Antimicrobial therapy against streptococcus pneumoniae by means of mRNA encoding bacteriophage endolysin / autolysin

Abstract

The present invention relates in a first aspect to a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a drug or to a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use in treating and / or preventing a bacterial infection, wherein the bacterial infection is preferably a Streptococcus infection, in particular a Streptococcus pneumoniae infection. The invention relates in a second aspect to a polynucleotide, in particular ribonucleic acid molecule, comprising and preferably consisting of a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, of SEQ ID NO. 2, of SEQ ID NO. 3, of SEQ ID NO: 4 or of SEQ ID NO: 12 or of SEQ ID NO: 13. The invention relates in a third aspect to a pharmaceutical composition containing a polynucleotide according to the second aspect of the invention and optionally one or more pharmaceutically acceptable carriers and / or excipients.

Description

[0001] Antimicrobial therapy against Streptococcus pneumoniae using mRNA encoding bacteriophage endolysin / autolysin

[0002] In a first aspect, the present invention relates to a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a medicament or a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use in the treatment and / or prevention of a bacterial infection, wherein the bacterial infection is preferably a Streptococcus infection, in particular a Streptococcus pneumoniae infection. A second aspect of the invention relates to a polynucleotide, in particular a ribonucleic acid molecule, comprising, preferably consisting of, a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 12 or SEQ ID NO. 13.In a third aspect, the invention relates to a pharmaceutical composition comprising a polynucleotide according to the second aspect of the invention and optionally one or more pharmaceutically acceptable carrier(s) and / or excipient(s).

[0003] Streptococcus pneumoniae (S. pneumoniae) is the most common cause of pneumonia, sepsis, meningitis, and other serious infections in childhood. In 2015 alone, an estimated 294,000 children (without concurrent HIV infection) aged 1–59 months died worldwide from S. pneumoniae infections (Wahl et al., 2018). Effective antibiotic treatment of S. pneumoniae infections is increasingly hampered by resistance to established antibiotics. Resistance to beta-lactam antibiotics and macrolides is estimated to exceed 20% in some European countries (Cillöniz et al., 2018). Therefore, there is a strong need for new, effective antibiotic therapies against S. pneumoniae infections.

[0004] Endolysins (bacteriophage endolysins) represent a group of enzymes (peptidoglycan hydrolases) that have the ability to rupture bacterial cell walls. In the replication cycle of bacteriophages, endolysins serve to free the bacteriophages from the bacterial host cell at the end of the so-called lytic cycle. The rupture of the cell walls and the associated disruption of the osmotic balance lead to the death of the bacteria. Autolysins represent a group of enzymes expressed by bacterial cells that have the ability to rupture the bacterial cell wall, enabling bacterial cell division. Due to their ability to rupture cell walls, endolysins and autolysins represent a promising alternative to therapies with conventional, mostly low-molecule antibiotics and have therefore been the focus of clinical research for some time (Murray et al., 2021).Since members of these antibiotic groups are also effective against multidrug-resistant pathogens, they offer a potential alternative for infections caused by pathogens that cannot be treated, or can only be treated to a limited extent, with conventional antibiotics. Due to their mechanism of action, the development of resistance to endolysins is unlikely according to current knowledge (Roach and Donovan, 2015). In previous applications, endolysins and autolysins are typically produced recombinantly in bacterial cells in the laboratory, then isolated from the cells and administered in purified form to the animal organism.

[0005] Despite their potential and intensive research efforts, there are still unresolved problems with the use of endolysins / autolysins for the treatment of infectious diseases. Problems with their application primarily relate to the ability to specifically transport the enzymes to the site of infection in the human body, as well as their bioavailability. Endolysins / autolysins cannot penetrate mucosal barriers and are degraded by numerous processes in the animal organism (e.g., proteases or cells of the immune system) (Murray et al., 2021). Due to their often small size, many endolysins / autolysins are below the threshold of glomerular filtration. The half-life of Cpl-1 endolysin, which effectively disrupts the cell walls of S. pneumoniae, was only 20 minutes in the rat model (Entenza et al., 2005).Intravenously administered endolysins are therefore rapidly excreted via the kidneys, negatively impacting their ability to act in the body. Another disadvantage of current endolysin / autolysin therapies is the recombinant protein production. The process of recombinant protein production, subsequent purification, and quality control is associated with relatively high effort and expense (Puetz and Wurm, 2019).

[0006] For these reasons, the clinical application of endolysins is currently limited to topical applications on the skin (Murray et al., 2021), while intravenous applications are being tested in clinical trials (Fowler et al., 2020). The use of autolysins, such as lytA encoded by S. pneumoniae, is limited to laboratory trials (Rodriguez-Cerrato et al., 2007).

[0007] The discovery of mRNA molecules in the 1960s marked the beginning of research into mRNA molecules as an alternative to the therapeutic delivery of recombinantly produced proteins. Advanced research projects or even established clinical applications for the use of mRNA technology can currently be found in areas such as cancer therapies, vaccines, and protein replacement therapies (Weng et al., 2020). However, research into mRNA-based therapies has not yet been reflected in the field of antibiotic therapies; to the best of the applicants' knowledge, there are no entries on this topic in the literature. Fundamental properties of mRNA therapies could prove advantageous in the treatment of infectious diseases and represent approaches to solving existing challenges of protein-based endolysin therapy:

[0008] The administration of endolysin-encoding mRNA opens up new possibilities for cell / organ-specific therapy. Due to the continuous development of formulations for in vivo mRNA transfection, numerous advances have been made in this field in recent years (Weng et al., 2020) (Guevara, Persano, and Persano, 2020). Systemically administered mRNA can be successfully enriched in the liver, endothelium, or lung parenchyma, for example (Weng et al., 2020) (Schrom et al., 2017).

[0009] -mRNA-based endolysin therapy enables standardized administration that is independent of the subsequent chemical properties of the endolysins. mRNA-based delivery thus potentially represents a universal platform for the administration of various endolysins. Variations are limited to the endolysin-coding region of the mRNA construct. With minor changes in the mRNA structure, mRNA-based endolysin therapy can thus be adapted for the treatment of specific infectious agents.

[0010] -mRNA introduced into human cells is translated while it remains intact within the cell's cytosol. The corresponding proteins are thus available in the organism for the duration of translation. Due to this difference from conventional therapies using recombinantly produced endolysins, the use of mRNA-based endolysins is expected to offer optimized bioavailability over several hours to days. This means that a single administration may potentially be sufficient for a sustained therapeutic effect.

[0011] A further advantage of mRNA-encoded endolysins is the production of mRNA compared to recombinantly produced proteins. mRNA can be produced for clinical applications in high purity and, compared to small molecule drugs or recombinantly produced proteins, inexpensively and rapidly (Damase et al., 2021) (Weng et al., 2020). It is estimated that the production costs for mRNA therapeutics manufactured according to good manufacturing practice (GMP) criteria are five to ten times lower than the costs of recombinantly produced proteins in eukaryotic expression systems (Ouranidis et al., 2022). The object of the invention was to provide endolysin-encoding mRNA or autolysin-encoding mRNA, which would solve the problems of protein-based endolysin therapy or autolysin therapy, respectively.

[0012] 1. Aspect - Polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a medicament

[0013] In a first aspect, the object is achieved by a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a medicament.

[0014] By administering mRNA molecules encoding the protein sequence of endolysins or autolysins, the cells of a patient suffering from a bacterial infection can be equipped with the "blueprint" for producing a specific endolysin or autolysin. This enables the affected patient's cells to independently produce the corresponding endolysin or autolysin through heterologous protein expression. In sharp contrast to previous endolysin or autolysin therapy, the finished protein is no longer administered, but rather specific mRNA constructs that are taken up by mammalian cells and lead to the production of the endolysins or autolysins in the animal organism.

[0015] In preferred embodiments, the invention according to the first aspect relates to a polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use in the treatment and / or prevention of a bacterial infection, wherein the bacterial infection is preferably a Streptococcus infection, in particular a Streptococcus pneumoniae infection.

[0016] Prevention of bacterial infection includes the use of endolysin-encoding ribonucleic acid or autolysin-encoding ribonucleic acid for decolonization in the setting of S. pneumoniae colonization.

[0017] For use in the treatment and / or prevention of a bacterial infection, the endolysin-encoding ribonucleic acids or autolysin-encoding ribonucleic acids are used in monotherapy or combination therapy with one or more other antibiotic substances.

[0018] Infections caused by S. pneumoniae include pneumonia, sinusitis, rhinitis, otitis media, mastoiditis, bacterial meningitis, sepsis, bronchitis, conjunctivitis, septic arthritis, endocarditis, pericarditis, osteomyelitis, appendicitis, endophthalmitis, and peritonitis. Pneumonia, bacterial meningitis, sepsis, and otitis media are the most common infections caused by S. pneumoniae.

[0019] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid comprises a polynucleotide sequence which is at least 70% identical to the sequence according to SEQ ID NO. 1, or at least 70% identical to the sequence according to SEQ ID NO. 2, or at least 70% identical to the sequence according to SEQ ID NO. 3, or at least 70% identical to the sequence according to SEQ ID NO. 4.

[0020] The polynucleotide sequences according to SEQ ID NO. 1 of the (modified) Cpl-1 endolysin, according to SEQ ID NO. 2 of the (modified) Cpl-711 endolysin, according to SEQ ID NO. 3 of the (modified) endolysin PAL, and according to SEQ ID NO. 4 of the (modified) autolysin lytA are shown below, notated from the 5' to the 3' end, with the start and stop codons underlined once (start codon) and twice (stop codon), respectively. Start and stop codons are not part of the sequence according to SEQ ID NO. 1, NO. 2, NO. 3, and NO. 4. Furthermore, nucleotides written in bold with underline are modified compared to known sequences of these endolysins in such a way that glycosylation of the resulting protein is reduced or avoided. Nucleotides are marked in bold (without underlining) at whose position one or more further modifications are possible, which also reduce or prevent glycosylation of the protein.In this context, "modification" means the replacement of the respective nucleotide with another nucleotide, whereby the possible modifications are explained in detail below for the specific positions. The term "modification" in this context does not include, in particular, deletions of one or more nucleotides, or in particular triplets, nor does it include insertions of one or more nucleotides in this region, especially triplets.

[0021] SEQ ID NO. 1 : (modifzierte) Streptococcus phage Cp-1 (Cpl-1) Endolysin mRNA AUGGUGAAGAAGAACGACCUGUUCGUGGACGUGAGCAGCCACAACGGCUACGAC AUCACCGGCAUCCUGGAGCAGAUGGGCACCACCAACACCAUCAUCAAGAUCAGCG AGAGCACCACCUACCUGAACCCCUGCCUGAGCGCCCAAGUGGAGCAGAGCAACCC CAUCGGCUUCUACCACUUCGCUAGAUUCGGCGGCGACGUGGCCGAGGCCGAGAGA GAGGCUCAGUUCUUCCUGGACAACGUGCCCAUGCAAGUGAAGUACCUGGUGCUGG ACUACGAGGACGACCCUAGCGGCGACGCCCAAGCCAACACCAACGCCUGCCUGAG AUUCAUGCAGAUGAUCGCCGACGCCGGCUACAAGCCCAUCUACUACAGCUACAAG CCCUUCACCCACGACAACGUGGACUAUCAGCAGAUCCUGGCUCAGUUCCCCAACA GCCUGUGGAUCGCCGGCUACGGCCUGAACGACGGCACCGCCAACUUCGAGUACUU CCCUAGCAUGGACGGCAUCAGAUGGUGGCAGUACAGCAGCAACCCCUUCGACAAG

[0022] AACAUCGUGCUGCUGGACGACGAGGAGGACGACAAGCCCAAGACCGCCGGCACCU

[0023] GGAAGCAAGACUCCAAGGGUUGGUGGUUCAGAAGAAACGACGGCAGCUUCCCCU

[0024] ACAACAAGUGGGAGAAGAUCGGCGGCGUGUGGUACUACUUCGAUAGCAAGGGCU

[0025] ACUGCCUGACAAGCGAGUGGCUGAAAGACAACGAGAAGUGGUACUACCUGAAGG

[0026] ACAACGGCGCCAUGGCCACGGGCUGGUGCUUGUGGGCAGCGAGUGGUACUACAU

[0027] GGACGACAGCGCGCCAUGGUGACGGGACGGAUGGGUGAGUACAAGAACAACUGGUA

[0028] UUAUAUGACAAACGAGAGAGGCAACAUGGUGAGCAACGAGUUCAUCAAGAGCGG

[0029] GAAGGGCUGGUACUUUAUGAACACCAACGGCGAGCUGCCGACAACCCUAGCUUC

[0030] ACC AAGGAGCCCGACGGCCI JGAI JCACCGI JGGCCUAGUAAA

[0031] SEQ ID NO.2: (modifzierte) Cpl-711 Endolysin mRNA

[0032] AUGGUGAAGAAGAACGACCAGCUGUUCGUGGACGUGGCUAGCCACCAAGGCUACGAC

[0033] AUCAGCGGCAUCCUGGAGGAGGCCGGCACCACCAACACCAUCAUCCAAGGUGAGCG

[0034] AGAGCACAAGCUACCUGAACCCCCUGCCUGAGCGCCCAAGUGUCUCAGAGCAACCC

[0035] CAUCGGCUUCUACCACUUCGCCUGGUUCGGCGGCAACGAGGAGGAGGCCGAGGCC

[0036] GAGGCUAGUACUUCCUCGACAACGUGCCCACCCAAGUGAAGUACCUGGUGCUGG

[0037] ACUACGAGGACCACGCUAGCGCUAGCGUGCAGAAAACCACCGCCCUGCCUGAG

[0038] AUUCAUGCAGAUCAUCGCCGAGGCCGGCUACACCCCCAUCUACUACAGCUACAAG

[0039] CCCUUCACCUUAGACAACGUGGACUAUCAGCAGACAUCCUGGCUCAGUUCCCCAACA

[0040] GCCUGUGGAUCGCCGGCUACGGCCUGAACGACGGCACCGCCAACUUCGAGUACUU

[0041] CCCUAGCAUGGACGGCAUCAGAUGGUGGCAGUACAGCAGCAACCCCUUCGACAAG

[0042] AACAUCGUGCUGCUGGACGACGAGGAGGACGACAAGCCCAAGACCGCCGGCACCU

[0043] GGAAGCAAGACUCCAAGGCUGGUGGUUCAGAAGAAAACGACGGCAGCUUCCCCU

[0044] ACAACAAGUGGGAGAAGAUCGGCGGCGUGUGGUACUACUUCGACAGCAAGGGCU

[0045] ACUGCCUGACAAGCGAGUGGCUCAAGGAUACGAAAAAAUGGUACUACCUGAAGG

[0046] ACAACGGGCGAUGGCCACCGGCUGGGGUUCUGGUGGCAGCGAGUGGGUACUACA

[0047] UGGAUGAUAGCGGCCGCAUGGUGACGGGUUGGUCAAGUAUAAGAAACAACUGGU

[0048] ACUAUAUGACGAACGAGAGAGGCAACAUGGUGAGCAACGAGUUCAUCAAGAGCG

[0049] GUAAAGGCUGGUACUUCAUGAACACCAACGGCGAGCUGCCGACAACCCUAGCUU

[0050] CACCAAGGAGCCCGACGGCCI JGAI JCACCGI JGGCCUAGUAAA

[0051] SEQ ID NO.3: (modifizierte) Streptococcus phage Dp-1 Endolysin (PAL) mRNA

[0052] AUGGGCGUGGACAUCGAGAAGGGCGUGGCCUGGAUGCAAGCUAGAAAGGGCAGA

[0053] GUGAGCUACAGCAUGGACUUCAGAGACGGCCCCGACAGCUACGACUGCAGCAGCA

[0054] GCAUGUACUACGCCCUGAGAUCCGCCGGCGCUAGCAGCGCCGGCUGGGCCGUGAA

[0055] CACCGAGUACAUGCACGCCUGGCUGAUCGAGAACGGCUACGAGCUGAUCAGCGAG

[0056] AACGCCCCCUGGGACGCCAAGAGAGGCGACAUCUUCAUCUGGGGCAGAAAGGGCG

[0057] CCUCAGCCGGCGCCGGCGGCCACACCGGCAUGUUCAUCGACAGCGACAACAUCAU CCACUGCAACUACGCCUACGACGGCAUCAGCGUGAACGACCACGACGAGAGAUGG

[0058] UACUACGCCGGGCAGCCCUACUACUACGUGUACAGACUGACCAACGCCAACGCUC

[0059] AGCCCGCCGAGAAGAAGCUGGGCUGGCAGAAGGACGCCACCGGCUUCUGGUACGC

[0060] UAGAGCCGACGGCACCUACCCCAAGGACGAGUUCGAGUACAUCGAGGAGGACAA

[0061] GAGCUGGUUCUACUUCGACGACCAAGGCUACAUGCUGGCCGAGAAGUGGCUGAA

[0062] GCACACCGACGGCAACUGGUACUGGUUCGACAGAGACGGCUACAUGGCCACAAGC

[0063] UGGAAGAGAAUCGGCGAGAGCUGGUACUACUUCAACAGAGACGGCAGCAUGGUG

[0064] ACCGGCUGGAUCAAGUACUACGACAACUGGUACUACUGCGACGCCACCAACGGCG

[0065] ACAUGAAGAGCAACGCCUUCAUCAGAUACAACGACGGCUGGUACCUGCUGCUGCC

[0066] CGACGGCAGACUGGCCGACAAGCCUCAGUUCACCGUGGAGCCCGACGGCCUGAUC ACCGCC AAGGI JGUAGUAAA

[0067] SEQ ID NO.4: (modifizierte) lytA Autolysin mRNA

[0068] AUGGAGAUCGACGUGAGCAAGCUGAGAACCGACCUGCCCCAAGUGGGCGUGCAG

[0069] CCCUACAGACAAGUGCACGCCCACAGUACCGGUAAUCCCCACAGCACCGUGCAGA

[0070] ACGAGGCCGACUACCACUGGAGAAAGGACCCCGAGCUGGGCUUCUUCAGCCACAU

[0071] CGUGGGCAAUGGAUGCAUCAUGCAAGUUGGCCCGGUGGACAAUGGUGCCUGGGA

[0072] CGUUGGCGGCGGCUGGAACGCCGAGACCUACGCCGCCGUGGAGCUGAUCGAGAGC

[0073] CACAGCACCAAGGAGGAGUUCAUGACCGACUACAGACGUACAUCGAGCUGCUGA

[0074] GAAACCUGGCCGACGAGGCCGGCCUGCCCAAGACCCUGGACCACCGGCAGCCUGGC

[0075] CGGCAUCAAGACCCACGAGUACUGCACCAACAAUCAGCCCAACGACCACAGCGAC

[0076] CACGUGGACCCCUACCCCUACCUAGCUGGCCAAGUGGGCAUCAGCAGAGAGCAGUUCA

[0077] AGCACGACAUCGAGAACGGCCUGACCAUCGAGACCGGCUGGCAGAAGGACGACA

[0078] CCGGCUACUGGUACGUACGUCACAGCGACGGCAGCUACCCCAAGGACAAGUUCGAGAA

[0079] GAUCGACGGCACCUGGUAUUAUCGAUUCGAGCGGCUACAUGCUGGCCGACAG

[0080] AUGGAGAAAGCACACCGACGGCAACUGGUACUGGUUCGACAACAGCGGCGAGAU

[0081] GGCCACCGGCUGGAAGAAGAUCGCCGACAAGUGGUAUUACUUUAUGAAGAGGG

[0082] CGCCAUGAAAACCGCUGGGUGAGUACAAGGCACCUGGUACUAUCUGGACGCC

[0083] AAGGAAGGCGCAAUGGUGUCCAACGCCUUCAUUCAGAGGCCCGACGGCACCGGCU

[0084] GGUAUUAUUUAAGCCCGACGGCACCCUGGCCGACAAGCCCGAGUUCACCGUGGA GCCCGACGGCCI JGAI JO ACCGI JGAAGUAGUAAA

[0085] The endolysin-encoding ribonucleic acid or the autolysin-encoding ribonucleic acid is, in particular, an mRNA (messenger ribonucleic acid, synonymously also messenger RNA). The sequence of SEQ ID NO. 1 and SEQ ID NO. 2 is characterized in comparison to the described protein sequence of the unmodified Cpl-1 endolysin (UniProtKB / Swiss-Prot: P15057.2 ) ) or the unmodified Cpl-711 endolysin, which is a chimeric endolysin, (amino acid sequence: see Diez-Martinez et al., 2015) among other things by the modification(s) N215F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or G216P and / or S217F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N, which are responsible for avoiding glycosylation of the endolysin during secretion from the human cell. At the level of the nucleotide sequence, this particularly concerns the nucleotides at positions 640-648 (the codons or triplets in this region orat positions 640-642, 643-645, 646-648). The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 640-642 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 643-645 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 646-648 lead to the preferred modifications.

[0086] The present invention encompasses polynucleotide sequences which are at least 70% identical to the sequence of SEQ ID NO. 1 or SEQ ID NO. 2, with the exception of corresponding modifications at positions 640-648. At these positions, only the modifications listed above are encompassed; any modifications in the sense of a sequence identity of at least 70% relate only to positions 1-639 and 649 ff.

[0087] The protein produced by translation of SEQ ID NO. 3 is characterized in comparison to the described protein sequence of the unmodified PAL endolysin (UniProtKB / Swiss-Prot: 003979.1 , Streptococcus phage Dp-1 endolysin) by, among other things, the modification N168F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or G169P and / or T217F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N and

[0088] NI 82F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or KL 83P and / or

[0089] S184F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N, which are responsible for preventing glycosylation of endolysin during secretion from human cells. At the nucleotide sequence level, this is particularly due to the nucleotides at positions 499-507 (the codons or triplets in this region, or at positions 499-501, 502-504, 505-507) and at positions 541-549 (the codons or triplets in this region, or at positions 541-543, 544-546, 547-549).The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 499-501 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 502-504 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 505-507 and.

[0090] UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 541-543 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 544-546 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 547-549 lead to the preferred modifications.

[0091] The present invention encompasses polynucleotide sequences which are at least 70% identical to the sequence of SEQ ID NO. 3, with the exception of corresponding modifications in the region of positions 499-507 and in the region of positions 541-549 - at these positions only the modifications listed above are encompassed, any modifications in the sense of a sequence identity of at least 70% relate only to positions 1-498, 508-540 and 550 ff. 4 is characterized by the modification N4F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or V5P and / or S6F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N and

[0092] N143F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or H144P and / or

[0093] S 145F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N and

[0094] NI 81F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or D 182P and / or

[0095] T 183F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N and

[0096] N203F / L / P / Y / H / Q / C / W / I / M / T / K / S / R / V / A / D / E / G and / or G204P and / or

[0097] T205F / L / P / Y / H / Q / C / W / I / M / K / R / V / A / D / E / G / N, which are responsible for preventing glycosylation of autolysin during secretion from the human cell. At the level of the nucleotide sequence, the nucleotides responsible for this are in particular the nucleotides at positions 7-15 (the codons or triplets in this region or at positions 7-9, 10-12, 13-15) and in the region of positions 424-432 (the codons or triplets in this region or at positions 424-426, 427-429, 430-432) and in the region of positions 538-546 (the codons or triplets in this region or at positions 538-540, 541-543, 544-546) and in the region of positions 604-612 (the codons or triplets in this region or at positions 604-606, 607-609, 610-612).The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 7-9 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 10-12 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 13-15 and.

[0098] The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 424-426 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 427-429 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 430-432 and

[0099] The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 538-540 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 541-543 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 544-546 and

[0100] The nucleotide sequences UUU, UUC, UUA, UUG, UCU, UCC, UCA, UCG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, ACG, AAA, AAG, AGU, AGC, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 604-606 and / or the nucleotide sequences CCU, CCC, CCA, CCG at positions 607-609 and / or the nucleotide sequences UUU, UUC, UUA, UUG, UAU, UAC, UGU, UGC, UGG, CUU, CUC, CUA, CUG, CCU, CCC, CCA, CCG, CAU, CAC, CAA, CAG, CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, AAU, AAC, AAA, AAG, AGA, AGG, GUU, GUC, GUA, GUG, GCU, GCC, GCA, GCG, GAU, GAC, GAA, GAG, GGU, GGC, GGA, GGG at positions 610-612 lead to the preferred modifications.

[0101] The present invention encompasses polynucleotide sequences which are at least 70% identical to the sequence of SEQ ID NO. 4, with the exception of corresponding modifications in the region of positions 7-15, 424-432, 538-546, and 604-612. At these positions, only the modifications listed above are encompassed; any modifications in the sense of a sequence identity of at least 70% relate only to positions 1-6, 16-423, 433-537, 547-603, and 613 ff.

[0102] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the polynucleotide further comprises a 5' UTR sequence and / or a 3' UTR sequence. A "5' UTR sequence" means an untranslated region, i.e., a nucleotide sequence is positioned at the 5' end of the endolysin / autolysin coding sequence. The 5' UTR stabilizes the mRNA and also plays an important role in the initiation of translation. The 5' UTR contains the Kozak sequence, which is essential for the initiation of translation. The sequences of numerous 5' UTRs naturally occurring in mammalian cells, such as the 5' UTR of human alpha / beta globin mRNA, can be used for this purpose. A “3' UTR sequence” means an untranslated region, i.e. a nucleotide sequence is positioned at the 3' end of the endolysin / autolysin coding sequence.This plays an important role in mRNA stabilization. The sequences of numerous 3'UTRs naturally occurring in mammalian cells, such as the 3'UTR of human alpha / beta globin mRNA, can be used for this purpose. In preferred embodiments, the corresponding sequence of human alpha-globin is used both as the 5' UTR sequence and as the 3' UTR sequence, wherein the 5' UTR sequence is preferably 5' GAGACUCUUCUGGUCCCCACAGACUCAGAGAGAACGCCACC 3' (SEQ ID NO. 5) and the 3' UTR sequence is preferably 5' GCUGGAGCCUCGGUAGCCGUUCCUCCUGCCCGCUGGGCCUCCCAACGGGCCCUCC UCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCAGC 3' (SEQ ID NO. 6), wherein these sequences can have one or more modifications, e.g. one or more nucleotide substitution(s), insertion(s), addition(s) and / or deletion(s).

[0103] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the polynucleotide further comprises a sequence encoding a signal peptide for protein secretion. All naturally occurring and artificially generated signal peptides of secretory proteins can be used. As a sequence coding for a signal peptide, a sequence is preferably selected from the group consisting of sequences coding for the signal peptides of human lysozyme (NCBI Reference Sequence: NM_000239.3), human albumin (NCBI Reference Sequence: NM_000477.7), human azurocidin (NCBI Reference Sequence: NM 001700.5), human immunoglobulin (Ig) heavy chain (HC) (GenBank: AK128477.1) and SARS-CoV-2 spike protein (NCBI Reference Sequence: NC_045512.2), particularly preferably at least one sequence coding for human lysozyme is used, which more preferably has the sequence 5' AAGG CUCUCAUUGU UCUGGGGCUU GUCCUCCUUU CUGUUACGGU CCAGGGC 3' (SEQ ID NO. 7), which more preferably is located upstream (upstream = before the 5' end of the endolysin / autolysin-coding sequence) from the beginning of an endolysin / autolysin-coding sequence and downstream of the start codon. Sequences of the other mentioned signal peptides, which can be used instead of the sequence of human lysozyme, are shown below: human albumin, sequence (SEQ ID NO. 8): 5' AAGUGGGUAACCUUUAUUUCCCUUUUUUCUCUUUAGCUCGGCUUAUUCC 3 human azurocidin, sequence (SEQ ID NO. 9): 5'ACCCGGCUGACAGUCCUGGCCCUGCUGGCUGGCUGGCGUCCUCGAGGGCC 3'; human immunoglobulin (Ig) heavy chain (HC), sequence (SEQ ID NO. 10): 5'GAGUUUGGGCUGAGCUGGGUUUUCCUCGUUGCUCUUUUUAGAGGUGUCCAGUG U 3';.

[0104] SARS-CoV-2 spike protein, sequence (SEQ ID NO. 11): 5'UUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGU 3'.

[0105] In embodiments in which no secretion from the cell is desired, and in particular therefore also without a signal peptide, the sequences according to SEQ ID NO. 1 to 4 are modified such that they are used in unmodified form. In particular, in the sequence according to SEQ ID NO. 1, an A is present at position 640 instead of a G, in the sequence according to SEQ ID NO. 2, an A is present at position 640 instead of a G, in the sequence according to SEQ ID NO. 3, an A is present at position 499 instead of a G and an A is present at position 541 instead of a G, and in the sequence according to SEQ ID NO. 4, an A is present at position 7 instead of a G, an A is present at position 424 instead of a G, an A is present at position 538 instead of a G and an A is present at position 604 instead of a G.

[0106] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the polynucleotide further comprises a start codon and / or a stop codon. In preferred embodiments, for example, AUG (beginning of translation) is used as the start codon, and one or more triplets, preferably selected from the group consisting of UAA, UAG, and UGA, are used as the stop codon, each in single / multiple sequences or in combination, wherein an additional nucleotide with adenosine (A) is preferably positioned at the very end (3' end). A further preferred stop codon is UAGUAAA.

[0107] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the polynucleotide further comprises a polynucleotide sequence which is at least 70% identical to the sequence of SEQ ID NO. 12 or 13.

[0108] The sequence of SEQ ID NO. 12 comprises in particular an endolysin-coding sequence of SEQ ID NO. 1, further upstream a 5'UTR sequence 5' GAGACUCUUCUGGUCCCCACAGACUCAGAGAGAACGCCACC 3' (SEQ ID NO. 5, alpha-globin), a start codon AUG and a sequence coding for a signal peptide (signal peptide of human lysozyme) 5' AAGG CUCUCAUUGU UCUGGGGCUU GUCCUCCUUU CUGUUACGGU CCAGGGC 3' (SEQ ID NO. 7). Downstream of the endolysin-coding sequence (downstream = after the 3' end of the endolysin-coding sequence), the sequence of SEQ ID NO. 1 contains a modified double stop codon UAGUAAA and a 3'UTR sequence

[0109] 5' GCUGGAGCCUCGGUAGCCGUUCCUCCUGCCCGGCUGGGCCUCCC AAACGGGCCCUC CUCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCAGC 3' (SEQ ID NO. 6, alpha-globin). The order of the individual sequences in a preferred embodiment is: 5' start codon sequence encoding a signal peptide sequence according to SEQ ID NO. 1 - stop codon 3'UTR 3' (SEQ ID NO. 12). The polynucleotide comprising a polynucleotide sequence which is at least 70% identical to the sequence of SEQ ID NO. 12 is particularly suitable for excretory protein production.

[0110] The polynucleotide sequence according to SEQ ID NO. 12 is shown below, notated from the 5' to the 3' end, with the start and stop codons underlined once (start codon) and twice (stop codon), respectively. The start and stop codons are part of the sequence according to SEQ ID NO. 12.

[0111] SEQ ID NO 12:

[0112] GAGACUCUUCUGGUCCCCACAGACUCAGAGAGAACGCCACCAUG AAGG CUCUCAUUGU UCUGGGGCUU GUCCUCCUUU CUGUUACGGU CCAGGGC GUGAAGAAGAACGACCUGUUCGUGGACGUGAGCAGCCACAACGGCUACGACAUCA CCGGCAUCCUGGAGCAGAUGGGCACCACCAACACCAUCAUCAAGAUCAGCGAGAG CACCACCUACCUGAACCCCUGCCUGAGCGCCCAAGUGGAGCAGAGCAACCCCAUC GGCUUCUACCACUUCGCUAGAUUCGGCGGCGACGUGGCCGAGGCCGAGAGAGAGG CUCAGUUCUUCCUGGACAACGUGCCCAUGCAAGUGAAGUACCUGGUGCUGGACUA CGAGGACGACCCUAGCGGCGACGCCCAAGCCAACACCAACGCCUGCCUGAGAUUC AUGCAGAUGAUCGCCGACGCCGGCUACAAGCCCAUCUACUACAGCUACAAGCCCU UCACCCACGACAACGUGGACUAUCAGCAGAUCCUGGCUCAGUUCCCCAACAGCCU GUGGAUCGCCGGCUACGGCCUGAACGACGGCACCGCCAACUUCGAGUACUUCCCU AGCAUGGACGGCAUCAGAUGGUGGCAGUACAGCAGCAACCCCUUCGACAAGAACA UCGUGCUGCUGGACGACGAGGAGGACGACAAGCCCAAGACCGCCGGCACCUGGAA GCAAGACUCCAAGGGUUGGUGGUUCAGAAGAAACGACGGCAGCUUCCCCUACAA CAAGUGGGAGAAGAUCGGCGGCGUGUGGUACUACUUCGAUAGCAAGGGCUACUG CCUGACAAGCGAGUGGCUGAAAGACAACGAGAAGUGGUACUACCUGAAGGACAA CGGCGCCAUGGCCACGGGCUGGGUGCUUGUGGGCAGCGAGUGGUACUACAUGGAC GACAGCGGCGCCAUGGUGACGGGAUGGGUGAAGUACAAGAACAACUGGUAUUAUAUGACAAACGAGAGAGGCAACAUGGUGAGCAACGAGUUCAUCAAGAGGCGGGAAG GGCUGGUACUUUAUGAACACCAACGGCGAGCUGGCCGACAACCCUAGCUUCACCA AGGAGCCCGACGGCCI JGAI IC ACCGI JGGCC UAGUAAA GCUGGAGCCUCGGUAGCCGUUCCUCCUGCCCGCUGGGCCUCCCAAC GGGCCCUCCUCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAG UGGGCAGC

[0113] The polynucleotide sequence according to SEQ ID NO. 13 corresponds to the sequence of SEQ ID NO. 12 without the signal peptide. It is particularly suitable for the intracellular production and subsequent cytosolic retention of endolysin and is shown below from the 5' to the 3' end, with the start and stop codons underlined once (start codon) and twice (stop codon), respectively. The start and stop codons are part of the sequence according to SEQ ID NO. 13. In particular, in SEQ ID NO. 13, an A is present at position 684 instead of a G.

[0114] SEQ ID NO 13:

[0115] GAGACUCUUCUGGUCCCCACAGACUCAGAGAGAACGCCACCAUG

[0116] GUGAAGAAGACGACCUGUUCGUGGAGCGUGAGCAGCCACAACGGCUACGACAUCA CCGGCAUCCUGGAGCAGAUGGGCACCACCAACACCAUCAUCAAGAUCAGCGAGAG CACCACCUACCUGAACCCCUGAGCUGAGCGCCCAAGUGGAGCAGAGCAACCCAUC GGCUUCUACCACUUCGCUAGAUUCGGCGGCGAACGUGGCCGAGGCCGAGAGAGAGG CUCAGUUCUCCUGGACAACGUGCCCAUGCAAGUGAAGUAACCUGGUGCUGGACUA CGAGGACGACCCUAGCGGCGACGCCCAAGCCAAACCAACGCCUGCCUGAGAUUC AUGCAGAUGAUCGCCGACGCCGGCUACAAGCCCAUCUACUACAGCUACAAGCCCU UCACCCACGACAACGUGGACUAUCAGCAGAUCCUGGCUCAGUUCCCCAACAGCCU GUGGAUCGCCGGCUACGGCCUGAACGACGGCACCGCCAACUUCGAGUACUUCCCU AGCAUGGACGGCAUCAGAGGUGGCAGUACAGCAGCAACCCCUUCGACAAGAACCA UCGUGCUGCUGGACGACGAGGAGGACGACAAGCCCAAGACCGCCGGCACCUGGAA GCAAGACUCCAAGGGUUGGUUCAGAAAGAAACGACGGCAGCUUCCCUACAA CAAGUGGGGAAGAUCGGCGGCGUGUGGUACUACUUCGAUAGCAAGGCUACUG CCUGACAAGCGAUGGCCUGAAAGACAACGAGAUGGUGUACCUACCUGAAGGACAA CGGCGCCAUGGGCCACGGGCUGGUGCUUGUGGGCAGCGAUGGUACUACAUGGAC GACAGCGGGCCCAUGGUGAGGUAGGACGGUAGGUAUAUAU AUGACAAACGAGAGGCAACAUGGGUAGCAACGAGUUCAUCAAAGAGGCGGGAAGGGCUGGUACUUUAUGAACACCAACGGCGAGCUGGCCGACAACCCUAGCUUCACCA AGGAGCCCGACGGCCI JGAI IC ACCGI JGGCC UAGUAAA GCUGGAGCCUCGGUAGCCGUUCCUCCUGCCCGCUGGGCCUCCCAAC GGGCCCUCCUCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAG UGGGCAGC

[0117] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the sequence identity is at least 75%, preferably at least 80%, further preferably at least 85%, further preferably at least 90%, further preferably at least 95%, further preferably at least 98%, further preferably at least 99%. An identity of xx% means that sequences are included which have a nucleic acid sequence which differs from the stated sequence by at least one nucleotide substitution, deletion, insertion and / or addition. The term "at least one" as used herein means one or more than one, such as "at least two", "at least three", "at least four", "at least five", etc.Substitution, insertion, addition of naturally occurring nucleotides or modified nucleotides, for example NI-methyl-pseudouridine (mlT) or 5-methylcytidine.

[0118] Through the use of modified nucleotides (in particular NI-methyl-pseudouridine and 5-methylcytidine), the mRNA is stabilized and the stimulation of the animal's immune system is minimized. In preferred embodiments, at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all uridines occurring in one or more of the sequences according to SEQ ID NO. 1 to 13 are replaced by NI-methyl-pseudouridine (mI).In alternative preferred embodiments, at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in one or more of the sequences according to SEQ ID NO. 1 to 13 are replaced by 5-methylcytidine. In further preferred embodiments, at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in one or more of the sequences according to SEQ ID NO.1 to 13 occurring uridines are replaced by NI-methyl-pseudouridine (ml ) and at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in the same sequence(s) according to SEQ ID NO. 1 to 13 are replaced by 5-methylcytidine.

[0119] The degree of identity (e.g., expressed as "% identity") between two biological sequences, preferably (m)RNA in the context of the present invention, can be determined using algorithms known in the art. Preferably, the degree of identity is determined by comparing two optimally aligned sequences across a comparison window, where the sequence fragment in the comparison window may contain additions or omissions (e.g., gaps or overhangs) compared to the sequence with which it is compared for optimal alignment.The percentage is calculated by determining the number of positions at which the identical residue occurs in both sequences, preferably over the entire length of the polynucleotide, to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Optimal alignment of the sequences to be compared can be achieved using the local homology algorithm of Smith and Waterman (1981), the homology alignment algorithm of Needleman and Wunsch (1970), the similarity search of Pearson and Lipman (1988), computer-assisted implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by visual inspection.Once two sequences have been identified for comparison, GAP and BESTFIT are preferably used to determine their optimal alignment and thus the degree of identity. The default values ​​of 5.00 for gap weight and 0.30 for gap weight length are preferably used.

[0120] In preferred embodiments of the polynucleotide for use as a medicament or for use in the treatment and / or prevention of a bacterial infection, the polynucleotide further comprises a 5' encapsulation. "5' encapsulation" means that the 5' cap is positioned at the 5' end of the mRNA. This cap consists of a methyl-7-guanine nucleotide, which in turn is connected to the mRNA via a 5'-5' triphosphate bridge. The first regular nucleotide of the mRNA is methylated at the 2' position (cap 1). Other possible modifications include the use of a poly-A sequence (poly(A) tail), i.e., a repetitive adenosine nucleotide sequence with a length of at least 120 adenosine nucleotides, preferably a length in the range of 120 to 300 adenosine nucleotides, is positioned at the 3' tail end of the mRNA. The poly-A sequence plays an important role in protecting against degradation.

[0121] 2, Aspect - Polynucleotide

[0122] In a second aspect, the invention relates to a polynucleotide, in particular a ribonucleic acid molecule, comprising, preferably consisting of, a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 12 or 13. All details, embodiments, and preferred embodiments described in the scope of the first aspect also apply to the polynucleotide of the second aspect.

[0123] 3, Aspect - Pharmaceutical Composition

[0124] In a second aspect, the invention relates to a pharmaceutical composition comprising a polynucleotide according to the second aspect and optionally one or more pharmaceutically acceptable carrier(s) and / or excipient(s). All details, embodiments, and preferred embodiments described in the scope of the first aspect also apply to the polynucleotide of the second aspect.

[0125] The invention further relates to a method for the treatment and / or prevention of a bacterial infection, preferably a Streptococcus infection, more preferably a S. pneumoniae infection, comprising

[0126] (a) administering a polynucleotide, in particular ribonucleic acid molecule, comprising, preferably consisting of, a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 12 or SEQ ID NO. 13;

[0127] (b) thus treating and / or preventing a bacterial infection.

[0128] The present invention is further illustrated by the following embodiments and combinations of embodiments, as indicated by the respective dependencies and cross-references. In particular, it is noted that whenever a range of embodiments is mentioned, e.g., in connection with a term such as "The ... of any of embodiments 1 to 4," each embodiment within this range is intended to be explicitly disclosed to those skilled in the art. That is, the wording of this term is to be understood by those skilled in the art as a synonym for "The ... of any of embodiments 1, 2, 3, and 4."

[0129] 1. A polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a medicament.

[0130] 2. A polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use in the treatment and / or prevention of a bacterial infection, wherein the bacterial infection is preferably a Streptococcus infection, in particular a Streptococcus pneumoniae infection.

[0131] 3. Polynucleotide for use according to any one of embodiments 1 or 2, wherein the endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid comprises a polynucleotide sequence which is at least 70% identical to the sequence according to SEQ ID NO. 1, or at least 70% identical to the sequence according to SEQ ID NO. 2, or at least 70% identical to the sequence according to SEQ ID NO. 3, or at least 70% identical to the sequence according to SEQ ID NO. 4.

[0132] 4. Polynucleotide for use according to embodiment 3, further comprising a 5' UTR sequence and / or a 3' UTR sequence.

[0133] 5. Polynucleotide for use according to any one of embodiments 3 to 4, further comprising a sequence encoding a signal peptide.

[0134] 6. Polynucleotide for use according to any one of embodiments 3 to 5, further comprising a start codon and / or a stop codon.

[0135] 7. A polynucleotide for use according to any one of embodiments 1 to 6, comprising a polynucleotide sequence which is at least 70% identical to the sequence of SEQ ID NO. 12 or SEQ ID NO. 13.

[0136] 8. Polynucleotide for use according to any one of embodiments 1 to 7, wherein the sequence identity is at least 75%, preferably at least 80%, further preferably at least 85%, further preferably at least 90%, further preferably at least 95%, further preferably at least 98%, further preferably at least 99%. Polynucleotide for use according to any one of embodiments 1 to 8, further comprising a 5' encapsulation. Polynucleotide for use according to any one of embodiments 1 to 9, wherein at least 10%, further preferably at least 20%, further preferably at least 30%, further preferably at least 40%, further preferably at least 50%, further preferably at least 60%, further preferably at least 70%, further preferably at least 80%, further preferably at least 90%, further preferably 100% all in one or more of the sequences according to SEQ ID NO. 1 to 13 occurring uridines are replaced by NI -methyl- pseudouridine (ml ).Polynucleotide for use according to any one of embodiments 1 to 9, wherein at least 10%, further preferably at least 20%, further preferably at least 30%, further preferably at least 40%, further preferably at least 50%, further preferably at least 60%, further preferably at least 70%, further preferably at least 80%, further preferably at least 90%, further preferably 100% of all cytidines occurring in one or more of the sequences according to SEQ ID NO. 1 to 13 are replaced by 5-methylcytidine. Polynucleotide for use according to any one of embodiments 1 to 11, wherein at least 10%, further preferably at least 20%, further preferably at least 30%, further preferably at least 40%, further preferably at least 50%, further preferably at least 60%, further preferably at least 70%, further preferably at least 80%, further preferably at least 90%, further preferably 100% all in one or more of the sequences according to SEQ ID NO.1 to 13 occurring uridines are replaced by NI-methyl-pseudoxyuridine (mIT) and in the same sequence(s) at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in the sequence are replaced by 5-methylcytidine. Polynucleotide, in particular ribonucleic acid molecule, comprising, preferably consisting of, a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 12 or 13. 14. A pharmaceutical composition comprising a polynucleotide according to embodiment 13 and optionally one or more pharmaceutically acceptable carrier(s) and / or excipient(s).

[0137] The present invention is further explained by the following reference examples, comparative examples and examples.

[0138] EXAMPLES

[0139] The endolysin of bacteriophage Cp-1, the so-called Cpl-1 endolysin (Genebank accession number NC 001825.1), specifically targets the pneumonia pathogen S. pneumoniae. Previous studies have investigated the lytic activity, spectrum of activity, and immunological effects of Cpl-1 in a murine infection model (17) (18) (4), (19). Here, Cpl-1 endolysin was used as an example for the establishment of an mRNA-based heterologous expression system for the production of bacteriolytic proteins in human cells.

[0140] Cpl-1 encoding mRNA constructs for heterologous expression in human cells: The nucleotide sequence of the Cpl-1 gene was optimized for expression in human cells and extended by stabilizing untranslated regions (UTRs) at the 5' and 3' ends of the gene (20). The production of the corresponding mRNA constructs was carried out starting from double-stranded plasmid DNA by in vitro transcription (IVT). As a further modification to increase the stability of the mRNA construct, a 5' cap was introduced. The first nucleotide was a methyl-7 guanine nucleotide, which was linked to the mRNA via a 5'-5' triphosphate bridge (10). In addition, a repetitive adenosine nucleotide sequence with a length of at least 120 nucleotides was located at the 3' end of the mRNA (poly(A) tail) (21). Instead of uridine, NI-methyl-pseudouridine was used. In Fig.Figure 1 (a) shows a schematic overview of the mRNA construct encoding Cpl-1 (construct a).

[0141] Transfection of human cells with Cpl-1 encoding mRNA and subsequent detection of cytosolic Cpl-1 expression:

[0142] Cpl-1-encoding mRNA constructs were tested in human cell lines. Alveolar basal epithelial cells [A549], hepatocytes [HEPG2], and human embryonic kidney cells [HEK293T] were transfected with the mRNA construct a for cytosolic protein expression. After 24 h, the cell lines were lysed. Addition of the cell lysates to a suspension containing S. pneumoniae led to a significant reduction in the number of bacteria (Figs. 2-4). Specific amino acids of Cpl-1 were detected in the lysates of all cell lines by mass spectrometry (Table 1, (a)). Table 1 shows the mass spectrometric detection of Cpl-1: a) Cpl-1 sequence, peptides detected from the cell lysate (underlined); b) Cpl-1 sequence, peptides detected from the cell medium (underlined).

[0143] Table 1

[0144] Extension of the mRNA-based heterologous expression platform for the production of Cpl-1 endolysin as a secretory protein

[0145] In the experiments described above, mRNA-based heterologous expression of Cpl-1 in human cells was demonstrated. The lytic activity of Cpl-1 could be detected in the cell lysate of human cells, but not in the culture medium. Thus, it was assumed that the Cpl-1 endolysin remained within the cells after translation of construct a.

[0146] General: For the treatment of extracellularly residing pathogens, the secretion of endolysins from the cells into the extracellular space is the goal. Secretory proteins are recognized during translation based on a specific amino acid sequence (signal peptide) at the N-terminal end and are actively secreted from the cells. Since endolysins disrupt bacterial cell walls from the intracellular level at the end of the bacteriophage replication cycle, secretion is naturally unnecessary, and no signal peptides are encoded in the endolysin genes. Therefore, signal peptides from human proteins that are secreted in high levels in the human body (e.g., human albumin, human azurocidin, human lysozyme) were selected for the secretion of Cpl-1 endolysin.

[0147] The mRNA constructs for Cpl-1 endolysin were modified with corresponding signal peptides (construct b, Fig. 1 (b)). In subsequent transfection experiments with the modified mRNA constructs, Cpl-1 endolysin was detected in the cell culture medium by mass spectrometry (Table 1, (b)). Thus, the secretion of Cpl-1 after fusion with signal peptides was demonstrated.

[0148] Modification of the Cpl-1 amino acid sequence to avoid glycosylation during secretion

[0149] To prevent glycosylation of the Cpl-1 endolysin during secretion, mutations in the mRNA sequence were performed to alter the glycosylation site (NGS, positions 215-217) present in the amino acid sequence of Cpl-1. The point mutation A640G in the mRNA sequence of the Cpl-1 endolysin resulted in the mutation N215D in the amino acid sequence. The mutations A646G and G647C resulted in the mutation S217A in the amino acid sequence. Figure 5 shows the protein bands of Cpl-1 in the wild-type sequence (band 5) and the mutants (bands 2, 3, and 4) on an SDS-PAGE performed on culture medium samples of A549 cells 24 hours after mRNA transfection. The different height of the protein band of the wild-type sequence of Cpl-1 on the gel compared to the mutants Cpl-1N215D and Cpl-1 S217A as well as the band of the recombinantly produced Cpl-1 (bands 1 and 6) was caused by the glycosylation of the wild-type sequence.It was shown that the point mutations in the amino acid sequence led to the inhibition of glycosylation.

[0150] To test the biological activity of Cpl-1 and the non-glycosylated mutants secreted into the culture medium, the culture medium was first concentrated by a factor of 1:10 using centrifugation columns 24 hours after mRNA transfection of the cells with the corresponding mRNA constructs (Cpl-1, Cpl-1N215D, and Cpl-1S217A mRNA constructs, each containing the signal peptide of human lysozyme). Then, 20 μl of the concentrated cell medium was added to 200 μl of pneumococcal suspension (ODO 0.4-0.5). A decrease in the bacterial load was observed in the culture media samples from the cells previously transfected with mRNA. The results of the mRNA transfections of the A549 cell line are shown in Figure 6.

[0151] Description of the illustrations

[0152] Fig. 1: a) mRNA construct for cytosolic protein expression, b) mRNA construct for secretory protein production; Gray circle: 5'Cap; mRNA sequence of the 5'UTR; mRNA sequence of the signal peptide; AUG: start codon (beginning of translation); mRNA sequence of the endolysin; Stop: stop codon (UAA, UAG, UGA in single / multiple sequence or in combination, followed by a single adenosine nucleotide (A)); mRNA sequence of the 3'UTR; A: poly(A) tail, consisting of >=120 adenosine nucleotides; each indicated with arrows.

[0153] Fig. 2-4: Bacteriolytic effect of cell lysates after mRNA transfection (HEK293T, HEPG2, and A549 cells). Transfections with mRNA encoding Cpl-1 endolysin were performed 24 hours prior to the experiments. After adding the lysates to a S. pneumoniae suspension, the samples were incubated at 37°C for 90 minutes, and the optical density (OD600) was determined. The experiments were performed at least three times in triplicate, and mean values ​​were calculated. The cell lysate samples were then plated on solid culture media (box plots on the right with median, IQR, and minimum and maximum values ​​are shown as whisker plots). The lysates of cells transfected with Cpl-1 mRNA resulted in a decrease in bacterial load compared to the controls (Welch test: HEK293T cells p=0.005; HEPG2 cells p=0.071; A549 cells p =0.012;).

[0154] Fig. 5: SDS PAGE performed on the cell medium of A549 cells 24 hours after mRNA transfection encoding different variants of the Cpl-1 endolysin compared with the wild-type sequence.

[0155] Fig. 6: Bacteriolytic effect of the cell medium (A549 cells) after mRNA

[0156] Transfection with mRNA encoding Cpl-1, Cpl-1N215D, and Cpl-1 S217A with the signal peptide of human lysozyme. mRNA transfections were performed 24 hours prior to experiments. After adding 20 μl of concentrated (1:10) culture medium to 200 μl of a S. pneumoniae suspension, the samples were incubated at 37°C for 60 minutes, and the optical density (OD600) was determined. The experiments were performed at least twice in triplicate, and mean values ​​were calculated. The culture media samples were then plated onto solid culture media (box plots on the right with median, IQR, and minimum and maximum values ​​are shown as whisker plots). The media of A549 cells transfected with Cpl-1 and Cpl-1N215D mRNA resulted in a decrease in bacterial load compared to the control (Welch test: Cpl-1 p= 0.089; Cpl-1N215D p=0.088).

[0157] Angeführte Literatur Cilloniz, C. et al. (2018) ‘Antimicrobial Resistance Among Streptococcus pneumoniae’, in Antimicrobial Resistance in the 21st Century. Cham: Springer International Publishing, pp. 13- 38. Available at: https: / / doi.org / 10.1007 / 978-3-319-78538-7_2.

[0158] Damase, T.R. et al. (2021) ‘The Limitless Future of RNA Therapeutics’, Frontiers in Bioengineering and Biotechnology, 9. Available at: https: / / doi.org / 10.3389 / fbioe.2021.628137. Diez-Martinez, R. et al. (2015) ‘A novel chimeric phage lysin with high in vitro and in vivo bactericidal activity against Streptococcus pneumoniae.’, The Journal of antimicrobial chemotherapy, 70(6), pp. 1763-1773. Available at: https: / / doi.org / 10.1093 / jac / dkv038.

[0159] Entenza, J.M. et al. (2005) ‘Therapeutic effects of bacteriophage Cpl-1 lysin against Streptococcus pneumoniae endocarditis in rats’, Antimicrobial agents and chemotherapy, 49(11), pp. 4789-4792. Available at: https: / / doi.org / 10.1128 / AAC.49. l l.4789-4792.2005.

[0160] Fowler, V.G.J. et al. (2020) ‘Exebacase for patients with Staphylococcus aureus bloodstream infection and endocarditis.’, The Journal of clinical investigation, 130(7), pp. 3750-3760. Available at: https: / / doi.org / 10.1172 / JCI136577.

[0161] Garcia, J.L. et al. (1987) ‘Cloning, purification, and biochemical characterization of the pneumococcal bacteriophage Cp-1 lysin.’, Journal of virology, 61(8), pp. 2573-2580. Available at: https: / / doi.org / 10.1128 / JVI.6L8.2573-2580.1987.

[0162] Guevara, M.L., Persano, F. and Persano, S. (2020) ‘Advances in Lipid Nanoparticles for mRNA- Based Cancer Immunotherapy’, Frontiers in Chemistry, 8. Available at: https: / / doi.org / 10.3389 / fchem.2020.589959.

[0163] Harhala, M. et al. (2018) ‘Safety Studies of Pneumococcal Endolysins Cpl-1 and Pal’, Viruses, 10(11), p. 638. Available at: https: / / doi.org / 10.3390 / vl0110638.

[0164] Loeffler, J.M., Djurkovic, S. and Fischetti, V.A. (2003) ‘Phage lytic enzyme Cpl-1 as a novel antimicrobial for pneumococcal bacteremia.’, Infection and immunity, 71(11), pp. 6199-6204. Available at: https: / / doi.org / 10.1128 / IAI.71. l l.6199-6204.2003.

[0165] Murray, E. et al. (2021) ‘The Advantages and Challenges of Using Endolysins in a Clinical Setting.’, Viruses, 13(4). Available at: https: / / doi.org / 10.3390 / vl3040680.

[0166] Ouranidis, A. et al. (2022) ‘mRNA Therapeutic Modalities Design, Formulation and Manufacturing under Pharma 4.0 Principles’, Biomedicines, 10(1). Available at: https: / / doi.org / 10.3390 / biomedicinesl0010050.

[0167] Puetz, J. and Wurm, F.M. (2019) ‘Recombinant Proteins for Industrial versus Pharmaceutical Purposes: A Review of Process and Pricing’, Processes, 7(8). Available at: https: / / doi.org / 10.3390 / pr7080476.

[0168] Roach, D.R. and Donovan, D.M. (2015) ‘Antimicrobial bacteriophage-derived proteins and therapeutic applications.’, Bacteriophage, 5(3), p. el 062590. Available at: https: / / doi.org / 10.1080 / 21597081.2015.1062590.

[0169] Rodriguez-Cerrato, V. et al. (2007) ‘Pneumococcal LytA autolysin, a potent therapeutic agent in experimental peritonitis-sepsis caused by highly beta-lactam-resistant Streptococcus pneumoniae’, Antimicrobial agents and chemotherapy . 2007 / 06 / 18, 51(9), pp. 3371-3373.

[0170] Available at: https: / / doi.org / 10.1128 / AAC.00137-07.

[0171] Schrom, E. et al. (2017) ‘Translation of Angiotensin-Converting Enzyme 2 upon Liver- and Lung-Targeted Delivery of Optimized Chemically Modified mRNA.’, Molecular therapy. Nucleic acids, 7, pp. 350-365. Available at: https: / / doi.Org / 10.1016 / j.omtn.2017.04.006.

[0172] Wahl, B. et al. (2018) ‘Burden of Streptococcus pneumoniae and Haemophilus influenzae type b disease in children in the era of conjugate vaccines: global, regional, and national estimates for 2000-15’, The Lancet Global Health, 6(7), pp. e744-e757. Available at: https : / / doi . org / 10.1016 / S2214- 109X( 18)30247-X. Weng, Y. et al. (2020) ‘The challenge and prospect of mRNA therapeutics landscape.’, Biotechnology advances, 40, p. 107534. Available at: https: / / doi.Org / 10.1016 / j.biotechadv.2020.107534.

Claims

Patent claims 1. A polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use as a medicament.

2. A polynucleotide comprising an endolysin-encoding ribonucleic acid or an autolysin-encoding ribonucleic acid for use in the treatment and / or prevention of a bacterial infection, wherein the bacterial infection is preferably a Streptococcus infection, in particular a Streptococcus pneumoniae infection.

3. Polynucleotide for use according to claim 1 or 2, wherein the endolysin-encoding ribonucleic acid or the autolysin-encoding ribonucleic acid comprises a polynucleotide sequence which is at least 70% identical to the sequence according to SEQ ID NO. 1, or at least 70% identical to the sequence according to SEQ ID NO. 2, or at least 70% identical to the sequence according to SEQ ID NO. 3, or at least 70% identical to the sequence according to SEQ ID NO.

4.

4. A polynucleotide for use according to claim 3, further comprising a 5' UTR sequence.

5. A polynucleotide for use according to claim 3, further comprising a sequence encoding a signal peptide.

6. Polynucleotide for use according to any one of claims 3 to 5, further comprising a start codon and / or a stop codon.

7. A polynucleotide for use according to any one of claims 1 to 6, comprising a polynucleotide sequence which is at least 70% identical to the sequence of SEQ ID NO. 12 or 13.

8. Polynucleotide for use according to any one of claims 1 to 7, wherein the sequence identity is at least 75%, preferably at least 80%, further preferably at least 85%, further preferably at least 90%, further preferably at least 95%, further preferably at least 98%, further preferably at least 99%.

9. Polynucleotide for use according to any one of claims 1 to 8, further comprising a 5' encapsulation. Polynucleotide for use according to one of claims 1 to 9, wherein at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all uridines occurring in one of the sequences according to SEQ ID NO. 1 to 13 are replaced by NI-methyl-pseudouridine (mlT). Polynucleotide for use according to any one of claims 1 to 9, wherein at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in one of the sequences according to SEQ ID NO. 1 to 13 are replaced by 5-methylcytidine.Polynucleotide for use according to one of claims 1 to 11, wherein at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all in one of the sequences according to SEQ ID NO. 1 to 13 occurring uridines are replaced by NI-methyl-pseudouridine (m1T) and in the same sequence at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably 100% of all cytidines occurring in the sequence are replaced by 5-methylcytidine.Polynucleotide, in particular ribonucleic acid molecule, comprising, preferably consisting of, a nucleic acid sequence which is at least 70% identical to the sequence of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 12 or SEQ ID NO.

13. Pharmaceutical composition comprising a polynucleotide according to embodiment 13 and optionally one or more pharmaceutically acceptable carrier(s) and / or excipient(s).

Images