topically. In some embodiments the administration further comprises electroporation or ultrasound.BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 - Identification of siRNA with allelic discrimination for NRAS c.181C>A mutation, (a) Experimental design for selecting optimal siRNA candidate targeting NRAS c.181 C>A. (b) siRNA with the potential to knockdown the variant NRAS transcript were designed with a “walking” approach over the mutation of interest (vertical grey bar NRAS c.181 C>A). The 3’ end of siRNA complimentary sequences is completed with two uracil nucleotides which have been reported to improve their activity. Note that the sequences illustrated in the panel are the passenger strands for ease of interpreting corresponding nucleotides. siRNAs 1 , 8 and 15 are colour coded for reference in other panels of this figure, (c) The impact of siRNA treatment on the expression of NRAS transcript expression was investigated with qPCR. siRNA8 (blue) and siRNA15 (red) were selected based on their propensity to reduce the variant NRAS transcript and not the WT NRAS transcript. siRNAI (green) was included in these experiments as a comparative control as it minimised both variant and WT NRAS expression, (d) Assessment of allelic discrimination. Positive values indicate specificity for the NRAS c.181 C>A mRNA transcript, negative values indicate specificity for the NRAS WT mRNA transcript.

[0054] Figure 2 - Evaluation of candidate siRNA specificity. The qPCR data from previous experiments were validated with RNA-seq to confirm that the selected candidates do selectively minimise expression of A) variant NRAS compared to B) WT NRAS (n=3, SEM), C) WT KRAS, and D) WT HRAS. E) Volcano plots demonstrating the impact of siRNA candidates on the transcriptome of variant NRAS cells (E) and WT NRAS cells (F). Circles mark the position of NRAS in this data set. G) Analysis of the RNA-seq data was refined to computationally predicted targets of each RNA. The sequence of each siRNA was blasted against human cDNA database. Those genes with close homology (i.e. predicted off-targets) were investigated in the RNA-seq dataset. Genes with the greatest decrease in expression for each siRNA are illustrated (n=3, SEM).

[0055] Figure 3 - In vitro growth of congenital melanocytic naevi (CMN) patient-derived NRAS variant cells, (a) In vitro culture of CMN patient-derived naevus cells without feeder cells, (b) Ptychographic image of CMN patient-derived naevus cells, (c) Cell counts of four patients’ CMN-derived naevus cell cultures over 24 hours, (d) Nuclear SOX10 and cytoplasmic Tyrosinase expression in proliferating (EdU) naevus cells (d(i)) and cells that did not divide (EdU-) (ii). (e) Selective proliferation of CMN-derived naevus cells reveal somatic NRAS c.181 C>A (Patient #) or less common NRAS c.182A>G (Patient #) appearing as heterozygous reads on Sanger sequencing, (f) Variety of naevus cell morphologies ranging from nonpolar cells to increasingly complex and dilated multipolar cells, (g) Evaluation of classification tool presented as a confusion matrix, (h) Fraction of each cell morphology for four different patient cell lines.

[0056] Figure 4 - Treatment of naevus cells with anti-NRASQeiKsiRNA decreases MAPK activation and proliferation, (a) Experimental design for assessing proliferation following treatment of CMN patient-derived naevus cells with ar\t\-NRASQ61KsiRNA, (b) Relative levels of NRASVVYmRNA following anti-NRASQ6)KsiRNA treatment normalised to untreated cells, (c) Relative levels of NRASQ61KmRNA following ant\-NRASQ61KsiRNA treatment normalised to untreated cells, (d) Relative levels of total NRAS protein following anti-NRASQ6)KsiRNA treatment normalised to untreated cells, (e) Relativeactivation of the MAPK signalling pathway following ant\-NRASQ61KsiRNA treatment normalised to untreated cells, (f) Western blot showing relative levels of total NRAS, pERK, total ERK and Vinculin following ant\-NRASQ61KsiRNA treatment in 2 CMN patient-derived naevus cell cultures, (g) Ptychographic images of naevus cells during the second day of siRNA8 treatment, (h) Cell count for ant\-NRASQ61KsiRNA treated cells levels over 24 hours, (i) EdU positive naevus cells (SOXI O / Tyrosinase) following Trametinib and or ar\t\-NRASQ61KsiRNA treatment, (j) Quantification of EdU positive naevus cells following Trametinib and or an -NRASQ61KsiRNA treatment normalised to untreated cells. All error bars = standard deviation, (b-h) N=4 patients, (i-j) N=3 patients.

[0057] Figure 5 - Treatment of CMN patient-derived naevus cells with anti NRASQ61 K siRNA and naevus cells characteristics (expression / morphology), (a) Fraction of each cell morphology for four different patient cell lines following anti-A / RASQ61 K siRNA8 treatment, (b-e) Impact of siRNA on naevus cells morphologies, N=4, bars=SD, 2_,tailed t-test. (f) anti-A / RASQ61 K siRNA8 treatment on EdU positive cells (N=9, bars=SD). (g) anti-A / RASQ61 K siRNA8 treatment on Tyrosinase expression (N=9, bars=SD). (h) anti-A / RASQ61 K siRNA8 treatment on SOX10 expression (N=9, bars=SD). (i) anti- A / RASQ61 K siRNA8 treatment on MITF expression (N=9, bars=SD). (j) anti-A / RASQ61 K siRNA8 treatment on Nestin expression (N=9, bars=SD).

[0058] Figure 6 - Intradermal delivery of lipid nanoparticles containing siRNA to the site of naevus cells in human and mouse skin, (a) Lipid nanoparticles containing siRNA were injected with microneedles into the dermis of a biopsy collected from a human with CMN (A / RASQ61 K positive patient), (b) Control skin from the same patient, (c) Lipid nanoparticles containing siRNA were injected with microneedles into the dermis of a mouse model of CMN (Tg(Tyr-A / RAS*Q61 K)1 Bee). (d) Control skin from the same mouse..

[0059] Figure 7 - Identification of three sgRNAs covering the NRAS c.(181C>A) mutation. The wildtype allele c.(181 C) is highlighted in red. sgRNA sequences are coloured in green and the corresponding SaCas9 PAM sequences in blue. The bases at loci c.(181) have been highlighted in yellow to show the change from the wildtype allele c.(181 C) to the variant allele of interest c.(181A).

[0060] Figure 8 - Enzymatic digestions confirms correct insertion of sgRNA1-3 into plasmid vector px601 . A BciVI enzymatic digest screen for the confirmation of either sgRNAI or 2 insertion into the px601 plasmid for 3 colonies plasmids 1 , 2, and 3). This shows a Earl enzymatic digest screen for the confirmation of sgRNA3 insertion into the px601 plasmid in four colonies (plasmids 1 through 4). Negative controls consist of the px601 plasmid without any attempted insert. The positive control consists of a plasmid previously obtained and confirmed by sequencing to have the sgRNAI insert. A breakdown of expected fragment sizes (bp) is shown beneath the picture of the agarose gels. The fragmentation sizes were deduced using the Serial Cloner v.2.6.1 programme.

[0061] Figure 9 - BciVI enzymatic screen showing correct insertion of sgRNAI and 2 into the px601-GFP plasmid in all tested colonies. Three plasmids were tested for the insertion of sgRNAI orsgNRA2. The last lane contains a negative control of px601-GFP without an insert. GFP sgRNA 1.1 , 1 .2, and 1 .3 were three separate colonies that were screened for the insertion ofsgRNAI into the px601- GFP plasmid. GFP sgRNA 2.1 , 2.2, and 2.3 were three separate colonies that were screened for the insertion of sgRNA2 into the px601-GFP plasmid. The fragmentation sizes were deduced using the Serial Cloner v.2.6.1 programme.

[0062] Figure 10 - Earl enzymatic screen showing correct insertion of sgRNA3 into the px601- GFP plasmid in all tested colonies. Three px601-GFP plasmids (GFP sgRNA 3.1 , 3.2, and 3.3) were screened for the insertion of sgRNA3. The last lane contains a negative control of px601- GFP without an insert. The fragmentation sizes were deduced using the Serial Cloner v.2.6.1 programme.

[0063] Figure 11 - T7 enzymatic digest showing the presence of allele-specific gene editing by px601-GFP-sgRNA2 in the HCT116-Q (NRAS-variant) cell line. PCR products of size 827bp were digested with the T7 enzyme, in the presence of a positive result two fragments of sizes 372 and 455bp are produced. The figure shows the triplicate biological repeats for each sgRNA in both the HCT116-P and HCT116-Q cell lines; the first sample labelled HCT116-P 1 .1 is the result of the first replicate of the transfection of px601-GFP-sgRNA1 in the HCT116-P cell line. Cells were transfected 48 hours prior to DNA extraction using 250ng of DNA and 3pL of Lipofectamine® 2000 per well of a 24-well plate.

[0064] Figure 12 - Sequencing data from single cell colonies showing gene editing by sgRNAI and 2 in HCT116-Q cell line only. The DNA sequence of all edited single cell colonies compared to both the NRAS Wildtype Sequence and the NRAS-variant c.(181 C>A) Sequence. The NRAS c.(181) loci is highlighted in red for the wildtype allele and yellow for the variant allele. Cells highlighted in blue shows the result of a gene editing events. The first table shows all the deletions by px601-GFP-sgRNA2 in HCT1 16-Q. The second table shows the insertions by px601-GFP-sgRNA1 in HCT116-Q in colony 12, due to the size of the insert, this result is shown over two lines despite it being a single sample. The third table shows all the deletions by px601-GFP- sgRNAI in HCT1 16-Q in colony 18. The fourth table shows the indel by px601-GFP-sgRNA1 in HCT116-Q in colony 16. Single cell colonies that did not show any gene editing have not been shown.

[0065] Figure 13 - Impact of candidate siRNAs on MAPK pathway. siRNAs decrease p-ERK in the NRAS variant cell line (c.181 C>A, NRASQ61 K) compared to the NRAS wild type cell line (c.181 C, NRASWT). Total ERK and GAPDH are included as comparative loading controls.

[0066] Figure 14 - Treatment of naevus cells with siRNA8. a, Relative proliferation rate as assessed with EdU incorporation during final 24 hours of siRNA8 treatment (48 hours), b, Relative proliferation of naevus cells during 48 hour treatment (hours 24-48) using ptychographic imaging / analysis. c, RNAseq normalised counts for NRAS. Fraction of NRASWT and NRASQ61 K transcript were calculated based on reads covering the location of the NRAS variant, d, Volcano plot illustrating fold change and false discovery rate. Genes with very strong significance and fold change are labelled, e, Heatmap illustrating genes in pathways responding to siRNA8 (*Metascape WP2290 RALAdownstream regulated genes; M53 PID INTEGRIN3 PATHWAY; GQ0007346 regulation of mitotic cell cycle; GQ:0007272ensheathment of neurons; G0:0008366 axon ensheathment) and melanocyte stem cell and differentiation associated genes which were relatively unaffected. N = 7 patients, bars = average; error bars = SD, one-tailed unpaired t-test. N = 4 patients; points = average; error bars = SD, one-way ANOVA.

[0067] Figure 15 - Targeting NRAS variant in naevus cells from CMN patient tissue, a, Dosedependent effects on NRASWT (grey) and NRASc.181 C>A (black) transcript expression following 48 hours of treatment of naevus cells with different concentrations of siRNA8 (siNRASQ61 K). RNAiMAX was used as the delivery vector and the arrow is the concentration suggested in the manufacturers protocol. Two patient derived naevus cell lines were tested (individual circles at each time point), with the perforated line representing the average of the two. b, Western blot of protein lysates collected from all naevus patient cell cultures treated with siCTRL or siNRASQ61 K for 48 hours. All images are from the same blot. Chemiluminescence imaging was required to detect NRAS protein levels as it was more sensitive than the Odyssey. The Odysee (fluorescence) was required to assess pERK levels as it permitted simultaneous measurement of total ERK and pERK by using secondary antibodies conjugated to fluorophores of different wavelengths. c,d, impact of 48 hour siNRASQ61 K treatment of naevus cells on NRAS homologues KRAS (g) and HRAS (h). e, Top 10 enriched pathways from genes with expression changed (criteria: >1fold; <-1fold; p<0.05) by 48 hours siNRASQ61 K treatment of naevus cells, f, fraction of naevus cells in each stage of the cell cycle (estimated based on DNA content) following 48 hours siNRASQ61 K treatment.

[0068] Figure 16 - Treatment of naevus cells with siNRASQ61 K leads to endoplasmic reticulum (ER) stress and apoptosis, a, ER localised expression of ARL6IP1 in patient-derived naevus cells, b- e, Following 48 hours of treatment with siNRASQ61 K the expression of ARL6IP1 mRNA is decreased(b), the expression of ARL6IP1 protein is decreased (c), the expression of ER stress sensor, ERN1 (IRE1) is increased (d), and the expression of anti-apoptotic Survivin (BIRC5) is decreased (e). f, Caspase 3 / 7 activity in cells treated with siNRASQ61 K over 7 days. N = 7 patients (b,d,e), N = 8 patients(c), bars = average, error bars = SD, one-tailed unpaired t-test. N = 4, bars = average, error bars = SD, two-way ANOVA (f).

[0069] Figure 17 - Gene expression and antibody reactivity to naevus cells (NRAS c.181C>A (p.Q61 K) treated with siNRASQ61 K for 48 hours. RNAseq data (normalised counts) and relative signal intensity from antibody reactivity for a, TYR, b, SOX10, c, MITF, d, NES, e, DCT, f, CDKN2A, g, P53 and h, ARL6IP1 (note quantification of ARL6IP1 antibody reactivity is in main text). N=7 (Individual values), bars = average, error bars = SD, paired t-test. i, Immunocytochemistry showing decreased ARL6IP1 (magenta) expression in response to 48 hour siNRASQ61 K treatment. ARL6IP1 was assessed alongside an antibody targeting Ribophorin 1 (endoplasmic reticulum, green).

[0070] Figure 18 - Genes of interest in HCT116 dataset and endoplasmic reticulum stress associated genes in naevus cell RNAseq dataset, a-c, RNAseq expression data following 48 hourtreatment of HCT116 cells (c.181 C>A, NRASQ61 K) with siNRASQ61 K . a, Volcano plot showing comparable decrease of ARL6IP1 (ARMER, apoptotic regulator in the membrane of the endoplasmic reticulum) and NRAS expression, b, Decrease of ARL6IP1 expression following treatment with siNRASQ61 K . c, Decrease of Survivin (BIRC5) expression following treatment with siNRASQ61 K . d-f, RNAseq expression data of the three primary ER stress regulators ERN1 (IRE1) (d), EIF2AK3 (PERK) (e) and ATF6 (f) after 48 hour treatment of naevus cells with siNRASQ61 K . g, qPCR validation of EIF2AK3 result on RNAseq did not return a statistically significant difference. N=7, bars = average, error bars = SD, two-tailed upaired t-test.

[0071] Figure 19 - Treatment of naevus cells with siNRASQ61 K permits effectiveness and synergy with trametinib. A, Caspase 3 / 7 activity in patient naevus cells after 5 days of treatment with siNRASQ61 K in combination with trametinib at two concentrations (5nM and 12.5nM). b, Caspase 3 / 7 activity in cells treated with (perforated line) or without (solid line) 12.5nM trametinib in combination with siNRASQ61 K over 5 days. N = 4 patients; (a) bars = average, error bars = SD, one-way ANOVA. N = 5 technical replicates for each patient, points = average, error bars = SD, one-way ANOVA (b).

[0072] Figure 20 - Impact of lower concentrations of trametinib and siRNA combination treatment on proliferation. Quantification of EdU assay of naevus cells (NRAS c.181 C>A (p.Q61 K)) (N=4) treated with siNRASQ61 K for 5 days in combination with trametinib at lower concentrations (5nM and 12.5nM). Cells were treated with EdU in the final 24 hours of the 5 day treatment.

[0073] Figure 21 - In vivo delivery and knockdown of naevus cell causing NRAS variant with siRNA8 loaded lipid nanoparticles. A, Intradermal injection of naevus patient biopsy with siRNA-cy5 encapsulated in lipid nanoparticles. B, siRNA encapsulated in lipid nanoparticles could be delivered to the cells of the dermis of naevus patient biopsy. C, siRNA not encapsulated in lipid nanoparticles delivered relatively little into the cells of the dermis of naevus patient biopsy. D, Naevus causing NRAS variant expression driven by the melanocyte specific tyrosinase promoter causes ectopic pigment cells in the dermis and hypodermis of Tyr::NRASQ61 K mice. E, No ectopic pigment cells in the dermis or hypodermis of NRASWT mice. F, Intradermal injection of Tyr::NRASQ61 K mice with siRNA8 decreased the expression of naevus cell causing NRAS variant. G, Intradermal injection of Tyr::NRASQ61 K mice with siRNA8 did not decrease the expression of endogenous mouse NrasWT . N = 8, data pooled together from two experiments, points = individual mice (closed circles = mice treated for 24 hours, open circles = mice treated for 48 hours), bars = average, error bars = SD, unpaired one-tailed t-test (f,g).

[0074] Figure 22 - Lipid nanoparticles. The a, size (Zeta-average diameter), b, charge (Zetapotential) and c, siRNA encapsulation of lipid nanoparticles formulated at different ratios were assessed, d, Formulation of lipid nanoparticles at 1 :4:1 (lipid:peptide:siRNA) ratios protected siRNA from RNases better than siRNA alone, e, Visualisation and f, particle size distribution of RTNPs calculated with NanoSight instrument (Malvern), g, Delivery of siRNA-cy5 to naevus cells with RTNPs formulated using different peptides (KKKKKKKKKKKKKKKKGACXXXXXXCG) (SEQ ID NO: 1348) with thetargeting motif (XXXXXX): ISVYMM (SEQ ID NO: 1349) (reported to bind to KIT), NRVTNN (SEQ ID NO: 1350) (predicted to bind to KIT), CRGDCL (SEQ ID NO: 1351) (reported to bind to a5p1 , avp5, and avp3 integrin) and CDGRCL (SEQ ID NO: 1352) (no known target).

[0075] Figure 23 - Intradermal delivery of siRNAQ61 K in mouse model of CMN. a, Tyr::NRASQ61 K mice (Tg(Tyr-NRAS*Q61 K)1 Bee in which expression of the human disease causing variant NRAS c.181 C>A,p.(Q61 K) is driven by the endogenous mouse tyrosinase promoter, b, Mice heterozygous for the transgene show widespread skin hyperpigmentation with accumulation of melanin producing cells within the dermis, recapitulating the human phenotype of CMN to a large degree. c,d, Biopsies of skin taken one hour after a single intradermal injection of c, a fluorescent siRNA-Cy5 within lipid nanoparticles or d, lipid nanoparticles only.

[0076] Figure 24 - siRNA treatment of BRAF-mutant melanoma cell lines. A375, SKMEL28 are homozygous mutant cell lines, A2058 and G-361 are heterozygous cell lines. siSCRA used as negative control siUBB used as positive control for caspase activation. A) Proliferation analysis determined by percentage confluency. Data shown as mean ±SD of triplicate wells. B) Apoptosis analysis determined by caspase 3 / 7 activity. Data shown as mean ±SD of triplicate wells. Statistical differences between siSCRA and siBRAFV600E examined by unpaired T-test, p>0.05.

[0077] Figure 25 - siRNA treatment of BRAF-mutant melanoma cell lines. Results are the same as those shown in Figure 24, but without displaying the positive control siUBB to allow better visualisation of the changes.

[0078] Figure 26 - siRNA treatment of leptomeningeal melanocytosis (LM). A) % confluency of primary naevus cell cultures isolated from LM patient biopsies and treated with siRNA8 targeting variant NRAS. B) Caspase 3 / 7 activation in primary naevus cell cultures isolated from LM patient biopsies and treated with siRNA8 targeting variant NRAS. ****p<0.0001 .DETAILED DESCRIPTION OF THE INVENTIONDefinitions

[0079] Below are provided certain definitions of terms, technical means, and embodiments used herein.

[0080] As used herein, the term “mosaicism” or “genetic mosaicism” refers to a condition in multi-cellular organisms in which a single organism possesses more than one genotype as the result of genetic mutation to a single cell during development of the embryo or fetus. The offspring of that cell then all contain the same mutation, which will in addition only be present in those cells. A recent consensus definition is the coexistence of more than one genotype in an individual derived from a single zygote by the time of birth, and producing a disease phenotype [1] although the phenotype may not appear until any time after birth. Genetic mosaicism can result from many different molecular mechanisms, and lead to mosaicism at different genetic levels - for example mosaicism can relate to asingle point mutation or to a whole chromosome aneuploidy. Mosaic variants can be passed on to future generations as a germline heterozygous mutation if two conditions are met - firstly that it affects the germ cells (usually not ascertainable) and secondly if the mutation is compatible with life in the germline (often but not always known from epidemiological studies) [1 ,2,3]. Mosaicism is also sometimes used to describe the co-existence of two genotypes in one individual where the variant or mutation arises after birth.

[0081] The term "gain-of-function variant" as used herein, refers to any variant in a gene in which the protein encoded by said gene (i.e., the variant protein) has a variant that confers new or enhanced function on a protein with respect either to its intrinsic function or to its effect on interacting molecules or cascades of molecular interactions, which may in itself act via changes in the protein's intrinsic activity, or via alteration of its interactions with other molecules. The gain-of-function variant can be a deletion, insertion, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the function of the encoded protein. In one embodiment, the gain-of-function variant changes the function of the variant protein or changes the interactions with other proteins. In another embodiment, the gain- of-function mutation causes a decrease in or removal of normal wild-type protein, for example, by interaction of the altered, variant protein with said normal, wild-type protein. In another embodiment, the gain-of-function variant causes an increase or decrease in the normal function of the protein such that its activity or some or all of its downstream effects are increased or exaggerated or accentuated, constitutively and / or under relevant physiological stimuli.

[0082] The term ‘variant’ may encompass both disease causing genetic mutations and benign mutations with no effect on the function of the gene. All types of DNA changes that produce that protein change are included, such as a deletion, addition, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the amino acid sequence of the encoded protein.

[0083] An “expression construct” can be for example, a viral vector, retroviral vector, expression cassette or plasmid. The expression construct can also have an RNA polymerase II promoter sequence or RNA Polymerase II promoter sequence, such as, U6 snRNA promoter of H1 promoter. Expression constructs of the present invention include any construct suitable for use in the appropriate expression system and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids and viral or virally-derived vectors, as known in the art. Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems such as U6 snRNA promoters or HI RNA polymerase III promoters, or other promoters known in the art. The constructs can include one or both strands of the siRNA. Expression constructs expressing both strands can also include loop structures linking both strands, or each strand can be separately transcribed from separate promoters within the same construct. Each strand can also be transcribed from a separate expression construct.

[0084] As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%,15%, 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%), 6%), 5%, 4%, 3%, 2%, 1 %), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0085] As used herein, the term "amelioration" means the prevention, reduction or palliation of a state, or improvement of the state of a subject or in disease biomarkers of severity or outcome. Amelioration includes, but does not require, complete recovery or complete prevention of a disease condition.

[0086] The term "comparable", as used herein, refers to a system, set of conditions, effects, or results that is / are sufficiently similar to a test system, set of conditions, effects, or results, to permit scientifically legitimate comparison. Those of ordinary skill in the art will appreciate and understand which systems, sets of conditions, effects, or results are sufficiently similar to be "comparable" to any particular test system, set of conditions, effects, or results as described herein.

[0087] The term "correlates", as used herein, has its ordinary meaning of "showing a correlation with". Those of ordinary skill in the art will appreciate that two features, items or values show a correlation with one an-other if they show a tendency to appear and / or to vary, together. In some embodiments, a correlation is statistically significant when its p-value is less than 0.05; in some embodiments, a correlation is statistically significant when its p-value is less than 0.01 . In some embodiments, correlation is assessed by regression analysis. In some embodiments, a correlation is a correlation coefficient.

[0088] As used herein, the terms "improve," "increase" or "reduce," or grammatical equivalents, indicate values that are relative to a reference (e.g., baseline) measurement, such as a measurement taken under comparable conditions (e.g., in the same individual prior to initiation of treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of treatment) described herein.

[0089] As used herein, a "polypeptide", generally speaking, is a string of at least two amino acids attached to one another by a peptide bond. In some embodiments, a polypeptide may include at least 3-5 amino acids, each of which is attached to others by way of at least one peptide bond. Those of ordinary skill in the art will appreciate that polypeptides sometimes include "non-natural" amino acids or other entities that nonetheless are capable of integrating into a polypeptide chain, optionally.

[0090] As used herein, the term "protein" refers to a polypeptide (i.e. , a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and / or may be otherwise processed or modified. Those of ordinary skill in the art will appreciate that a "protein" can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof. Those of ordinary skill will appreciate that a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-aminoacids, D- amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.

[0091] As used herein, the term "subject", "individual", or "patient" refers to any organism upon which embodiments of the invention may be used or administered, e.g. , for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.). In a preferred embodiment of the invention the subject is a human.

[0092] As used herein , the terms "target cell" or "target tissue" refers to any cell, cell type, tissue, or organism. In preferred embodiments, the target cell or target tissue is a vascular cell, a melanocytic cell, and / or any other cell type which contains the mutation.

[0093] As used herein, the term "therapeutic regimen" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and / or reduce incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. It may include administration of one or more doses, optionally spaced apart by regular or varied time intervals. In some embodiments, a therapeutic regimen is one whose performance is designed to achieve and / or is correlated with achievement of (e.g., across a relevant population of cells, tissues, or organisms) a particular effect, e.g., reduction or elimination of a detrimental condition or disease. In some embodiments, treatment includes administration of one or more therapeutic agents either simultaneously, sequentially or at different times, for the same or different amounts of time. In some embodiments, a "treatment regimen" includes genetic methods such as gene therapy, gene ablation or other methods known to induce or reduce expression (e.g. transcription, processing, and / or translation of a particular gene product, such as a primary transcript or mRNA).

[0094] As used herein, the term "therapeutically effective amount" refers to an amount of a therapeutic agent which confers a therapeutic effect on the treated subject, at a reasonable benefit / risk ratio applicable to any medical treatment. Such a therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). In some embodiments, "therapeutically effective amount" refers to an amount of a therapeutic agent or composition effective to treat, ameliorate, or prevent (e.g., delay onset of or reduce risk of) a relevant disease or condition, and / or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying onset of the disease, and / or also lessening severity or frequency of symptoms of the disease. A therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses. For any particulartherapeutic agent, a therapeutically effective amount (and / or an appropriate unit dose within an effective dosing regimen) may vary, for example, de-pending on route of administration, or on combination with other therapeutic agents. Alternatively or additionally, a specific therapeutically effective amount (and / or unit dose) for any particular patient may depend upon a variety of factors including the activity of the specific therapeutic agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and / or rate of excretion or metabolism of the specific therapeutic agent employed; the duration of the treatment; and like factors as is well known in the medical arts.

[0095] As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapeutic agent according to a therapeutic regimen that achieves a desired effect in that it partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of and / or reduces incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. In some embodiments, administration of the therapeutic agent according to the therapeutic regimen is correlated with achievement of the desired effect. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the dis-ease, disorder, and / or condition. Alternatively, or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant dis-ease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition.

[0096] As used herein "antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0097] As used herein “antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

[0098] As used herein "antisense mechanisms" are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing. "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

[0099] As used herein "portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound

[0100] As used herein "prevent" refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. “Prevent” also means reducing the risk of developing a disease, disorder, or condition.

[0101] As used herein, "nucleoside" means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0102] As used herein, "chemical modification" or "chemically modified" means a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.

[0103] As used herein, "furanosyl" means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.

[0104] As used herein, "naturally occurring sugar moiety" means a ribofuranosyl as found in naturally occurring RNA or a de oxy ribofuranosy I as found in naturally occurring DNA. A "naturally occurring sugar moiety" as referred to herein is also termed as an "unmodified sugar moiety". In particular, such a "naturally occurring sugar moiety" or an "unmodified sugar moiety" as referred to herein has a -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2'-position of the sugar moiety, especially a -H (DNA sugar moiety) at the 2'-position of the sugar moiety.

[0105] As used herein, "sugar moiety" means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. As used herein, "modified sugar moiety" means a substituted sugar moiety or a sugar surrogate.

[0106] As used herein, "substituted sugar moiety" means a furanosyl that has been substituted. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'- position, the 3'-position, the 5'-position and / or the 4'-position. Certain substituted sugar moieties are bicyclic sugar moieties.

[0107] As used herein, "2'-substituted sugar moiety" means a furanosyl comprising a substituent at the 2'- position other than H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclicsugar moiety (i.e., the 2' -substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring).

[0108] As used herein, "MOE" means -OCH2CH2OCH3.

[0109] As used herein, "2'-F nucleoside" refers to a nucleoside comprising a sugar comprising fluorine at the 2' position. Unless otherwise indicated, the fluorine in a 2'-F nucleoside is in the ribo position (replacing the OH of a natural ribose). Duplexes of uniformly modified 2 -fluorinated (ribo) oligonucleotides hybridized to RNA strands are not RNase H substrates while the ara analogs retain RNase H activity.

[0110] As used herein the term "sugar surrogate" means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and / or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7- membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitro-gen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.

[0111] As used herein, "bicyclic sugar moiety" means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In some embodiments, the 4 to 7 membered ring is a sugar ring. In some embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2 '-carbon and the 4 '-carbon of the furanosyl.

[0112] As used herein, "nucleotide" means a nucleoside further comprising a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes, but is not limited to "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

[0113] As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0114] As used herein the terms, "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0115] As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase. As used herein, "modified nucleoside" means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides can comprise a modified sugar moiety and / or a modified nucleobase.

[0116] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety. As used herein, "locked nucleic acid nucleoside" or "LNA" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH2-0-2'bridge. As used herein, "2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2'- position of the sugar moiety other than H or OH. Unless otherwise indicated, a 2 '-substituted nucleoside is not a bicyclic nucleoside.

[0117] As used herein, "deoxynucleoside" means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In some embodiments, a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).

[0118] As used herein, "oligonucleotide" means a compound comprising a plurality of linked nucleosides. In some embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0119] As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0120] As used herein, "linkage" or "linking group" means a group of atoms that link together two or more other groups of atoms.

[0121] As used herein "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide.

[0122] As used herein "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage. In particular, a "modified internucleoside linkage" as referred to herein can include a modified phosphorous linking group such as a phosphorothioate or phosphorodithioate internucleoside linkage.

[0123] As used herein, "terminal internucleoside linkage" means the linkage between the last two nucleosides of an oligonucleotide or defined region thereof.

[0124] As used herein, "phosphorus linking group" means a linking group comprising a phosphorus atom and can include naturally occurring phosphorous linking groups as present in naturally occurring RNA or DNA, such as phosphodiester linking groups, or modified phosphorous linking groups that are not generally present in naturally occurring RNA or DNA, such as phosphorothioate or phosphorodithioate linking groups. Phosphorus linking groups can therefore include without limitation, phosphodiester, phosphorothioate, phosphorodithioate, phosphonate, phosphoramidate, phosphorothioamidate, thionoalkylphosphonate, phosphotriesters, thionoalkylphosphotriester and boranophosphate.

[0125] As used herein, "internucleoside phosphorus linking group" means a phosphorus linking group that directly links two nucleosides

[0126] As used herein, "oligomeric compound" means a polymeric structure comprising two or more substructures. In some embodiments, an oligomeric compound comprises an oligonucleotide, such as a modified oligonucletide. In some embodiments, an oligomeric compound further comprises one or more conjugate groups and / or terminal groups and / or ligands. In some embodiments, an oligomeric compound consists of an oligonucleotide. In some embodiments, an oligomeric compound comprises a backbone of one or more linked monomeric sugar moieties, where each linked monomeric sugar moiety is directly or indirectly attached to a heterocyclic base moiety. In some embodiments, oligomeric compounds may also include monomeric sugar moieties that are not linked to a heterocyclic base moiety, thereby providing abasic sites.

[0127] As used herein, "terminal group" means one or more atom attached to either, or both, the 3 ' end or the 5' end of an oligonucleotide. In some embodiments, a terminal group comprises one or more terminal group nucleosides.

[0128] As used herein, "conjugate" or "conjugate group" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In some embodiments, a conjugate group links a ligand to a modified oligonucleotide or oligomeric compound. In general, conjugate groups can modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties.

[0129] As used herein, "conjugate linker" or "linker" in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms and which covalently link an oligonucleotide to another portion of the conjugate group. In some embodiments, the point of attachment on the oligomeric compound is the 3 '-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside of theoligonucleotide. In some embodiments the point of attachment on the oligomeric compound is the 5'- oxygen atom of the 5'-hydroxyl group of the 5' terminal nucleoside of the oligonucleotide. In some embodiments, the bond for forming attachment to the oligomeric compound is a cleavable bond. In certain such embodiments, such cleavable bond constitutes all or part of a cleavable moiety.

[0130] In some embodiments, conjugate groups comprise a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside) and ligand portion that can comprise one or more ligands, such as a carbohydrate cluster portion, such as an N-Acetyl-Galactosamine, also referred to as "GalNAc", cluster portion. In some embodiments, the carbohydrate cluster portion is identified by the number and identity ofthe ligand. For example, In some embodiments, the carbohydrate cluster portion comprises 2 GalNAc groups. For example, In some embodiments, the carbohydrate cluster portion comprises 3 GalNAc groups and this is particularly preferred. In some embodiments, the carbohydrate cluster portion comprises 4 GalNAc groups. Such ligand portions are attached to an oligomeric compound via a cleavable moiety, such as a cleavable bond or cleavable nucleoside. The ligands can be arranged in a linear or branched configuration, such as a biantennary or triantennary configurations.

[0131] As used herein, "cleavable moiety" means a bond or group that is capable of being cleaved under physiological conditions. In some embodiments, a cleavable moiety is cleaved inside a cell or sub-cellular compartments, such as an endosome or lysosome. In some embodiments, a cleavable moiety is cleaved by endogenous enzymes, such as nucleases. In some embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, a cleavable moiety is a phosphodiester linkage.

[0132] As used herein, "cleavable bond" means any chemical bond capable of being broken. As used herein, "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a linker group.

[0133] As used herein, "modified carbohydrate" means any carbohydrate having one or more chemical modifications relative to naturally occurring carbohydrates. As used herein, "carbohydrate derivative" means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.

[0134] As used herein, "carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. A carbohydrate is a biomolecule including carbon (C), hydrogen (H) and oxygen (O) atoms. Carbohydrates can include monosaccharide, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides or polysaccharides, such as one or more galactose moieties, one or more lactose moieties, one or more N-Acetyl-Galactosamine moieties, and / or one or more mannose moieties. A particularly preferred carbohydrate is N-Acetyl-Galactosamine moieties.

[0135] As used herein, "strand" means an oligomeric compound comprising linked nucleosides. As used herein, "single strand" or "single-stranded" means an oligomeric compound comprising linked nucleosides that are connected in a continuous sequence without a break therebetween. Such single strands may include regions of sufficient self-complementarity so as to be capable of forming a stable self-duplex in a hairpin structure.

[0136] As used herein, "hairpin" means a single stranded oligomeric compound that includes a duplex formed by base pairing between sequences in the strand that are self-complementary and opposite in directionality. As used herein, "hairpin loop" means an unpaired loop of linked nucleosides in a hairpin that is created as a result of hybridization of the self-complementary sequences. The resulting structure looks like a loop or a U-shape.

[0137] As used herein, "directionality" means the end-to-end chemical orientation of an oligonucleotide based on the chemical convention of numbering of carbon atoms in the sugar moiety meaning that there will be a 5'-end defined by the 5' carbon of the sugar moiety, and a 3'-end defined by the 3' carbon of the sugar moiety. In a duplex or double stranded oligonucleotide, the respective strands run in opposite 5' to 3' directions to permit base pairing between them.

[0138] As used herein, "duplex" means two or more complementary strand regions, or strands, of an oligonucleotide or oligonucleotides, hybridized together by way of non-covalent, sequence-specific interaction therebetween. Most commonly, the hybridization in the duplex will be between nucleobases adenine (A) and thymine (T), and / or (A) adenine and uracil (U), and / or guanine (G) and cytosine (C). The duplex may be part of a single stranded structure, wherein self-complementarity leads to hybridization, or as a result of hybridization between respective strands in a double stranded construct.

[0139] As used herein, "double strand" or "double stranded" means a pair of oligomeric compounds that are hybridized to one another. In some embodiments, a double-stranded oligomeric compound comprises a first and a second oligomeric compound.

[0140] As used herein, "expression" means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5 '-cap), and translation.

[0141] As used herein, "transcription" or "transcribed" refers to the first of several steps of DNA based gene expression in which a target sequence of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. During transcription, a DNA sequence is read by an RNA polymerase, which produces a complementary, antiparallel RNA sequence called a primary transcript.

[0142] As used herein, "target sequence" means a nucleoside sequence to which an oligomeric compound is intended to hybridize to result in a desired activity with respect to the disease or genefunction of interest. Oligonucleotides have sufficient complementarity to their target sequences to allow hybridization under physiological conditions.

[0143] As used herein, "nucleobase complementarity" or "complementarity" when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In some embodiments, complementary nucleobase means a nucleobase of an oligomeric compound that is capable of base pairing with a nucleobase of its target sequence. For example, if a nucleobase at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position of a target sequence, then the position of hydrogen bonding between the oligomeric compound and the target sequence is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0144] As used herein, "non-complementary" in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another. As used herein, "complementary" in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides) means the capacity of such oligomeric com-pounds or regions thereof to hybridize to a target sequence, or to a region of the oligomeric compound itself, through nucleobase complementarity.

[0145] Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In some embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In some embodiments, complementary oligomeric compounds or regions are at least 80% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 90% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 95% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 100% complementary.

[0146] As used herein, "self-complementarity" in reference to oligomeric compounds means a compound that may fold back on itself, creating a duplex as a result of nucleobase hybridization of internal complementary strand regions. Depending on how close together and / or how long the strand regions are, then the compound may form hairpin loops, junctions, bulges or internal loops.

[0147] As used herein, "mismatch" means a nucleobase of an oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a target sequence, or at a corresponding position of the oligomeric compound itself when the oligomeric compound hybridizes as a result of selfcomplementarity, when the oligomeric compound and the target sequence and / or self-complementary regions of the oligomeric compound, are aligned.

[0148] As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an oligomeric compound and its target sequence). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0149] As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.

[0150] As used herein, "fully complementary" in reference to an oligomeric compound or region thereof means that each nucleobase of the oligomeric compound or region thereof is capable of pairing with a nucleobase of a complementary nucleic acid target sequence or a self-complementary region of the oligomeric compound. Thus, a fully complementary oligomeric compound or region thereof comprises no mis-matches or unhybridized nucleobases with respect to its target sequence or a self- complementary region of the oligomeric compound.

[0151] As used herein, "percent complementarity" means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0152] As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.

[0153] As used herein, "modulation" means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.

[0154] The nucleic acid molecules described herein are capable of inhibiting the expression of variant NRAS in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. The nucleic acid molecules described herein are also capable of preferentially inhibiting the expression of variant NRAS compared to wild type NRAS. In other words, the nucleic acid molecules described herein may inhibit the expression of variant NRAS to a greater extent than wild type NRAS. For example, variant NRAS expression may be inhibited 2-fold, 3-fold, 4-fold, 5-fold or greater compared to wild type NRAS. The nucleic acid molecules described herein may inhibit expression of variant NRAS but not inhibit the expression of wild type NRAS.

[0155] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0156] As used herein, "differently modified" mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified naturally occurring RNA nucleoside are "differently modified," even though the naturally occurring nucleoside is unmodified. Likewise, DNA and RNA oligonucleotides are "differently modified," even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified thymine nucleobase are not differently modified.

[0157] As used herein, "the same type of modifications" refers to modifications that are the same as one an-other, including absence of modifications. Thus, for example, two unmodified RNA nucleosides have "the same type of modification," even though the RNA nucleosides are unmodified. Such nucleosides having the same type modification may comprise different nucleobases.

[0158] As used herein, "region" or "regions", or "portion" or "portions", mean a plurality of linked nucleosides that have a function or character as defined herein, in particular with reference to the claims and definitions as provided herein. Typically such regions or portions comprise at least 10, at least 11 , at least 12 or at least 13 linked nucleosides. For example, such regions can comprise 13 to 20 linked nucleosides, such as 13 to 16 or 18 to 20 linked nucleosides. Typically a first region as defined herein consists essentially of 18 to 20 nucleosides and a second region as defined herein consists essentially of 13 to 16 linked nucleosides.

[0159] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In some embodiments, such sterile saline is pharmaceutical grade saline.

[0160] As used herein, "substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'- substituent is any atom or group at the 2 '-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In some embodiments, compounds of the present disclosure have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as oxygen or an alkyl or hydrocarbyl group to a parent compound.

[0161] Such substituents can be present as the modification on the sugar moiety, in particular a substituent pre-sent at the 2'-position of the sugar moiety. Unless otherwise indicated, groups amenable for use as substituents include without limitation, one or more of halo, hydroxyl, alkyl, alkenyl, alkynyl, acyl, carboxyl, alkoxy, alkoxyalkylene and amino substituents. Certain substituents as described herein can represent modifications directly attached to a ring of a sugar moiety (such as a halo, such as fluoro, directly attached to a sugar ring), or a modification indirectly linked to a ring of a sugar moiety by way of an oxy-gen linking atom that itself is directly linked to the sugar moiety (such as an alkoxyalkylene, such as methoxyethylene, linked to an oxygen atom, overall providing an MOE substituent as described herein attached to the 2'-position of the sugar moiety).

[0162] As used herein, "alkyl," as used herein, means a saturated straight or branched monovalent C1- 6 hydro-carbon radical, with methyl being a most preferred alkyl as a substituent at the 2'-position of the sugar moiety. The alkyl group typically attaches to an oxygen linking atom at the 2'poisition of the sugar, there-fore, overall providing a -Oalkyl substituent, such as an -OCH3 substituent, on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood be a person skilled in the art.

[0163] As used herein, "alkylene" means a saturated straight or branched divalent hydrocarbon radical of the general formula -CnH2n- where n is 1-6. Methylene or ethylene are preferred alkylenes.

[0164] As used herein, "alkenyl" means a straight or branched unsaturated monovalent C2-6 hydrocarbon radical, with ethenyl or propenyl being most preferred alkenyls as a substituent at the 2'- position of the sugar moiety. As will be well understood in the art, the degree of unsaturation that is present in an alkenyl radical is the presence of at least one carbon to carbon double bond. The alkenyl group typically attaches to an oxygen linking atom at the 2'-position of the sugar, therefore, overall providing a -Oalkenyl substituent, such as an -OCH2CH=CH2 substituent, on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood be a person skilled in the art.

[0165] As used herein, "alkynyl" means a straight or branched unsaturated C2-6 hydrocarbon radical, with ethynyl being a most preferred alkynyl as a substituent at the 2'-position of the sugar moiety. As will be well understood in the art, the degree of unsaturation that is present in an alkynyl radical is the presence of at least one carbon to carbon triple bond. The alkynyl group typically attaches to an oxygen linking atom at the 2'-position of the sugar, therefore, overall providing a -Oalkynyl substituent on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood be a per-son skilled in the art.

[0166] As used herein, "carboxyl" is a radical having a general formula -CO2H.

[0167] As used herein, "acyl" means a radical formed by removal of a hydroxyl group from a carboxyl radical as defined herein and has the general Formula -C(O)-X where X is typically C1-6 alkyl.

[0168] As used herein, "alkoxy" means a radical formed between an alkyl group, such as a C1-6 alkyl group, and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group either to a parent molecule (such as at the 2'-position of a sugar moiety), or to another group such as an alkylene group as defined herein. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy and tert-butoxy. Alkoxy groups as used herein may optionally include further substituent groups.

[0169] As used herein, alkoxyalkylene means an alkoxy group as defined herein that is attached to an alkylene group also as defined herein, and wherein the oxygen atom of the alkoxy group attaches to the alkylene group and the alkylene attaches to a parent molecule. The alkylene group typically attaches to an oxygen linking atom at the 2'-position of the sugar, therefore, overall providing a -Oalkylenealkoxy substituent, such as an -OCH2CH2OCH3 substituent, on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood by a person skilled in the art and is generally referred to as an MOE substituent as defined herein and as known in the art.

[0170] As used herein, "amino" includes primary, secondary and tertiary amino groups. As used herein, "halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.

[0171] It will also be understood that nucleic acid molecules or compounds as described herein may have one or more non-hybridizing nucleosides at one or both ends of one or both strands (overhangs) and / or one or more internal non-hybridizing nucleosides (mismatches) provided there is sufficient complementarity to maintain hybridization under physiologically relevant conditions. Alternatively, oligomeric compounds as described herein may be blunt ended at at least one end.

[0172] The term "comprising" is used herein to mean including the method steps or elements identified, but that such steps or elements do not comprise an exclusive list and as such there may be present additional steps or elements.

[0173] Further, to the extent that the term "includes" is used in either the detailed description or the claims, such term is intended to be inclusive in a manner similar to the term "comprising" as "comprising" is interpreted when employed as a transitional word in a claim.

[0174] Microneedles or microneedle patches or microarray patches are micron-scaled medical devices used to administer therapeutic agents. Microneedles can be used for transdermal drug delivery applications, and also for intraocular, vaginal, transungual, cardiac, vascular, gastrointestinal, and intracochlear delivery of drugs. Microneedles are constructed through various methods, usually involving photolithographic processes or micromolding. These methods involve etching microscopic structure into resin or silicon in order to cast microneedles. Microneedles are made from a variety ofmaterial ranging from silicon, titanium, stainless steel, and polymers. Some microneedles are made of a drug to be delivered to the body but are shaped into a needle so they will penetrate the skin. The microneedles range in size, shape, and function but are all used as an alternative to other delivery methods like the conventional hypodermic needle or other injection apparatus.

[0175] Microneedles are usually applied through even single needle or small arrays. The arrays used are a collection of microneedles, ranging from only a few microneedles to several hundred, attached to an applicator, sometimes a patch or other solid stamping device. The arrays are applied to the skin of patients and are given time to allow for the effective administration of drugs. The size of individual microneedles may be optimized depending upon the desired size of the microneedle, for instance depending upon the targeting depth of the microneedle, the strength requirements of the needle to avoid breakage in a particular tissue type, etc.

[0176] Solid microneedles are designed as a two part system; the microneedle array is first applied to the skin to create microscopic wells just deep enough to penetrate the outermost layer of skin, and then the drug is applied via transdermal patch. Solid microneedles are already used by dermatologists in collagen induction therapy, a method which uses repeated puncturing of the skin with microneedles to induce the expression and deposition of the proteins collagen and elastin in the skin.

[0177] Hollow microneedles are similar to solid microneedles in material. They contain reservoirs that deliver the drug directly into the site. Since the delivery of the drug is dependent on the flow rate of the microneedle, there is a possibility that this type of array could become clogged by excessive swelling or flawed design.

[0178] Coated microneedles are usually designed from polymers or metals. In this method the drug is applied directly to the microneedle array instead of being applied through other patches or applicators. Coated microneedles are often covered in other surfactants or thickening agents to assure that the drug is delivered properly.

[0179] Dissolvable microneedles encapsulate the drug in a nontoxic polymer which dissolves once inside the skin. This polymer allows the drug to be delivered into the skin and can be broken down once inside the body. Polymers such as Fibroin, a silk-based protein that can be molded into structures like microneedles and dissolved once in the body.

[0180] Hydrogel-forming microneedles have medications enclosed in a polymer. The microneedles can penetrate the stratum corneum and draw up interstitial fluid leading to polymer swelling. Drugs enter the skin from the swollen matrix.

[0181] Different methods of producing lipid-encapsulated RNA nanoparticles are known to the skilled person. Techniques are known for preparing lipid-encapsulated RNA nanoparticles using an ethanol injection-type process with a static mixer that provides a turbulent environment, which after vesicle formation are combined with a therapeutic molecule. Other techniques are known for forming lipid-encapsulated RNA nanoparticles using non-turbulent mixing and a series of sequential stepwise dilutions. Particles can also be formed by spraying lipids in an organic solution pipe through an orifice into nucleic acids in an aqueous solution flowing past the orifice. The parameters for generating an lipid- encapsulated RNA nanoparticle can be varied according to the desired properties.

[0182] Nanodelivery systems such as ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplexes (RTNPs) can be engineered to mimic viruses whilst retaining the safety of a non-viral particle. One approach is to encourage delivery to specific cell types by incorporating peptides into the particle that have affinity for cell surface receptors or other proteins specific to the cell type of interest. Quite often peptides targeting specific cell types are not already known and experiments (e.g. phage display library biopanning) can be used to identify novel amino acid sequences with affinity for specific cell types of interest.

[0183] Together with selection of optimal lipids for this purpose, there is a modular approach to testing hypotheses in order to identify those attributes that best deliver cargo to the cell types of interest [3]. A recent study used pre-existing literature to design peptides targeting receptors on specific cell types in the skin: fibroblasts, melanocytes and keratinocytes [4]. However, we anticipate that a non-biased approach to identifying novel cell targeting peptides with a phage display library will reveal the most effective peptides for this purpose. Furthermore, the cells of interest are often pathological and / or different to the closest equivalent cell in a healthy human. Therefore, it is important to carry out studies specifically on these cells in order to target nanodelivery systems most effectively.

[0184] In some embodiments, reconstituted viral envelopes are used to encapsulate and deliver siRNAs. The reconstituted membrane vesicles may contain viral spike proteins and additionally added cationic lipids. The siRNA-loaded vesicles are taken up by receptor-mediated endocytosis, and are able to escape endosomal degradation by fusion with the endosomal membrane. Functional siRNA delivery has been demonstrated in vitro and in vivo. As with some viral approaches, drawbacks of the systems are the difficulties of repeated administration and limited control over transduced cell type.

[0185] In some embodiments, DNA encoding for siRNA may be delivered by viruses for gene silencing in vivo. To improve specificity, the natural tropism of viruses for certain cell types may be used. In some embodiments, it may be possible to redirect the natural tropism of viruses towards therapeutically useful receptors on the surface of target cells. Examples include the retargeting of murine coronavirus to the human epidermal growth factor receptor, directing adenovirus via fibroblast growth factor ligand towards its associated receptor (FGFR1) for delivery to glioma, or adenoviral delivery to angiogenic endothelium via RGD-peptides binding alpha v-integrins. One particular advantage of the viral delivery approach is the efficient transduction of cells.

[0186] In some embodiments, compounds of the invention may be delivered via nonviral delivery. Whereas viral vectors provide many of the desired characteristics for efficient nucleic acid delivery, nonviral vectors provide other advantages. Important benefits of synthetic vector systems are the safety(related to their lack of immunogenicity and low frequency of integration) and ease of large-scale production. In addition, they can accommodate a wide variety of nucleic acid sizes and they allow easy modification.

[0187] Non-viral delivery systems may require functional groups to be incorporated into compounds of the invention. A cationic functional group is usually required to bind and condense the nucleic acid, thereby protecting it against nucleases and (importantly for siRNA) increasing the apparent molecular weight above the renal clearance cut-off.

[0188] Nucleic acid molecules targeting multiple variants

[0189] In some cases, a nucleic acid molecule as described herein may be used to target two different NRAS variants, in particular two or more NRAS alleles at the same position. For example, a single nucleic acid molecule comprising a sequence that targets Q61 K may be adapted to also target Q61 R, since this mutation involves a substitution at a different position in the nucleotide sequence (C181A for Q61 K, and A182G for Q61 R). This single nucleic acid molecule may therefore comprise a sequence complementary to AG at positions 181 and 182 in order to target both Q61 K and Q61 R variants. The foregoing is merely an example and the nucleic acid molecules herein may be used to target various combinations of NRAS variants (for example, Q61 K and Q61 L; Q61 K and Q61 H, etc.)

[0190] Described herein is a nucleic acid molecule comprising a sequence that is fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding a first variant NRAS, and that is fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding a second variant NRAS, wherein the second variant NRAS is different to the first variant NRAS. Described herein is a nucleic acid molecule comprising a sequence that is at least 80% complementary to an equal length portion of an mRNA encoding a first variant NRAS, and that is at least 80% complementary to an equal length portion of an mRNA encoding a second variant NRAS. For example, described herein is a nucleic acid molecule comprising a sequence that is fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 R). The nucleic acid molecule may comprise a first strand comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 187-205, and at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 225-243.

[0191] Pharmaceutical Compositions of the Agent

[0192] As used herein "pharmaceutical composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.

[0193] As used herein "pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0194] Other aspects of the present invention also relate to a medicinal product or a diagnostic aid comprising a composition according to the invention or a nucleic acid according to the invention and, where appropriate, suitable excipients and additives, such as, for example, a physiological saline solution, stabilizers or proteinase inhibitors.

[0195] Antisense Mechanisms

[0196] In some embodiments, antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0197] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0198] Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In some embodiments, the amount and / or activity of the target nucleic acid is modulated. In some embodiments, the amount and / or activity of the target nucleic acid is reduced. In some embodiments, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In some embodiments, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In some embodiments, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In some embodiments, antisense compounds function through more than one mechanism and / or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by a particular mechanism.

[0199] Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and / or through additional mechanisms.

[0200] RNase H-Mediated Antisense. In some embodiments, antisense activity results at least in part from degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid. In some embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In some embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity.

[0201] RNAi Compounds. In some embodiments, antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as shortinterfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and / orsequester a target nucleic acid (thus, include microRNA / microRNA-mimic compounds). In some embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.

[0202] Conjugates

[0203] In some embodiments, the present disclosure provides conjugated antisense compounds. In some embodiments, the present disclosure provides conjugated antisense compounds comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of a nucleic acid transcript in a cell.

[0204] The asialoglycoprotein receptor (ASGP-R) has been described previously. See e.g., Park et al., PNAS vol. 102, No. 47, pp 17125-17129 (2005). Such receptors are expressed on liver cells, particularly hepatocytes. Further, it has been shown that compounds comprising clusters of three N-acetylgalactosamine (GalNAc) ligands are capable of binding to the ASGP-R, resulting in uptake of the compound into the cell. See e.g., Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp 5216- 5231 (May 2008).

[0205] Accordingly, conjugates comprising such GalNAc clusters have been used to facilitate uptake of certain compounds into liver cells, specifically hepatocytes. For example, it has been shown that certain GalNAc-containing conjugates increase activity of duplex siRNA compounds in liver cells in vivo. In such instances, the GalNAc-containing conjugate is typically attached to the sense strand of the siRNA duplex. Since the sense strand is discarded before the antisense strand ultimately hybridizes with the target nucleic acid, there is little concern that the conjugate will interfere with activity. Disclosedherein are conjugated single-stranded antisense compounds having improved potency in liver cells in vivo compared with the same antisense compound lacking the conjugate.

[0206] In some embodiments, conjugate groups herein comprise a cleavable moiety. As noted, without wishing to be bound by mechanism, it is logical that the conjugate should remain on the compound long enough to provide enhancement in uptake, but after that, it is desirable for some portion or, ideally, all of the conjugate to be cleaved, releasing the parent compound (e.g., antisense compound) in its most active form. In some embodiments, the cleavable moiety is a cleavable nucleoside. Such embodiments take advantage of endogenous nucleases in the cell by attaching the rest of the conjugate (the cluster) to the antisense oligonucleotide through a nucleoside via one or more cleavable bonds, such as those of a phosphodiester linkage. In some embodiments, the cluster is bound to the cleavable nucleoside through a phosphodiester linkage. In some embodiments, the cleavable nucleoside is attached to the antisense oligonucleotide (antisense compound) by a phosphodiester linkage. In some embodiments, the conjugate group may comprise two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to one another, to the antisense compound and / or to the cluster via cleavable bonds (such as those of a phosphodiester linkage). Certain conjugates herein do not comprise a cleavable nucleoside and instead comprise a cleavable bond. It is shown that that sufficient cleavage of the conjugate from the oligonucleotide is provided by at least one bond that is vulnerable to cleavage in the cell (a cleavable bond).

[0207] In some embodiments, conjugated antisense compounds are prodrugs. Such prodrugs are administered to an animal and are ultimately metabolized to a more active form. For example, conjugated antisense compounds are cleaved to remove all or part of the conjugate resulting in the active (or more active) form of the antisense compound lacking all or some of the conjugate.

[0208] In some embodiments, conjugates are attached at the 5' end of an oligonucleotide. Certain such 5'- conjugates are cleaved more efficiently than counterparts having a similar conjugate group attached at the 3 ' end. In some embodiments, improved activity may correlate with improved cleavage. In some embodiments, oligonucleotides comprising a conjugate at the 5' end have greater efficacy than oligonucleotides comprising a conjugate at the 3' end. In some embodiments, oligonucleotides comprising a conjugate at the 3' end have greater efficacy than oligonucleotides comprising a conjugate at the 5' end. 5'-attachment allows simpler oligonucleotide synthesis.

[0209] Typically, oligonucleotides are synthesized on a solid support in the 3 ' to 5' direction. To make a 3'-conjugated oligonucleotide, typically one attaches a pre-conjugated 3' nucleoside to the solid support and then builds the oligonucleotide as usual. However, attaching that conjugated nucleoside to the solid support adds complication to the synthesis. Further, using that approach, the conjugate is then present throughout the synthesis of the oligonucleotide and can become degraded during subsequent steps or may limit the sorts of reactions and reagents that can be used. Using the structures and techniques described herein for 5'-conjugated oligonucleotides, one can synthesize the oligonucleotideusing standard automated techniques and introduce the conjugate with the final (5 -most) nucleoside or after the oligonucleotide has been cleaved from the solid support.

[0210] In view of the art and the present disclosure, one of ordinary skill can easily make any of the conjugates and conjugated oligonucleotides herein. Moreover, synthesis of certain such conjugates and conjugated oligonucleotides disclosed herein is easier and / or requires few steps, and is therefore less expensive than that of conjugates previously disclosed, providing advantages in manufacturing. For example, the synthesis of certain conjugate groups consists of fewer synthetic steps, resulting in increased yield, relative to conjugate groups previously described.

[0211] Conjugate linkers

[0212] In some embodiments, the conjugate groups comprise a linker. In certain such embodiments, the linker is covalently bound to the cleavable moiety. In certain such embodiments, the linker is covalently bound to the antisense oligonucleotide. In some embodiments, the linker is covalently bound to a cell-targeting moiety. In some embodiments, the linker further comprises a covalent attachment to a solid support. In some embodiments, the linker further comprises a covalent attachment to a protein binding moiety. In some embodiments, the linker further comprises a covalent attachment to a solid support and further comprises a covalent attachment to a protein binding moiety. In some embodiments, the linker includes multiple positions for attachment of tethered ligands. In some embodiments, the linker includes multiple positions for attachment of tethered ligands and is not attached to a branching group. In some embodiments, the linker further comprises one or more cleavable bond. In some embodiments, the conjugate group does not include a linker.

[0213] In some embodiments, the linker includes at least a linear group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-) and hydroxylamino (-O-N(H)-) groups. In some embodiments, the linear group comprises groups selected from alkyl, amide and ether groups. In some embodiments, the linear group comprises groups selected from alkyl and ether groups. In some embodiments, the linear group comprises at least one phosphorus linking group. In some embodiments, the linear group comprises at least one phosphodiester group. In some embodiments, the linear group includes at least one neutral linking group. In some embodiments, the linear group is covalently attached to the cell-targeting moiety and the cleavable moiety. In some embodiments, the linear group is covalently attached to the cell-targeting moiety and the antisense oligonucleotide. In some embodiments, the linear group is covalently attached to the cell-targeting moiety, the cleavable moiety and a solid support. In some embodiments, the linear group is covalently attached to the celltargeting moiety, the cleavable moiety, a solid support and a protein binding moiety. In some embodiments, the linear group includes one or more cleavable bond.

[0214] In some embodiments, the linker includes the linear group covalently attached to a scaffold group. In some embodiments, the scaffold includes a branched aliphatic group comprising groupsselected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In some embodiments, the scaffold includes a branched aliphatic group comprising groups selected from alkyl, amide and ether groups. In some embodiments, the scaffold includes at least one mono or polycyclic ring system. In some embodiments, the scaffold includes at least two mono or polycyclic ring systems. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety and the linker. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a solid support. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a protein binding moiety. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker, a protein binding moiety and a solid support. In some embodiments, the scaffold group includes one or more cleavable bonds.

[0215] In some embodiments, the linker includes a protein binding moiety. In some embodiments, the protein binding moiety is a lipid such as for example including but not limited to cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1 ,3-Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1 ,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), a vitamin (e.g., folate, vitamin A, vitamin E, biotin, pyridoxal), a peptide, a carbohydrate (e.g., monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide), an endosomolytic component, a steroid (e.g., uvaol, hecigenin, diosgenin), a terpene (e.g., triterpene, e.g., sarsasapogenin, friedelin, epifriedelanol derivatized lithocholic acid), or a cationic lipid. In some embodiments, the protein binding moiety is a Ci6 to C22 long chain saturated or unsaturated fatty acid, cholesterol, cholic acid, vitamin E, adamantane or 1 -pentafluoropropyl.Combination Therapies

[0216] In some embodiments, the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising a double-stranded ribonucleic acid molecule or compound or composition comprising a double-stranded ribonucleic acid molecule and a conjugate according to the invention and a second therapeutic agent. In some embodiments, the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising a therapeutic agent according to the invention and a second therapeutic agent.

[0217] In some embodiments, the composition comprises a pharmaceutically acceptable carrier or diluent. In some embodiments, the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent can be present in a single composition or as two or more different compositions. The double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate andthe second agent can be administered via the same administration route or via different administration routes. The double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent can be administered simultaneously or sequentially. In some embodiments, the pharmaceutical combination comprises the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent separately or together.

[0218] Methods of the invention described herein may include the administration of a nucleic acid molecule, compound, composition or produg as described herein, in combination with a second therapeutic agent. The second therapeutic agent may be an anti-cancer agent or a chemotherapeutic agent. For example, the second therapeutic agent may be a protein kinase inhibitor, such as a MEK inhibitor. The second therapeutic agent may be trametinib. The second therapeutic agent may be administered simultaneously, separately or sequentially to the nucleic acid molecule, compound, composition or produg as described herein. Also described herein is a pharmaceutical composition comprising a double stranded ribonucleic acid molecule as described herein in combination with trametinib.Combined NRAS and BRAF

[0219] Also described herein is a composition comprising two nucleic acid molecules, wherein a first nucleic acid molecule targets variant NRAS, and a second nucleic acid molecule targets variant BRAF. Such compositions can advantageously be used in the treatment, reduction or removal of acquired naevi (common moles). Acquired naevi express one of either variant NRAS or variant BRAF (i.e. they do not carry mutations in both). The inventors exploit this expression pattern by providing a composition that can target both variant NRAS and variant BRAF. This avoids the need to first perform sequencing analysis to determine which variants are present in the naevus, since the composition is capable of targeting both NRAS and BRAF variants. Such a composition is advantageous since no genotyping is necessary prior to administration. The treatment, reduction or removal of acquired naevi also has the potential to provide benefits in preventing cancer such as melanoma.

[0220] Accordingly, provided herein is a composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS; and wherein the second nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF. The composition may comprise any nucleic acid molecule described herein for the targeting of NRAS, in combination with any nucleic acid molecule described herein for the targeting of BRAF.

[0221] One of the advantages of the composition is that genotyping or sequencing of the acquired naevus is not required prior to administration. In line with this, the composition may comprise multiplesiRNAs targeting different NRAS variants / alleles, and / or multiple siRNAs targeting different BRAF variants. For example, the composition may comprise an siRNA targeting NRAS Q61 K, an siRNA targeting NRAS Q61 R, and an siRNA targeting NRAS Q61 L, together with an siRNA targeting BRAF V600E and an siRNA targeting BRAF V600K. The composition may comprise at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting NRAS variants, wherein the at least two, at least three, at least four, at least five, or at least six nucleic acid molecules target different NRAS variants. The composition may comprise at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting BRAF variants, wherein the at least two, at least three, at least four, at least five, or at least six nucleic acid molecules target different BRAF variants. The composition may comprise at least three nucleic acid molecules targeting NRAS variants, wherein the three nucleic acid molecules target different NRAS variants, and at least two nucleic acid molecules targeting BRAF variants, wherein the at least two nucleic acid molecules target different BRAF variants. The composition may comprise at least two nucleic acid molecules targeting NRAS variants, wherein the two nucleic acid molecules target different NRAS variants, and at least two nucleic acid molecules targeting BRAF variants, wherein the at least two nucleic acid molecules target different BRAF variants. The composition may comprise at least three nucleic acid molecules targeting NRAS variants, wherein the three nucleic acid molecules target different NRAS variants, and at least one nucleic acid molecule targeting a BRAF variant. The composition may comprise at least two nucleic acid molecules targeting NRAS variants, wherein the two nucleic acid molecules target different NRAS variants, and at least one nucleic acid molecule targeting a BRAF variant.

[0222] The composition may also comprise different ratios of the nucleic acid molecules targeting variant NRAS and variant BRAF. Variant BRAF is a more common cause of acquired melanocytic naevi relative to variant NRAS. However, more variant NRAS alleles exist relative to variant BRAF alleles. The ratio of variant NRAS:variant BRAF targeting nucleic acid molecules may be varied accordingly.

[0223] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position Q61 , G60, G12, and / or G13 relative to wild type NRAS, and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF.

[0224] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position Q61 relative to wild type NRAS, and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF.

[0225] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position G60 relative to wild type NRAS, and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF.

[0226] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position G12 relative to wild type NRAS, and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF.

[0227] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position G13 relative to wild type NRAS, and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF.

[0228] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

[0229] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0230] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNAencoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0231] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 R), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0232] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 H), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0233] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 L), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0234] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 P), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0235] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G).

[0236] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600M).

[0237] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600D).

[0238] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600R).

[0239] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600K).

[0240] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 80% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0241] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 85% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 85% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0242] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0243] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprisea sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0244] The first strand of the first nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and the first strand of the second nucleic acid molecule may comprise a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E).

[0245] In some cases, the variant NRAS p.(Q61 K) is caused by a C.C181A mutation in the NRAS genomic sequence. The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 206-224. The first strand of the first nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 206-224. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 206-224. The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 213. The first strand of the first nucleic acid molecule may comprise the sequence set forth in SEQ ID NO: 213. The first strand of the first nucleic acid molecule may consist of the sequence set forth in SEQ ID NO: 213.

[0246] In some cases, the variant NRAS p.(Q61 K) is caused by a C.C181A mutation in the NRAS genomic sequence. The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 187-205. The first strand of the first nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 187-205. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 187-205. The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 194. The first strand of the first nucleic acid molecule may comprise the sequence set forth in SEQ ID NO: 194. The first strand of the first nucleic acid molecule may consist of the sequence set forth in SEQ ID NO: 194.

[0247] In some cases, the variant BRAF p.(V600E) is caused by a c.1799_1800delisAA mutation in the BRAF genomic sequence. The first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1287-1306. The first strand of the second nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 1287-1306. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 1287-1306.

[0248] In some cases, the variant BRAF p.(V600E) is caused by a c.1799_1800delisAA mutation in the BRAF genomic sequence. The first strand of the second nucleic acid molecule may comprise asequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1267-1286. The first strand of the second nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 1267-1286. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 1267-1286.

[0249] In some cases, the variant BRAF p.(V600E) is caused by a C.T1799A mutation in the BRAF genomic sequence. The first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1326-1344. The first strand of the second nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 1326-1344. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 1326-1344.

[0250] In some cases, the variant BRAF p.(V600E) is caused by a C.T1799A mutation in the BRAF genomic sequence. The first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1307-1325. The first strand of the second nucleic acid molecule may comprise a sequence selected from the group consisting of SEQ ID NOs: 1307-1325. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs: 1307-1325.

[0251] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 206-224, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1287-1306.

[0252] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 187-205, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1267-1286.

[0253] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 206-224, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1326-1344.

[0254] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 187-205, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1307-1325.

[0255] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 213, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 1334.

[0256] The first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 194, and the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 1315.

[0257] Also described herein is a pharmaceutical composition comprising a composition as described above, e.g. having a first nucleic acid molecule targeting variant NRAS and a second nucleic acid molecule targeting variant BRAF.

[0258] Also described herein are methods for treating an acquired naevus in a subject. To treat may mean to remove, reduce or prevent an acquired naevus. The method may comprise administering to the subject a composition as described herein, or the pharmaceutical composition described herein, having a first nucleic acid molecule targeting variant NRAS and a second nucleic acid molecule targeting variant BRAF. Alternatively, the method may comprise administering to the subject a first nucleic acid molecule in combination with a second nucleic acid molecule, wherein said administration occurs simultaneously or sequentially in any order, wherein the first nucleic acid molecule targets variant NRAS as described herein, preferably Q61 K, and the second nucleic acid molecule targets variant BRAF as described herein, preferably V600E.

[0259] Also described herein are methods for preventing melanoma in a subject, the method may comprise administering to the subject a composition as described herein, or the pharmaceutical composition described herein, having a first nucleic acid molecule targeting variant NRAS, preferably Q61 K, and a second nucleic acid molecule targeting variant BRAF, preferably V600E.

[0260] Also described herein are compositions described herein comprising the first and second nucleic acid molecules (targeting variant NRAS and variant BRAF) for use in methods of treating an acquired naevus, and for use in methods of preventing melanoma.

[0261] Also provided herein is the use of a composition as described herein for reducing or removing an acquired naevus in a subject.

[0262] It will be understood that the nucleic acid molecule targeting variant NRAS and the nucleic acid molecule targeting variant BRAF can be provided together as part of a single composition, or can be provided separately. When provided separately, the first and second nucleic acid molecules may be administered to a subject simultaneously or sequentially in any order.

[0263] Also described herein is a kit comprising a first nucleic acid molecule targeting variant NRAS as described herein, and a second nucleic acid molecule targeting variant BRAF as described herein. The kit may comprise (a) a first nucleic acid molecule, wherein the first nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS and (b) a second nucleic acid molecule, wherein the second nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF.Routes of Administration

[0264] The agent or pharmaceutical composition can be administered by different routes including orally, parenterally, sublingually, intradermally, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and / or intraarticularly, or combinations thereof. In some embodiments the agent or pharmaceutical composition is administered orally. In some embodiments the agent or pharmaceutical composition is administered intravenously. In some embodiments the agent or pharmaceutical composition is administered topically. In some embodiments the agent or pharmaceutical composition is administered via microneedle injection. In some embodiments the agent or pharmaceutical composition is administered via microneedle injection into the dermis.CRISPR

[0265] As used herein, "CRISPR nuclease system" refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding a Cas gene, a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.

[0266] In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcuspyogenes. A CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence.

[0267] In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell, in some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.

[0268] When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell. In some embodiments, a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein, also called Cas enzyme.

[0269] Non-limiting examples of Cas proteins (or Cas enzymes) include Cas1 , Cas1.13, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Casi o, Csy1 , Csy2, Csy3, Csel, Cse2, Csel, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm.5, Csm6, Cmr1 , Cmr3, Cmr4, Cmr5, Crnr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1 , Csx15, Csf1 , Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.

[0270] These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae.

[0271] In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.Nucleic acid molecules

[0272] Nucleic acid molecules as described herein may comprise a first strand comprising a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS (e.g. an NRAS variant). Nucleic acid molecules asdescribed herein may comprise a first strand comprising a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS (e.g. an NRAS variant). Nucleic acid molecules as described herein may comprise a first strand comprising a sequence that is fully complementary to a sequence having at least 99% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS (e.g. an NRAS variant).

[0273] Nucleic acid molecules as described herein may comprise a first strand comprising a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS. The variant NRAS may possess mutations at positions Q61 , G60, G12 and / or G13, relative to wild type NRAS. For example, variant NRAS that differs from wild type NRAS at position Q61 may be referred to as a “Q61 variant”.

[0274] In some embodiments, the variant NRAS differs from wild type NRAS at position G60. The variant NRAS may be a G60R variant. The variant NRAS may be a G60V variant. The variant NRAS may be a G60E variant.

[0275] The variant NRAS G60R may be caused by a c.178G>C (c.G178C) mutation in the NRAS genomic sequence. The variant NRAS G60V may be caused by a c.179G>T (C.G179T) mutation in the NRAS genomic sequence. The variant NRAS G60E may be caused by a c.179G>A (C.G179A) mutation in the NRAS genomic sequence.

[0276] In some embodiments, the variant NRAS differs from wild type NRAS at position Q61. The variant NRAS may be a Q61 K variant. The variant NRAS may be a Q61 H variant. The variant NRAS may be a Q61 R variant. The variant NRAS may be a Q61 L variant. The variant NRAS may be a Q61 P variant.

[0277] The variant NRAS Q61 K may be caused by a c.181C>A (c.C181A) mutation in the NRAS genomic sequence. The variant NRAS Q61 H may be caused by a c.183A>C (c.A183C) mutation in the NRAS genomic sequence. The variant NRAS Q61 H may be caused by a c.183A>T (C.A183T) mutation in the NRAS genomic sequence. The variant NRAS Q61 R may be caused by a c.182A>G (C.A182G) mutation in the NRAS genomic sequence. The variant NRAS Q61 L may be caused by a c.182A>T (C.A182T) mutation in the NRAS genomic sequence. The variant NRAS Q61 P may be caused by a c.182A>C (c.A182C) mutation in the NRAS genomic sequence.

[0278] In some embodiments, the variant NRAS differs from wild type NRAS at position G12. The variant NRAS may be a G12V variant. The variant NRAS may be a G12R variant. The variant NRAS may be a G12D variant. The variant NRAS may be a G12S variant. The variant NRAS may be a G12P variant. The variant NRAS may be a G12C variant. The variant NRAS may be a G12A variant.

[0279] The variant G12V may be caused by a c.35G>T (c.G35T) mutation in the NRAS genomic sequence. The variant G12R may be caused by a c.34G>C (c.G34C) mutation in the NRAS genomic sequence. The variant G12D may be caused by a c.35G>A (c.G35A) mutation in the NRAS genomic sequence. The variant G12S may be caused by a c.34G>A (c.G34A) mutation in the NRAS genomic sequence. The variant G12P may be caused by a c.34_35 inversion or double nucleotide change fromGG to CC in the NRAS genomic sequence. The variant G12C may be caused by a c.34G>T (c.G34T) mutation in the NRAS genomic sequence. The variant G12A may be caused by a c.35G>C (c.G35C) mutation in the NRAS genomic sequence.

[0280] In some embodiments, the variant NRAS differs from wild type NRAS at position G13. The variant NRAS may be a G13S variant. The variant NRAS may be a G13C variant. The variant NRAS may be a G13R variant. The variant NRAS may be a G13F variant. The variant NRAS may be a G13Y variant. The variant NRAS may be a G13V variant. The variant NRAS may be a G13D variant. The variant NRAS may be a G13A variant.

[0281] The variant G13S may be caused by a c.37G>A (c.G37A) mutation in the NRAS genomic sequence. The variant G13C may be caused by a c.37G>T (c.G37T) mutation in the NRAS genomic sequence. The variant G13R may be caused by a c.37G>C (c.G37C) mutation in the NRAS genomic sequence. The variant G13F may be caused by a c.37_38 deletion and insertion of TT in the NRAS genomic sequence. The variant G13Y may be caused by a c.37_38 deletion and insertion of TA in theNRAS genomic sequence. The variant G13V may be caused by a c.38G>T (c.G38T) mutation in theNRAS genomic sequence. The variant G13D may be caused by a c.38G>A (c.G38A) mutation in theNRAS genomic sequence. The variant G13A may be caused by a c.38G>C (c.G38C) mutation in theNRAS genomic sequence.

[0282] Nucleic acid molecules described herein may specifically target the sequence of a variant NRAS. “Specifically target” as used herein describes the preferential hybridisation of the nucleic acid molecule to a sequence of interest, in this case a sequence of variant NRAS.

[0283] Nucleic acid molecules as described herein may comprise a first strand comprising a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant BRAF. The variant BRAF may possess mutations at position V600, relative to wild type BRAF. For example, variant BRAF that differs from wild type BRAF at position V600 may be referred to as a “V600 variant”.

[0284] In some embodiments, the variant BRAF differs from wild type BRAF at position V600. The variant BRAF may be a V600G variant. The variant BRAF may be a V600M variant. The variant BRAF may be a V600D variant. The variant BRAF may be a V600R variant. The variant BRAF may be a V600K variant. The variant BRAF may be a V600E variant.

[0285] The variant BRAF V600G may be caused by a c.1799T>G (C.T1799G) mutation in the BRAF genomic sequence. The variant BRAF V600M may be caused by a c.1798G>A (C.G1798A) mutation in the BRAF genomic sequence. The variant BRAF V600D may be caused by a c.1799_1800delisAT mutation in the BRAF genomic sequence. The variant BRAF V600R may be caused by a c.1798_1799delisCG mutation in the BRAF genomic sequence. The variant BRAF V600K may be caused by a c.1798_1799delisAA mutation in the BRAF genomic sequence. The variant BRAF V600E may be caused by a c.1799_1800delisAA mutation in the BRAF genomic sequence. The variant BRAF V600E may be caused by a c.1799T>A (C.T1799A) mutation in the BRAF genomic sequence.

[0286] Nucleic acid molecules described herein may specifically target the sequence of a variant BRAF. “Specifically target” as used herein describes the preferential hybridisation of the nucleic acid molecule to a sequence of interest, in this case a sequence of variant BRAF.

[0287] Nucleic acid molecules described herein may inhibit the expression of a G60R variant NRAS, and may specifically target a nucleic acid molecule having the sequence GACATACTGGATACAGCTCGACAAGAAGAGTACAGTG (SEQ ID NO: 7). Nucleic acid molecules described herein may inhibit the expression of a G60V variant NRAS, and may specifically target a nucleic acid molecule having the sequence ACATACTGGATACAGCTGTACAAGAAGAGTACAGTGC (SEQ ID NO: 9). Nucleic acid molecules described herein may inhibit the expression of a G60E variant NRAS, and may specifically target a nucleic acid molecule having the sequence ACATACTGGATACAGCTGAACAAGAAGAGTACAGTGC (SEQ ID NO: 11). Nucleic acid molecules described herein may inhibit the expression of a Q61 K variant NRAS, and may specifically target a nucleic acid molecule having the sequence ATACTGGATACAGCTGGAAAAGAAGAGTACAGTGCCA (SEQ ID NO: 13). Nucleic acid molecules described herein may inhibit the expression of a Q61 R variant NRAS, and may specifically target a nucleic acid molecule having the sequence TACTGGATACAGCTGGACGAGAAGAGTACAGTGCCAT (SEQ ID NO: 15). Nucleic acid molecules described herein may inhibit the expression of a Q61 L variant NRAS, and may specifically target a nucleic acid molecule having the sequence TACTGGATACAGCTGGACTAGAAGAGTACAGTGCCAT (SEQ ID NO: 17). Nucleic acid molecules described herein may inhibit the expression of a Q61 P variant NRAS, and may specifically target a nucleic acid molecule having the sequence TACTGGATACAGCTGGACCAGAAGAGTACAGTGCCAT (SEQ ID NO: 19). Nucleic acid molecules described herein may inhibit the expression of a Q61 H variant NRAS, and may specifically target a nucleic acid molecule having the sequence ACTGGATACAGCTGGACACGAAGAGTACAGTGCCATG (SEQ ID NO: 21). Nucleic acid molecules described herein may inhibit the expression of a Q61 H variant NRAS, and may specifically target a nucleic acid molecule having the sequence ACTGGATACAGCTGGACATGAAGAGTACAGTGCCATG (SEQ ID NO: 23).

[0288] Nucleic acid molecules described herein may inhibit the expression of a G12V variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTGGTTGGAGCAGTTGGTGTTGGGAAAAGCGC (SEQ ID NO: 25). Nucleic acid moleculesdescribed herein may inhibit the expression of a G12R variant NRAS, and may specifically target a nucleic acid molecule having the sequence CTGGTGGTGGTTGGAGCACGTGGTGTTGGGAAAAGCG (SEQ ID NO: 27). Nucleic acid molecules described herein may inhibit the expression of a G12D variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGC (SEQ ID NO: 29). Nucleic acid molecules described herein may inhibit the expression of a G12S variant NRAS, and may specifically target a nucleic acid molecule having the sequenceCTGGTGGTGGTTGGAGCAAGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 31). Nucleic acid molecules described herein may inhibit the expression of a G12P variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTGGTTGGAGCACCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 33). Nucleic acid molecules described herein may inhibit the expression of a G12C variant NRAS, and may specifically target a nucleic acid molecule having the sequence CTGGTGGTGGTTGGAGCATGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 35). Nucleic acid molecules described herein may inhibit the expression of a G12A variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTGGTTGGAGCAGCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 37). Nucleic acid molecules described herein may inhibit the expression of a G13S variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTAGTGTTGGGAAAAGCGCAC (SEQ ID NO: 39). Nucleic acid molecules described herein may inhibit the expression of a G13C variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTTGTGTTGGGAAAAGCGCAC (SEQ ID NO: 41). Nucleic acid molecules described herein may inhibit the expression of a G13R variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTCGTGTTGGGAAAAGCGCAC (SEQ ID NO: 43). Nucleic acid molecules described herein may inhibit the expression of a G13F variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTTTTGTTGGGAAAAGCGCAC (SEQ ID NO: 45). Nucleic acid molecules described herein may inhibit the expression of a G13Y variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTTATGTTGGGAAAAGCGCAC (SEQ ID NO: 47). Nucleic acid molecules described herein may inhibit the expression of a G13V variant NRAS, and may specifically target a nucleic acid molecule having the sequence GTGGTGGTTGGAGCAGGTGTTGTTGGGAAAAGCGCAC (SEQ ID NO: 49). Nucleic acid molecules described herein may inhibit the expression of a G13D variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTTGGAGCAGGTGATGTTGGGAAAAGCGCACT (SEQ ID NO: 51). Nucleic acid molecules described herein may inhibit the expression of a G13A variant NRAS, and may specifically target a nucleic acid molecule having the sequence TGGTGGTTGGAGCAGGTGCTGTTGGGAAAAGCGCACT (SEQ ID NO: 53).

[0289] Nucleic acid molecules described herein may inhibit the expression of the variant NRAS, and may specifically target a nucleic acid molecule having the sequence ATACTGGATACAGCTGGTAAAGAAGAGTACAGTGCCA (SEQ ID NO: 55). Nucleic acid moleculesdescribed herein may inhibit the expression of the variant NRAS, and may specifically target a nucleic acid molecule having the sequence ATACTGGATACAGCTGGAAAGGAAGAGTACAGTGCCA (SEQ ID NO: 57).

[0290] Nucleic acid molecules described herein may inhibit the expression of a V600G variant BRAF, and may specifically target a nucleic acid molecule having the sequence ATTTTGGTCTAGCTACAGGGAAATCTCGATGGAGTGG (SEQ ID NO: 59). Nucleic acid molecules described herein may inhibit the expression of a V600M variant BRAF, and may specifically target a nucleic acid molecule having the sequence GATTTTGGTCTAGCTACAATGAAATCTCGATGGAGTG (SEQ ID NO: 61). Nucleic acid molecules described herein may inhibit the expression of a V600D variant BRAF, and may specifically target a nucleic acid molecule having the sequence ATTTTGGTCTAGCTACAGATAAATCTCGATGGAGTGG (SEQ ID NO: 63). Nucleic acid molecules described herein may inhibit the expression of a V600R variant BRAF, and may specifically target a nucleic acid molecule having the sequence GATTTTGGTCTAGCTACACGGAAATCTCGATGGAGTG (SEQ ID NO: 65). Nucleic acid molecules described herein may inhibit the expression of a V600K variant BRAF, and may specifically target a nucleic acid molecule having the sequence GATTTTGGTCTAGCTACAAAGAAATCTCGATGGAGTG (SEQ ID NO: 67). Nucleic acid molecules described herein may inhibit the expression of a V600E variant BRAF, and may specifically target a nucleic acid molecule having the sequence ATTTTGGTCTAGCTACAGAAAAATCTCGATGGAGTGG (SEQ ID NO: 69). Nucleic acid molecules described herein may inhibit the expression of a V600E variant BRAF, and may specifically target a nucleic acid molecule having the sequence ATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGG (SEQ ID NO: 71).Sequence Identity

[0291] The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[0292] In some embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

[0293] In some embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobase portion is compared to an equal length portion of the target nucleic acid.

[0294] In some embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobase portion is compared to an equal length portion of the target nucleic acid. A nucleoside is a base-sugar combination. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0295] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.Sequence complementarity

[0296] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect (for example inhibition of target gene expression) will occur.

[0297] Non-complementary nucleobases between an antisense compound and a nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

[0298] In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%), or 100% complementary to a nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

[0299] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may beclustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) known in the art. Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program using default settings.

[0300] The present invention is further illustrated in the following Examples. It should be understood that these Examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.EXAMPLESExample 1 - Identification and validation of variant NRAS selective siRNAsIdentification of siRNA with allelic discrimination for NRAS c.181 C>A mutation

[0301] Experiments were designed to identify siRNA sequences capable of discriminating between wild type allele NRAS and the NRAS allele having the c.181 C>A mutation. The experimental design is as shown in Figure 1 (a). Briefly, siRNA with the potential to knockdown the variant NRAS transcript were designed with a “walking” approach over the mutation of interest (vertical grey bar NRAS c.181 C>A). The 3’ end of siRNA complementary sequences is completed with two uracil nucleotides which have been reported to improve their activity. Note that the sequences illustrated in the panel are the passenger (sense) strands for ease of interpreting corresponding nucleotides.

[0302] HCT116 colorectal carcinoma WT (CrownBio, C8052C-WT) and homozygous NRASC 181c>A;PQ61K(CrownBio, C6072C) were treated with the siRNA for 48 hours. RNA was extracted, reverse transcribed into cDNA and analysed with qPCR. Allelic discrimination for the target NRAS c.181 C>A transcript was measured based on simple statistical analysis (i.e. a statistically significant reduction in the target allele and no statistically significant reduction in the non-target allele). To expand upon this evaluation, we also considered the results of formulae that either tolerate or do not tolerate targeting of the non-target allele (Takahashi and Hohjoh 2014).

[0303] As shown in Figure 1 , a total of 19 siRNAs were tested. Of these, siRNAs 8 and 15 showed excellent allelic discrimination between wt and c.181 C>A variant NRAS, and were able to significantly reduce the expression of variant NRAS, without affecting wild type NRAS expression.

[0304] The qPCR data obtained from this initial study was then validated using an RNA-seq approach. Briefly, HCT116 colorectal carcinoma WT (CrownBio, C8052C-WT) and homozygous NRASc 181c>A;p Q61K(CrownBio, C6072C) were treated with siRNA for 48 hours. RNA was extracted and then analysed with RNAseq. The results of the RNA-seq analysis are shown in Figure 14.

[0305] As shown in Figure 2A, siRNAs 1 , 8 and 15 significantly reduced expression of variant NRAS. Figure 2E,F,G shows the impact of siRNA candidates 1 , 8 and 15 on the transcriptome. Figure 2E,F,G shows the predicted off-targets of each siRNA, and the extent to which expression of each of those targets is affected following siRNA treatment. siRNAs 8 and 15 in particular show minimal disruption to expression of predicted off-targets, indicating good potential as modulators of variant NRAS. siRNA8 also did not affect the expression of NRAS homologues KRAS and HRAS in non-variant cells (Figure 2C and 2D).Impact of identified siRNAs on downstream signalling pathways and cellular morphology

[0306] Having identified several siRNA candidates that could selectively modulate expression of variant NRAS, the impact of these siRNAs on the MARK pathway was analysed by Western blot. HCT116 colorectal carcinoma WT (CrownBio, C8052C-WT) and homozygous NRASc 181c>A;p Q61K(CrownBio, C6072C) were treated with the candidate siRNAs (siRNAI , siRNA8 and siRNA15) for 48 hours. Protein was extracted and then investigated by Western blot.

[0307] As shown in Figure 13, candidate siRNAs did not alter the amount of phosphorylated ERK relative to control in WT NRAS carcinoma cells. However, in variant NRAS cells, phosphorylated ERK was reduced following treatment with the candidate siRNAs 1 , 8 and 15. These results demonstrate that the candidate siRNAs can modulate variant NRAS expression and influence downstream signalling pathways.Example 2 - Variant NRAS inhibition in congenital melanocytic naevi (CMN) patient-derived cells

[0308] Naevus cells derived from CMN patients were first characterised. In brief, naevus cells were derived and grown in culture from CMN patient biopsies. Cells were fixed and labelled with antibodies targeting SOX10 and Tyrosinase. Cells were sequenced using Sanger sequencing. Morphologies were analysed using CellProfiler Analyst (by training a machine learning classifier model) using images acquired from the Livecyte microscope.

[0309] The results of the characterisation are shown in Figure 3. In particular, Figure 3E shows the NRAS mutations identified by Sanger sequencing in CMN patient-derived naevus cells. Both the c.181 C>A and c.182A>G mutations were identified.

[0310] Once the CMN patient-derived naevus cells had been characterised, the impact of variant NRAS inhibition on cellular morphology, proliferation, and downstream signalling pathways was assessed.

[0311] In brief, naevus cells were derived and grown in culture from CMN patient biopsies. Cells were treated with either siRNA8 or a scrambled RNA as control for 48 hours. Cellular RNA was extracted, reverse transcribed into cDNA and analysed with qPCR. Protein was extracted and analysed with antibodies targeting total NRAS (i.e. both WT and variant NRASQ61 K protein, since there is no antibody available that targets only the WT or the variant NRASQ61 K protein). The final 24 hours of cell growth following siRNA treatment was analysed with Livecyte microscope and ptychographic analysis. The number of cells that had been though cell divisions in the final 24 hours following siRNA treatment was analysed with EdU incorporation and imaged with standard fluorescence microscopy. Images were quantified using CellProfiler software.

[0312] The results are shown in Figure 4. siRNA8 treatment significantly reduced expression of variant NRAS c.181C>A (Fig 4C), and also significantly reduced total NRAS protein (Fig. 4D), confirming that the knockdown at mRNA level translates into reduced protein expression. The ratio of phosphorylated ERK to total ERK was also significantly reduced in siRNA8 treated cells (Figs 4E, 4F), again demonstrating that modulation of NRAS in CMN patient-derived naevus cells can influence downstream signalling pathways. Treatment of CMN patient-derived naevus cells with siRNA8 also significantly reduced cellular proliferation compared to no treatment and scrambled RNA controls (Fig 4H).

[0313] The combined effect of variant NRAS inhibition and trametinib treatment was then assessed. Trametinib is an anti-cancer drug used in the treatment of melanoma. Trametinib treatment alone caused a dose-dependent decrease in proliferation of CMN patient-derived naevus cells, as expected (Fig 4I). Inhibiting variant NRAS by treatment with siRNA8 further reduced the proliferation of trametinib treated cells (Fig 4I, 4J).

[0314] Naevus cells were derived and grown in culture from CMN patient biopsies. Cells were treated with siRNA for 48 hours. The final 24 hours of cell growth following siRNA treatment was analysed with Livecyte microscope and ptychographic analysis. Cells were assigned morphologies based on a machine learning (CellProfiler Analyst software, see figure “In vitro growth of congenital melanocytic naevi (CMN) patient-derived NRAS variant cells”). Immunofluorescence was carried out using antibodies targeting specific proteins associated with stem cells and melanocyte cells. Images were quantified using CellProfiler software. These data are shown in Figure 5.

[0315] siRNA8 also reduces the proportion of non-polar cells in primary naevus cell cultures. Label- free ptychographic imaging of naevus cell morphology and behaviour in samples from four patients demonstrated a range of morphologies within each sample (Figure 3, Figure 4). Morphologies were therefore classified using a machine learning tool, into relative proportions of nonpolar, bipolar,multipolar and large multinucleated likely senescent cells (Figure 3). The fractions of each cell type were consistent between patients (Figure 3h). The nonpolar morphology generally appeared briefly before a cell division, which was notably sometimes into three daughter cells. A single dose of siRNA8 treatment induced a significant decrease in the fraction of nonpolar cells with no other subtype alterations at 48 hours (Figure 5b-e). Flow cytometry based on DNA content (DAPI intensity) analysis did not detect an impact on cell cycle stages following 48 hours of siRNA8 treatment.

[0316] Baseline characterisation of naevus cells to confirm melanocytic lineage characterised SOX10 and Tyrosinase expression by immunocytochemistry, in addition to MITF, DCT and Nestin (Figure 5), and markers of senescence P53 (TP53) and P16 (CDKN2A). Despite an increase in DCT expression and a small decrease in NES expression seen in the RNAseq dataset, all immunocytochemical markers were unaffected by siRNA8 treatment at 48 hours.

[0317] SiRNA8 treatment of primary CMN cells suppresses anti-apoptotic marker ARL6IP1 . RNAseq was performed on primary naevus cell lines pre- and post-treatment with siRNA8 to look for both on- and off-target effects. Expression of variant NRAS was significantly and preferentially downregulated over wildtype (Figure 14C), whereas highly homologous genes KRAS (Figure 15C) and HRAS (Figure 15D) were unaffected. Pathway analysis of differentially expressed genes identified enrichment primarily for pathways associated with the cell cycle (Figure 14E, Figure 15E and Supplementary Data Table 2). The RAL and integrin pathways were also enriched along with pathways associated with neuronal ensheathment (Figure 14E, Figure 15E and Supplementary Data Table 2). In contrast, genes associated with melanocyte differentiation were largely unaffected, except for an increase in the expression of DCT (Figure 14E, Figure 17E). Importantly, the most significantly differentially expressed gene was ADP Ribosylation Factor Like GTPase 6 Interacting Protein 1 or ARL6IP1 , also known as Apoptosis regulator in the endoplasmic reticulum membrane or ARMER (Figure 14A).

[0318] siRNA8 treatment triggers apoptosis in primary CMN cell cultures. As highlighted above, ARL6IP1 is highly expressed in naevus cells (Figure 17H) with a distribution across the endoplasmic reticulum membrane in a pattern similar but not identical to the rough endoplasmic reticulum associated protein Ribophorin 1 (RPN1) (Figure 16A). Validation experiments demonstrated that 48 hours of siRNA8 treatment results in suppression of ARL6IP1 gene (Figure 16B) and protein (Figure 16C and Figure 171) in all patient lines. ARL6IP1 was also significantly downregulated in the HCT116 cells treated with siRNA8 dataset (Figure 18A, Figure 18B). ARL6IP1 is known to have a role in protecting cells from the apoptotic effects of ER stress and oncogenic NRAS activity has been demonstrated to drive resistance to ER stress. The inventors therefore reviewed expression of key ER-stress-induced apoptosis regulators ERN1 , EIF2AK3 and ATF6. ERN1 and EIFAK3 were significantly increased on RNAseq (Figure 18D-F) but only ERN1 was found to be significantly upregulated in response to siNRASQ61 K treatment at 48 hours with qPCR (Figure 16D and Figure 18G). In parallel the inventors identified a significant reduction BIRC5 expression with siRNA8 treatment in both the naevus cells(Figure 16E) and the HCT116 cell datasets (Figure 18C). BIRC5 encodes Survivin, a key protein in protection of RAS inducted apoptosis.

[0319] Given these early indicators of activation of apoptosis pathways on RNAseq at 48 hours the inventors then measured apoptosis using Caspase3 / 7 activation in live imaging of cells from 4 naevus patients over a period of seven days. All naevus cell cultures treated with a single dose of siRNA8 showed markedly increased levels of apoptosis over that period, in all patients, when compared to untreated cells and control siRNA by seven days, measurable from 3-4 days (Figure 16F).

[0320] siRNA8 treatment in primary naevus cell cultures permits effectiveness of MEKi. The effectiveness of siRNA8 treatment was then compared to that of MEK inhibitor (MEKi) trametinib, currently the only medical therapy to have been tried in CMN patients in vivo. Individually, at the doses used, the effectiveness of siRNA8 and trametinib alone were similar (Fig. 4i,j). The combined effectiveness of siRNA8 and trametinib in reducing proliferation however was significantly greater than that of trametinib alone at 48 hours (Fig 4i,j and Figure 20). Unlike its effects on proliferation of CMN cells in culture, MEKi trametinib alone had no impact on Caspase 3 / 7 activity (Figure 19). Addition of 12.5nM trametinib to siRNA8 treated cells however significantly increased the induction of apoptosis seen with siRNA8 treatment alone, an effect not seen with addition of trametinib to siCTRL treated cells (Figure 19).

[0321] The above data demonstrates that manipulation of variant NRAS has therapeutic utility for rescuing overactivation of the ERK pathway and reducing proliferation of CMN patient-derived naevus cells. Given that CMN individuals are at much higher risk for developing melanoma compared to non- CMN individuals, modulation of variant NRAS also presents an opportunity to mitigate melanoma risk by rescuing the effects associated with gain-of-function NRAS mutations. Importantly, the data included herein confirms that silencing the variant NRAS allele leads to a triggering of apoptosis in disease cells. This in turn confirms the utility of targeting NRAS variants as an approach in both CMN and melanoma treatment.Example 3 - Injection of NRAS-targeting siRNA into dermisMaterials and Methods

[0322] TYR::NRASQ61 K mice were culled and depilated. 50ul of siRNA-cy5 prepared in cationic lipid nanoparticles (DOTMA+DOPE+Peptide KKKKKKKKKKKKKKKKGACISVYMMCG) (SEQ ID NO: 1353) mixed at a ratio of 1 :4:1 (lipids:peptide:siRNA) in an isotonic sucrose buffer (300 mOsmol) were injected into the dermis. Injection of just the sucrose vehicle buffer is shown as a negative control. The injection site was immediately isolated, fixed, cryoprotected then cryosectioned. Sections were stained with Hoechst to observe DNA (i.e. Nuclei) and the siRNA-cy5 is displayed in white in Figure 6.Results

[0323] Since the dermis is the primary site of naevus cells in CMN, experiments were performed to investigate whether siRNA could be successfully delivered to the dermis by injection in mice. The distribution of siRNA following intradermal injection of mouse skin was investigated by tracking siRNA- Cy5. siRNA can be observed within the dermis which is the primary site of naevus cells in CMN. The dotted line delineates the boundary between the epidermis and the dermis.

[0324] The results shown in Figure 6 confirm that the siRNA can be successfully delivered to the location of naevus cells in vivo by injection.

[0325] Although siRNA is used in the examples above as a targeting modality, any targeting modality that can modulate variant NRAS expression will have utility in this setting. With that in mind, the inventors sought to provide a guide RNA that would enable the selective targeting of variant NRAS through CRISPR editing.Example 4 - CRISPR editing

[0326] The CRISPR-Cas9 system has two major components, the Cas9 endonuclease and the Single Guide RNA. Both parts play roles in target designation. The sgRNA is a single RNA molecule generated as a result of fusion of a custom-designed short CRISPR RNA (crRNA) complementary to the DNA sequence of interest, to the trans-activating crRNA (tracrRNA) scaffold. This sgRNA can guide the Cas9 system to any complementary sequence, however, the Cas9 nuclease will not be activated unless it detects a Protospacer Adjacent Motif (PAM) sequence. A PAM sequence is short sequence of nucleotides that is recognised by the C-terminal domain within the nuclease lobe of the Cas9 enzyme. Once a Cas9-sgRNA complex is formed, the complex scans the genome for the presence of a PAM site through hydrogen bonding of the C-terminal domain to DNA via the major grove. Upon recognition of the PAM sequence, the Cas9 enables localised DNA melting, allowing for sgRNA strand invasion resulting in the formation of the R-loop. The sgRNA is then aligned with the potential target site, and given high homology between the sequences, enables the activation of the two nuclease domains HNH and RuvC resulting in a double-stranded DNA break.

[0327] Many homologues of Cas9 have been discovered in many different bacterial species which include S. pyogenes (Sp), S. aureus (Sa), S. thermophiles, and N. 162 meningitides, each of these Cas9 homologues have different PAM recognition sequences.

[0328] To produce allele-specific sgRNAs, either the sgRNA or the PAM sequence must include the NRAS c.(181 C>A) mutation. No PAM sequences specific to -NGG-; where N can be any nucleotide) were found in NRAS either incorporating or sufficiently close to the mutation to use this endonuclease. Instead, using Benchling (October 2016; Benchling Inc., -NNGRRT-; where N is any nucleotide and Ris an A or a G) were located close enough, such that the sgRNAs could include the NRAS c.(181 C>A) mutation (Figure 7). 21 -nucleotide sequences for the three sgRNAs corresponding to the three PAM sites are shown in Figure 7.

[0329] The three sgRNAs were inserted into a plasmid via restriction enzyme digest of the backbone and ligation of the sgRNA DNA template. The px601 plasmid vector (Addgene plasmid #61591 ; Addgene, MA, USA) was chosen as it contained SaCas9 as well as a site where the sgRNA DNA template could be inserted into the plasmid via Golden Gate cloning.

[0330] The plasmids were provided in chemically competent E.coli (Stbl3), the E.coli were expanded for 16 hours in selective media and a proportion of the bacterial suspension was removed for plasmid extraction. Confirmation of the identity of the plasmids were achieved through an enzymatic digest of the plasmid using the Hinclll enzyme (New England Biolabs, MA, USA). Once confirmed, the plasmids were then linearised using the Bsal enzyme (New England Biolabs, MA, USA) allowing for Golden Gate cloning.

[0331] The sgRNA DNA inserts had the relevant overhangs incorporated into their design prior to synthesis. The plasmid and inserts were then ligated together, and transformed into chemically competent E.coli ThermoFisher Scientific, MA, USA). The E.coli were streaked onto selective agar and incubated for 16 hours to create single cell colonies. Single cell colonies were selected and expanded in a selective media suspension for a further 16 hours. A proportion of the bacterial cell suspension was used for plasmid extraction in order to screen the colonies for the correct insertion of the sgRNA DNA insert into the px601 plasmid backbone. Screening consisted of enzymatic digestion and Sanger sequencing (Figures 6-8). To check for the correct insertion of either sgRNAI or 2, plasmids extracted from bacterial colonies were digested with the BciVI enzyme. Figure 8A shows that plasmid 1 contains the sgRNA2 insert, and so was designated as px601-sgRNA2, px601 -sgRNAI had been identified in a previous screen, and was used in Figure 8A as a positive control for enzymatic activity. Figure 9 shows that all three colonies tested contained the sgRNAI insert in the px601-GFP backbone, and as such GFP sgRNAI .1 was taken forward and designated as px601-GFP-sgRNA1 . Figure 9 shows that all three colonies tested contained the sgRNA2 insert in the px601-GFP backbone, and as such GFP sgRNA2.1 was taken forward and designated as px601 -GFP-sgRNA2.To check for the correct insertion of sgRNA3, plasmids extracted from bacterial colonies were digested with the Earl enzyme (New England Biolabs, MA, USA, Figure 8B, Figure 10). Figure 8B shows that plasmid 3 contains the sgRNA3 insert, and so was designated as px601-sgRNA3. Figure 10 shows that all three colonies tested contained the sgRNA3 insert in the px601-GFP backbone, and as such GFP sgRNA3.1 was taken forward and designated as px601-GFP-sgRNA3. Positive results from the enzymatic screens (Figures 6-8) were confirmed by Sanger sequencing. This resulted in the generation of px601-sgRNA1 , px601- sgRNA2, and px601-sgRNA3; px601-GFP-sgRNA1 , px601-GFP-sgRNA2, and px601-GFP-sgRNA3.

[0332] DNA from the positive results generated from Figure [22 (in thesis)], Figure

[0023] , and Figure 24 were sent for Sanger sequencing for confirmation of the insert of the relevant sgRNA oligonucleotide into the px601 or px601-GFP backbone. Figure 25 shows the resulting chromatograms. The relevant inserted sequence has been highlighted within the chromatograms. sgRNA sequences can be seen in Figure 20 and the sgRNA DNA oligonucleotide sequences for each insert can be seen in Table 6. Chromatograms were produced using the Snap Gene Viewer (GSL Biotech LLC, IL, USA).Transfection optimisation of HCT116 cell line with a GFP-containing plasmid

[0333] The aim of this experiment was to maximise transfection efficiency. This is necessary to provide the best chance of observing any genome editing while using the CRISPR-Cas9 system. In order to achieve this aim, a plasmid containing a GFP protein (pEGFP-N1 ; Clontech, CA, USA) was transfected into the HCT1 16-Q cell line using Lipofectamine® 2000 (ThermoFisher Scientific, Waltham, MA, USA). A GFP plasmid was utilised as the plasmid containing the CRISPR-Cas9 system did not have a selectable marker. HCT116-Q cells were seeded at two different densities on a 24-well plate, 1 .8x105 and 2.2x105, and left over night in a 37°C 5% CO2 incubator. The two different seeding densities were observed and it was found that 2.2x105 wells were above the suggested confluency for the transfection so only the 1.8x105 wells were taken forward for transfection. Three quantities of plasmid DNA were used (250, 500, and 750ng), along with three volumes of Lipofectamine® 2000 (1 , 2, and 3pL). This transfection optimisation protocol was untaken in three biological triplicates. After 48 hours, the cells were run through a flow cytometer. Cells were initially selected for health by utilising a normal range of forward and side scatter. Following this, the cells were then measured for the presence and abundance of fluorescence. Using the untransfected cells as a negative fluorescent control, gates were introduced in order to determine the percentage of cells that were fluorescently active, and thus provide a transfection efficiency. The same gating was applied to all biological replicates (Figure 26).

[0334] It was found that transfections with 1 pL of Lipofectamine® 2000 collectively had the worst transfection with approximately 10% GFP fluorescence. The rest of the combinations all had comparable transfection efficiencies with both of the 2 and 3pL Lipofectamine® combinations having approximately 50% transfection efficiency. The controls all showed negligible transfection rates. From these results, future plasmid transfections will be carried out using 250ng of DNA and 3pL of Lipofectamine® 2000 (Figure 27).Determining editing efficiency in HCT116 cell lines

[0335] The px601-sgRNAs were transfected into the HCT116 cell lines. Cells were seeded and after 24 hours, the optimised formulation was applied to them, the cells were incubated for 48 hours, after which the cells were lysed, and DNA was extracted. A PCR of the region of interest was carried out and after purifying the PCR product, a T7 assay was used to determine genome editing (Figure 28).

[0336] The assay had a number of controls to assist in any fault finding. The samples used were px601- sgRNAI (sgRNAI), px601-sgRNA2 (sgRNA2), px601-sgRNA3 (sgRNA3), px601 without any sgRNA (px601), a CFTR transfection control plasmid, a lipofectamine 2000 only control (L2K), an untransfected control (Unt), and a T7 control (T7 control). All samples were run with an uncut (no T7 added) and a test (T7 added) as indicated with a "2 or "+". A px601 plasmid was transfected which did not contain any sgRNA, this control was used to show any effect of adding a Cas9 plasmid without a guide. A plasmid that was known to target CFTR was used a positive control for transfection, this plasmid had shown efficacy by a previous member of the lab in a different cell line. A Lipofectamine® 2000 only control was used to determine any confounding influences of adding only Lipofectamine. There was also an untransfected control to indicate what the baseline of no editing would show. Finally there was a T7 assay control, this control was designed to show if the T7 assay was working, this was achieved by being gifted a sample of genomic DNA on which gene editing had been shown to occur within the CFTR gene, this DNA was amplified by PCR, cleaned, and digested by the T7. The experiment was done with biological triplicates.

[0337] A positive result of gene editing was expected to show the PCR product being digested resulting in the generation of two lower DNA fragments of total length of the original PCR product. For the plasmids targeting NRAS, the PCR product was 827bp, and if gene editing had occurred at the site of interest, two fragments of sizes 372 and 455bp would be observed. An example of a positive T7 result can be seen in the T7 control in all three repeats, where the PCR product of a region of the CFTR gene was approximately 840bp, and if editing had occurred, two fragments of sizes 210 and 630bp would be present. As these DNA fragments can be seen, I can conclude that the T7 assay did indeed work. However, the transfection control in the form of the CFTR targeting plasmid showed no editing. Further to this, all three of the px601-sgRNAs showed no editing. The other negative controls, the px601 without a guide, the Lipofectamine® 2000 only, and untransfected sample, all showed no editing. This has led to the conclusion that the transfection might not have worked as hoped. To move forward it would be useful to ensure the transfection had worked correctly by utilising a tagged Cas9.Single cell sorting of GFP-positive cells to assist in identification of gene editing

[0338] The new px601-GFP plasmids containing the guide RNAs were transfected into both the parental (wildtype c.(181 C)) and variant (homozygous c.(181 C>A)) HCT116 cell lines. The cells were incubated for 48 hours and then underwent cell sorting (Figure 29). Cell sorting was performed using flow cytometry, utilising the GFP tag, to enrich for cells transfected with CRISPR-Cas9.

[0339] Flow cytometry was also used to create single cell colonies of GFP-positive cells through single cell sorting. After a period of expansion, these colonies were harvested for DNA extraction and sequencing. In addition to this, excess GFP-positive cells that were not used for seeding of single cell colonies were collected into "GFP-positive mixed populations" of cells. These cells had DNA and proteinextracted, where the DNA was used to investigate if any editing had occurred in the population, and the protein was used to examine the effect of the editing on the activation of the MAPK pathway through western blot analysis of the phosphorylation state of ERK.Investigation of the presence of gene editing within GFP-positive mixed populations transfected with px601-GFP-sgRNAs

[0340] As mentioned previously, the excess GFP-positive cells that were not used for the generation of single cell colonies were collected as a GFP-positive mixed population in triplicate. These populations were expanded until both DNA and protein could be extracted. The site of interest was amplified using PCR, and a T7 assay was carried out on the PCR product. Briefly, this consisted of melting and reannealing the PCR products, digesting the annealed PCR products with the T7 endonuclease I (New England Biolabs®, MA, USA), and examining the result on an agarose gel using electrophoresis. Figure 30 demonstrates clear gene editing in the HCT116-Q (A / RAS-variant) cell line transfected with px601- GFP-sgRNA2, witnessed by digestion of the PCR product in all three triplicates. No detectable editing by this method was seen with transfection of the HCT116-Q by px601-GFP-sgRNA1 or px601-GFP- sgRNA3, and none in the HCT116-P (non-A / RAS-variant).Investigation of the presence of gene editing within single cell populations transfected with px601-GFP-sgRNAs

[0341] Having established that the GFP-positive mixed populations had undergone gene editing, the single cell colonies were investigated. After single cell sorting, the single cell colonies were expanded prior to DNA extraction. The region of interest was amplified by PCR and sequenced by the Sanger method.

[0342] Gene editing had occurred using both px601-GFP-sgRNA1 and px601-GFP- sgRNA2 in the HCT116-Q cell lines only (Figure 31). Of the 18 single cell colonies sequenced for HCT116-Q transfected with px601-GFP-sgRNA1 , two colonies showed gene editing, and 19 single cell colonies HCT116-P transfected with px601-GFP-sgRNA1 showed no gene editing. Of the 16 single cell colonies sequenced for HCT116-Q transfected with px601-GFP-sgRNA2, eight colonies showed gene editing, and 9 single cell colonies HCT116-P transfected with px601-GFP-sgRNA2 showed no gene editing. No gene editing was detected for px601-GFP-sgRNA3 in both HCT116-Q and HCT116-P in 21 and 7 sequenced single cell colonies respectively.

[0343] This lead to the conclusion that the px601-GFP-sgRNA1 had a gene editing rate of 11 %, and px601-GFP-sgRNA2 of 50%, where both showed allele-specific editing of the variant allele only.Determining the effect of gene editing of the GFP-positive mixed population on the activation state of the MAPK signalling pathway

[0344] Having determined the presence of gene editing in NRAS in an allele-specific manner, the GFP- positive mixed samples were further investigated in order to uncover any potential changes in the downstream MAPK signalling pathway by interrogating ERK phosphorylation state. After DNA was taken for the analysis of gene editing (Figure 30), protein was also extracted. ERK, phosphorylated ERK, and Histone 3 (H3) were blotted for in each of the triplicates (Figure 32). The resulting blots were quantified using densitometry (Figure 33), the values normalised to the relevant untransfected controls (Unt), and a ratio of phosphorylated ERK to total ERK was obtained to provide a marker of MAPK signalling activation.

[0345] There was a non-significant reduction in the relative phosphorylation state of ERK when transfected with the sgRNAs when compared to the untransfected controls (Figure 33). The largest change was observed in HCT116-Q when transfected sgRNA2 (HCT116-P: 0.122±0.080; HCT1 16-Q: 0.023±0.017; mean±standard deviation; p=0.125), consistent with the previously observed gene editing in those samples.CRISPR-Cas9 conclusions

[0346] The main aim was to achieve allele-specific gene editing of the NRAS c.(181A) allele. This involved the design of three sgRNAs specific to the variant allele that covered the c.(181) loci and were sufficiently close to utilise the SaCas9-unique PAM sites. These sgRNAs were successfully cloned into a GFP containing p601 plasmid, which was confirmed by both enzymatic digest and Sanger sequencing. The transfection for the HCT116 cell lines were optimised with the GFP containing plasmid using flow cytometry. Once optimised, the cells were transfected with the px601-GFP- sgRNA plasmids and sorted by flow cytometry. Mixed and single cell clones demonstrated absolutely allele-specific targeting and knockdown of the NRAS gene, confirmed at DNA level. Overall, sgRNA2 appears to be the most promising guide, with sgRNAI also demonstrating good activity.Example 5 - Design and testing of receptor-targeted nanoparticles (RTNPs)Materials & Methods

[0347] Lipids for cationic nanoparticles are resuspended and mixed to a total lipid concentration of 1 mg / ml in 100% ethanol: 49.5% Cationic lipid DOTMA (DOTMA 1 ,2-di-O-octadecenyl-3- trimethylammonium propane (chloride salt). Molecular Weight: 670.575 [CAS: 104872-42-6; Avanti SKU: 890898P]). 49.5% Neutral lipid DOPE (18:1 (A9-Cis) PE (DOPE) 1 ,2-dioleoyl-sn-glycero-3- phosphoethanolamine. Molecular Weight: 744.034 [CAS:4004-05-1 ; Avanti SKU: 850725P]). 1 % PEGylated lipid (DPPE-PEG(2000)Azide 1 ,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N- azido(polyethylene glycol)-2000 (ammonium salt). Molecular Weight: 2760.38 [CAS: Not available; Avanti SKU: 880231 P]). Peptide (27 amino acids, Lys-Lys Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Gly-Ala-Cys-lle-Ser-Val-Tyr-Met-Met-Cys-Gly (KKKKKKKKKKKKKKKKGACISVYMMCG (SEQ ID NO: 1353)) [AMSBIO]) is resuspended to a concentration of 10mg / ml in 95% ethanol.

[0348] Self-assembly of lipid nanoparticles is initiated by mixing the lipids, peptide and siRNA, in that order and unless otherwise specified at a ratio of 1 : 4 : 1 (lipid : peptide : siRNA). 3 volumes of water must be used for every 1 volume of ethanol (i.e. input of siRNA must be in 3 volumes of water for every 1 volume of ethanol from the lipid and peptide stock). The lipid nanoparticles containing siRNA were dialysed (GeBaFlex-tube - Dialysis kit MWCO 8kDa, Generon) to exchange the ethanol to water, changing the water 3 times over 24 h.

[0349] The RTNPs were concentrated by loading the dialysed sample in Centrifugal filter units, (Amicron Ultra, Merck), and centrifugation at speed / time outlined in protocol. The concentrated nanoparticles were resuspended in sucrose solution (275-300mOsm). Sterile filter (Syringe Filter PTFE 25mm 0.2ulm NSTR, Fisher 15141499). The hydrodynamic size and charge of lipid nanoparticles was measured with the Malvern Zetasizer. RNase protection assay was performed by treating the formulated lipid nanoparticles or siRNA alone with RNase A at 2pg / ml before incubation for either 1 , 2 or 4 hours at 37°C. 1 ul of RNase inhibitor was added to stop the digestion. The nanoparticles were then lysed with 16.4mM of SDS before running on an agarose gel. The encapsulation assay was performed by loading formulated lipid nanoparticles into an agarose gel and checking for free siRNA following electrophoresis.Results

[0350] Designing a delivery system for siRNA treatment was done with extrapolation to human trials in mind. Whilst the inventors had already incorporated allele-targeting within the siRNA design, additional targeting of the cell type was considered desirable to keep the eventual required dose as low as possible. The KIT receptor was selected as the most melanocyte-specific cell surface target compared to other skin cells on the basis of single cell expression data, and as a peptide sequence for targeting had already been established in a previous publication.

[0351] Optimisation of self-assembling receptor-targeted nanoparticles (RTNPs) protects siRNA from degradation and allow delivery into human skin explants. Self-assembling RTNPs have previously been described as highly effective methods of intracellular delivery for siRNA. Formulation of the RTNPs was optimised using variable peptide content, whilst maintaining equal ratios of siRNA and lipid (Figure 22A- C), producing siRNA8-RTNPs. Mean nanoparticle diameter was assessed using dynamic light scattering at approximately 200nm (Figure 22A, Figure 22F). Addition of increasing amounts of peptide altered the lipid nanoparticles from anionic to cationic (Figure 22B) and in parallel resulted in increased siRNA encapsulation. Encapsulation was complete at ratios 1 :3:1 and 1 :4:1 (lipid: peptide: siRNA) (Figure 22C), and protected the siRNA from RNase degradation (Figure 22D). Treatment of naevus cells with RTNPs containing a peptide sequence reported to bind to the KIT receptor delivered siRNA moreeffectively than controls (Figure 22G). siRNA8-RTNPs were successfully delivered to the dermis of CMN patient skin explants after intradermal injection (Figure 21 A, Figure 21 B).Example 6 - Treatment with siRNA8-RTNPs in a murine model of CMNMaterials & Methods

[0352] Tyr::NRASQ61 K mice (age = 41-45 weeks, 3x females, 5x males) were shaved with clippers before receiving intradermal injections (insulin needle 30G) of 450pg of RTNPs prepared in sucrose solution (295 mOsmol) either side of the dorsal midline while under general anaesthesia (isolfurane). Injection sites were marked by drawing around the bleb with a marker pen. 48 hours later the mice were culled and a 4mm punch biopsy was collected from each site. The biopsy was stored in RNAIater (Invitrogen AM7021) prior to RNA extraction.Results

[0353] Cy5-siRNA in RTNPs can be delivered successfully into mouse dermis. To demonstrate in vivo delivery, Cy5-tagged control siRNA incorporated into RTNPs was injected into mouse dermis and skin was fixed one hour later. Fluorescence was visualised after paraffin embedding and H&E staining confirming successful delivery into the dermis (Figure 23C, Figure 23D).

[0354] Treatment with siRNA8-RTNPs induces selective knockdown of variant humanised NRAS Treatment with siRNA8-RTNPs was then tested in a murine model of CMN (Tg(Tyr-NRAS*Q61 K)1 Bee; MGI:376864540 (Figure 23A), in which mice have hyperpigmented skin and an excess of melaninproducing cells present in the dermis (Figure 21 D, Figure 21 E and Figure 23B). Eight mice received two separate intradermal injections of siRNA8-RTNPs into the skin of the back, shaved just prior to the procedure, in addition to an identical neighbouring injection of RTNPs containing non-targeting siRNA as a control. siRNA8-RTNPs induced knockdown of the transgenic variant NRAS allele (Figure 21 F) but not of the WT endogenous Nras allele (Figure 21 G) at 24 and 48 hours. No side effects were observable macroscopically either at the injection site or on mouse behaviour or general health at this time point.

[0355] The above findings demonstrate targeted silencing of variant NRAS in primary patient naevus cells in vitro, in patient skin explants, and in a humanised transgenic mouse in vivo. Importantly, silencing of the variant allele triggers apoptosis of naevus cells in vitro, via a previously unknown link to the ER-stress induced apoptosis pathway. These results illustrate the utility of targeting variant NRAS to reverse benign lesions, treat CMN, and prevent malignant disease development.Example 7 - Variant BRAF inhibition in BRAF-mutant melanoma cell linesMaterials & Methods

[0356] Effect of siRNA inhibition of variant BRAF was investigated in homozygous (A375, SKMEL28) and heterozygous (A2058, G-361) cell lines. Cells were treated with siBRAFV600E (antisense strand SEQ ID NO: 1334, sense strand SEQ ID NO: 1315) to selectively target variant BRAF, or siBRAF to non-selectively target BRAF. siSCRA was used as a negative control and siUBB, which knocks down the essential gene UBB, was used as a positive control for Caspase 3 / 7 activation.Results

[0357] Figure 24 shows the results including the positive control siUBB. Figure 25 shows the same results without displaying the siUBB, allowing better visualisation due to the scaling required. As shown in Figure 25A, treating cells with the allele-specific siBRAFV600E significantly reduced proliferation compared to the control siSCRA in A375, A2058 and G-361 cell lines. siBRAFV600E also performed better than the non-selective siRNA (siBRAF). As shown in Figure 25B, siBRAFV600E treatment also induced apoptosis in heterozygous cell lines.

[0358] The results shown above demonstrate that directly targeting oncogenic BRAF variants can induce apoptosis in melanoma cells. Allele-targeted siRNA also performed better than non-targeted siRNA.Example 8 - Variant NRAS inhibition in leptomeningeal melanocytosis

[0359] Naevus cells were derived and grown in culture from a patient with leptomeningeal melanocytosis. In leptomeningeal melanocytosis the patient has dysplastic (between benign and malignant) leptomeningeal disease. Primary naevus cell cultures were treated with a single dose of siRNA8, and apoptosis was measured using Caspase 3 / 7 activation in live imaging of cells. SiUBB was used as a positive control, and non-treated, liposome only, and siNon-target were used as negative controls.

[0360] As shown in Figure 26B, inhibition of variant NRAS by treatment with siRNA8 triggers apoptosis. Significantly more caspase 3 / 7 activation was observed in primary naevus cell cultures treated with siRNA8 compared to siNon-target (p<0.0001). Confluency of siRNA8 treated cells was also significantly reduced relative to control (p<0.0001).

[0361] The results above demonstrate that targeting variant NRAS triggers apoptosis in leptomeningeal melanocytosis, providing evidence of the utility of this approach in a different tissue type.Example 9 - NRAS and BRAF combination therapy in acquired naevi

[0362] Individuals with acquired naevi will be recruited according to standard protocols, randomised and allocated to placebo (control) or treatment conditions. In the treatment condition, individuals will be administered a composition comprising siRNAs targeting NRAS and BRAF variants, and apharmaceutically acceptable excipient. In the placebo condition, individuals will be administered the same composition without the siRNAs. Administration of placebo or treatment will be via microneedle injection into the dermis, or via topical application. Repeated doses may be administered. Measurement of naevus size, surface area, colour and shape will be performed prior to administration (baseline) and again at a defined time after administration, such as four weeks after administration. Changes in naevus size and surface area will be calculated relative to baseline and compared statistically between placebo and treatment conditions.EQUIVALENTS AND SCOPE

[0363] Those skilled in the art will appreciate that the present invention is defined by the appended claims and not by the Examples or other description of certain embodiments included herein.

[0364] Similarly, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.

[0365] Unless defined otherwise above, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, genetics and protein and nucleic acid chemistry described herein are those well-known and commonly used in the art, or according to manufacturer's specifications.

[0366] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

[0367] SequencesTable 1 - Exemplary target sequences and exemplary siRNA sequencesCLAUSES

[0368] The present application also provides the following embodiments:1. A nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS or BRAF.2. The nucleic acid molecule of embodiment 1 , wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS or BRAF.3. The nucleic acid molecule according to any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS.4. The nucleic acid molecule according to any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS.5. The nucleic acid molecule according to any one of embodiments 1 or 2, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding BRAF.6. The nucleic acid molecule according to any one of embodiments 1 , 2 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of BRAF.7. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 40 linked nucleosides.8. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 30 linked nucleosides.9. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 30 linked nucleosides.10. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 25 linked nucleosides.11. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 20 linked nucleosides.12. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 20 linked nucleosides.13. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 20 to 30 linked nucleosides.14. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 20 to 25 linked nucleosides.15. The nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 21 linked nucleosides.16. The nucleic acid molecule according to any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D).17. The nucleic acid molecule according to any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to anequal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D).18. The nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G60RA / / E / D) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.19. The nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G60R / V / E / D) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro.20. The nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G60R / V / E / D).21. The nucleic acid molecule according to any one of embodiments 16-20, wherein the variant NRAS p.(G60R) is caused by a c.G178C mutation in the NRAS genomic sequence.22. The nucleic acid molecule according to embodiment 21 , wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 73-91 .23. The nucleic acid molecule according to embodiment 21 or 22, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 73-91 .24. The nucleic acid molecule according to any one of embodiments 21-23, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 73-91 .25. The nucleic acid molecule according to any one of embodiments 16-20, wherein the variant NRAS p.(G60V) is caused by a C.G179T mutation in the NRAS genomic sequence.26. The nucleic acid molecule according to embodiment 25, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 111-129.27. The nucleic acid molecule according to embodiment 25 or 26, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 11 1-129.28. The nucleic acid molecule according to any one of embodiments 25-27, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 11 1-129.29. The nucleic acid molecule according to any one of embodiments 16-20, wherein the variant NRAS p.(G60E) is caused by a C.G179A mutation in the NRAS genomic sequence.30. The nucleic acid molecule according to embodiment 29, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 149-167.31 . The nucleic acid molecule according to embodiment 29 or 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 149-167.32. The nucleic acid molecule according to any one of embodiments 29-31 , wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 149-167.33. The nucleic acid molecule according to any one of embodiments 1-4 or 7-15, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P).34. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 33, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P).35. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 33-34, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(Q61 K / R / H / L / P) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.36. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 33-35, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(Q61 K / R / H / L / P) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro.37. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 33-36, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(Q61 K / R / H / L / P).38. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 K) is caused by a C.C181A mutation in the NRAS genomic sequence.39. The nucleic acid molecule according to embodiment 38, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 187-205.40. The nucleic acid molecule according to embodiment 38 or 39, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 187-205.41. The nucleic acid molecule according to any one of embodiments 38-40, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 187-205.42. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 R) is caused by a c.A182G mutation in the NRAS genomic sequence.43. The nucleic acid molecule according to embodiment 42, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 225-243.44. The nucleic acid molecule according to embodiment 42 or 43, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 225-243.45. The nucleic acid molecule according to any one of embodiments 42-44, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 225-243.46. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 L) is caused by a c.A182T mutation in the NRAS genomic sequence.47. The nucleic acid molecule according to embodiment 46, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 263-281 .48. The nucleic acid molecule according to embodiment 46 or 47, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 263-281 .49. The nucleic acid molecule according to any one of embodiments 46-48, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 263-281 .50. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 P) is caused by a c.A182C mutation in the NRAS genomic sequence.51. The nucleic acid molecule according to embodiment 50, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 301-319.52. The nucleic acid molecule according to embodiment 50 or 51 , wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 301-319.53. The nucleic acid molecule according to any one of embodiments 50-52, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 301-319.54. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 H) variant is caused by a c.A183C mutation in the NRAS genomic sequence.55. The nucleic acid molecule according to embodiment 54, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 339-357.56. The nucleic acid molecule according to embodiment 54 or 55, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 339-357.57. The nucleic acid molecule according to any one of embodiments 54-56, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 339-357.58. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS p.(Q61 H) variant is caused by a C.A183T mutation in the NRAS genomic sequence.59. The nucleic acid molecule according to embodiment 58, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 377-395.60. The nucleic acid molecule according to embodiment 58 or 59, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 377-395.61. The nucleic acid molecule according to any one of embodiments 58-60, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 377-395.62. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS is caused by a c.180_181 delinsTA mutation in the NRAS genomic sequence.63. The nucleic acid molecule according to embodiment 62, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 991-1010.64. The nucleic acid molecule according to embodiment 62 or 63, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 991-1010.65. The nucleic acid molecule according to any one of embodiments 62-64, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 991-1010.66. The nucleic acid molecule according to any one of embodiments 33-37, wherein the variant NRAS is caused by a c.181_183delinsAAG mutation in the NRAS genomic sequence.67. The nucleic acid molecule according to embodiment 66, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1031-1051 .68. The nucleic acid molecule according to embodiment 66 or 67, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1031-1051 .69. The nucleic acid molecule according to any one of embodiments 66-68, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1031-1051 .70. The nucleic acid molecule according to any one of embodiments 1-4 or 7-15, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V).71. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 70, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V).72. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 70-71 , wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G12R / S / D / P / C / A / V) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.73. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 70-72, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G12 R / S / D / P / C / AA / ) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro.74. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 70-73, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G 12 R / S / D / P / C / AA / ).75. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12V) is caused by a C.G35T mutation in the NRAS genomic sequence.76. The nucleic acid molecule according to embodiment 75, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 415-433.77. The nucleic acid molecule according to embodiment 75 or 76, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 415-433.78. The nucleic acid molecule according to any one of embodiments 75-77, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 415-433.79. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12R) is caused by a C.G34C mutation in the NRAS genomic sequence.80. The nucleic acid molecule according to embodiment 79, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 453-471 .81 . The nucleic acid molecule according to embodiment 79 or 80, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 453-471 .82. The nucleic acid molecule according to any one of embodiments 79-81 , wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 453-471 .83. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12D) is caused by a C.G35A mutation in the NRAS genomic sequence.84. The nucleic acid molecule according to embodiment 83, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 491-509.85. The nucleic acid molecule according to embodiment 83 or 84, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 491-509.86. The nucleic acid molecule according to any one of embodiments 83-85, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 491-509.87. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12S) is caused by a C.G34A mutation in the NRAS genomic sequence.88. The nucleic acid molecule according to embodiment 87, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 529-547.89. The nucleic acid molecule according to embodiment 87 or 88, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 529-547.90. The nucleic acid molecule according to any one of embodiments 87-89, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 529-547.91. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12P) is caused by a C.G34C / G35C mutation in the NRAS genomic sequence.92. The nucleic acid molecule according to embodiment 91 , wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 567-586.93. The nucleic acid molecule according to embodiment 91 or 92, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 567-586.94. The nucleic acid molecule according to any one of embodiments 91-93, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 567-586.95. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12C) is caused by a C.G34T mutation in the NRAS genomic sequence.96. The nucleic acid molecule according to embodiment 95, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 607-625.97. The nucleic acid molecule according to embodiment 95 or 96, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 607-625.98. The nucleic acid molecule according to any one of embodiments 95-97, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 607-625.99. The nucleic acid molecule according to any one of embodiments 70-74, wherein the variant NRAS p.(G12A) is caused by a C.G35C mutation in the NRAS genomic sequence.100. The nucleic acid molecule according to embodiment 99, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 645-663.101 . The nucleic acid molecule according to embodiment 99 or 100, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 645-663.102. The nucleic acid molecule according to any one of embodiments 99-101 , wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 645-663.103. The nucleic acid molecule according to any one of embodiments 1-4 or 7-15, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y).104. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 103, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y).105. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 103-104, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.106. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 103-105, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro to a greater extent relative to inhibition of the expression of wild type NRAS in vitro.107. The nucleic acid molecule according to any one of embodiments 1-4, 7-15 or 103-106, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant NRAS p.(G13V / D / A / S / C / R / F / Y).108. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13S) is caused by a C.G37A mutation in the NRAS genomic sequence.109. The nucleic acid molecule according to embodiment 108, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 683-701 .110. The nucleic acid molecule according to embodiment 108 or 109, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 683-701 .111. The nucleic acid molecule according to any one of embodiments 108-110, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 683-701 .112. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13C) is caused by a C.G37T mutation in the NRAS genomic sequence.113. The nucleic acid molecule according to embodiment 112, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 721-739.114. The nucleic acid molecule according to embodiment 112 or 113, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 721-739.115. The nucleic acid molecule according to any one of embodiments 112-114, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 721-739.116. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13R) is caused by a C.G37C mutation in the NRAS genomic sequence.117. The nucleic acid molecule according to embodiment 116, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 759-777.118. The nucleic acid molecule according to embodiment 116 or 117, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 759-777.119. The nucleic acid molecule according to any one of embodiments 116-118, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 759-777.120. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13F) is caused by a c.37_38delinsTT mutation in the NRAS genomic sequence.121. The nucleic acid molecule according to embodiment 120, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 797-816.122. The nucleic acid molecule according to embodiment 120 or 121 , wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 797-816.123. The nucleic acid molecule according to any one of embodiments 120-122, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 797-816.124. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13Y) is caused by a c.37_38delinsTA mutation in the NRAS genomic sequence.125. The nucleic acid molecule according to embodiment 124, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 837-856.126. The nucleic acid molecule according to embodiment 124 or 125, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 837-856.127. The nucleic acid molecule according to any one of embodiments 124-126, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 837-856.128. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13V) is caused by a C.G38T mutation in the NRAS genomic sequence.129. The nucleic acid molecule according to embodiment 128, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 877-895.130. The nucleic acid molecule according to embodiment 128 or 129, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 877-895.131. The nucleic acid molecule according to any one of embodiments 128-130, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 877-895.132. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13D) is caused by a C.G38A mutation in the NRAS genomic sequence.133. The nucleic acid molecule according to embodiment 132, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 915-933.134. The nucleic acid molecule according to embodiment 132 or 133, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 915-933.135. The nucleic acid molecule according to any one of embodiments 132-134, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 915-933.136. The nucleic acid molecule according to any one of embodiments 103-107, wherein the variant NRAS p.(G13A) is caused by a C.G38C mutation in the NRAS genomic sequence.137. The nucleic acid molecule according to embodiment 136, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 953-971 .138. The nucleic acid molecule according to embodiment 136 or 137, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 953-971 .139. The nucleic acid molecule according to any one of embodiments 136-138, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 953-971 .140. The nucleic acid molecule according to any one of embodiments 1-2 or 5-15, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least95% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).141. The nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 140, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).142. The nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 140-141 , wherein the nucleic acid molecule is capable of inhibiting the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.143. The nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 140-142, wherein the nucleic acid molecule inhibits the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro to a greater extent relative to inhibition of the expression of wild type BRAF in vitro.144. The nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or MOMS, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant BRAF p.(V600G / M / D / R / K / E).145. The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600G) is caused by a C.T1799G mutation in the BRAF genomic sequence.146. The nucleic acid molecule according to embodiment 145, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1073-1091 .147. The nucleic acid molecule according to embodiment 145 or 146, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1073-1091 .148. The nucleic acid molecule according to any one of embodiments 145-147, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1073- 1091 .149. The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600M) is caused by a C.G1798A mutation in the BRAF genomic sequence.150. The nucleic acid molecule according to embodiment 149, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 11 11-1129.. The nucleic acid molecule according to embodiment 149 or 150, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 11 11-1129. . The nucleic acid molecule according to any one of embodiments 149-151 , wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1111- 1129. . The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600D) is caused by a c.1799_1800delisAT mutation in the BRAE genomic sequence. . The nucleic acid molecule according to embodiment 153, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1149-1167. . The nucleic acid molecule according to embodiment 153 or 154, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1149-1167. . The nucleic acid molecule according to any one of embodiments 153-155, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1149- 1167. . The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600R) is caused by a c.1798_1799delisCG mutation in the BRAF genomic sequence. . The nucleic acid molecule according to embodiment 157, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1187-1206. . The nucleic acid molecule according to embodiment 157 or 158, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1187-1206. . The nucleic acid molecule according to any one of embodiments 157-159, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1187- 1206. . The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600K) is caused by a c.1798_1799delisAA mutation in the BRAF genomic sequence.162. The nucleic acid molecule according to embodiment 161 , wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1227-1246.163. The nucleic acid molecule according to embodiment 161 or 162, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1227-1246.164. The nucleic acid molecule according to any one of embodiments 161-163, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1227- 1246.165. The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600E) is caused by a c.1799_1800delisAA mutation in the BRAE genomic sequence.166. The nucleic acid molecule according to embodiment 165, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1267-1286.167. The nucleic acid molecule according to embodiment 165 or 166, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1267-1286.168. The nucleic acid molecule according to any one of embodiments 165-167, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1267- 1286.169. The nucleic acid molecule according to any one of embodiments 140-144, wherein the variant BRAF p.(V600E) is caused by a C.T1799A mutation in the BRAF genomic sequence.170. The nucleic acid molecule according to embodiment 169, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1307-1325.171 . The nucleic acid molecule according to embodiment 169 or 170, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1307-1325.172. The nucleic acid molecule according to any one of embodiments 169-171 , wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 1307- 1325.173. The nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule is a single stranded nucleic acid molecule.174. The nucleic acid molecule according to any one of embodiments 1 to 172, wherein the nucleic acid molecule is a double stranded nucleic acid molecule.175. The nucleic acid molecule according to embodiment 174, wherein the double stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand.176. The nucleic acid molecule according to embodiment 175, wherein the second strand is at least 80% complementary to the first strand.177. The nucleic acid molecule according to embodiment 175 or 176, wherein the second strand is at least 90% complementary to the first strand.178. The nucleic acid molecule according to any one of embodiments 175-177, wherein the second strand is at least 95% complementary to the first strand.179. The nucleic acid molecule according to any one of embodiments 175-178, wherein the second strand is fully complementary to the first strand.180. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 10 to 40 linked nucleosides.181 . The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 10 to 30 linked nucleosides.182. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 15 to 30 linked nucleosides.183. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 15 to 25 linked nucleosides.184. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 15 to 20 linked nucleosides.185. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 10 to 20 linked nucleosides.186. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 20 to 30 linked nucleosides.187. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 20 to 25 linked nucleosides.188. The nucleic acid molecule according to any one of embodiments 175-179, wherein the second strand consists of 21 linked nucleosides.189. The nucleic acid molecule according to any one of embodiments 175-188, wherein the first strand is longer than the second strand.190. The nucleic acid molecule according to any one of embodiments 175-189 having an overhang at the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.191. The nucleic acid molecule according to any one of embodiments 175-190 having an overhang at the 3’ end of the first strand of 2 nucleosides.192. The nucleic acid molecule according to any one of embodiments 175-191 having an overhang at the 5’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.193. The nucleic acid molecule according to any one of embodiments 175-192 having an overhang at the 5’ end of the first strand of 2 nucleosides.194. The nucleic acid molecule according to any one of embodiments 175-188, wherein the second strand is longer than the first strand.195. The nucleic acid molecule according to embodiment 175-188 or 194 having an overhang at the 3’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides.196. The nucleic acid molecule according to any one of embodiments 175-188 or 194-195 having an overhang at the 3’ end of the second strand of 2 nucleosides.197. The nucleic acid molecule according to any one of embodiments 175-188 or 194-196 having an overhang at the 5’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides.198. The nucleic acid molecule according to any one of embodiments 175-188 or 194-197 having an overhang at the 5’ end of the second strand of 2 nucleosides.199. The nucleic acid molecule according to any one of embodiments 175-188 or 194-198 having an overhang at both the 5’ end and the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.200. The nucleic acid molecule according to any one of embodiments 175-188 or 194-199 having an overhang at both the 5’ end and the 3’ end of the first strand of 2 nucleosides.. The nucleic acid molecule according to any one of embodiments 190-193 or 194-200 wherein the overhang comprises two thymine nucleotides (TT). . The nucleic acid molecule according to any one of embodiments 190-193 or 194-200 wherein the overhang consists of two thymine nucleotides (TT). . The nucleic acid molecule according to any one of embodiments 175-202, wherein the second strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the groups consisting of:(a) SEQ ID NOs: 92-1 10;(b) SEQ ID NOs: 130-148;(c) SEQ ID NOs: 168-186;(d) SEQ ID NOs: 206-224;(e) SEQ ID NOs: 244-262;(f) SEQ ID NOs: 282-300;(g) SEQ ID NOs: 320-338;(h) SEQ ID NOs: 358-376;(i) SEQ ID NOs: 396-414;(j) SEQ ID NOs: 434-452;(k) SEQ ID NOs: 472-490;(l) SEQ ID NOs: 510-528;(m) SEQ ID NOs: 548-566;(n) SEQ ID NOs: 587-606;(o) SEQ ID NOs: 626-644;(p) SEQ ID NOs: 664-682;(q) SEQ ID NOs: 702-720;(r) SEQ ID NOs: 740-758;(s) SEQ ID NOs: 778-796;(t) SEQ ID NOs: 817-836;(u) SEQ ID NOs: 857-876;(v) SEQ ID NOs: 896-914;(w) SEQ ID NOs: 934-952;(x) SEQ ID NOs: 972-990;(y) SEQ ID NOs: 1011-1030;(z) SEQ ID NOs: 1052-1072;(aa)SEQ ID NOs: 1092-1110;(bb)SEQ ID NOs: 1 130-1148;(cc) SEQ ID NOs: 1 168-1186;(dd)SEQ ID NOs: 1207-1226;(ee)SEQ ID NOs: 1247-1266;(fl) SEQ ID NOs: 1287-1306; or(gg)SEQ ID NOs: 1326-1344. . The nucleic acid molecule according to embodiment 175-203, wherein the second strand comprises a sequence selected from the groups consisting of:(a) SEQ ID NOs: 92-1 10;(b) SEQ ID NOs: 130-148;(c) SEQ ID NOs: 168-186;(d) SEQ ID NOs: 206-224;(e) SEQ ID NOs: 244-262;(f) SEQ ID NOs: 282-300;(g) SEQ ID NOs: 320-338;(h) SEQ ID NOs: 358-376;(i) SEQ ID NOs: 396-414;(j) SEQ ID NOs: 434-452;(k) SEQ ID NOs: 472-490;(l) SEQ ID NOs: 510-528;(m) SEQ ID NOs: 548-566;(n) SEQ ID NOs: 587-606;(o) SEQ ID NOs: 626-644;(p) SEQ ID NOs: 664-682;(q) SEQ ID NOs: 702-720;(r) SEQ ID NOs: 740-758;(s) SEQ ID NOs: 778-796;(t) SEQ ID NOs: 817-836;(u) SEQ ID NOs: 857-876;(v) SEQ ID NOs: 896-914;(w) SEQ ID NOs: 934-952;(x) SEQ ID NOs: 972-990;(y) SEQ ID NOs: 1011-1030;(z) SEQ ID NOs: 1052-1072;(aa)SEQ ID NOs: 1092-1110;(bb)SEQ ID NOs: 1 130-1148;(cc) SEQ ID NOs: 1 168-1186;(dd)SEQ ID NOs: 1207-1226;(ee)SEQ ID NOs: 1247-1266;(ft) SEQ ID NOs: 1287-1306; or(gg)SEQ ID NOs: 1326-1344.. The nucleic acid molecule according to any one of embodiments 175-204, wherein the second strand consists of a sequence selected from the groups consisting of:(a) SEQ ID NOs: 92-1 10;(b) SEQ ID NOs: 130-148;(c) SEQ ID NOs: 168-186;(d) SEQ ID NOs: 206-224;(e) SEQ ID NOs: 244-262;(f) SEQ ID NOs: 282-300;(g) SEQ ID NOs: 320-338;(h) SEQ ID NOs: 358-376;(i) SEQ ID NOs: 396-414;(j) SEQ ID NOs: 434-452;(k) SEQ ID NOs: 472-490;(l) SEQ ID NOs: 510-528;(m) SEQ ID NOs: 548-566;(n) SEQ ID NOs: 587-606;(o) SEQ ID NOs: 626-644;(p) SEQ ID NOs: 664-682;(q) SEQ ID NOs: 702-720;(r) SEQ ID NOs: 740-758;(s) SEQ ID NOs: 778-796;(t) SEQ ID NOs: 817-836;(u) SEQ ID NOs: 857-876;(v) SEQ ID NOs: 896-914;(w) SEQ ID NOs: 934-952;(x) SEQ ID NOs: 972-990;(y) SEQ ID NOs: 1011-1030;(z) SEQ ID NOs: 1052-1072;(aa)SEQ ID NOs: 1092-1110;(bb)SEQ ID NOs: 1 130-1148;(cc) SEQ ID NOs: 1 168-1186;(dd)SEQ ID NOs: 1207-1226;(ee)SEQ ID NOs: 1247-1266;(ff) SEQ ID NOs: 1287-1306; or(gg)SEQ ID NOs: 1326-1344. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:73 and SEQ ID NO:92, SEQ ID NO:74 and SEQ ID NO:93, SEQ ID NO:75 and SEQ ID NO:94, SEQ ID NO:76 and SEQ IDNO:95, SEQ ID NO:77 and SEQ ID NO:96, SEQ ID NO:78 and SEQ ID NO:97, SEQ ID NO:79 and SEQ ID NO:98, SEQ ID NQ:80 and SEQ ID NO:99, SEQ ID N0:81 and SEQ ID NQ:100, SEQ ID NO:82 and SEQ ID NQ:101 , SEQ ID NO:83 and SEQ ID NQ:102, SEQ ID NO:84 and SEQ ID NQ:103, SEQ ID NO:85 and SEQ ID NQ:104, SEQ ID NO:86 and SEQ ID NQ:105, SEQ ID NO:87 and SEQ ID NQ:106, SEQ ID NO:88 and SEQ ID NQ:107, SEQ ID NO:89 and SEQ ID NQ:108, SEQ ID NQ:90 and SEQ ID NQ:109, and SEQ ID N0:91 and SEQ ID NQ:110.207. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:111 and SEQ ID NQ:130, SEQ ID NO:112 and SEQ ID NO:131 , SEQ ID NO:113 and SEQ ID NO:132, SEQ ID NO:114 and SEQ ID NO:133, SEQ ID NO:115 and SEQ ID NO:134, SEQ ID NO:116 and SEQ ID NO:135, SEQ ID NO:117 and SEQ ID NO:136, SEQ ID NO:118 and SEQ ID NO:137, SEQ ID NO:119 and SEQ ID NO:138, SEQ ID NQ:120 and SEQ ID NO:139, SEQ ID NO:121 and SEQ ID NQ:140, SEQ ID NO:122 and SEQ ID NO:141 , SEQ ID NO:123 and SEQ ID NO:142, SEQ ID NO:124 and SEQ ID NO:143, SEQ ID NO:125 and SEQ ID NO:144, SEQ ID NO:126 and SEQ ID NO:145, SEQ ID NO:127 and SEQ ID NO:146, SEQ ID NO:128 and SEQ ID NO:147 and SEQ ID NO:129 and SEQ ID NO:148.208. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:149 and SEQ ID NO:168, SEQ ID NQ:150 and SEQ ID NO:169, SEQ ID NO:151 and SEQ ID NQ:170, SEQ ID NO:152 and SEQ ID NO:171 , SEQ ID NO:153 and SEQ ID NO:172, SEQ ID NO:154 and SEQ ID NO:173, SEQ ID NO:155 and SEQ ID NO:174, SEQ ID NO:156 and SEQ ID NO:175, SEQ ID NO:157 and SEQ ID NO:176, SEQ ID NO:158 and SEQ ID NO:177, SEQ ID NO:159 and SEQ ID NO:178, SEQ ID NQ:160 and SEQ ID NO:179, SEQ ID NO:161 and SEQ ID NQ:180, SEQ ID NO:162 and SEQ ID NO:181 , SEQ ID NO:163 and SEQ ID NO:182, SEQ ID NO:164 and SEQ ID NO:183, SEQ ID NO:165 and SEQ ID NO:184, SEQ ID NO:166 and SEQ ID NO:185 and SEQ ID NO:167 and SEQ ID NO:186.209. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:187 and SEQ ID NQ:206, SEQ ID NO:188 and SEQ ID NQ:207, SEQ ID NO:189 and SEQ ID NQ:208, SEQ ID NQ:190 and SEQ ID NQ:209, SEQ ID NO:191 and SEQ ID NQ:210, SEQ ID NO:192 and SEQ ID NO:211 , SEQ ID NO:193 and SEQ ID NO:212, SEQ ID NO:194 and SEQ ID NO:213, SEQ ID NO:195 and SEQ ID NO:214, SEQ ID NO:196 and SEQ ID NO:215, SEQ ID NO:197 and SEQ ID NO:216, SEQ ID NO:198 and SEQ ID NO:217, SEQ ID NO:199 and SEQ ID NO:218, SEQ ID NQ:200 and SEQ ID NO:219, SEQ ID NQ:201 and SEQ ID NQ:220, SEQ ID NQ:202 and SEQ IDNO:221 , SEQ ID NO:203 and SEQ ID NO:222, SEQ ID NO:204 and SEQ ID NO:223 and SEQ ID NO:205 and SEQ ID NO:224.210. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:225 and SEQ ID NO:244, SEQ ID NO:226 and SEQ ID NO:245, SEQ ID NO:227 and SEQ ID NO:246, SEQ ID NO:228 and SEQ ID NO:247, SEQ ID NO:229 and SEQ ID NO:248, SEQ ID NQ:230 and SEQ ID NO:249, SEQ ID NO:231 and SEQ ID NQ:250, SEQ ID NO:232 and SEQ ID NO:251 , SEQ ID NO:233 and SEQ ID NO:252, SEQ ID NO:234 and SEQ ID NO:253, SEQ ID NO:235 and SEQ ID NO:254, SEQ ID NO:236 and SEQ ID NO:255, SEQ ID NO:237 and SEQ ID NO:256, SEQ ID NO:238 and SEQ ID NO:257, SEQ ID NO:239 and SEQ ID NO:258, SEQ ID NQ:240 and SEQ ID NO:259, SEQ ID NO:241 and SEQ ID NQ:260, SEQ ID NO:242 and SEQ ID NO:261 and SEQ ID NO:243 and SEQ ID NO:262.211 . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:263 and SEQ ID NO:282, SEQ ID NO:264 and SEQ ID NO:283, SEQ ID NO:265 and SEQ ID NO:284, SEQ ID NO:266 and SEQ ID NO:285, SEQ ID NO:267 and SEQ ID NO:286, SEQ ID NO:268 and SEQ ID NO:287, SEQ ID NO:269 and SEQ ID NO:288, SEQ ID NQ:270 and SEQ ID NO:289, SEQ ID NO:271 and SEQ ID NQ:290, SEQ ID NO:272 and SEQ ID NO:291 , SEQ ID NO:273 and SEQ ID NO:292, SEQ ID NO:274 and SEQ ID NO:293, SEQ ID NO:275 and SEQ ID NO:294, SEQ ID NO:276 and SEQ ID NO:295, SEQ ID NO:277 and SEQ ID NO:296, SEQ ID NO:278 and SEQ ID NO:297, SEQ ID NO:279 and SEQ ID NO:298, SEQ ID NQ:280 and SEQ ID NO:299 and SEQ ID NO:281 and SEQ ID NQ:300.212. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NQ:301 and SEQ ID NQ:320, SEQ ID NQ:302 and SEQ ID NO:321 , SEQ ID NQ:303 and SEQ ID NO:322, SEQ ID NQ:304 and SEQ ID NO:323, SEQ ID NQ:305 and SEQ ID NO:324, SEQ ID NQ:306 and SEQ ID NO:325, SEQ ID NQ:307 and SEQ ID NO:326, SEQ ID NQ:308 and SEQ ID NO:327, SEQ ID NQ:309 and SEQ ID NO:328, SEQ ID NQ:310 and SEQ ID NO:329, SEQ ID NO:31 1 and SEQ ID NQ:330, SEQ ID NO:312 and SEQ ID NO:331 , SEQ ID NO:313 and SEQ ID NO:332, SEQ ID NO:314 and SEQ ID NO:333, SEQ ID NO:315 and SEQ ID NO:334, SEQ ID NO:316 and SEQ ID NO:335, SEQ ID NO:317 and SEQ ID NO:336, SEQ ID NO:318 and SEQ ID NO:337, and SEQ ID NO:319 and SEQ ID NO:338.213. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:339 and SEQ ID NO:358, SEQ IDNO:340 and SEQ ID NO:359, SEQ ID NO:341 and SEQ ID NO:360, SEQ ID NO:342 and SEQ ID NO:361 , SEQ ID NO:343 and SEQ ID NO:362, SEQ ID NO:344 and SEQ ID NO:363, SEQ ID NO:345 and SEQ ID NO:364, SEQ ID NO:346 and SEQ ID NO:365, SEQ ID NO:347 and SEQ ID NO:366, SEQ ID NO:348 and SEQ ID NO:367, SEQ ID NO:349 and SEQ ID NO:368, SEQ ID NQ:350 and SEQ ID NO:369, SEQ ID NO:351 and SEQ ID NQ:370, SEQ ID NO:352 and SEQ ID NO:371 , SEQ ID NO:353 and SEQ ID NO:372, SEQ ID NO:354 and SEQ ID NO:373, SEQ ID NO:355 and SEQ ID NO:374, SEQ ID NO:356 and SEQ ID NO:375, and SEQ ID NO:357 and SEQ ID NO:376. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:377 and SEQ ID NO:396, SEQ ID NO:378 and SEQ ID NO:397, SEQ ID NO:379 and SEQ ID NO:398, SEQ ID NQ:380 and SEQ ID NO:399, SEQ ID NO:381 and SEQ ID NQ:400, SEQ ID NO:382 and SEQ ID NQ:401 , SEQ ID NO:383 and SEQ ID NQ:402, SEQ ID NO:384 and SEQ ID NQ:403, SEQ ID NO:385 and SEQ ID NQ:404, SEQ ID NO:386 and SEQ ID NQ:405, SEQ ID NO:387 and SEQ ID NQ:406, SEQ ID NO:388 and SEQ ID NQ:407, SEQ ID NO:389 and SEQ ID NQ:408, SEQ ID NQ:390 and SEQ ID NQ:409, SEQ ID NO:391 and SEQ ID NQ:410, SEQ ID NO:392 and SEQ ID NO:411 , SEQ ID NO:393 and SEQ ID NO:412, SEQ ID NO:394 and SEQ ID NO:413, and SEQ ID NO:395 and SEQ ID NO:414. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:415 and SEQ ID NO:434, SEQ ID NO:416 and SEQ ID NO:435, SEQ ID NO:417 and SEQ ID NO:436, SEQ ID NO:418 and SEQ ID NO:437, SEQ ID NO:419 and SEQ ID NO:438, SEQ ID NQ:420 and SEQ ID NO:439, SEQ ID NO:421 and SEQ ID NQ:440, SEQ ID NO:422 and SEQ ID NO:441 , SEQ ID NO:423 and SEQ ID NO:442, SEQ ID NO:424 and SEQ ID NO:443, SEQ ID NO:425 and SEQ ID NO:444, SEQ ID NO:426 and SEQ ID NO:445, SEQ ID NO:427 and SEQ ID NO:446, SEQ ID NO:428 and SEQ ID NO:447, SEQ ID NO:429 and SEQ ID NO:448, SEQ ID NQ:430 and SEQ ID NO:449, SEQ ID NO:431 and SEQ ID NQ:450, SEQ ID NO:432 and SEQ ID NO:451 , and SEQ ID NO:433 and SEQ ID NO:452. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:453 and SEQ ID NO:472, SEQ ID NO:454 and SEQ ID NO:473, SEQ ID NO:455 and SEQ ID NO:474, SEQ ID NO:456 and SEQ ID NO:475, SEQ ID NO:457 and SEQ ID NO:476, SEQ ID NO:458 and SEQ ID NO:477, SEQ ID NO:459 and SEQ ID NO:478, SEQ ID NQ:460 and SEQ ID NO:479, SEQ ID NO:461 and SEQ ID NQ:480, SEQ ID NO:462 and SEQ ID NO:481 , SEQ ID NO:463 and SEQ ID NO:482, SEQ ID NO:464 and SEQ ID NO:483, SEQ ID NO:465 and SEQ ID NO:484, SEQ ID NO:466and SEQ ID NO:485, SEQ ID NO:467 and SEQ ID NO:486, SEQ ID NO:468 and SEQ ID NO:487, SEQ ID NO:469 and SEQ ID NO:488, SEQ ID NQ:470 and SEQ ID NO:489, and SEQ ID NO:471 and SEQ ID NQ:490.217. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:491 and SEQ ID NQ:510, SEQ ID NO:492 and SEQ ID NO:511 , SEQ ID NO:493 and SEQ ID NO:512, SEQ ID NO:494 and SEQ ID NO:513, SEQ ID NO:495 and SEQ ID NO:514, SEQ ID NO:496 and SEQ ID NO:515, SEQ ID NO:497 and SEQ ID NO:516, SEQ ID NO:498 and SEQ ID NO:517, SEQ ID NO:499 and SEQ ID NO:518, SEQ ID NQ:500 and SEQ ID NO:519, SEQ ID NQ:501 and SEQ ID NQ:520, SEQ ID NQ:502 and SEQ ID NO:521 , SEQ ID NQ:503 and SEQ ID NO:522, SEQ ID NQ:504 and SEQ ID NO:523, SEQ ID NQ:505 and SEQ ID NO:524, SEQ ID NQ:506 and SEQ ID NO:525, SEQ ID NQ:507 and SEQ ID NO:526, SEQ ID NQ:508 and SEQ ID NO:527, and SEQ ID NQ:509 and SEQ ID NO:528.218. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:529 and SEQ ID NO:548, SEQ ID NQ:530 and SEQ ID NO:549, SEQ ID NO:531 and SEQ ID NQ:550, SEQ ID NO:532 and SEQ ID NO:551 , SEQ ID NO:533 and SEQ ID NO:552, SEQ ID NO:534 and SEQ ID NO:553, SEQ ID NO:535 and SEQ ID NO:554, SEQ ID NO:536 and SEQ ID NO:555, SEQ ID NO:537 and SEQ ID NO:556, SEQ ID NO:538 and SEQ ID NO:557, SEQ ID NO:539 and SEQ ID NO:558, SEQ ID NQ:540 and SEQ ID NO:559, SEQ ID NO:541 and SEQ ID NQ:560, SEQ ID NO:542 and SEQ ID NO:561 , SEQ ID NO:543 and SEQ ID NO:562, SEQ ID NO:544 and SEQ ID NO:563, SEQ ID NO:545 and SEQ ID NO:564, SEQ ID NO:546 and SEQ ID NO:565, and SEQ ID NO:547 and SEQ ID NO:566.219. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:567 and SEQ ID NO:587, SEQ ID NO:568 and SEQ ID NO:588, SEQ ID NO:569 and SEQ ID NO:589, SEQ ID NQ:570 and SEQ ID NQ:590, SEQ ID NO:571 and SEQ ID NO:591 , SEQ ID NO:572 and SEQ ID NO:592, SEQ ID NO:573 and SEQ ID NO:593, SEQ ID NO:574 and SEQ ID NO:594, SEQ ID NO:575 and SEQ ID NO:595, SEQ ID NO:576 and SEQ ID NO:596, SEQ ID NO:577 and SEQ ID NO:597, SEQ ID NO:578 and SEQ ID NO:598, SEQ ID NO:579 and SEQ ID NO:599, SEQ ID NQ:580 and SEQ ID NQ:600, SEQ ID NO:581 and SEQ ID NQ:601 , SEQ ID NO:582 and SEQ ID NQ:602, SEQ ID NO:583 and SEQ ID NQ:603, SEQ ID NO:584 and SEQ ID NQ:604, SEQ ID NO:585 and SEQ ID NQ:605, and SEQ ID NO:586 and SEQ ID NQ:606.220. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair ofsequences selected from the list consisting of: SEQ ID NO:607 and SEQ ID NO:626, SEQ ID NO:608 and SEQ ID NO:627, SEQ ID NQ:609 and SEQ ID NO:628, SEQ ID NQ:610 and SEQ ID NO:629, SEQ ID NO:611 and SEQ ID NQ:630, SEQ ID NO:612 and SEQ ID NO:631 , SEQ ID NO:613 and SEQ ID NO:632, SEQ ID NO:614 and SEQ ID NO:633, SEQ ID NO:615 and SEQ ID NO:634, SEQ ID NO:616 and SEQ ID NO:635, SEQ ID NO:617 and SEQ ID NO:636, SEQ ID NO:618 and SEQ ID NO:637, SEQ ID NO:619 and SEQ ID NO:638, SEQ ID NQ:620 and SEQ ID NO:639, SEQ ID NO:621 and SEQ ID NQ:640, SEQ ID NO:622 and SEQ ID NO:641 , SEQ ID NO:623 and SEQ ID NO:642, SEQ ID NO:624 and SEQ ID NO:643, and SEQ ID NO:625 and SEQ ID NO:644. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:645 and SEQ ID NO:664, SEQ ID NO:646 and SEQ ID NO:665, SEQ ID NO:647 and SEQ ID NO:666, SEQ ID NO:648 and SEQ ID NO:667, SEQ ID NO:649 and SEQ ID NO:668, SEQ ID NQ:650 and SEQ ID NO:669, SEQ ID NO:651 and SEQ ID NQ:670, SEQ ID NO:652 and SEQ ID NO:671 , SEQ ID NO:653 and SEQ ID NO:672, SEQ ID NO:654 and SEQ ID NO:673, SEQ ID NO:655 and SEQ ID NO:674, SEQ ID NO:656 and SEQ ID NO:675, SEQ ID NO:657 and SEQ ID NO:676, SEQ ID NO:658 and SEQ ID NO:677, SEQ ID NO:659 and SEQ ID NO:678, SEQ ID NQ:660 and SEQ ID NO:679, SEQ ID NO:661 and SEQ ID NQ:680, SEQ ID NO:662 and SEQ ID NO:681 , and SEQ ID NO:663 and SEQ ID NO:682. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:683 and SEQ ID NQ:702, SEQ ID NO:684 and SEQ ID NQ:703, SEQ ID NO:685 and SEQ ID NQ:704, SEQ ID NO:686 and SEQ ID NQ:705, SEQ ID NO:687 and SEQ ID NQ:706, SEQ ID NO:688 and SEQ ID NQ:707, SEQ ID NO:689 and SEQ ID NQ:708, SEQ ID NQ:690 and SEQ ID NQ:709, SEQ ID NO:691 and SEQ ID NQ:710, SEQ ID NO:692 and SEQ ID NO:711 , SEQ ID NO:693 and SEQ ID NO:712, SEQ ID NO:694 and SEQ ID NO:713, SEQ ID NO:695 and SEQ ID NO:714, SEQ ID NO:696 and SEQ ID NO:715, SEQ ID NO:697 and SEQ ID NO:716, SEQ ID NO:698 and SEQ ID NO:717, SEQ ID NO:699 and SEQ ID NO:718, SEQ ID NQ:700 and SEQ ID NO:719, and SEQ ID NQ:701 and SEQ ID NQ:720. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:721 and SEQ ID NQ:740, SEQ ID NO:722 and SEQ ID NO:741 , SEQ ID NO:723 and SEQ ID NO:742, SEQ ID NO:724 and SEQ ID NO:743, SEQ ID NO:725 and SEQ ID NO:744, SEQ ID NO:726 and SEQ ID NO:745, SEQ ID NO:727 and SEQ ID NO:746, SEQ ID NO:728 and SEQ ID NO:747, SEQ ID NO:729 and SEQ ID NO:748, SEQ ID NQ:730 and SEQ ID NO:749, SEQ ID NO:731 and SEQ ID NQ:750,SEQ ID NO:732 and SEQ ID NO:751 , SEQ ID NO:733 and SEQ ID NO:752, SEQ ID NO:734 and SEQ ID NO:753, SEQ ID NO:735 and SEQ ID NO:754, SEQ ID NO:736 and SEQ ID NO:755, SEQ ID NO:737 and SEQ ID NO:756, SEQ ID NO:738 and SEQ ID NO:757, and SEQ ID NO:739 and SEQ ID NO:758.224. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:759 and SEQ ID NO:778, SEQ ID NQ:760 and SEQ ID NO:779, SEQ ID NO:761 and SEQ ID NQ:780, SEQ ID NO:762 and SEQ ID NO:781 , SEQ ID NO:763 and SEQ ID NO:782, SEQ ID NO:764 and SEQ ID NO:783, SEQ ID NO:765 and SEQ ID NO:784, SEQ ID NO:766 and SEQ ID NO:785, SEQ ID NO:767 and SEQ ID NO:786, SEQ ID NO:768 and SEQ ID NO:787, SEQ ID NO:769 and SEQ ID NO:788, SEQ ID NQ:770 and SEQ ID NO:789, SEQ ID NO:771 and SEQ ID NQ:790, SEQ ID NO:772 and SEQ ID NO:791 , SEQ ID NO:773 and SEQ ID NO:792, SEQ ID NO:774 and SEQ ID NO:793, SEQ ID NO:775 and SEQ ID NO:794, SEQ ID NO:776 and SEQ ID NO:795, and SEQ ID NO:777 and SEQ ID NO:796.225. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:797 and SEQ ID NO:817, SEQ ID NO:798 and SEQ ID NO:818, SEQ ID NO:799 and SEQ ID NO:819, SEQ ID NQ:800 and SEQ ID NQ:820, SEQ ID NQ:801 and SEQ ID NO:821 , SEQ ID NQ:802 and SEQ ID NO:822, SEQ ID NQ:803 and SEQ ID NO:823, SEQ ID NQ:804 and SEQ ID NO:824, SEQ ID NQ:805 and SEQ ID NO:825, SEQ ID NQ:806 and SEQ ID NO:826, SEQ ID NQ:807 and SEQ ID NO:827, SEQ ID NQ:808 and SEQ ID NO:828, SEQ ID NQ:809 and SEQ ID NO:829, SEQ ID NQ:810 and SEQ ID NQ:830, SEQ ID NO:81 1 and SEQ ID NO:831 , SEQ ID NO:812 and SEQ ID NO:832, SEQ ID NO:813 and SEQ ID NO:833, SEQ ID NO:814 and SEQ ID NO:834, SEQ ID NO:815 and SEQ ID NO:835, and SEQ ID NO:816 and SEQ ID NO:836.226. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:837 and SEQ ID NO:857, SEQ ID NO:838 and SEQ ID NO:858, SEQ ID NO:839 and SEQ ID NO:859, SEQ ID NQ:840 and SEQ ID NQ:860, SEQ ID NO:841 and SEQ ID NO:861 , SEQ ID NO:842 and SEQ ID NO:862, SEQ ID NO:843 and SEQ ID NO:863, SEQ ID NO:844 and SEQ ID NO:864, SEQ ID NO:845 and SEQ ID NO:865, SEQ ID NO:846 and SEQ ID NO:866, SEQ ID NO:847 and SEQ ID NO:867, SEQ ID NO:848 and SEQ ID NO:868, SEQ ID NO:849 and SEQ ID NO:869, SEQ ID NQ:850 and SEQ ID NQ:870, SEQ ID NO:851 and SEQ ID NO:871 , SEQ ID NO:852 and SEQ ID NO:872, SEQ ID NO:853 and SEQ ID NO:873, SEQ ID NO:854 and SEQ ID NO:874, SEQ ID NO:855 and SEQ ID NO:875, and SEQ ID NO:856 and SEQ ID NO:876.227. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:877 and SEQ ID NO:896, SEQ ID NO:878 and SEQ ID NO:897, SEQ ID NO:879 and SEQ ID NO:898, SEQ ID NQ:880 and SEQ ID NO:899, SEQ ID NO:881 and SEQ ID NQ:900, SEQ ID NO:882 and SEQ ID NQ:901 , SEQ ID NO:883 and SEQ ID NQ:902, SEQ ID NO:884 and SEQ ID NQ:903, SEQ ID NO:885 and SEQ ID NQ:904, SEQ ID NO:886 and SEQ ID NQ:905, SEQ ID NO:887 and SEQ ID NQ:906, SEQ ID NO:888 and SEQ ID NQ:907, SEQ ID NO:889 and SEQ ID NQ:908, SEQ ID NQ:890 and SEQ ID NQ:909, SEQ ID NO:891 and SEQ ID NQ:910, SEQ ID NO:892 and SEQ ID NO:911 , SEQ ID NO:893 and SEQ ID NO:912, SEQ ID NO:894 and SEQ ID NO:913, and SEQ ID NO:895 and SEQ ID NO:914.228. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:915 and SEQ ID NO:934, SEQ ID NO:916 and SEQ ID NO:935, SEQ ID NO:917 and SEQ ID NO:936, SEQ ID NO:918 and SEQ ID NO:937, SEQ ID NO:919 and SEQ ID NO:938, SEQ ID NQ:920 and SEQ ID NO:939, SEQ ID NO:921 and SEQ ID NQ:940, SEQ ID NO:922 and SEQ ID NO:941 , SEQ ID NO:923 and SEQ ID NO:942, SEQ ID NO:924 and SEQ ID NO:943, SEQ ID NO:925 and SEQ ID NO:944, SEQ ID NO:926 and SEQ ID NO:945, SEQ ID NO:927 and SEQ ID NO:946, SEQ ID NO:928 and SEQ ID NO:947, SEQ ID NO:929 and SEQ ID NO:948, SEQ ID NQ:930 and SEQ ID NO:949, SEQ ID NO:931 and SEQ ID NQ:950, SEQ ID NO:932 and SEQ ID NO:951 , and SEQ ID NO:933 and SEQ ID NO:952.229. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:953 and SEQ ID NO:972, SEQ ID NO:954 and SEQ ID NO:973, SEQ ID NO:955 and SEQ ID NO:974, SEQ ID NO:956 and SEQ ID NO:975, SEQ ID NO:957 and SEQ ID NO:976, SEQ ID NO:958 and SEQ ID NO:977, SEQ ID NO:959 and SEQ ID NO:978, SEQ ID NQ:960 and SEQ ID NO:979, SEQ ID NO:961 and SEQ ID NQ:980, SEQ ID NO:962 and SEQ ID NO:981 , SEQ ID NO:963 and SEQ ID NO:982, SEQ ID NO:964 and SEQ ID NO:983, SEQ ID NO:965 and SEQ ID NO:984, SEQ ID NO:966 and SEQ ID NO:985, SEQ ID NO:967 and SEQ ID NO:986, SEQ ID NO:968 and SEQ ID NO:987, SEQ ID NO:969 and SEQ ID NO:988, SEQ ID NQ:970 and SEQ ID NO:989, and SEQ ID NO:971 and SEQ ID NQ:990.230. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:991 and SEQ ID NQ:1011 , SEQ ID NO:992 and SEQ ID NQ:1012, SEQ ID NO:993 and SEQ ID NQ:1013, SEQ ID NO:994 and SEQ ID NQ:1014, SEQ ID NO:995 and SEQ ID NQ:1015, SEQ ID NO:996 and SEQ IDNQ:1016, SEQ ID NO:997 and SEQ ID NQ:1017, SEQ ID NO:998 and SEQ ID NQ:1018, SEQ ID NO:999 and SEQ ID NQ:1019, SEQ ID NQ:1000 and SEQ ID NQ:1020, SEQ ID NQ:1001 and SEQ ID NQ:1021 , SEQ ID NQ:1002 and SEQ ID NQ:1022, SEQ ID NQ:1003 and SEQ ID NQ:1023, SEQ ID NQ:1004 and SEQ ID NQ:1024, SEQ ID NQ:1005 and SEQ ID NQ:1025, SEQ ID NQ:1006 and SEQ ID NQ:1026, SEQ ID NQ:1007 and SEQ ID NQ:1027, SEQ ID NQ:1008 and SEQ ID NQ:1028, SEQ ID NQ:1009 and SEQ ID NQ:1029, and SEQ ID NQ:1010 and SEQ ID NQ:1030. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NQ:1031 and SEQ ID NQ:1052, SEQ ID NQ:1032 and SEQ ID NQ:1053, SEQ ID NQ:1033 and SEQ ID NQ:1054, SEQ ID NQ:1034 and SEQ ID NQ:1055, SEQ ID NQ:1035 and SEQ ID NQ:1056, SEQ ID NQ:1036 and SEQ ID NQ:1057, SEQ ID NQ:1037 and SEQ ID NQ:1058, SEQ ID NQ:1038 and SEQ ID NQ:1059, SEQ ID NQ:1039 and SEQ ID NQ:1060, SEQ ID NQ:1040 and SEQ ID NQ:1061 , SEQ ID NQ:1041 and SEQ ID NQ:1062, SEQ ID NQ:1042 and SEQ ID NQ:1063, SEQ ID NQ:1043 and SEQ ID NQ:1064, SEQ ID NQ:1044 and SEQ ID NQ:1065, SEQ ID NQ:1045 and SEQ ID NQ:1066, SEQ ID NQ:1046 and SEQ ID NQ:1067, SEQ ID NQ:1047 and SEQ ID NQ:1068, SEQ ID NQ:1048 and SEQ ID NQ:1069, SEQ ID NQ:1049 and SEQ ID NQ:1070, SEQ ID NQ:1050 and SEQ ID NQ:1071 , and SEQ ID NQ:1051 and SEQ ID NQ:1072. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NQ:1073 and SEQ ID NQ:1092, SEQ ID NQ:1074 and SEQ ID NQ:1093, SEQ ID NQ:1075 and SEQ ID NQ:1094, SEQ ID NQ:1076 and SEQ ID NQ:1095, SEQ ID NQ:1077 and SEQ ID NQ:1096, SEQ ID NQ:1078 and SEQ ID NQ:1097, SEQ ID NQ:1079 and SEQ ID NQ:1098, SEQ ID NQ:1080 and SEQ ID NQ:1099, SEQ ID NQ:1081 and SEQ ID NQ:1100, SEQ ID NQ:1082 and SEQ ID NQ:1101 , SEQ ID NQ:1083 and SEQ ID NO:1 102, SEQ ID NQ:1084 and SEQ ID NQ:1103, SEQ ID NQ:1085 and SEQ ID NQ:1104, SEQ ID NQ:1086 and SEQ ID NQ:1105, SEQ ID NQ:1087 and SEQ ID NQ:1106, SEQ ID NQ:1088 and SEQ ID NQ:1107, SEQ ID NQ:1089 and SEQ ID NQ:1 108, SEQ ID NQ:1090 and SEQ ID NQ:1109, and SEQ ID NQ:1091 and SEQ ID NQ:1110. . The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1111 and SEQ ID NO:1130, SEQ ID NO:1112 and SEQ ID NO:1 131 , SEQ ID NO:1 113 and SEQ ID NO:1132, SEQ ID NO:1114 and SEQ ID NO:1133, SEQ ID NO:1115 and SEQ ID NO:1134, SEQ ID NO:1 116 and SEQ ID NO:1135, SEQ ID NO:1117 and SEQ ID NO:1136, SEQ ID NO:1 118 and SEQ ID NO:1 137, SEQ ID NO:1119 and SEQ ID NO:1138, SEQ ID NQ:1120 and SEQ ID NO:1139, SEQ ID NO:1121 and SEQ ID NQ:1 140, SEQ ID NO:1 122 and SEQ ID NO:1141 , SEQ ID NO:1123 andSEQ ID NO:1142, SEQ ID NO:1124 and SEQ ID NO:1143, SEQ ID NO:1 125 and SEQ ID NO:1144, SEQ ID NO:1126 and SEQ ID NO:1145, SEQ ID NO:1 127 and SEQ ID NO:1 146, SEQ ID N0:1 128 and SEQ ID N0:1147, and SEQ ID N0:1129 and SEQ ID N0:1148.234. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1149 and SEQ ID NO:1168, SEQ ID NQ:1150 and SEQ ID NO:1 169, SEQ ID NO:1 151 and SEQ ID NQ:1170, SEQ ID NO:1152 and SEQ ID NO:1171 , SEQ ID NO:1153 and SEQ ID NO:1172, SEQ ID NO:1 154 and SEQ ID NO:1173, SEQ ID NO:1155 and SEQ ID NO:1174, SEQ ID NO:1 156 and SEQ ID NO:1 175, SEQ ID NO:1157 and SEQ ID NO:1176, SEQ ID NO:1158 and SEQ ID NO:1177, SEQ ID NO:1159 and SEQ ID NO:1 178, SEQ ID NQ:1 160 and SEQ ID NO:1179, SEQ ID NO:1161 and SEQ ID NQ:1180, SEQ ID NO:1162 and SEQ ID NO:1181 , SEQ ID NO:1 163 and SEQ ID NO:1182, SEQ ID NO:1164 and SEQ ID NO:1183, SEQ ID NO:1 165 and SEQ ID NO:1 184, SEQ ID NO:1 166 and SEQ ID NO:1185, and SEQ ID NO:1167 and SEQ ID NO:1186.235. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1187 and SEQ ID NQ:1207, SEQ ID NO:1188 and SEQ ID NQ:1208, SEQ ID NO:1 189 and SEQ ID NQ:1209, SEQ ID NQ:1190 and SEQ ID NQ:1210, SEQ ID NO:1191 and SEQ ID NO:1211 , SEQ ID NO:1 192 and SEQ ID NO:1212, SEQ ID NO:1193 and SEQ ID NO:1213, SEQ ID NO:1 194 and SEQ ID NO:1214, SEQ ID NO:1195 and SEQ ID NO:1215, SEQ ID NO:1196 and SEQ ID NO:1216, SEQ ID NO:1197 and SEQ ID NO:1217, SEQ ID NO:1 198 and SEQ ID NO:1218, SEQ ID NO:1199 and SEQ ID NO:1219, SEQ ID NQ:1200 and SEQ ID NQ:1220, SEQ ID NQ:1201 and SEQ ID NO:1221 , SEQ ID NQ:1202 and SEQ ID NO:1222, SEQ ID NQ:1203 and SEQ ID NO:1223, SEQ ID NQ:1204 and SEQ ID NO:1224, SEQ ID NQ:1205 and SEQ ID NO:1225, and SEQ ID NQ:1206 and SEQ ID NO:1226.236. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1227 and SEQ ID NO:1247, SEQ ID NO:1228 and SEQ ID NO:1248, SEQ ID NO:1229 and SEQ ID NO:1249, SEQ ID NQ:1230 and SEQ ID NQ:1250, SEQ ID NO:1231 and SEQ ID NO:1251 , SEQ ID NO:1232 and SEQ ID NO:1252, SEQ ID NO:1233 and SEQ ID NO:1253, SEQ ID NO:1234 and SEQ ID NO:1254, SEQ ID NO:1235 and SEQ ID NO:1255, SEQ ID NO:1236 and SEQ ID NO:1256, SEQ ID NO:1237 and SEQ ID NO:1257, SEQ ID NO:1238 and SEQ ID NO:1258, SEQ ID NO:1239 and SEQ ID NO:1259, SEQ ID NQ:1240 and SEQ ID NQ:1260, SEQ ID NO:1241 and SEQ ID NO:1261 , SEQ ID NO:1242 and SEQ ID NO:1262, SEQ ID NO:1243 and SEQ ID NO:1263, SEQ ID NO:1244 and SEQ ID NO:1264, SEQ ID NO:1245 and SEQ ID NO:1265, and SEQ ID NO:1246 and SEQ ID NO:1266.237. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1267 and SEQ ID NO:1287, SEQ ID NO:1268 and SEQ ID NO:1288, SEQ ID NO:1269 and SEQ ID NO:1289, SEQ ID NQ:1270 and SEQ ID NO:1290, SEQ ID NO:1271 and SEQ ID NO:1291 , SEQ ID NO:1272 and SEQ ID NO:1292, SEQ ID NO:1273 and SEQ ID NO:1293, SEQ ID NO:1274 and SEQ ID NO:1294, SEQ ID NO:1275 and SEQ ID NO:1295, SEQ ID NO:1276 and SEQ ID NO:1296, SEQ ID NO:1277 and SEQ ID NO:1297, SEQ ID NO:1278 and SEQ ID NO:1298, SEQ ID NO:1279 and SEQ ID NO:1299, SEQ ID NQ:1280 and SEQ ID NQ:1300, SEQ ID NO:1281 and SEQ ID NO:1301 , SEQ ID NO:1282 and SEQ ID NQ:1302, SEQ ID NO:1283 and SEQ ID NQ:1303, SEQ ID NO:1284 and SEQ ID NQ:1304, SEQ ID NO:1285 and SEQ ID NQ:1305, and SEQ ID NO:1286 and SEQ ID NQ:1306.238. The nucleic acid molecule according to any one of embodiments 175-205, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NQ:1307 and SEQ ID NO:1326, SEQ ID NQ:1308 and SEQ ID NO:1327, SEQ ID NQ:1309 and SEQ ID NO:1328, SEQ ID NQ:1310 and SEQ ID NO:1329, SEQ ID NO:1311 and SEQ ID NQ:1330, SEQ ID NO:1312 and SEQ ID NO:1331 , SEQ ID NO:1313 and SEQ ID NO:1332, SEQ ID NO:1314 and SEQ ID NO:1333, SEQ ID NO:1315 and SEQ ID NO:1334, SEQ ID NO:1316 and SEQ ID NO:1335, SEQ ID NO:1317 and SEQ ID NO:1336, SEQ ID NO:1318 and SEQ ID NO:1337, SEQ ID NO:1319 and SEQ ID NO:1338, SEQ ID NQ:1320 and SEQ ID NO:1339, SEQ ID NO:1321 and SEQ ID NQ:1340, SEQ ID NO:1322 and SEQ ID NO:1341 , SEQ ID NO:1323 and SEQ ID NO:1342, SEQ ID NO:1324 and SEQ ID NO:1343, and SEQ ID NO:1325 and SEQ ID NO:1344.239. The nucleic acid molecule according to any one of embodiments 206-238 wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the lists in embodiments 206-238.240. The nucleic acid molecule according to any one of embodiments 206-238 wherein the nucleic acid molecule consists of a first strand and a second strand consisting of a pair of sequences selected from the lists in embodiments 206-238.241 . The nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NOT (A / RAS_c.178G>C_p.G60R), SEQ ID NO:9 (A / RAS_c.179G>T_p.G60V), SEQ ID NO:1 1 (A / RAS_c.179G>A_p.G60E), SEQ ID NO:13 (A / RAS_c.181 C>A_p.Q61 K), SEQ ID NO:15(A / RAS_c.182A>G_p.Q61 R), SEQ ID NO:17 (A / RAS_c.182A>T_p.Q61 L), SEQ ID NO:19(A / RAS_c.182A>C_p.Q61 P), SEQ ID NO:21 (A / RAS_c.183A>C_p.Q61 H), SEQ ID NO:23(A / RAS_c.183A>T_p.Q61 H), SEQ ID NO:25 (A / RAS_c.35G>T_p.G12V), SEQ ID NO:27(A / RAS_c.34G>C_p.G12R), SEQ ID NO:29 (A / RAS_c.35G>A_p.G12D), SEQ ID NO:31(A / RAS_c.34G>A_p.G12S), SEQ ID NO:33 (A / RAS_c.34_35G>C_ p.G12P), SEQ ID NO:35 (A / RAS_c.34G>T_p.G12C), SEQ ID NO:37 (A / RAS_c.35G>C_p.G12A), SEQ ID NO:39 (A / RAS_c.37G>A_p.G13S), SEQ ID N0:41 (A / RAS_c.37G>T_p.G13C), SEQ ID NO:43 (A / RAS_c.37G>C_p.G13R), SEQ ID NO:45 (A / RAS_c.37_38delinsTT_ p.G13F), SEQ ID NO:47 (A / RAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO:49 (A / RAS_c.38G>T_p.G13V), SEQ ID N0:51 (A / RAS_c.38G>A_p.G13D ), SEQ ID NO:53 (A / RAS_c.38G>C_p.G13A), SEQ ID NO:55 (A / RAS_c.180_181delinsTA), SEQ ID NO:57 (A / RAS_c.181_183delinsAAG), SEQ ID NO:59 (BRAF_c.1799T>G.p.V600G), SEQ ID N0:61 (BRAF_c.1798G>A.p.V600M), SEQ ID NO:63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO:65(BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO:67(BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO:69(BRAF_c.1799_1800delisAA_p.V600E) and SEQ ID N0:71 (BRAF_c.1799T>A.p.V600E). . A compound comprising a nucleic acid molecule according to any preceding embodiment and a targeting moiety. . The compound according to embodiment 242, wherein the targeting moiety comprises a lipid nanoparticle, a liposome, a...

Claims

CLAIMS1. A nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS or BRAF.

2. The nucleic acid molecule according to any preceding claim, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of NRAS.

3. The nucleic acid molecule according to claim 1 , wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of BRAF.

4. The nucleic acid molecule according to any preceding claim, wherein the first strand consists of20 to 25 linked nucleosides.

5. The nucleic acid molecule according to any preceding claim, wherein the first strand consists of21 linked nucleosides.

6. The nucleic acid molecule according to any one of 1 , 2, 4 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D).

7. The nucleic acid molecule according to any one of 1 , 2, 4 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P).

8. The nucleic acid molecule according to any one of 1 , 2, 4 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V).

9. The nucleic acid molecule according to any one of 1 , 2, 4 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(G 13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y).The nucleic acid molecule according to any one of 1 , 3, 4 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). The nucleic acid molecule according to any preceding claim, wherein the nucleic acid molecule is a single stranded nucleic acid molecule. The nucleic acid molecule according to any one of claims 1 to 10, wherein the nucleic acid molecule is a double stranded nucleic acid molecule. The nucleic acid molecule according to claim 12, wherein the double stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand. The nucleic acid molecule according to claim 13, wherein the second strand is at least 95% complementary to the first strand. The nucleic acid molecule according to any one of claims 13 or 14 having an overhang at both the 5’ end and the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. The nucleic acid molecule according to any one of claims 13-15 having an overhang at both the 5’ end and the 3’ end of the first strand of 2 nucleosides, optionally wherein the overhang comprises two thymine nucleotides (TT). The nucleic acid molecule according to any preceding claim, wherein the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO:7 (A / RAS_c.178G>C_p.G60R), SEQ ID NO:9 (A / RAS_c.179G>T_p.G60V), SEQ ID NO:11(A / RAS_c.179G>A_p.G60E), SEQ ID NO:13 (A / RAS_c.181 C>A_p.Q61 K), SEQ ID NO:15(A / RAS_c.182A>G_p.Q61 R), SEQ ID NO:17 (A / RAS_c.182A>T_p.Q61 L), SEQ ID NO:19(A / RAS_c.182A>C_p.Q61 P), SEQ ID NO:21 (A / RAS_c.183A>C_p.Q61 H), SEQ ID NO:23(A / RAS_c.183A>T_p.Q61 H), SEQ ID NO:25 (A / RAS_c.35G>T_p.G12V), SEQ ID NO:27(A / RAS_c.34G>C_p.G12R), SEQ ID NO:29 (A / RAS_c.35G>A_p.G12D), SEQ ID NO:31(A / RAS_c.34G>A_p.G12S), SEQ ID NO:33 (A / RAS_c.34_35G>C_ p.G12P), SEQ ID NO:35 (A / RAS_c.34G>T_p.G12C), SEQ ID NO:37 (A / RAS_c.35G>C_p.G12A), SEQ ID NO:39(A / RAS_c.37G>A_p.G13S), SEQ ID NO:41 (A / RAS_c.37G>T_p.G13C), SEQ ID NO:43(A / RAS_c.37G>C_p.G13R), SEQ ID NO:45 (A / RAS_c.37_38delinsTT_ p.G13F), SEQ ID NO:47 (A / RAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO:49 (A / RAS_c.38G>T_p.G13V), SEQ ID NO:51 (A / RAS_c.38G>A_p.G13D ), SEQ ID NO:53 (A / RAS_c.38G>C_p.G13A), SEQ ID NO:55 (A / RAS_c.180_181delinsTA), SEQ ID NO:57 (A / RAS_c.181_183delinsAAG), SEQ ID NO:59 (BRAF_c.1799T>G.p.V600G), SEQ ID NO:61 (e / ?AF_c.1798G>A.p.V600M), SEQ ID NO:63(BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO:65(BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO:67(BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO:69(BRAF_c.1799_1800delisAA_p.V600E) and SEQ ID N0:71 (BRAF_c.1799T>A.p.V600E). A compound comprising a nucleic acid molecule according to any preceding claim and a targeting moiety. The compound according to claim 18, wherein the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof. The compound according to claim 18 or 19, wherein targeting moiety comprises a conjugate group, and wherein the conjugate group comprises one or more carbohydrates. The nucleic acid molecule or compound according to any preceding claim, wherein at least one nucleoside comprises a modified sugar. The nucleic acid molecule or compound according to any preceding claim, wherein at least one internucleoside linkage is a modified internucleoside linkage. A composition comprising the single-stranded nucleic acid molecule or compound according to any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. The nucleic acid molecule, compound or composition according to any preceding claim for use in a method of treating a patient having a disease or disorder associated with or driven by overexpression of NR AS or BRAF. The nucleic acid molecule, compound or composition according to any one of claims 1-23 for use in a method of treating a patient having a melanocytic disease, disorder or lesion, optionally wherein the melanocytic disease, disorder or lesion is congenital melanocytic naevi (CMN), acquired melanocytic naevi (AMN) or melanoma. A composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding NRAS; andwherein the second nucleic acid molecule comprises a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding BRAF. The composition of claim 26, wherein the first nucleic acid molecule is as defined in any of claims 2, 4-9, 11-17, and wherein the second nucleic acid molecule is as defined in any of claims 3-5 or 10-17. The composition of claim 26 or 27, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position Q61 , G60, G12, and / or G13 relative to wild type NRAS, and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF. The composition according to any of claims 26-28, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS, wherein the variant NRAS comprises a mutation at position Q61 relative to wild type NRAS, and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF, wherein the variant BRAF comprises a mutation at position V600 relative to wild type BRAF. The composition according to any of claims 26-29, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). The composition according to any of claims 26-29, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E) or p.(G60D), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). composition according to any of claims 26-29, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p. (G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). composition according to any of claims 26-29, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). composition according to any of claims 26-30, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), p.(Q61 R), p.(Q61 H), p.(Q61 L), or p.(Q61 P), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E). composition according to any of claims 26-30, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). The composition according to any of claims 26-30, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E). The composition according to any of claims 26-30 or 36, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E). The composition according to any of claims 26-29, 36 or 37, wherein:(a) the first strand of the first nucleic acid molecule comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant NRAS p.(Q61 K), and(b) the first strand of the second nucleic acid molecule comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant BRAF p.(V600E). The composition according to any of claims 26-30 or 34-38, wherein the variant NRAS p.(Q61 K) is caused by a c.C181 A mutation in the NRAS genomic sequence. The composition according to any of claims 26-30 or 34-39, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 206-224.The composition according to any of claims 26-30 or 34-40, wherein the first strand of the first nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 206-224. The composition according to any of claims 26-30 or 34-41 , wherein the first strand of the first nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 206-224. The composition according to any of claims 26-42, wherein the variant BRAF p.(V600E) is caused by a c.1799_1800delisAA mutation in the BRAF genomic sequence. The composition according to any of claims 26-43, wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1287-1306. The composition according to any of claims 26-44, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 1287- 1306. The composition according to any of claims 26-45, wherein the first strand of the second nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 1287- 1306. The composition according to any of claims 26-42, wherein the variant BRAF p.(V600E) is caused by a C.T1799A mutation in the BRAF genomic sequence. The composition according to any of claims 26-42 or 47, wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 1326-1344. The composition according to any of claims 26-42, 47 or 48, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 1326-1344. The composition according to any of claims 26-42, or 47-49, wherein the first strand of the second nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 1326-1344.The composition according to any of claims 26-30 or 34-50, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO:

213. The composition according to any of claims 26-42 or 47-51 , wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90% or at least 95% identity to the sequence set forth in SEQ ID NO: 1334. The composition according to any of claims 26-30, 34-42, or 47-52, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 95% identity to the sequence set forth in SEQ ID NO: 213, and wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 95% identity to the sequence set forth in SEQ ID NO: 1334. The composition according to any of claims 26-30 or 34-42, or 47-53, wherein the first strand of the first nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 213, and wherein the first strand of the second nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 1334. The composition according to any of claims 26-54, comprising at least two nucleic acid molecules targeting variant NRAS, wherein the at least two nucleic acid molecules targeting variant NRAS target different NRAS alleles. The composition according to any of claims 26-55, comprising at least three nucleic acid molecules targeting variant NRAS, wherein the at least three nucleic acid molecules targeting variant NRAS target different NRAS alleles. A pharmaceutical composition comprising the composition of any of claims 26-56 and a pharmaceutically acceptable excipient. A method of treating an acquired naevus in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition of any of claims 26-56 or the pharmaceutical composition of claim 55. A method of treating an acquired naevus in a subject, the method comprising administering to the subject a first nucleic acid molecule in combination with a second nucleic acid molecule, wherein said administration occurs simultaneously or sequentially in any order, wherein the first nucleic acid molecule is as defined in any of claims 2, 4-9, 11-17, 26- 30 or 34-42, and wherein the second nucleic acid molecule is as defined in any of claims 3-5, 10-17, or 26-56.A method of preventing melanoma in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition according to any of claims 26-56 or the pharmaceutical composition of claim 55. The composition according to any of claims 26-56 or the pharmaceutical composition of claim 55 for use in a method of treating an acquired naevus in a subject. The composition according to any of claims 26-56 or the pharmaceutical composition of claim 55 for use in a method of preventing melanoma in a subject. Use of the composition according to any of claims 26-56 or the pharmaceutical composition of claim 55 for reducing or removing acquired naevi. A cosmetic method for reducing or removing an acquired naevus in a subject, the method comprising administering to the subject the composition according to any of claims 26-56. A non-therapeutic method for reducing or removing an acquired naevus.

Images