Internal ribosome entry sites for improved polynucleotide translation

Abstract

This disclosure relates to internal ribosome entry site (IRES) elements that are capable of effectuating expression of a desired polynucleotide even in the absence of a 5' cap structure. The disclosure also provides polynucleotides (e.g., RNA molecules, such as circular or linear RNA molecules) containing such IRES elements. In some embodiments of the disclosure, the IRES element contains one or more nucleic acid segments that are enriched in uridine nucleosides or modified uridine nucleosides, such as 1-methylpseudouridine nucleosides. In some embodiments, the IRES element contains one or more nucleic acid segments that feature a plurality of contiguous uridine nucleosides or modified uridine nucleosides (e.g., 1-methylpseudouridine nucleosides). The polynucleotides of the disclosure may be used to express a desired polypeptide in a subject, such as a subject having a disease or condition associated with a deficiency in the corresponding endogenous polypeptide. The polynucleotides may contain modified 5' or 3' regions that effectuate enhanced protein output and stability of the polynucleotide.

Description

[0001]PATENT ATTORNEY DOCKET NO.50858-145WO3 INTERNAL RIBOSOME ENTRY SITES FOR IMPROVED POLYNUCLEOTIDE TRANSLATION SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created December 12, 2023, is named “50858-145WO3_Sequence_Listing_12_12_23” and is 301,380 bytes in size. BACKGROUND The use of exogenous nucleic acids has become a particularly effective strategy for delivering polypeptides of interest to a target cell, tissue, or organism, as a single protein-encoding nucleic acid can be translated to yield multiple copies of a desired polypeptide, allowing the administration of a small quantity of nucleic acid to achieve high levels of protein expression. As the nucleic acid therapeutic field has grown, steps have been taken to improve the pharmacokinetic properties of nucleic acid molecules. For example, efforts to further augment the half-lives of nucleic acid molecules, such as protein-encoding RNA molecules, have led to modifications that render nucleic acids less susceptible to nucleolytic degradation. Examples of these modifications are the inclusion of 5’ and / or 3’ chemical groups that sterically restrict the access of exonucleases to the 5’ and / or 3’ end of a nucleic acid, as well as nucleic acid circularization, which altogether removes the 5’ and 3’ ends that would otherwise be available for an exonuclease to engage and cleave. Although the foregoing modifications promote nucleic acid stability by mitigating nucleolytic degradation, these modifications generally preclude the inclusion of a 5’ cap structure. 5’ cap structures are often included in protein-encoding nucleic acid (e.g., RNA) molecules, as the 5’ cap promotes ribosome binding and, thus, protein translation. Accordingly, although modifications such as 5’ / 3’ blocking and circularization may confer the benefit of reduced exonuclease-mediated degradation, these modifications may hinder ribosomal recruitment due to the absence of a 5’ cap. There exists a need for improved strategies for effectuating ribosomal entry and the initiation of protein translation, particularly in nucleic acid molecules that lack a 5’ cap. SUMMARY The present disclosure features nucleic acid molecules, such as linear and circular RNA molecules, that are capable of recruiting and binding to ribosomes in a manner that is independent of a 5’ cap structure. Without being limited by mechanism, nucleic acid molecules generally employ 5’ cap structures in order to promote ribosomal binding and, thus, translation of an encoded protein. The presence of a 5’ cap that is susceptible to decapping – which, in turn, triggers subsequent degradation of the RNA – precludes the possibility of adding certain chemical modifications that extend the molecule’s half-life. Examples of these types of modifications include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. PATENT ATTORNEY DOCKET NO.50858-145WO3 However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap. The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in a manner that is independent of the presence of a 5’ cap. Significantly, the IRES elements of the disclosure can be used in nucleic acids (e.g., RNA molecules) that either lack or contain a 5’ cap, as the present IRES elements confer advantages to both types of molecules. For example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear or circular RNA molecule) that lacks a 5’ cap, thereby providing a means by which the nucleic acid molecule may be bound – and translated – by a ribosome, notwithstanding the absence of a 5’ cap structure that would, ordinarily, be regarded as important for the onset of protein biosynthesis. In another example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear RNA) that contains a 5’ cap. In this setting, the IRES element may provide the benefit of a means by which the nucleic acid may be translated even after the 5’ cap is removed by way of endogenous decapping processes. In this way, the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression. Nucleic acids containing the IRES elements described herein may also contain a modified 5’ region and / or a modified 3’region. These modified regions may include, for example, at least one modified sugar (e.g., at least one modified ribose), at least one modified internucleoside linkage (e.g., at least one phosphorothioate), and / or a modified terminal group (e.g., a modified phosphate or an inverted nucleobase), or any combination of these modifications. The modifications of the 5’ or 3’ region may include any of the modifications described in the sections that follow. These modifications may be installed into the nucleic acid molecules of the disclosure by any of a variety of methods, for example, co-transcriptionally or by way of ligation. The nucleic acid molecules may be of any length. The modification of the 5’ end or 3’ end of the nucleic acid molecule (e.g., RNA) of the disclosure may have a beneficial impact on (i) the stability of the nucleic acid molecule, (ii) the immunogenicity of the nucleic acid molecule, (iii) extracellular and intracellular interactions of the nucleic acid molecule, and / or (iv) translation of the nucleic acid molecule. These beneficial improvements may lead to an increased output of expressed protein. In one aspect, the disclosure provides a nucleic acid comprising: (i) a modified 5’ region and / or a modified 3’ region; and (ii) an internal ribosome entry site (IRES) operably linked to an open reading frame encoding a polypeptide. In some embodiments, the nucleic acid does not comprise a 5’ cap. In some embodiments, the nucleic acid is translatable in the absence of a 5’ cap. In some embodiments, the IRES comprises one or more polynucleotide tracts enriched in uridine or modified uridine. In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). In some embodiments, the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in PATENT ATTORNEY DOCKET NO.50858-145WO3 uridine or a modified uridine. In some embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length. In some embodiments, each polynucleotide tract, independently, comprises from 5 to 20 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 11 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises at least 9 contiguous pyrimidine- containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises 9 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1-methylpseudouridine. In other embodiments, the modified uridine is pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6- aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio- pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy- uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5- aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5- methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl- uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In preferred embodiments, the modified uridine is 1-methylpseudouridine. In some embodiments, the IRES is 100% modified at uridine, and the modification consists of 1-methylpseudouridine. In some embodiments, the entire mRNA, including the IRES, is 100% modified at uridine, and the modification consists of 1-methylpseudouridine. In some embodiments, the IRES does not contain a chemical modification at uridine. In some embodiments, the IRES does not contain a chemical modification at any of the nucleosides therein. In some embodiments, the IRES is located within a noncoding region of the nucleic acid. For example, the IRES may be located within a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR. In some embodiments, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, PATENT ATTORNEY DOCKET NO.50858-145WO3 independently, comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 nucleosides. In some embodiments, the IRES is represented by the formula: [(N)n – (U’)m]p wherein: each N is, independently, any nucleoside residue; each U’ is, independently, a pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides), preferably wherein each U’ is, independently, uridine or a modified uridine, even more preferably wherein each U’ is, independently, modified uridine (e.g., 1- methylpseudouridine); each n is, independently, an integer from 1 to 100 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). In some embodiments, N is, independently, selected from uridine, a modified uridine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine. In some embodiments, the modified uridine of N is 1-methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2- thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl- 4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl- pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio- dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3- carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5- (isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O- methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5- methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl-uridine, 5- carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5-(isopentenylaminomethyl)- PATENT ATTORNEY DOCKET NO.50858-145WO3 2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐ (2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo- cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4- methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl-cytidine, 5,2′-O-dimethyl- cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl-2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐cytidine. In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl-adenosine, N6,N6,2′- O-trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐adenosine, or N6‐(19‐amino‐pentaoxanonadecyl)-adenosine. In some embodiments, the modified guanosine of N is inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7- cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl- guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6- thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl-guanosine, N2- methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl-guanosine, 1-methyl-2′-O-methyl- guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl-inosine, 2′-O- ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, or 2’‐F‐guanosine. In some embodiments, the modified uridine of U’ is 1-methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- PATENT ATTORNEY DOCKET NO.50858-145WO3 uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2- thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl- 4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl- pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio- dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3- carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5- (isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O- methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5- methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl-uridine, 5- carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5-(isopentenylaminomethyl)- 2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐ (2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 11. In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6. In some embodiments, the IRES contains three polynucleotide tracts, each of the three polynucleotide tracts having 9 contiguous 1-methylpseudouridine residues, and each tract separated from one another by two 13-nucleoside spacers. In some embodiments, the IRES has the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the IRES is a CVB3 IRES. In some embodiments, the IRES is a Sali IRES. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading frame consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, thymidine, a modified thymidine, cytidine, and a modified cytidine. In some embodiments, the open reading frame consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine. In some embodiments, the modified uridine of the open reading frame is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- PATENT ATTORNEY DOCKET NO.50858-145WO3 thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1-methylpseudouridine. In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo- cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4- methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl-cytidine, 5,2′-O-dimethyl- cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl-2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐cytidine. In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- PATENT ATTORNEY DOCKET NO.50858-145WO3 dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl-adenosine, N6,N6,2′- O-trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐adenosine, or N6‐(19‐amino‐pentaoxanonadecyl)-adenosine. In some embodiments, the modified guanosine of N is inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7- cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl- guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6- thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl-guanosine, N2- methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl-guanosine, 1-methyl-2′-O-methyl- guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl-inosine, 2′-O- ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, or 2’‐F‐guanosine. In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen- binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein. In some embodiments, the nucleic acid does not comprise a 5’ cap. In another aspect, the disclosure provides a nucleic acid comprising: (i) a modified 5’ region and / or a modified 3’ region; and (ii) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (eIF4G), eukaryotic translation initiation factor 4G2 (eIF4G2, also referred to as Dap5),eukaryotic translation initiation factor 3 (eIF3) La), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP) or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to (iii) an open reading frame encoding a polypeptide. In some embodiments, the one or more polynucleotides specifically bind eIF4G, eIF4G2, eIF3, La protein, or an ITAF, such as PTBP. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, PATENT ATTORNEY DOCKET NO.50858-145WO3 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, each U residue in SEQ ID NO: 1 is replaced with a modified uridine, such as 1-methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza- uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, each U residue in SEQ ID NO: 1 is replaced with 1-methylpseudouridine. In some embodiments, the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. As a non-limiting example, the RNA- binding protein may be an MS2-binding protein, and the one or more polynucleotides may comprise one or more MS2 RNA hairpins. In some embodiments, the IRES comprises a plurality of polynucleotides that specifically bind a translation initiation factor (for example, eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. In some embodiments, the IRES comprises from 2 to 20 polynucleotides that specifically bind a translation initiation factor (for example, eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, PATENT ATTORNEY DOCKET NO.50858-145WO3 19, or 20 polynucleotides that specifically bind a translation initiation factor (for example, eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf, such as PTBP) fused to an RNA- binding protein). In some embodiments, the IRES comprises from 2 to 10 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein). In some embodiments, the IRES comprises from 3 to 9 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein (e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein). In some embodiments, the IRES comprises from 4 to 8 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein (e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein). In some embodiments, the IRES comprises from 5 to 7 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein (e.g., 5, 6, or 7 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein). In some embodiments, the IRES comprises 2 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 3 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 4 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 5 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 6 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 7 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 8 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 9 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 10 polynucleotides that specifically bind (a) eIF4G, (b) La protein, or (c) a fusion protein comprising eIF4G or La fused to an RNA-binding protein. In some embodiments, the nucleic acid does not comprise a 5’ cap. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of any of the nucleic acids described herein, the nucleic acid includes a modified 5’ region. In some embodiments of any of the nucleic acids described herein, the nucleic acid includes a modified 3’ region. In some embodiments of the modified 5’ region and / or the modified 3’ region, the region has at least one (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more) modifications selected from a terminal group, a modified internucleoside linkage, an internal linker, and a modified ribose. In some embodiments, the modified 5’ region and / or the modified 3’ region has at least one (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, or more) modified ribose. In some embodiments, at least one modified ribose is selected from a 2’-deoxyribose, a 2’-OMe ribose, a 2’-O- methoxyethyl ribose (2’-MOE), a 2’-F ribose, a 2’-NH2 ribose, a 2’fluoroarabino ribose (FANA), a locked nucleic acid (LNA), or a 4’-S ribose. In some embodiments, at least one modified ribose is selected from a 2’-methoxy ribose, an LNA, or a deoxyribose. In some embodiments, at least one modified ribose is an LNA. In some embodiments, at least one modified ribose is a 2’-deoxyribose. In some embodiments, at least one modified ribose is a 2’-methoxy ribose. In some embodiments, at least one modified ribose is a 2’-O-methoxyethyl ribose. In some embodiments, at least one modified ribose is a 2’-fluoro ribose. In some embodiments, the modified 5’ region and / or the modified 3’ region has at least one (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, or more) modified internucleoside linkages. In some embodiments, at least one modified internucleoside linkage is a phosphorothioate, a phosphoroselenate, a boranophosphate, a boranophosphate ester, a hydrogen phosphonate, a phosphoramidate, a phosphorodiamidate, an alkyl phosphonate, an aryl phosphonate, a phosphotriester, a phosphorodithioate, a bridged phosphoramidate, a bridged phosphorothioate, a bridged methylene-phosphonate, or an α-thio phosphate. In particular embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, the modified 5’ region and / or the modified 3’ region includes a terminal group. In some embodiments, the terminal group is a 5' triphosphate, a 5’ phosphate, a 5’ hydroxyl, a biotinylated group, an inverted nucleobase, an alkyl or heteroalkyl group (e.g., spacer 18), cap1, or a poly adenosine. In some embodiments, the terminal group is a 5’ triphosphate. In some embodiments, the terminal group is a 5’ hydroxyl. In some embodiments, the terminal group is Cap1. In some embodiments, the terminal group is spacer 18. In some embodiments, the terminal group is a 5’ phosphate. In some embodiments, the terminal group is a linear or branched alkyl chain having from 1 to 50 atoms (e.g., 1 to 40, 1 to 30, 1 to 20, 1 to 10, 10 to 20, 10 to 30, 10 to 40, 20 to 40, or 20 to 30 atoms). In some embodiments, the terminal group is a linear or branched heteroalkyl chain having from 1 to 50 atoms (e.g., 1 to 40, 1 to 30, 1 to 20, 1 to 10, 10 to 20, 10 to 30, 10 to 40, 20 to 40, or 20 to 30 atoms). In some embodiments, the heteroalkyl group is a polyethylene glycol chain (e.g., diethylene glycol, triethylene glycol, tetraethylene glycol, pentaethylene glycol, or hexaethylene glycol). PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the linear or branched heteroalkyl chain contains one or more oxygen atoms. In some embodiments, the linear or branched heteroalkyl chain contains one or more nitrogen atoms. In some embodiments, the linear or branched heteroalkyl chain contains one or more sulfur atoms. In some embodiments, the heteroalkyl group has the structure: wherein z is an integer from 1 to 50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50). In some embodiments, z is an integer from 1 to 40 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40). In some embodiments, z is an integer from 1 to 30 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). In some embodiments, z is an integer from 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). In some embodiments, z is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, z is an integer from 10 to 40 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40). In some embodiments, z is an integer from 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). In some embodiments, z is an integer from 10 to 20 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). In some embodiments, z is 1. In some embodiments, z is 2. In some embodiments, z is 3. In some embodiments, z is 4. In some embodiments, z is 5. In some embodiments, z is 6. In some embodiments, z is 7. In some embodiments, z is 8. In some embodiments, z is 9. In some embodiments, z is 10. In some embodiments, z is 11. In some embodiments, z is 12. In some embodiments, the heteroalkyl group is a polyethylene glycol chain. In some embodiments, the heteroalkyl group has the structure: wherein y is an integer from 1 to 50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50). In some embodiments, y is an integer from 1 to 40 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40). In some embodiments, y is an integer from 1 to 30 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). In some embodiments, y is an integer from 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). In some embodiments, y is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, y is 2. In some embodiments, y is 3. In some embodiments, y is 4. In some embodiments, y is 5. In some embodiments, y is 6. In some embodiments, y is 7. In some embodiments, y is 8. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the terminal group is: . In some embodiments, the terminal group is: In some embodiments, the terminal group is . some group an some the inverted nucleobase is an inverted deoxythymidine. In some embodiments, the inverted nucleobase has the structure of Formula XI: or a salt thereof; wherein each X is, independently O or S; and A represents adenine and T represents thymine. In some embodiments of Formula XI, each X is O. In some embodiments of Formula XI, each X is S. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of the nucleic acid molecules described herein, the modified 5’ region and / or the modified 3’ region contains an internal linker. In some embodiments, the internal linker contains a linear or branched alkyl chain (e.g., a C1-C12 alkyl chain). In some embodiments, the internal linker contains a linear or branched heteroalkyl chain. In some embodiments, the internal linker contains a linear or branched heteroalkyl chain is a polyethylene glycol chain. In some embodiments, the internal linker has the following structure: . In some embodiments, the internal linker has the following structure: . In some embodiments, the internal linker has the following structure: . In some embodiments the modified 5’ region and / or the modified 3’ region has the structure of Formula XLIX: Q-N1-L1-N2-(L2)a-(N3)b-(L3)c-(N4)d-(L4)e-(N5)f-(L5)g-(N6)h-Z Formula XLIX wherein Q is a terminal group; Z is a bond between the 5’ region or the 3’ region and the rest of the nucleic acid each of N1, N2, N3, N4, N5, and N6 is, independently, a nucleoside or a modified nucleoside; each of L1, L2, L3, L4, and L5 is, independently, an internucleoside linkage; and each of a, b, c, d, e, f, g, and h is, independently, 0 or 1. In some embodiments of Formula XLIX, a is 0. In some embodiments of Formula XLIX, a is 1. In some embodiments of Formula XLIX, b is 0. In some embodiments of Formula XLIX, b is 1. In some embodiments of Formula XLIX, c is 0. In some embodiments of Formula XLIX, c is 1. In some embodiments of Formula XLIX, d is 0. In some embodiments of Formula XLIX, d is 1. In some embodiments of Formula XLIX, e is 0. In some embodiments of Formula XLIX, e is 1. In some embodiments of Formula XLIX, f is 0. In some embodiments of Formula XLIX, f is 1. In some embodiments of Formula XLIX, g is 0. In some embodiments of Formula XLIX, g is 1. In some embodiments of Formula XLIX, h is 0. In some embodiments of Formula XLIX, h is 1. In some embodiments, Q is a 5’ triphosphate. In some embodiments, Q is a 5’ phosphate. In some embodiments, Q is spacer 18. In some embodiments, Q is cap1. In some embodiments, Q is PATENT ATTORNEY DOCKET NO.50858-145WO3 hydroxyl. In some embodiments, Q is biotinylated group. In some embodiments, Q is inverted deoxythymidine. In some embodiments, Q is a linear or branched alkyl chain having from 1 to 50 atoms (e.g., 1 to 40, 1 to 30, 1 to 20, 1 to 10, 10 to 20, 10 to 30, 10 to 40, 20 to 40, or 20 to 30 atoms). In some embodiments, Q is a linear or branched heteroalkyl chain having from 1 to 50 atoms (e.g., 1 to 40, 1 to 30, 1 to 20, 1 to 10, 10 to 20, 10 to 30, 10 to 40, 20 to 40, or 20 to 30 atoms). In some embodiments, the heteroalkyl group is a polyethylene glycol chain (e.g., diethylene glycol, triethylene glycol, tetraethylene glycol, pentaethylene glycol, or hexaethylene glycol). In some embodiments, the linear or branched heteroalkyl chain contains one or more oxygen atoms. In some embodiments, the linear or branched heteroalkyl chain contains one or more nitrogen atoms. In some embodiments, the linear or branched heteroalkyl chain contains one or more sulfur atoms. . In some embodiments, Q is . In some In some In some modified guanosine, adenosine, modified adenosine, cytosine, or modified cytosine. In some embodiments, N1 is guanosine. In some embodiments, N1 is modified guanosine. In some embodiments, N1 is adenosine. In some embodiments, N1 is modified adenosine. In some embodiments, N1 is cytosine. In some embodiments, N1 is modified cytosine. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, N2 is guanosine. In some embodiments, N2 is modified guanosine. In some embodiments, N2 is adenosine. In some embodiments, N2 is modified adenosine. In some embodiments, N2 is cytosine. In some embodiments, N2 is modified cytosine. In some embodiments, N3 is guanosine. In some embodiments, N3 is modified guanosine. In some embodiments, N3 is adenosine. In some embodiments, N3 is modified adenosine. In some embodiments, N3 is cytosine. In some embodiments, N3 is modified cytosine. In some embodiments, N4 is guanosine. In some embodiments, N4 is modified guanosine. In some embodiments, N4 is adenosine. In some embodiments, N4 is modified adenosine. In some embodiments, N4 is cytosine. In some embodiments, N4 is modified cytosine. In some embodiments, N5 is guanosine. In some embodiments, N5 is modified guanosine. In some embodiments, N5 is adenosine. In some embodiments, N5 is modified adenosine. In some embodiments, N5 is cytosine. In some embodiments, N5 is modified cytosine. In some embodiments, N6 is guanosine. In some embodiments, N6 is modified guanosine. In some embodiments, N6 is adenosine. In some embodiments, N6 is modified adenosine. In some embodiments, N6 is cytosine. In some embodiments, N6 is modified cytosine. In some embodiments, each of N1, N2, N3, N4, N5, and N6 is, independently, an unmodified ribonucleoside, a 2’-deoxy ribonucleoside, a 2’-methoxy ribonucleoside, or a locked nucleic acid (LNA). In some embodiments, N1 is an unmodified ribonucleoside. In some embodiments, N1 is a 2’-methoxy ribonucleoside. In some embodiments, N1 is a 2’-deoxyribonucleoside. In some embodiments, N1 is an LNA. In some embodiments, N2 is an unmodified ribonucleoside. In some embodiments, N2 is a 2’-methoxy ribonucleoside. In some embodiments, N2 is a 2’-deoxyribonucleoside. In some embodiments, N2 is an LNA. In some embodiments, N3 is an unmodified ribonucleoside. In some embodiments, N3 is a 2’-methoxy ribonucleoside. In some embodiments, N3 is a 2’-deoxyribonucleoside. In some embodiments, N3 is an LNA. In some embodiments, N4 is an unmodified ribonucleoside. In some embodiments, N4 is a 2’-methoxy ribonucleoside. In some embodiments, N4 is a 2’-deoxyribonucleoside. In some embodiments, N4 is an LNA. In some embodiments, N5 is an unmodified ribonucleoside. In some embodiments, N5 is a 2’-methoxy ribonucleoside. In some embodiments, N5 is a 2’-deoxyribonucleoside. In some embodiments, N5 is an LNA. In some embodiments, N6 is an unmodified ribonucleoside. In some embodiments, N6 is a 2’-methoxy ribonucleoside. In some embodiments, N6 is a 2’-deoxyribonucleoside. In some embodiments, N6 is an LNA. In some embodiments, each of L1, L2, L3, L4, and L5 is, independently, a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. In some embodiments, each of L1 and L2 are a phosphorothioate internucleoside linkage. In some embodiments, L4 and L5 are phosphodiester internucleoside linkages. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, L1 is a phosphodiester internucleoside linkage. In some embodiments, L1 is a phosphorothioate internucleoside linkage. In some embodiments, L2 is a phosphodiester internucleoside linkage. In some embodiments, L2 is a phosphorothioate internucleoside linkage. In some embodiments, L3 is a phosphodiester internucleoside linkage. In some embodiments, L3 is a phosphorothioate internucleoside linkage. In some embodiments, L4 is a phosphodiester internucleoside linkage. In some embodiments, L4 is a phosphorothioate internucleoside linkage. In some embodiments, L5 is a phosphodiester internucleoside linkage. In some embodiments, L5 is a phosphorothioate internucleoside linkage. In some embodiments, L6 is a phosphodiester internucleoside linkage. In some embodiments, L6 is a phosphorothioate internucleoside linkage. In some embodiments, the 5’ region has the sequence of an initiator oligonucleotide. The initiator oligonucleotide, in some embodiments, includes an adenine-guanine (AG) dinucleotide. For example, in some embodiments, the two nucleotides at the 3’ end of an initiator oligonucleotide are an AG dinucleotide. In some embodiments, an initiator oligonucleotide comprises a nucleotide sequence selected from GCAAG (SEQ ID NO: 173), GGCAG (SEQ ID NO: 174), GCGAG (SEQ ID NO: 175), GCAGG (SEQ ID NO: 176), GGCGCAG (SEQ ID NO: 177), and GGCGCGCAG (SEQ ID NO: 178). In some embodiments, an initiator oligonucleotide comprising an AG dinucleotide comprises the nucleic acid sequence of [N]X1-AG-[N]X2, wherein N is any nucleotide, X1 is a number from 1 to 20, and X2 is a number from 0 to 2. In some embodiments, an initiator oligonucleotide comprises a nucleotide sequence selected from NNAG (SEQ ID NO: 179), NNNAG (SEQ ID NO: 180), NNNNAG (SEQ ID NO: 181), NNNNNGG (SEQ ID NO: 182), NNNNNNAG (SEQ ID NO: 183), NNNNNNNAG (SEQ ID NO: 184), and NNNNNNNNAG (SEQ ID NO: 185), wherein N is any nucleotide. In some embodiments, the modified 5’ region has one of the following structures, in the 5’ to 3’ direction: Table 12. Exemplary 5’ regions PATENT ATTORNEY DOCKET NO.50858-145WO3 wherein PPP is a triphosphate, biotin is a biotinylated group, Sp18 is spacer 18, P is a phosphate, idT is inverted deoxythymidine, A is adenosine, G is guanosine, C is cytosine, mA is 2’- methoxy adenosine, mG is 2’-methoxy guanosine, mC is 2’-methoxy cytosine, dG is 2’-deoxy guanosine, dA is 2’-deoxy adenosine, LA is an LNA adenosine, LG is an LNA guanosine, LC is an LNA cytosine, O is a phosphodiester internucleoside linkage, S is a phosphorothioate internucleoside linkage, and Z is a bond to the rest of the nucleic acid. In some embodiments, the 5’ region has the structure of Formula A1. In some embodiments, the 5’ region has the structure of Formula A2. In some embodiments, the 5’ region has the structure of Formula A3. In some embodiments, the 5’ region has the structure of Formula A4. In some embodiments, the 5’ region has the structure of Formula A5. In some embodiments, the 5’ region has the structure of Formula A6. In some embodiments, the 5’ region has the structure of Formula A7. In some embodiments, the 5’ region has the structure of Formula A8. In some embodiments, the 5’ region has the structure of Formula A9. In some embodiments, the 5’ region has the structure of Formula A10. In some embodiments, the 5’ region has the structure of Formula A11. In some embodiments, the 5’ region has the structure of Formula A12. In some embodiments, the 5’ region has the structure of Formula A13. In some embodiments, the 5’ region has the structure of Formula A14. In some embodiments, the 5’ region has the structure of Formula A15. In some embodiments, the 5’ region has the structure of Formula A16. In some embodiments, the 5’ region has the structure of Formula A17. In some embodiments, the 5’ region has the structure of Formula A18. In some embodiments, the 5’ region has the structure of Formula A19. In some embodiments, the 5’ region has the structure of Formula A20. In some embodiments, the 5’ region has the structure of Formula A21. In some embodiments, the 5’ region has the structure of Formula A22. In some embodiments, the 5’ region has the structure of Formula A23. In some embodiments, the 5’ region has the structure of Formula A24. In some embodiments, the 5’ region has the structure of Formula A25. In some embodiments, the 5’ region has the structure of Formula A26. In some embodiments, the 5’ region PATENT ATTORNEY DOCKET NO.50858-145WO3 has the structure of Formula A27. In some embodiments, the 5’ region has the structure of Formula A28. In some embodiments, the 5’ region has the structure of Formula A29. In some embodiments, the 5’ region has the structure of Formula A30. In some embodiments, the 5’ region has the structure of Formula A31. In some embodiments, the 5’ region has the structure of Formula A32. In some embodiments, the 5’ region has the structure of Formula A33. In some embodiments, the 5’ region has the structure of Formula A34. In some embodiments, the 5’ region has the structure of Formula A34. In some embodiments, the 5’ region has the structure of Formula A35. In some embodiments, the 5’ region has the structure of Formula A36. In some embodiments, the 5’ region has the structure of Formula A37. In some embodiments, the 5’ region has the structure of Formula A38. In some embodiments, the modified 3’ region is inverted deoxythymidine. In a further aspect, the disclosure provides a polypeptide expression system comprising: (i) the nucleic acid of either of the foregoing aspects (or any of the above embodiments thereof); and (ii) a nucleic acid comprising an open reading frame that encodes eIF4G, La protein, or a functional variant thereof. In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules. In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’: (i) a 5’ UTR; (ii) the open reading frame encoding the eIF4G, La protein, or functional variant thereof; and (iii) a 3’ UTR. In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR. In a further aspect, the disclosure provides a host cell comprising the nucleic acid or polypeptide expression system of any one of the above aspects or embodiments of the disclosure. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In another aspect, the disclosure provides a method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure. In another aspect, the disclosure provides a method of expressing a polypeptide in a cell or population of cells, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure. In another aspect, the disclosure provides a method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure, with the proviso that the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition. PATENT ATTORNEY DOCKET NO.50858-145WO3 DEFINITIONS In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. The present disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. In this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. The terms “a” (or “an”), as well as the terms “one or more,” and “at least one” can be used interchangeably herein. In certain aspects, the term “a” or “an” means “single.” In other aspects, the term “a” or “an” includes “two or more” or “multiple.” Furthermore, “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show,2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology,3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of” and / or “consisting essentially of” are also provided. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the present disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be PATENT ATTORNEY DOCKET NO.50858-145WO3 understood that values which are about the same quantity or amount as the recited value are also within the scope of the present disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the present disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed. As used herein, the term “about” refers to a value that is no more than 10% above or below the value being described. For example, the term “about 5 nM” indicates a range of from 4.5 nM to 5.5 nM. As used herein, the term “biocompatible” means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system. As used herein, the term “biodegradable” means capable of being broken down into innocuous products by the action of living things. As used herein, the phrase “biologically active” refers to a characteristic of any substance that has activity in a biological system and / or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present disclosure can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant. As used herein, the term “biotinylated group” refers to a group at the 5’ end of a nucleic acid that is attached to a biotin moiety by way of a linker. Exemplary biotinylated groups include compounds of the following structure: , wherein the wavy line represents a point of attachment to the nucleic acid molecule. The point of attachment may be a direct or indirect point of attachment. The group may be attached by a linkage, such as a phosphodiester or phosphorothioate linkage. PATENT ATTORNEY DOCKET NO.50858-145WO3 As used herein, the term “amino acid substitution” refers to the replacement of an amino acid residue present in a parent or reference polypeptide (e.g., a target polypeptide described herein) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a “substitution at position X” refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the scheme AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In some aspects, substitution patterns can be described according to the scheme An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position n, and Y and Z are alternative substituting amino acid residue. In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) may be conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue may be conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid. As used herein, the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and / or steric volume. These properties are summarized for each of the twenty naturally-occurring amino acids in Table 1 below. Table 1. Representative physicochemical properties of naturally-occurring amino acids PATENT ATTORNEY DOCKET NO.50858-145WO3 From this table it is appreciated that the conservative amino acid families include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. A conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg). As used herein, the term “conjugate” refers to a compound formed by the chemical bonding of a reactive functional group of one molecule with an appropriately reactive functional group of another molecule. Conjugates may additionally be produced, e.g., as two polypeptide domains covalently bound to one another as part of a single polypeptide chain that is synthesized by the translation of a single RNA transcript encoding both polypeptides in frame with one another. As used herein, the term “sequence optimization” refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity. In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by the codon optimized nucleotide sequence with respect to the polypeptide encoded by the reference nucleotide sequence. As used herein, the terms “codon substitution” or “codon replacement” in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a “substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon. PATENT ATTORNEY DOCKET NO.50858-145WO3 As used herein, the terms "coding region" and "region encoding" and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein. As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition. As used herein, the term “delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition. As used herein, "delivery agent" refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells. As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an mRNA template from a DNA sequence (e.g., by transcription); (2) processing of an mRNA transcript (e.g., by splicing, editing, 5′ cap formation, and / or 3′ end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein. As used herein, the term “lipid nanoparticle” refers to a transfer vehicle including one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids). Exemplary lipid nanoparticles are formulated to deliver one or more mRNA to one or more target cells. Examples of suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides). Lipid nanoparticles may contain a cationic lipid, or a lipid species with a net positive charge at a selected pH (e.g., physiological pH), to encapsulate and / or enhance the delivery of mRNA into the target cells. As used herein, the term “helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). Typically, the helper lipid is a phospholipid. A function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and / or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP. As used herein, the term “ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. PATENT ATTORNEY DOCKET NO.50858-145WO3 Such ionizable amino lipids include, but are not limited to dLin-MC3-DMA (MC3), (13Z,165Z)-N,N- dimethyl-3-nonydocosa-13-16-dien-1-amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound I-1, Compound I-2, Compound I-3, or Compound I- VI). As used herein, a "linker" refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof., Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and / or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis. As used herein, the terms “messenger RNA” or “mRNA” refer to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Traditionally, the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail. As used herein the term "modified" refers to a changed state or structure of a molecule of the present disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and / or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and / or C. Examples of “modified” nucleosides are provided herein. As used herein, the terms “modified messenger RNA” or “modified mRNA” refer to mRNA polynucleotides that include naturally occurring and / or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone). Non-natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties. The modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar. The modification may be introduced with chemical synthesis or with a polymerase PATENT ATTORNEY DOCKET NO.50858-145WO3 enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified. As used herein, the term “modified 5’ region” or “modified 3’ region” refers to a region of a nucleic acid at the 5’ or 3’ end, respectively, that contains at least one chemical modification compared to an unmodified RNA. The modifications of the 5’ region or 3’ region may be any of the nucleic acid modifications described herein, for example, a terminal group (e.g., a triphosphate, phosphate, cap1, a spacing group such as spacer 18, biotinylated phosphate), a modified internucleoside linkage (e.g., phosphorothioate), or a modified ribose (e.g., 2’-deoxyribose, 2’- methoxyribose, LNA). In some embodiments, the 5’ region or the 3’ region is from 1 to 20 nucleotides in length. In some embodiments, the 5’ region or the 3’ region is from 1 to 10 nucleotides in length. In some embodiments, the 5’ region or the 3’ region is between 1 and 7 nucleotides in length. In some embodiments, the 5’region is 5 nucleotides in length. In some embodiments, the 5’ region is 6 nucleotides in length. In some embodiments, the 3’ region is 1 nucleotide in length. As used herein, "unmodified" refers to any substance, compound, or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification. Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via an N1- glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine." The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence). The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and / or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable. A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high PATENT ATTORNEY DOCKET NO.50858-145WO3 uridine codon can be replaced with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied. As used herein, the terms "uridine enriched" and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). As used herein, the terms "uridine rarefied" and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). As used herein, the term “initiation codon”, used interchangeably with the term “start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as “alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met- tRNAiMet) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”. The initiation codon plays an important role in translation initiation. The initiation codon is the first codon of an open reading frame that is translated by the ribosome. Typically, the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides. The initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; eIFs). The current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5′ cap) to the initiation codon by scanning nucleotides in a 5′ to 3′ direction until the first AUG codon that resides PATENT ATTORNEY DOCKET NO.50858-145WO3 within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241). Scanning by the PIC ends upon complementary base-pairing between nucleotides comprising the anticodon of the initiator Met-tRNAiMettransfer RNA and nucleotides comprising the initiation codon of the mRNA. Productive base-pairing between the AUG codon and the Met-tRNAiMetanticodon elicits a series of structural and biochemical events that culminate in the joining of the large 60S ribosomal subunit to the PIC to form an active ribosome that is competent for translation elongation. The term “Kozak sequence” (also referred to as “Kozak consensus sequence”) refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5′ UTR. The Kozak consensus sequence was originally defined as the sequence GCCRCC (SEQ ID NO: 2), where R = a purine, following an analysis of the effects of single mutations surrounding the initiation codon (AUG) on translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof. (Examples of translational enhancer compositions and methods of use thereof, see U.S. Pat. No.5,807,707 to Andrews et al., incorporated herein by reference in its entirety; U.S. Pat. No.5,723,332 to Chernajovsky, incorporated herein by reference in its entirety; U.S. Pat. No.5,891,665 to Wilson, incorporated herein by reference in its entirety.) As used herein, the term “nucleobase” (alternatively “nucleotide base” or “nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and / or synthetic nucleobases, as known in the art and / or described herein, can be incorporated into nucleic acids. Unless otherwise specified, the nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil). As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and / or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. As used herein, the term “open reading frame”, abbreviated as “ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome. PATENT ATTORNEY DOCKET NO.50858-145WO3 As used herein, the term “translational regulatory activity” (used interchangeably with “translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and / or ribosome. In some aspects, the desired translation regulatory activity promotes and / or enhances the translational fidelity of mRNA translation. In some aspects, the desired translational regulatory activity reduces and / or inhibits leaky scanning. As used herein, the terms "nucleic acid" and “polynucleotide” are used interchangeably. In their broadest sense, these terms include any compound and / or substance that comprises a polymer of nucleotides. Exemplary nucleic acids or polynucleotides of the present disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a β- D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2′- amino-LNA having a 2′-amino functionalization, and 2′-amino- α-LNA having a 2′-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof. Nucleic acid molecules of the disclosure may be, for example, triple-, double-, or single- stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). This term also includes modified, for example, by alkylation, and / or by capping, and unmodified forms of the corresponding unmodified nucleic acid. In particular aspects, the nucleic acid comprises an mRNA. In other aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 1-methylpseudouridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A (adenosine), G (guanosine), C (cytidine), and T (thymidine) in the case of a synthetic DNA, or A, C, G, and U (uridine) in the case of a synthetic RNA. The skilled artisan will appreciate that the T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present disclosure. A skilled artisan would also understand that equivalent codon- maps can be generated by replacing one or more bases with non-natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ΨΨC codon (RNA map in which U has been replaced with pseudouridine). Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2, respectively, of adenosine and between the C2-oxy, N3 and C4-NH2, of cytidine and the C2-NH2, N′—H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino-6-oxy-9-β-D-ribofuranosyl-purine) PATENT ATTORNEY DOCKET NO.50858-145WO3 can be modified to form isoguanosine (2-oxy-6-amino-9-β-D-ribofuranosyl-purine). Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1-β-D-ribofuranosyl-2-oxy-4-amino-pyrimidine) to form isocytosine (1-β-D-ribofuranosyl-2-amino-4-oxy-pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine (U.S. Pat. No. 5,681,702 to Collins et al.). Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489- 10496 and references cited therein; 2′-deoxy-5-methyl-isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc.115:4461-4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem.14:5593-5601, or by the method described in U.S. Pat. No.5,780,610 to Collins et al. Other nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6-diaminopyrimidine and its complement (1-methylpyrazolo- [4,3]pyrimidine-5,7-(4H,6H)-dione. Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc.114:3675-3683 and Switzer et al., supra. Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil. In accordance with the compositions and methods disclosed herein, nucleic acids or polynucleotides may be “enriched” in certain nucleosides. As used in this context, the term “enriched” refers to a polynucleotide in which at least 50% of the nucleosides within the polynucleotide are the same. For example, a polynucleotide is said to be “enriched” in uridine if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are uridine nucleosides. In another example, a polynucleotide is said to be “enriched” in a modified uridine nucleoside (e.g., in 1- methylpseudouridine) if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are the modified uridine nucleoside (e.g., 1-methylpseudouridine). As used herein, polynucleotides that are “enriched” for certain nucleoside residues may be separated from one another by way of a spacer. In this context, a “spacer” refers to a polynucleotide that does not code for a polypeptide (i.e., does not contain a start codon operably linked to a continuous segment of amino acid-encoding codons) and that is not enriched with the same nucleoside as the enriched polynucleotide(s) adjacent to the spacer. In some embodiments, a spacer may be enriched for a different nucleoside as the enriched polynucleotide(s) adjacent to the spacer. Spacers may be, for example, from 5 to 100 nucleosides in length, such as from 10 to 40 nucleosides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in length). PATENT ATTORNEY DOCKET NO.50858-145WO3 The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some embodiments, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. As used herein, the terms “percent (%) sequence identity,” “percent (%) identity,” and the like, with respect to a reference polynucleotide or polypeptide sequence, is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows: 100 multiplied by (the fraction X / Y) PATENT ATTORNEY DOCKET NO.50858-145WO3 where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A. As used herein, the term “operatively linked” in the context of a polynucleotide fragment is intended to mean that the two polynucleotide fragments are joined such that the amino acid sequences encoded by the two polynucleotide fragments remain in-frame. As used herein, the term "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue. As used herein, the term “regulatory sequence” includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation, e.g., of open reading frames described herein. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990); incorporated herein by reference. As used herein, the phrases "signal sequence," "signal peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus, references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide. As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. As used herein in the context of a terminal group, “spacer 18” or “sp18” are used interchangeably to refers to a 5’ phosphate attached to a polyethylene glycol having the following structure: wherein the wavy line represents the point of attachment to the 5’ phosphate. PATENT ATTORNEY DOCKET NO.50858-145WO3 As used herein, the phrase “specifically binds” refers to a binding reaction which is determinative of the presence of an antigen in a heterogeneous population of proteins and other biological molecules that is recognized, e.g., by a protein or nucleic acid with particularity. A protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM. For example, a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM). A protein or nucleic acid that does not exhibit specific binding to a particular antigen or epitope thereof will exhibit a KD of greater than 100 nM (e.g., greater than 500 nm, 1 µM, 100 µM, 500 µM, or 1 mM) for that particular antigen or epitope thereof. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate. See, Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. As used herein, the terms “subject” and “patient” refer to an organism that receives treatment for a particular disease or condition. Examples of subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovidae family (such as cattle, bison, buffalo, and yaks, among others), sheep, and horses, among others. A patient that may be treated using the compositions and methods described herein may have an established disease, in which case the patient has been diagnosed as having the disease and has shown symptoms of the disease for a prolonged period of time (e.g., over the course of days, weeks, months, or years). Alternatively, a patient may be symptomatic for a particular disease, but has yet to be diagnosed with the disease by a physician. Other patients that may be treated using the compositions and methods described herein include those that have been diagnosed as having a particular disease and may or may not be showing symptoms of the disease as of yet. For example, a patient eligible for treatment with the compositions and methods described herein may be described as diagnosed but asymptomatic if the patient has received a diagnosis of a disease, even though the patient may not yet be showing symptoms thereof. As used herein, "transfection" refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and / or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. As used herein, the terms “treat” or “treatment” refer to therapeutic treatment, in which the object is to inhibit or slow down (lessen) an undesired physiological change or disorder. Beneficial or desired clinical results of treatment include, without limitation, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease PATENT ATTORNEY DOCKET NO.50858-145WO3 progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Those in need of treatment include those already having the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be inhibited. As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of administering an agent that treats a protein deficiency, an effective amount of an agent is, for example, an amount of mRNA expressing sufficient the desired protein to ameliorate, reduce, eliminate, or prevent the symptoms associated with the corresponding protein deficiency, as compared to the severity of the symptom observed without administration of the agent. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose." As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body. As used herein, the terms “internal linker,” “internal spacer” and the like refer to a linking group between nucleosides that is not a traditional internucleoside linkage. Internal linkers may be, for example, a linear or branched alkyl chain or a linear or branched heteroalkyl chain (e.g., a polyethylene glycol chain). In some embodiments, any internal linker described herein may contain from 1 to 50 atoms, from 1 to 40 atoms, from 3 to 30 atoms, from 3 to 25 atoms, from 5 to 30 atoms, from 5 to 25 atoms, from 3 to 15 atoms, 1 atom, 2 atoms, 3 atoms, 4 atoms, 5 atoms, 6 atoms, 7 atoms, 8 atoms, 9 atoms, 10 atoms, 11 atoms, 12 atoms, 13 atoms, 14 atoms, 15 atoms, 16 atoms, 17 atoms, 18 atoms, 19 atoms, 20 atoms, 21 atoms, 22 atoms, 23 atoms, 24 atoms, 25 atoms, 26 atoms, 27 atoms, 28 atoms, 29 atoms, 30 atoms, 31 atoms, 32 atoms, 33 atoms, 34 atoms, 35 atoms, 36 atoms, 37 atoms, 38 atoms, 39 atoms, 40 atoms, 41 atoms, 42 atoms, 43 atoms, 44 atoms, 45 atoms, 46 atoms, 47 atoms, 48 atoms, 49 atoms, or 50 atoms. As used herein, the term “internal ribosome entry site” or “IRES” refers to a nucleic acid element that is capable of recruiting one or more components of the translation machinery, e.g., a component of the ribosome, eIF4G, or eIF3, thereby fostering translation of an open reading frame that is operably linked thereto. IRES elements of the disclosure may be used in conjunction with either a 5’ cap-containing nucleic acid (e.g., a 5’-cap containing mRNA molecule) or a nucleic acid that lacks a 5’ cap (e.g., a circular RNA molecule). Exemplary IRES elements of the disclosure include polypyrimidine tracts, such as one or a plurality of polynucleotide tracts in which at least 70% of the nucleosides therein are pyrimidine-containing nucleosides, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine). PATENT ATTORNEY DOCKET NO.50858-145WO3 The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non- inflammatory in a patient. Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspension or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol. The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from PATENT ATTORNEY DOCKET NO.50858-145WO3 non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17thed., Mack Publishing Company, Easton, Pa., 1985, p.1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley- VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety. The term "pharmaceutically acceptable solvate," as used herein, means a compound of the present disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N'- dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a "hydrate." As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1-14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups. As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18 alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups. As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, PATENT ATTORNEY DOCKET NO.50858-145WO3 twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups. As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon- carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refer to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles. As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refer to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles. As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and / or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls. As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, - PATENT ATTORNEY DOCKET NO.50858-145WO3 CH(OH)-, -P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups. Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=O), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(OR)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-), a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)2OH), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-), a sulfonyl (e.g., S(O)2 ), an amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., OC(O)NR2, OC(O)NRH, or OC(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein. Compounds of the disclosure that contain nitrogens can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen- containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N-oxide derivative (which can be designated as N→O or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is PATENT ATTORNEY DOCKET NO.50858-145WO3 substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A is a schematic illustrating that linear RNA molecules are prone to degradation at the 5’ and / or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame. FIG.1B is a schematic showing ways in which RNAs may mitigate or avoid exonuclease degradation. In one example (top), a linear RNA molecule may be bound to a chemical moiety at the 5’ and / or 3’ ends that blocks the access of exonucleases to the RNA molecule. In another example (middle), the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease). One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation. The present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit ribosomes in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove / modify the cap so as to avoid nucleolytic degradation (e.g., by way of 5’ and / or 3’ blocking moieties or by way of RNA circularization). FIG.2 provides a graph comparing the expression of green fluorescent protein (GFP) from three different, linear RNA constructs in HEK293 cells over the course of 60 hours. Each linear RNA contained an open reading frame encoding degGFP (degron fused GFP protein to enable fast degradation of the protein), and each RNA lacked a 5’ cap structure. The RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR). One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“G0 lin, 5’ CVB3,” top of graph); another construct contained a standard UTR with no known IRES elements (“G0 lin, 5’ v1.1,” lower line of graph); and another construct three polynucleotide tracts each containing 9 contiguous 1- methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5 lin, 5’ 3xU9,” middle of graph). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG.2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “G0 lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’v1.1,” but also containing the known 5’ Cap1 structure. FIGS.3A – 3E are graphs comparing the expression of GFP from three different, linear RNA constructs in various cell types (HeLa (FIG.3A), HEK293 (FIG.3B), THP1 (FIG.3C), and Hep3B (FIG.3D)). Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence / absence of a 5’ cap. One construct contained the known 5’ Cap1 structure (“Cap1-A100,” circles); another construct contained the CVB3 IRES sequence in its 5’ UTR, without a 5’ cap structure (“CVB3 (G0),” squares); and another construct contained three polynucleotide tracts each containing 9 contiguous 1- PATENT ATTORNEY DOCKET NO.50858-145WO3 methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers without a 5’cap structure (“3xU9_1 (G5),” diamonds). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG.3 also includes a table (FIG.3E) comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (G0)” construct as compared to the “Cap1-A100” construct. FIG.4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB / c mice injected intravenously with SM86 / DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO- encoding open reading frame and a 5’ Cap1 structure (“Cap1-A100,” also referred to as “G0 Cap1”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin G0 CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin G0 CVB3, 5’ bA”); (iv) a linear RNA construct containing an EPO- encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, each tract separated from one another by two 13- nucleoside spacers, and a 5’ triphosphate structure (“lin G53xU9, 5’ PPP”); and (v) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ biotin-triazole structure (“lin G53xU9, 5’ bA”). Mice were injected with the SM86-DMG nanoparticles intravenously and were assessed for serum EPO concentrations after 3 hours, 6 hours, 1 day, and 2 days. FIG.4B is a graph comparing the serum EPO concentrations achieved by each construct. FIG.5 is a graph comparing the secretion of IFN-γ-inducible protein 10 (IP10) – an immune response marker – in BALB / c mice injected intravenously with one of five different EPO-encoding RNA constructs in the same experiment as Fig.4, 6 hours after injection. A vehicle-only arm (“buffer”) was included as a negative control. Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations. FIG.6A is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); and (iii) a linear RNA construct having the same structure as in (ii), except containing a 5’ Cap1 structure in lieu of a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”). FIG.6B is table comparing the luciferase expression of the constructs tested in FIG.6A in two different cell types: HeLa cells and Hep3B cells. PATENT ATTORNEY DOCKET NO.50858-145WO3 FIG.7A is a graph comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG.6A, with a circular RNA molecule containing a luciferase-encoding open reading frame. Within each RNA molecule, each instance of uridine was replaced with 1-methylpseudouridine. In addition to encoding luciferase, the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-eIF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP-encoding polypeptide to LACZ(t-Lacz), 4 G (“t-eIF4G”), or (iii) La protein (“t- La”). FIG.7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG.7A; in FIG.7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization. Notably, the data shown in FIGS.7A and 7B represent the first instance of successful translation of an RNA without a cap, particularly one in which all uridine nucleosides have been replaced with 1-methylpseudouridine nucleosides. Taken together, these data demonstrate that IRES elements of the disclosure are capable of effectuating ribosomal recruitment – and successful protein translation – in a manner that is independent of the presence or absence of a 5’ cap. Moreover, these data show that IRES elements of the disclosure can effectuate ribosomal recruitment and successful protein translation in a manner that is not dependent upon the presence or absence of a chemical modification of one of the nucleosides of the nucleic acid molecule, particularly because the interaction that mediates the recruitment of the ribosome (i.e., the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1-methylspeduorudiein). FIG.8A is a graph comparing the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K. Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern- encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1, and a 5’ triphosphate structure (“G0 lin 5’ PPP_1xApt17”); and (iii) a linear RNA construct containing an mGreenLantern- encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1, with all U residues replaced with N-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”). FIG.8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K. Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1- methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1.1”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, and a 5’ PATENT ATTORNEY DOCKET NO.50858-145WO3 triphosphate structure (“G5 lin 5’ PPP_3xU9”); (iii) a linear RNA construct containing a luciferase- encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1, with all U residues replaced with N-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”); and (v) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six repeats of the nucleic acid sequence of SEQ ID NO: 1, with all U residues replaced with N-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xApt17”). FIG.9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a luciferase-encoding open reading frame and a 5’ Cap1 structure (“C1”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1.1”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1- methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v2.0 (G0)”); (v) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, with all uridine residues in the polynucleotide tract replaced by 1-methylpseudouridine residues, and a 5’-triphosphate structure (“1xPDCD4 La (G5)”); (vi) a linear RNA construct containing a luciferase- encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, and a 5’-triphosphate structure (“1xPDCD4 La (G0)”); (vii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds eIF4G protein, with all uridine residues in the polynucleotide tract replaced by 1-methylpseudouridine residues, and a 5’-triphosphate structure (“1xAUAU4 (G5)”); and (viii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds eIF4G protein, and a 5’- triphosphate structure (“1xAUAU4 (G0)”). FIG.9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG.9A as a percentage of the luciferase expression achieved by the “Cap1” construct. FIG.10A is a graph comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID PATENT ATTORNEY DOCKET NO.50858-145WO3 NO: 3, “UTR1”), and a GFP-encoding open reading frame fused to a degron domain and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUUUGAUAUUAUAAGAGUUUUUUUUUGAUAUUAAGAAAAUUUUUUUUUGAUA UUAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4, “UTR2”), and a GFP-encoding open reading frame fused to a degron domain. A negative control (“no RNA”) was included for comparison purposes. FIG.10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells. FIG.10C provides a set of graphs comparing the expression of luciferase in BALB / c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1” (as in FIGS.10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS.10A and 10B), and a luciferase-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes. FIG.10D provides a set of graphs comparing the expression of erythropoietin in BALB / c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1” (as in FIGS.10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS.10A and 10B), and an erythropoietin-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes. FIG.11 is a graph demonstrating increased protein expression of luciferase-encoding polynucleotides of the disclosure. The polynucleotides contained a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues and different chemical modifications of the 5’ end synthesized co-transcriptionally. The nucleic acid molecules were tested in HEK293 cells in the presence of L2K. The polynucleotides contained a 5’ region having the structure of Formula A1-A13. A negative control in which no RNA was administered was also included. FIG.12A, 12B, and 12C depict the results of an experiment in which a linear RNA construct containing a deg-GFP-encoding open reading frame was tested with various 5’ regions of Table 12. The nucleic acid molecules contained a 5’ UTR containing either (i) no known IRES, and the sequence of SEQ ID NO: 186, or (ii) an IRES having six polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues. The 3’ region contained an inverted deoxythymidine residue. The total green indicated intensity was measured over a 48-hour period, and the results were reported as the area under the curve. These nucleic acids were evaluated in HeLa (FIG.12A), Hep3B (FIG.12B), and THP1 (FIG.12C) cells. FIG.13 is a graph demonstrating increased protein expression of degGFP-encoding polynucleotides of the disclosure. The nucleic acid molecules had a 5’ UTR containing an IRES with PATENT ATTORNEY DOCKET NO.50858-145WO3 three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues and different chemical modifications of the 5’ end. The nucleic acids tested had 5’ regions having the structure of Formulas A29, A27, A26, A22, and A20 in Table 12 and a 3’ inverted deoxythymidine. FIG.14 contains a set of graphs depicting the protein expression of degGFP-encoding polynucleotides of the disclosure in HELA, THP-1, and HEP3b cells. The nucleic acid molecules had a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1- methylpseudouridine residues and different chemical modifications of the 5’ end. The nucleic acids tested had 5’ regions having the structure of Formulas A20-A29 in Table 12 and a 3’ inverted deoxythymidine. FIG.15 is a graph demonstrating the relative abundance of nucleic acid molecules of the disclosure over a 48-hour period in HEK 293 cells. The nucleic acid molecules had a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1- methylpseudouridine residues and different chemical modifications of the 5’ end. The nucleic acid molecules had 5’ regions having the structure of Formulas A20-A29 in Table 12 and a 3’ inverted deoxythymidine. A higher abundance of mRNA over time was indicative of greater stability of the mRNA, attributable to the modified end regions. FIG.16 is a graph demonstrating the immunogenicity of nucleic acid molecules of the disclosure. The nucleic acid molecules had a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues and different chemical modifications of the 5’ end. The nucleic acid molecules had 5’ regions having the structure of Formulas A20-A29 in Table 12 and a 3’ inverted deoxythymidine. For comparison, several controls were also included. The molecules were tested in an A549 dual receptor cell line. FIG.17 is a graph demonstrating that IRES containing nucleic acid molecules having a 3’ inverted deoxythymidine and a 5’ end having the structure of one of Formulas A21-A24, A26-A27, and A29 that lack a 5’ cap show comparable or superior stability to RNA molecules containing a 5’ cap when administered to THP-1 cells. The abundance of mRNA was measured relative to BActin over a 48-hour period by qPCR. FIG.18A is a graph showing the relative RNA abundance in cells that were treated with compounds having a) a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues; and b) a 3’ inverted deoxythymidine. Each RNA also had c) a modified 5’ region having one of the following structures: i) 5’ cap1 (referred to as Cap13xU9 GFP22 idT), or ii) 5’ phosphate (referred to as 5’P 3xU9 GFP22 idT), or iii) 5’ spacer 18 followed by six 2’-methoxy ribose nucleosides (referred to as Sp18_2PS_6OMe 3xU9 GFP22 idT), with the first two internucleoside linkages being phosphorothioate, or iv) 5’ spacer 18 followed by three 2’-methoxy ribose nucleosides (referred to as Sp18_2PS_3OMe 3xU9 GFP22 idT), with the first two internucleoside linkages being phosphorothioate, or v) 5’ spacer 18 followed by ten 2’-methoxy ribose nucleosides, with the first two internucleoside linkages being phosphorothioate (referred to as Sp18_2PS_10OMe 3xU9 GFP22 idT). The relative mRNA abundance was measured over a 48-hour period. FIG.18B is a copy of FIG.18A showing only the first 8 hours of the time course. The graphs demonstrate that increasing the number of ribose modifications leads to an increase in stability. PATENT ATTORNEY DOCKET NO.50858-145WO3 FIGS.19A-19D show the results of a series of experiments that demonstrate that nucleic acid molecules of the disclosure lacking a 5’ cap, but with a modified 5’ region, may exhibit reduced sensitivity to exonucleases. The experiments are described in Example 15. All mRNA molecules tested in this figure contained a) a 5’ UTR containing an IRES with three polynucleotide tracts each containing 9 contiguous 1-methylpseudouridine residues; and b) a 3’ inverted deoxythymidine. The results are reported as both the total protein expression (measured as the total green intensity) over time (“Protein Kinetics”) and also as the percentage of the maximum protein expression over time (“Normalized Protein Kinetics”). mRNA molecules containing a 5’Cap1 or 5’ triphosphate were tested as a positive control (FIG.19A). mRNA molecules lacking a 5’ cap, but having the 5’ groups described in Example 13 were tested in this assay. The mRNA molecules were modified at the 5’ end to have 6 consecutive 2’-O-methoxyethyl nucleotides at the 5’ end of the mRNA molecule with the 2 terminal internucleotide linkages being modified to phosphorothioate internucleotide linkages (FIG. 19B); 6 consecutive 2’-fluoro nucleotides at the 5’ end of the mRNA molecule, with the 2 terminal internucleotide linkages being modified to phosphorothioate internucleotide linkages (FIG.19C); or 6 consecutive LNA nucleotides at the 5’ end of the mRNA molecule with the 2 terminal internucleotide linkages being modified to phosphorothioate internucleotide linkages (FIG.19D).The graphs demonstrate that the inclusion of the LNA modification may reduce the susceptibility of LNA-modified RNA molecules to undergo degradation by exonucleases. FIGS.20A and 20B are graphs showing the results of a series of experiments that demonstrate that nucleic acid molecules of the disclosure lacking a 5’ cap, but with a modified 5’ region, may exhibit good expression. The expression was measured by the total fluorescence over time. These results show that linking a terminal group to the rest of the RNA by a phosphorothioate internucleoside linkage and / or including an internal linker may lead to increased expression as compared to an RNA in which the terminal group is linked by a phosphodiester linkage. The results are reported in Thp1 cells (FIG.20A) and HEP3B cells (FIG.20B). FIG.21 is a graph showing the results of an experiment that demonstrates that nucleic acid molecules of the disclosure lacking a 5’ cap, but with a modified 5’ region, may exhibit good expression. The expression was measured by the total fluorescence over time. These results show that including both an external and an internal linker may lead to increased expression as compared to an RNA in which only one modification is present. DETAILED DESCRIPTION The present disclosure provides nucleic acid molecules (e.g., RNA molecules, such as linear or circular RNA molecules) that are capable of recruiting and binding to ribosomes without the need for a 5’ cap structure. Nucleic acid molecules often use 5’ cap structures as a means for promoting ribosomal binding and, ultimately, open reading frame translation. The presence of a 5’ cap that is susceptible to decapping and subsequent degradation of the RNA may preclude the possibility of instead having chemical modifications that extend the molecule’s half-life. The present disclosure addresses this problem by providing means for nucleic acid molecules to recruit and bind ribosome without the need for a 5’ cap structure, thus providing the advantage of simultaneously allowing the PATENT ATTORNEY DOCKET NO.50858-145WO3 nucleic acid molecules to be translatable and to be modified in ways that mitigate nucleolytic degradation. Examples of nucleic acid modifications that reduce or avoid nucleolytic degradation, but that also preclude the inclusion of a 5’ cap, include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap. The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in the absence of a 5’ cap. Importantly, not only do the presently described IRES elements promote cap-independent translation, thereby permitting half-life-extending modifications such as 5’ / 3’ blocking and circularization, the present IRES elements are also compatible with chemically modified uridine nucleosides, particularly 1-methylpseudouridine nucleosides. This is a significant departure from known IRES elements, which are often structure-based and are expected to be incompatible with chemically modified nucleosides. The use of modified uridine residues, particularly 1- methylpseudouridine, provides the benefit of engendering a nucleic acid molecule that is substantially less immunogenic than a corresponding nucleic acid molecule lacking this modification. Accordingly, IRES elements that are compatible with 1-methylpseudoridine are particularly advantageous. The IRES elements described herein thus provide multiple benefits: not only do the present IRES elements allow the types of half-life-extending nucleic acid modifications that would preclude a 5’ cap group, but they also function with a uridine modification that significantly suppresses immunogenicity of the nucleic acid molecule. Nucleic acids containing the IRES elements described herein may also contain a modified 5’ region and / or a modified 3’region. These modified regions may include, for example, one or more modification selected from (i) at least one modified sugar (e.g., at least one modified ribose), and / or (ii) at least one modified internucleoside linkage (e.g., at least one phosphorothioate), and / or (iii) a modified terminal group (e.g., a modified phosphate or an inverted nucleobase). The modifications of the 5’ or 3’ region may include any of the modifications mentioned in the sections that follow. These modifications may be installed into the nucleic acid molecules of the disclosure by any of a variety of methods described herein (e.g., co-transcriptionally or by way of ligation). The modification of the 5’ end or 3’ end of the nucleic acid molecule (e.g., RNA) of the disclosure may have a beneficial impact on (i) the stability of the nucleic acid molecule, (ii) the immunogenicity of the nucleic acid molecule, and / or (iii) extracellular and intracellular interactions of the nucleic acid molecule. These beneficial improvements may lead to an increased output of expressed protein. The sections that follow describe exemplary IRES elements in further detail, as well as the various types of nucleic acid modifications that can be used in conjunction with the IRES elements of the disclosure, including within the modified 5’ or 3’ regions described herein. PATENT ATTORNEY DOCKET NO.50858-145WO3 1. Internal Ribosome Entry Sites Exemplary nucleic acids of the disclosure are those that contain: (i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to (ii) an open reading frame encoding a polypeptide. In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). The IRES may, for example, comprise from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In certain embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be uridine or a modified uridine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length. In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine or modified uridine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous uridine or modified uridine nucleosides. In exemplary nucleic acids of the disclosure, each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides. In exemplary nucleic acids of the disclosure, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- PATENT ATTORNEY DOCKET NO.50858-145WO3 uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, the modified uridine is 1-methylpseudouridine. In exemplary nucleic acids of the disclosure, the IRES is located within a noncoding region of the nucleic acid, such as a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR. In exemplary nucleic acids of the disclosure, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 nucleosides. In exemplary nucleic acids of the disclosure, the IRES is represented by the formula: [(N)n– (U’)m]pwherein: each N is, independently, any nucleoside residue; each U’ is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20). PATENT ATTORNEY DOCKET NO.50858-145WO3 In exemplary nucleic acids of the disclosure, N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine. In exemplary nucleic acids of the disclosure, the modified uridine of N is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6- aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl- cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1- methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl- cytidine, 5,2′-O-dimethyl-cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl- 2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐cytidine. In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido- PATENT ATTORNEY DOCKET NO.50858-145WO3 adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl- adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2- methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6- threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6- threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2- methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl- adenosine, N6,N6,2′-O-trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2- amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐adenosine, or N6‐(19‐amino‐pentaoxanonadecyl)-adenosine. In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1-methyl- inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza- guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl- guanosine, N2-methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl-guanosine, 1-methyl-2′-O- methyl-guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl- inosine, 2′-O-ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, or 2’‐F‐ guanosine. In exemplary nucleic acids of the disclosure, the modified uridine of U’ is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- PATENT ATTORNEY DOCKET NO.50858-145WO3 methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In exemplary nucleic acids of the disclosure, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 11. In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6. In exemplary nucleic acids of the disclosure, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading frame consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading frame consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine. In exemplary nucleic acids of the disclosure, the modified uridine of the open reading frame is 1-methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5- oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2- seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl- 4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio- 1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl-pseudouridine, 2-thio- 2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5-carbamoylmethyl-2′-O-methyl- PATENT ATTORNEY DOCKET NO.50858-145WO3 uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl-uridine, 5- (isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐ uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1-methylpseudouridine. In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6- aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl- cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1- methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl- cytidine, 5,2′-O-dimethyl-cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl- 2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐cytidine. In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido- adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl- adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2- methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6- threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6- threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2- methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl- adenosine, N6,N6,2′-O-trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2- amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐adenosine, or N6‐(19‐amino‐pentaoxanonadecyl)-adenosine. In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1-methyl- inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza- guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl- guanosine, N2-methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl-guanosine, 1-methyl-2′-O- methyl-guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl- PATENT ATTORNEY DOCKET NO.50858-145WO3 inosine, 2′-O-ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, or 2’‐F‐ guanosine. In exemplary nucleic acids of the disclosure, the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane- bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein. In exemplary nucleic acids of the disclosure, the nucleic acid does not comprise a 5’ cap. In another aspect, the disclosure provides a nucleic acid comprising: (i) an internal ribosome entry site (IRES) comprising one or more polynucleotides that recruit a ribosome; operably linked to (ii) an open reading frame encoding a polypeptide. In another aspect, the disclosure provides a nucleic acid comprising: (i) an internal ribosome entry site (IRES) comprising one or more polynucleotides that specifically bind eukaryotic translation initiation factor 4 G (eIF4G) or La protein; operably linked to (ii) an open reading frame encoding a polypeptide. In exemplary nucleic acids of the disclosure, the one or more polynucleotides specifically bind eIF4G. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid does not comprise a 5’ cap. In a further aspect, the disclosure provides a polypeptide expression system comprising: (i) the nucleic acid of the foregoing aspect (or any of the above embodiments thereof); and (ii) a nucleic acid comprising an open reading frame that encodes eIF4G, La protein, or a functional variant thereof. In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules. In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’: (i) a 5’ UTR; (ii) the open reading frame encoding the eIF4G, La protein, or functional variant thereof; and (iii) a 3’ UTR. In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR. 2. Chemically Modified Nucleic Acids The IRES elements of the disclosure, as well as the open reading frame, UTR, modified 5’ PATENT ATTORNEY DOCKET NO.50858-145WO3 region, modified 3’ region, and other elements of the nucleic acid constructs described herein, may have one or more chemical modifications. According to Aduri et al., (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleosides in RNA. Journal of Chemical Theory and Computation.2006.3(4):1464-75), there are 107 naturally occurring nucleosides, including 1- methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O- ribosylphosphate adenosine, N6-methyl-N6-threonylcarbamoyladenosine, N6-acetyladenosine, N6- glycinylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6- threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6- hydroxynorvalylcarbamoyladenosine, 1,2-O-dimethyladenosine, N6,2-O-dimethyladenosine, 2-O- methyladenosine, N6,N6,O-2-trimethyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 2-methylthio- N6-threonyl carbamoyladenosine, 2-thiocytidine, 3-methylcytidine , N4-acetylcytidine, 5- formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, lysidine, N4-acetyl-2-O- methylcytidine, 5-formyl-2-O-methylcytidine, 5,2-O-dimethylcytidine, 2-O-methylcytidine, N4,2-O- dimethylcytidine, N4,N4,2-O-trimethylcytidine, 1-methylguanosine, N2,7-dimethylguanosine, N2- methylguanosine, 2-O-ribosylphosphate guanosine, 7-methylguanosine, under modified hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2- dimethylguanosine, 4-demethylwyosine, epoxyqueuosine, hydroxywybutosine, isowyosine, N2,7,2-O- trimethylguanosine, N2,2-O-dimethylguanosine, 1,2-O-dimethylguanosine, 2-O-methylguanosine, N2,N2,2-O-trimethylguanosine, N2,N2,7-trimethylguanosine, peroxywybutosine, galactosyl- queuosine, mannosyl-queuosine, queuosine, archaeosine, wybutosine, methylwyosine, wyosine, 2- thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5- hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5- (carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5- methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5- (isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2-O-dimethyluridine, 5- carboxymethylaminomethyl-2-O-methyluridine, 5-carbamoylmethyl-2-O-methyluridine, 5- methoxycarbonylmethyl-2-O-methyluridine, 5-(isopentenylaminomethyl)-2-O-methyluridine, 5,2-O- dimethyluridine, 2-O-methyluridine, 2-thio-2-O-methyluridine, uridine 5-oxyacetic acid, 5- methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5- aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-methylaminomethyl-2- selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurinomethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2-O-methylpseudouridine, inosine, 1-methylinosine, 1,2-O-dimethylinosine, and 2-O-methylinosine. Each of these may be components of nucleic acids of the present invention. a. Nucleosides containing modified sugars The alternative nucleosides and nucleotides (e.g., building block molecules), which may be incorporated into a polynucleotide (e.g., RNA or mRNA, as described herein, including in modified 5’ PATENT ATTORNEY DOCKET NO.50858-145WO3 or 3’ regions), can be altered on the sugar of the ribonucleic acid. For example, the 2′ hydroxyl group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C1-6 alkyl; optionally substituted C1-6 alkoxy; optionally substituted C6-10 aryloxy; optionally substituted C3-8 cycloalkyl; optionally substituted C3-8 cycloalkoxy; optionally substituted C6-10 aryloxy; optionally substituted C6-10 aryl-C1-6 alkoxy, optionally substituted C1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH2CH2O)nCH2CH2OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); “locked” nucleic acids (LNA) in which the 2′-hydroxyl is connected by a C1-6 alkylene or C1-6 heteroalkylene bridge to the 4’-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4- membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α-L-threofuranosyl-(3′→2′)), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. b. Alterations on the nucleobase The present disclosure provides for alternative nucleosides and nucleotides. As described herein “nucleoside” is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). As described herein, “nucleotide” is defined as a nucleoside including a phosphate group. Exemplary non-limiting alterations include an amino group, a thiol group, an alkyl group, a halo group, or any described herein. The alternative nucleotides may by synthesized by any useful method, as described herein (e.g., chemically, enzymatically, or recombinantly to include one or more alternative or alternative nucleosides). PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, a nucleic acid of the invention (e.g., an mRNA or an oligonucleotide) includes one or more 2’-OMe nucleotides, 2’-O-methoxyethyl nucleotides (2’-MOE nucleotides), 2’-F nucleotide, 2’-NH2 nucleotide, 2’fluoroarabino nucleotides (FANA nucleotides), locked nucleic acid nucleotides (LNA nucleotides), or 4’-S nucleotides. The alternative nucleotide base pairing encompasses not only the standard adenosine- thymine, adenosine-uracil, and guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil. The alternative nucleosides and nucleotides can include an alternative nucleobase. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. Examples of nucleobase found in DNA include, but are not limited to, adenine, guanine, cytosine, and thymine. These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties (e.g., resistance to nucleases and stability), and these properties may manifest through disruption of the binding of a major groove binding partner. In some embodiments, the alternative nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5- halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5- carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5- methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5- carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τm5U), 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(τm5s2U), 1-taurinomethyl-4-thio- pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxythymine), 1-methyl- pseudouridine (m1ψ), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio- 1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1- deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uridine PATENT ATTORNEY DOCKET NO.50858-145WO3 (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2′-O-methyl-uridine (Um), 5,2′-O-dimethyl-uridine (m5Um), 2′-O-methyl-pseudouridine (ψm), 2-thio-2′-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2′-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2′-O-methyl-uridine (cmnm5Um), 3,2′-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2′-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, and 5‐[3‐(1‐E‐propenylamino)uridine. In preferred embodiments, the nucleic acid is modified to contain 1-methylpseudouridine (m1ψ) in lieu of uridine at each instance. In some embodiments, the alternative nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4- methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5- hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1- methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4- methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), α-thio-cytidine, 2′-O-methyl-cytidine (Cm), 5,2′-O- dimethyl-cytidine (m5Cm), N4-acetyl-2′-O-methyl-cytidine (ac4Cm), N4,2′-O-dimethyl-cytidine (m4Cm), 5-formyl-2′-O-methyl-cytidine (f5Cm), N4,N4,2′-O-trimethyl-cytidine (m42Cm), 1-thio-cytidine, 2’‐F‐ara‐ cytidine, 2’‐F‐cytidine, and 2’‐OH‐ara‐cytidine. In some embodiments, the alternative nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro- purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7- deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza- 2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6- isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6- threonylcarbamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl-adenosine (m6t6A), 2- methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6-dimethyl-adenosine (m62A), N6- hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine (Am), N6,2′-O-dimethyl-adenosine (m6Am), N6,N6,2′-O- trimethyl-adenosine (m62Am), 1,2′-O-dimethyl-adenosine (m1Am), 2′-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐ adenosine, 2’‐OH‐ara‐adenosine, and N6‐(19‐amino‐pentaoxanonadecyl)-adenosine. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the alternative nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl- queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl- 7-deaza-guanosine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7- deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl- guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2,7G), N2, N2,7-dimethyl- guanosine (m2,2,7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl-guanosine (Gm), N2-methyl-2′-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2′-O-methyl-guanosine (m22Gm), 1- methyl-2′-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2′-O-methyl-guanosine (m2,7Gm), 2′-O-methyl- inosine (Im), 1,2′-O-dimethyl-inosine (m1Im), 2′-O-ribosylguanosine (phosphate) (Gr(p)) , 1-thio- guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, and 2’‐F‐guanosine. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine, or pyrimidine analog. For example, the nucleobase can each be independently selected from adenine, cytosine, guanine, uracil, or hypoxanthine. In some embodiments, the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7- deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4- d]pyrimidine, imidazo[1,5-a]1,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5- d]pyrimidines, pyrazin-2-ones, 1,2,4-triazine, pyridazine; and 1,3,5 triazine. When the nucleotides are depicted using the shorthand A, G, C, T or U, each letter refers to the representative base and / or derivatives thereof (e.g., A includes adenine or adenine analogs (e.g., 7-deaza adenine)). In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-iodo-cytosine, and cytosine as the PATENT ATTORNEY DOCKET NO.50858-145WO3 only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-acetyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-iodo- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-phenyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-fluoro- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, N4-acetyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some PATENT ATTORNEY DOCKET NO.50858-145WO3 embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-formyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-bromo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-methyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-aminoallyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-carboxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouridine, uridine, 5-bromo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-iodo- PATENT ATTORNEY DOCKET NO.50858-145WO3 cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouridine, uridine, 5-ethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-phenyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouridine, uridine, N4-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-fluoro- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl- pseudouridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-formyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1-methyl-pseudouridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1- methyl-pseudouridine, uridine, 5-carboxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain the uracil of one of the nucleosides of Table 2 and uracil as the only uracils. In other embodiments, the polynucleotides of the invention contain a uridine of Table 2 and uridine as the only uridines. Table 2. Exemplary modified uridine nucleosides PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the polynucleotides of the invention contain the cytosine of one of the nucleosides of Table 3 and cytosine as the only cytosines. In other embodiments, the polynucleotides of the invention contain a cytidine of Table 3 and cytidine as the only cytidines. Table 3. Exemplary modified cytidine nucleosides PATENT ATTORNEY DOCKET NO.50858-145WO3 PATENT ATTORNEY DOCKET NO.50858-145WO3 c. Alterations on the internucleoside linkage The alternative nucleotides, which may be incorporated into a polynucleotide molecule, can be altered on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent. The alternative nucleosides and nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates). The alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β) or gamma (γ) position) can be replaced with a sulfur (thio) and a methoxy. The replacement of one or more of the oxygen atoms at the α position of the phosphate moiety (e.g., α-thio phosphate) is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half- life in a cellular environment. While not wishing to be bound by theory, phosphorothioate linked polynucleotide molecules are expected to also reduce the innate immune response through weaker binding / activation of cellular innate immune molecules. In specific embodiments, an alternative nucleoside includes an alpha-thio-nucleoside (e.g., 5′- O-(1-thiophosphate)-adenosine, 5′-O-(1-thiophosphate)-cytidine (α-thio-cytidine), 5′-O-(1- thiophosphate)-guanosine, 5′-O-(1-thiophosphate)-uridine, or 5′-O-(1-thiophosphate)-pseudouridine). PATENT ATTORNEY DOCKET NO.50858-145WO3 Other internucleoside linkages that may be employed according to the present invention, including internucleoside linkages which do not contain a phosphorous atom, are described herein below. d. Combinations of alternative sugars, nucleobases, and internucleoside linkages The polynucleotides of the invention can include a combination of alterations to the sugar, the nucleobase, and / or the internucleoside linkage. These combinations can include any one or more alterations described herein. 3. Modified end regions Nucleic acids of the disclosure may contain a modified 5’ region and / or a modified 3’ region. These modified regions may include, for example, at least one modified sugar (e.g., at least one modified ribose), and / or at least one modified internucleoside linkage (e.g., at least one phosphorothioate), and / or a modified terminal group (e.g., a modified phosphate or an inverted nucleobase). The modifications of the 5’ or 3’ region may include any of the modifications described herein. These modifications may be installed into the nucleic acid molecules of the disclosure co- transcriptionally. The modification of the 5’ end or 3’ end of the nucleic acid molecule (e.g., RNA) of the disclosure may have a beneficial impact on (i) the stability of the nucleic acid molecule, (ii) the immunogenicity of the nucleic acid molecule, and / or (iii) extracellular and intracellular interactions of the nucleic acid molecule. These beneficial improvements may lead to an increased output of expressed protein. In some embodiments of any of the nucleic acids described herein, the nucleic acid includes a modified 5’ region. In some embodiments of any of the nucleic acids described herein, the nucleic acid includes a modified 3’ region. In some embodiments of any of the nucleic acids described herein, the nucleic acid includes both a modified 3’ region and a modified 5’ region. In some embodiments of the modified 5’ region and / or the modified 3’ region, the region has at least one modification selected from a terminal group, a modified internucleoside linkage, and a modified ribose. In some embodiments, the modified 5’ region and / or the modified 3’ region has at least one modified ribose. In some embodiments, at least one modified ribose is selected from a 2’- deoxyribose, a 2’-OMe ribose, a 2’-O-methoxyethyl ribose (2’-MOE), a 2’-F ribose, a 2’-NH2 ribose, a 2’fluoroarabino ribose (FANA), a locked nucleic acid (LNA), or a 4’-S ribose. In some embodiments, at least one modified ribose is selected from a 2’-methoxy ribose, an LNA, or a 2’-deoxyribose. In some embodiments, at least one modified ribose is an LNA. In some embodiments, at least one modified ribose is a 2’-deoxyribose. In some embodiments, at least one modified ribose is a 2’- methoxy ribose. In some embodiments, the modified 5’ region and / or the modified 3’ region has at least one modified internucleoside linkage. In some embodiments, at least one modified internucleoside linkage is a phosphorothioate, a phosphoroselenate, a boranophosphate, a boranophosphate ester, a hydrogen phosphonate, a phosphoramidate, a phosphorodiamidate, an alkyl phosphonate, an aryl PATENT ATTORNEY DOCKET NO.50858-145WO3 phosphonate, a phosphotriester, a phosphorodithioate, a bridged phosphoramidate, a bridged phosphorothioate, a bridged methylene-phosphonate, or an α-thio phosphate. In particular embodiments, at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In some embodiments, the modified 5’ region and / or the modified 3’ region includes a terminal group. In some embodiments, the terminal group is a 5’ triphosphate, a 5’ phosphate, a 5’ hydroxyl, a biotinylated phosphate, an inverted nucleobase, spacer 18, cap1, or a poly adenosine. In some embodiments, the terminal group is a 5’ triphosphate. In some embodiments, the terminal group is a 5’ hydroxyl. In some embodiments, the terminal group is Cap1. In some embodiments, the terminal group is spacer 18. In some embodiments, the terminal group is a 5’ phosphate. In some embodiments, the terminal group is an inverted nucleobase. In some embodiments, the inverted nucleobase is an inverted deoxythymidine. In some embodiments, the inverted nucleobase has the structure of Formula XI: or a salt thereof; wherein each X is, independently O or S; and A represents adenine and T represents thymine. In some embodiments of Formula XI, each X is O. In some embodiments of Formula XI, each X is S. In some embodiments the modified 5’ region and / or the modified 3’ region has the structure of Formula XLIX: Q-N1-L1-N2-(L2)a-(N3)b-(L3)c-(N4)d-(L4)e-(N5)f-(L5)g-(N6)h-Z Formula XLIX wherein Q is a terminal group; Z is a bond between the 5’ region or the 3’ region and the rest of the nucleic acid each of N1, N2, N3, N4, N5, and N6 is, independently, a nucleoside or a modified nucleoside; each of L1, L2, L3, L4, and L5 is, independently, an internucleoside linkage; and each of a, b, c, d, e, f, g, and h is, independently, 0 or 1. In some embodiments of Formula XLIX, a is 0. In some embodiments of Formula XLIX, a is 1. In some embodiments of Formula XLIX, b is 0. In some embodiments of Formula XLIX, b is 1. In some embodiments of Formula XLIX, c is 0. In some embodiments of Formula XLIX, c is 1. In some embodiments of Formula XLIX, d is 0. In some embodiments of Formula XLIX, d is 1. In some embodiments of Formula XLIX, e is 0. In some embodiments of Formula XLIX, e is 1. In some embodiments of Formula XLIX, f is 0. In some embodiments of Formula XLIX, f is 1. In some PATENT ATTORNEY DOCKET NO.50858-145WO3 embodiments of Formula XLIX, g is 0. In some embodiments of Formula XLIX, g is 1. In some embodiments of Formula XLIX, h is 0. In some embodiments of Formula XLIX, h is 1. In some embodiments, Q is a 5’ triphosphate. In some embodiments, Q is a 5’ phosphate. In some embodiments, Q is spacer 18. In some embodiments, Q is cap1. In some embodiments, Q is hydroxyl. In some embodiments, Q is biotinylated phosphate. In some embodiments, Q is inverted deoxythymidine. In some embodiments, each of N1, N2, N3, N4, N5, and N6 is, independently, guanosine, modified guanosine, adenosine, modified adenosine, cytosine, or modified cytosine. In some embodiments, N1 is guanosine. In some embodiments, N1 is modified guanosine. In some embodiments, N1 is adenosine. In some embodiments, N1 is modified adenosine. In some embodiments, N1 is cytosine. In some embodiments, N1 is modified cytosine. In some embodiments, N2 is guanosine. In some embodiments, N2 is modified guanosine. In some embodiments, N2 is adenosine. In some embodiments, N2 is modified adenosine. In some embodiments, N2 is cytosine. In some embodiments, N2 is modified cytosine. In some embodiments, N3 is guanosine. In some embodiments, N3 is modified guanosine. In some embodiments, N3 is adenosine. In some embodiments, N3 is modified adenosine. In some embodiments, N3 is cytosine. In some embodiments, N3 is modified cytosine. In some embodiments, N4 is guanosine. In some embodiments, N4 is modified guanosine. In some embodiments, N4 is adenosine. In some embodiments, N4 is modified adenosine. In some embodiments, N4 is cytosine. In some embodiments, N4 is modified cytosine. In some embodiments, N5 is guanosine. In some embodiments, N5 is modified guanosine. In some embodiments, N5 is adenosine. In some embodiments, N5 is modified adenosine. In some embodiments, N5 is cytosine. In some embodiments, N5 is modified cytosine. In some embodiments, N6 is guanosine. In some embodiments, N6 is modified guanosine. In some embodiments, N6 is adenosine. In some embodiments, N6 is modified adenosine. In some embodiments, N6 is cytosine. In some embodiments, N6 is modified cytosine. In some embodiments, each of N1, N2, N3, N4, N5, and N6 is, independently, an unmodified ribonucleoside, a 2’-deoxy ribonucleoside, a 2’-methoxy ribonucleoside, or a locked nucleic acid (LNA). In some embodiments, N1 is an unmodified ribonucleoside. In some embodiments, N1 is a 2’-methoxy ribonucleoside. In some embodiments, N1 is a 2’-deoxyribonucleoside. In some embodiments, N1 is an LNA. In some embodiments, N2 is an unmodified ribonucleoside. In some embodiments, N2 is a 2’-methoxy ribonucleoside. In some embodiments, N2 is a 2’-deoxyribonucleoside. In some embodiments, N2 is an LNA. In some embodiments, N3 is an unmodified ribonucleoside. In some embodiments, N3 is a 2’-methoxy ribonucleoside. In some embodiments, N3 is a 2’-deoxyribonucleoside. In some embodiments, N3 is an LNA. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, N4 is an unmodified ribonucleoside. In some embodiments, N4 is a 2’-methoxy ribonucleoside. In some embodiments, N4 is a 2’-deoxyribonucleoside. In some embodiments, N4 is an LNA. In some embodiments, N5 is an unmodified ribonucleoside. In some embodiments, N5 is a 2’-methoxy ribonucleoside. In some embodiments, N5 is a 2’-deoxyribonucleoside. In some embodiments, N5 is an LNA. In some embodiments, N6 is an unmodified ribonucleoside. In some embodiments, N6 is a 2’-methoxy ribonucleoside. In some embodiments, N6 is a 2’-deoxyribonucleoside. In some embodiments, N6 is an LNA. In some embodiments, each of L1, L2, L3, L4, and L5 is, independently, a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. In some embodiments, each of L1 and L2 are a phosphorothioate internucleoside linkage. In some embodiments, L4 and L5 are phosphodiester internucleoside linkages. In some embodiments, L1 is a phosphodiester internucleoside linkage. In some embodiments, L1 is a phosphorothioate internucleoside linkage. In some embodiments, L2 is a phosphodiester internucleoside linkage. In some embodiments, L2 is a phosphorothioate internucleoside linkage. In some embodiments, L3 is a phosphodiester internucleoside linkage. In some embodiments, L3 is a phosphorothioate internucleoside linkage. In some embodiments, L4 is a phosphodiester internucleoside linkage. In some embodiments, L4 is a phosphorothioate internucleoside linkage. In some embodiments, L5 is a phosphodiester internucleoside linkage. In some embodiments, L5 is a phosphorothioate internucleoside linkage. In some embodiments, L6 is a phosphodiester internucleoside linkage. In some embodiments, L6 is a phosphorothioate internucleoside linkage. In some embodiments, the 5’ region has the sequence of an initiator oligonucleotide. The initiator oligonucleotide, in some embodiments, includes an adenine-guanine (AG) dinucleotide. For example, in some embodiments, the two nucleotides at the 3’ end of an initiator oligonucleotide are an AG dinucleotide. In some embodiments, an initiator oligonucleotide comprises a nucleotide sequence selected from GCAAG (SEQ ID NO: 173), GGCAG (SEQ ID NO: 174), GCGAG (SEQ ID NO: 175), GCAGG (SEQ ID NO: 176), GGCGCAG (SEQ ID NO: 177), and GGCGCGCAG (SEQ ID NO: 178). In some embodiments, an initiator oligonucleotide comprising an AG dinucleotide comprises the nucleic acid sequence of [N]X1-AG-[N]X2, wherein N is any nucleotide, X1 is a number from 1 to 20, and X2 is a number from 0 to 2. In some embodiments, an initiator oligonucleotide comprises a nucleotide sequence selected from NNAG (SEQ ID NO: 179), NNNAG (SEQ ID NO: 180), NNNNAG (SEQ ID NO: 181), NNNNNGG (SEQ ID NO: 182), NNNNNNAG (SEQ ID NO: 183), NNNNNNNAG (SEQ ID NO: 184), and NNNNNNNNAG (SEQ ID NO: 185), wherein N is any nucleotide. In some embodiments, the modified 5’ region has one of the following structures, in the 5’ to 3’ direction: Table 12. Exemplary 5’ regions PATENT ATTORNEY DOCKET NO.50858-145WO3 wherein PPP is a triphosphate, biotin is a biotinylated phosphate, Sp18 is spacer 18, P is a phosphate, idT is inverted deoxythymidine, A is adenosine, G is guanosine, C is cytosine, mA is 2’- methoxy adenosine, mG is 2’-methoxy guanosine, mC is 2’-methoxy cytosine, dG is 2’-deoxy guanosine, dA is 2’-deoxy adenosine, LA is an LNA adenosine, LG is an LNA guanosine, LC is an LNA cytosine, O is a phosphodiester internucleoside linkage, S is a phosphorothioate internucleoside linkage, and Z is a bond to the rest of the nucleic acid. In some embodiments, the 5’ region has the structure of Formula A1. In some embodiments, the 5’ region has the structure of Formula A2. In some embodiments, the 5’ region has the structure of Formula A3. In some embodiments, the 5’ region has the structure of Formula A4. In some embodiments, the 5’ region has the structure of Formula A5. In some embodiments, the 5’ region has the structure of Formula A6. In some embodiments, the 5’ region has the structure of Formula A7. In PATENT ATTORNEY DOCKET NO.50858-145WO3 some embodiments, the 5’ region has the structure of Formula A8. In some embodiments, the 5’ region has the structure of Formula A9. In some embodiments, the 5’ region has the structure of Formula A10. In some embodiments, the 5’ region has the structure of Formula A11. In some embodiments, the 5’ region has the structure of Formula A12. In some embodiments, the 5’ region has the structure of Formula A13. In some embodiments, the 5’ region has the structure of Formula A14. In some embodiments, the 5’ region has the structure of Formula A15. In some embodiments, the 5’ region has the structure of Formula A16. In some embodiments, the 5’ region has the structure of Formula A17. In some embodiments, the 5’ region has the structure of Formula A18. In some embodiments, the 5’ region has the structure of Formula A19. In some embodiments, the 5’ region has the structure of Formula A20. In some embodiments, the 5’ region has the structure of Formula A21. In some embodiments, the 5’ region has the structure of Formula A22. In some embodiments, the 5’ region has the structure of Formula A23. In some embodiments, the 5’ region has the structure of Formula A24. In some embodiments, the 5’ region has the structure of Formula A25. In some embodiments, the 5’ region has the structure of Formula A26. In some embodiments, the 5’ region has the structure of Formula A27. In some embodiments, the 5’ region has the structure of Formula A28. In some embodiments, the 5’ region has the structure of Formula A29. In some embodiments, the 5’ region has the structure of Formula A30. In some embodiments, the 5’ region has the structure of Formula A31. In some embodiments, the 5’ region has the structure of Formula A32. In some embodiments, the 5’ region has the structure of Formula A33. In some embodiments, the 5’ region has the structure of Formula A34. In some embodiments, the 5’ region has the structure of Formula A34. In some embodiments, the 5’ region has the structure of Formula A35. In some embodiments, the 5’ region has the structure of Formula A36. In some embodiments, the 5’ region has the structure of Formula A37. In some embodiments, the 5’ region has the structure of Formula A38. In some embodiments, the modified 3’ region is inverted deoxythymidine. 4. Lipid Nanoparticle (LNP) Compositions The present disclosure provides LNP compositions that encapsulate a nucleic acid molecule (e.g., linear or circular RNA molecule) described herein. The LNPs of the disclosure may confer one or more advantageous properties. The lipid nanoparticle compositions described herein may be used for the delivery of therapeutic and / or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipid nanoparticles described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent. In some embodiments, the present application provides pharmaceutical compositions comprising: (a) a delivery agent comprising a lipid nanoparticle; and (b) a polynucleotide comprising an IRES of the disclosure. PATENT ATTORNEY DOCKET NO.50858-145WO3 a. Lipid Nanoparticles In some embodiments, polynucleotides of the present disclosure are included in a lipid nanoparticle (LNP). Lipid nanoparticles according to the present disclosure may comprise: (i) an ionizable lipid (e.g., an ionizable amino lipid); (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-modified lipid. In some embodiments, lipid nanoparticles according to the present disclosure further comprise one or more polynucleotides of the present disclosure (e.g., a linear or circular RNA encoding a therapeutic polypeptide, such as a therapeutic polypeptide disclosed herein). The lipid nanoparticles according to the present disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575 and PCT / US2016 / 069491 all of which are incorporated by reference herein in their entirety. In some embodiments, the lipid nanoparticle comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 20-60 mol.%, 25-60 mol.%, 30-60 mol.%, 35-60 mol.%, 40-60 mol.%, 45-60 mol.%, 20-55 mol.%, 25-55 mol.%, 30-55 mol.%, 35-55 mol.%, 40-55 mol.%, 45-55 mol.%, 20-50 mol.%, 25-50 mol.%, 30-50 mol.%, 35-50 mol.%, or 40-50 mol.%. For example, the lipid nanoparticle may comprise an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 40-50 mol.%, 45-50 mol.%, 45-46 mol.%, 46-47 mol.%, 47-48 mol.%, 48-49 mol.%, or 49-50 mol.%, for example about 45 mol.%, about 45.5 mol.%, about 46 mol.%, about 46.5 mol.%, about 47 mol.%, about 47.5 mol.%, about 48 mol.%, about 48.5 mol.%, about 49 mol.%, or about 49.5 mol.% ionizable cationic lipid (e.g., an ionizable amino lipid). In some embodiments, the lipid nanoparticle comprises a non-cationic helper lipid or phospholipid at a content of 5-25 mol.%. For example, the lipid nanoparticle may comprise a non- cationic helper lipid or phospholipid at a content of molar ratio of 5-25 mol.%, 5-20 mol.%, 5-15 mol.%, 10-25 mol.%, 10-20 mol.%, 10-15 mol.%, 5-6 mol.%, 6-7 mol.%, 7-8 mol.%, 8-9 mol.%, 9-10 mol.%, 10-11 mol.%, 11-12 mol.%, 12-13 mol.%, 13-14 mol.%, 14-15 mol.%, 10-14 mol.%, 10-13 mol.%, 10-12 mol.%, 10-11 mol.%, 9-15 mol.%, 9-14 mol.%, 9-13 mol.%, 9-12 mol.%, or 9-11 mol.% non-cationic lipid. In some embodiments, the lipid nanoparticle comprises a sterol or other structural lipid at a content molar ratio of 25-55 mol.%, 25-50 mol.%, 25-45 mol.%, 25-40 mol.%, 25-35 mol.%, 30-55 mol.%, 30-50 mol.%, 30-45 mol.%, 30-40 mol.%, 30-35 mol.%, 35-55 mol.%, 35-50 mol.%, 35-45 mol.%, 35-40 mol.%, 25-30 mol.%, 30-35 mol.%, 25-28 mol.%, 28-30 mol.%, 30-33 mol.%, 35-38 mol.%, 38-40 mol.%, 36-40 mol.%, 37-40 mol.%, 38-40 mol.%, 38-39 mol.%, 36-40 mol.%, 37-40 mol.%, 36-39 mol.%, or 37-39 mol.%. For example, the lipid nanoparticle may comprise a sterol or other structural lipid at a content of about 30 mol.%, about 30.5 mol.%, about 31.0 mol.%, about 31.5 mol.%, about 32.0 mol.%, about 32.5 mol.%, about 33.0 mol.%, about 33.5 mol.%, about 34.0 mol.%, PATENT ATTORNEY DOCKET NO.50858-145WO3 about 34.5 mol.%, about 35.0 mol.%, about 35.5 mol.%, about 36.0 mol.%, about 36.5 mol.%, about 37.0 mol.%, about 37.5 mol.%, about 38.0 mol.%, about 38.5 mol.%, about 39.0 mol.%, about 39.5 mol.%, about 40.0 mol.%, about 40.5 mol.%, about 41.0 mol.%, about 41.5 mol.%, about 42.0 mol.%, about 42.5 mol.%, about 43.0 mol.%, about 43.5 mol.%, about 44.0 mol.%, about 44.5 mol.%, or about 45.0 mol.%. In some embodiments, the lipid nanoparticle comprises a PEG-modified lipid at a content of 0.5-15 mol.%, 1.0-15 mol.%, 1.5-15 mol.%, 2.0-15 mol.%, 2.5-15 mol.%, 3.0-15 mol.%, 3.5-15 mol.%, 4.0-15 mol.%, 4.5-15 mol.%, 5.0-15 mol.%, 10-15 mol.%, 0.5-10 mol.%, 0.5-5 mol.%, 0.5-4.5 mol.%, 0.5-4.0 mol.%, 0.5-3.5 mol.%, 0.5-3.0 mol.%, 0.5-2.5 mol.%, 0.5-2.0 mol.%, 0.5-1.5 mol.%, 0.5-1.0 mol.%, 1.0-10 mol.%, 1.0-5 mol.%, 1.0-4.5 mol.%, 1.0-4.0 mol.%, 1.0-3.5 mol.%, 1.0-3.0 mol.%, 1.0- 2.5 mol.%, 1.0-2.0 mol.%, 1.0-1.5 mol.%, 1.5-5.0 mol.%, 1.5-4.5 mol.%, 1.5-4.0 mol.%, 1.5-3.5 mol.%, 1.5-3.0 mol.%, 1.5-2.5 mol.%, 1.5-2.0 mol.%, 2.0-5.0 mol.%, 2.0-4.5 mol.%, 2.0-4.0 mol.%, 2.0-3.5 mol.%, 2.0-3.0 mol.%, or 2.0-2.5 mol.%. For example, the lipid nanoparticle may comprise a PEG- modified lipid at a content of a about 0.5 mol.%, about 1.0 mol.%, about 1.5 mol.%, about 2.0 mol.%, about 2.5 mol.%, about 3.0 mol.%, about 3.5 mol.%, about 4.0 mol.%, about 4.5 mol.%, about 5.0 mol.%, about 6.0 mol.%, about 7.0 mol.%, about 8.0 mol.%, about 9.0 mol.%, about 10.0 mol.%, or about 15.0 mol.%. In some embodiments, the lipid nanoparticle comprises: (i) 20 to 60 mol.% ionizable cationic lipid (e.g., ionizable amino lipid), (ii) 25 to 55 mol.% sterol or other structural lipid, (iii) 5 to 25 mol.% non-cationic lipid (e.g., phospholipid), and (iv) 0.5 to 15 mol.% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises: (i) 40 to 50 mol.% ionizable cationic lipid (e.g., ionizable amino lipid), (ii) 30 to 45 mol.% sterol or other structural lipid, (iii) 5 to 15 mol.% non-cationic lipid (e.g., phospholipid), and (iv) 1 to 5 mol.% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises: (i) 45 to 50 mol.% ionizable cationic lipid (e.g., ionizable amino lipid), (ii) 35 to 45 mol.% sterol or other structural lipid, (iii) 8 to 12 mol.% non-cationic lipid (e.g., phospholipid), and (iv) 1.5 to 3.5 mol.% PEG-modified lipid. In the following sections, “Compounds” numbered with an “I-” prefix (e.g., “Compound I-1,” “Compound I-2,” “Compound I-3,” “Compound I-VI,” etc., indicate specific ionizable lipid compounds. Likewise, compounds numbered with a “P-” prefix (e.g., “Compound P-I,” etc.) indicate a specific PEG-modified lipid compound. b. Ionizable Amino Lipids In some embodiments, the lipid nanoparticle of the present disclosure comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) that is a compound of Formula (I): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein PATENT ATTORNEY DOCKET NO.50858-145WO3 denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments, in Formula (I), R’ais R’branched; denotes a point of attachment; Raα, Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments, in Formula (I), R’ais R’branched; R’branchedis denotes a point of attachment; Raα, Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 3; and m is 7. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of the compounds of Formula (I), R’ais R’branched; R’branchedis denotes a point of attachment; Raαis C2-12 alkyl; Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; alkyl); n2 is 2; R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments of the compounds of Formula (I), R’ais R’branched; denotes a point of attachment; Raα, Raβ, and Raδare each H; Raγis C2-12 alkyl; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments, the compound of Formula (I) is selected from: PATENT ATTORNEY DOCKET NO.50858-145WO3 (Compound I-2). In some embodiments, the compound of Formula (I) is: (Compound I-3). In some aspects, the disclosure relates to a compound of Formula (Ia): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein denotes a point of attachment; wherein Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2- 12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-; PATENT ATTORNEY DOCKET NO.50858-145WO3 R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some aspects, the disclosure relates to a compound of Formula (Ib): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments of Formula denotes a point of attachment; Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments of Formula denotes a point of attachment; Raβand Raδare each H; Raγis C2-12 alkyl; R2and R3are each PATENT ATTORNEY DOCKET NO.50858-145WO3 C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1- 12 alkyl; l is 5; and m is 7. In some embodiments, the disclosure relates to a compound of Formula (Ic): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments, denotes a point of attachment; Raβ, Raγ, and Raδare each H; Raαis C2-12 alkyl; R2and R3are each C1-14 alkyl; R4is PATENT ATTORNEY DOCKET NO.50858-145WO3 denotes a point of attachment; R10is NH(C1-6 alkyl); n2 is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments, the compound of Formula (Ic) is: (Compound I-2). In some aspects, the disclosure relates to a compound of Formula (II): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein wherein denotes a point of attachment; Raγand Raδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12 alkenyl, wherein at least one of Raγand Raδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγand Rbδare each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Rbγand Rbδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting PATENT ATTORNEY DOCKET NO.50858-145WO3 wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; Yais a C3-6 carbocycle; R*”ais selected from the group consisting of C1-15 alkyl and C2-15 alkenyl; and s is 2 or 3; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-a): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein Raγand Raδare each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Raγand Raδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγand Rbδare each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Rbγand Rbδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; PATENT ATTORNEY DOCKET NO.50858-145WO3 each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-b): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein wherein denotes a point of attachment; Raγand Rbγare each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-c): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein PATENT ATTORNEY DOCKET NO.50858-145WO3 wherein denotes a point of attachment; wherein Raγis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-d): its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein wherein denotes a point of attachment; wherein Raγand Rbγare each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment; wherein PATENT ATTORNEY DOCKET NO.50858-145WO3 R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-e): its N-oxide, or a salt or isomer thereof, wherein wherein R’branched and R’bis: wherein denotes a point of attachment; wherein Raγis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R’ independently is a C1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R’ independently is a C2-5 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each independently a C1-14 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each a C8 alkyl. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), , Raγis a C1-12 alkyl and R2and R3are each independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: is: are each independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), alkyl, and R2and R3are each a C8 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: are each a C2-6 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6 and each R’ independently is a C1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5 and each R’ independently is a C2-5 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, and Raγand Rbγare each a C1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , m and l are each 5, each R’ independently is a C2-5 alkyl, and Raγand Rbγare each a C2-6 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: are each independently selected from 4, 5, and 6, R’ is a C1-12 alkyl, Raγis a C1-12 are each independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: PATENT ATTORNEY DOCKET NO.50858-145WO3 , m and l are each 5, R’ is a C2-5 alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C8alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is , wherein R10is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, Raγand Rbγare each a C1-12 alkyl, and R4is wherein R10is NH(C1-6 alkyl), and n2 is 2. In some embodiments of the , (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: and l are each 5, each R’ independently is a C2-5 alkyl, Raγand Rbγare each a C2-6alkyl, , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , m and l are each independently selected from 4, 5, and 6, R’ is a C1-12 alkyl, R2and R3are each independently a C6-10 alkyl, Raγis a C1-12 alkyl, and , wherein R10is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is -(CH2)nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R4is -(CH2)nOH and n is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, Raγand Rbγare each a C1-12 alkyl, R4is - (CH2)nOH, and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- each R’ independently is a C2-5alkyl, Raγand Rbγare each a C2-6alkyl, R4is -(CH2)nOH, and n is 2. In some aspects, the disclosure relates to a compound of Formula (II-f): wherein denotes a point of attachment; Raγis a C1-12 alkyl; R2and R3are each independently a C1-14 alkyl; R4is -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C1-12 alkyl; m is selected from 4, 5, and 6; and l is selected from 4, 5, and 6. In some embodiments of the compound of Formula (II-f), m and l are each 5, and n is 2, 3, or In some embodiments of the compound of Formula (II-f) R’ is a C2-5 alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C6-10 alkyl. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments of the compound of Formula (II-f), m and l are each 5, n is 2, 3, or 4, R’ is a C2-5 alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C6-10 alkyl. In some aspects, the disclosure relates to a compound of Formula (II-g): Raγis a C2-6 alkyl; R’ is a C2-5 alkyl; and R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment, R10is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3. In some aspects, the disclosure relates to a compound of Formula (II-h): Raγand Rbγare each independently a C2-6 alkyl; each R’ independently is a C2-5 alkyl; and R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting wherein denotes a point of attachment, R10is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3. In some embodiments of the compound of Formula (II-g) or (II-h), R4is , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II-g) or (II-h), R4is -(CH2)2OH. In some aspects, the disclosure relates to a compound having the Formula (III): PATENT ATTORNEY DOCKET NO.50858-145WO3 or a salt or isomer thereof, wherein R1, R2, R3, R4, and R5 are independently selected from the group consisting of C5-20 alkyl, C5-20alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, an aryl group, and a heteroaryl group; X1, X2, and X3are independently selected from the group consisting of a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH2-, -CH2-C(O)-, -C(O)O-CH2-, -OC(O)-CH2-, -CH2-C(O)O-, -CH2-OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and a C3-6 carbocycle; each R’ is independently selected from the group consisting of C1-12 alkyl, C2-12 alkenyl, and H; and each R” is independently selected from the group consisting of C3-12 alkyl and C3-12 alkenyl, and wherein: i) at least one of X1, X2, and X3is not -CH2-; and / or ii) at least one of R1, R2, R3, R4, and R5 is -R”MR’. In some embodiments, R1, R2, R3, R4, and R5 are each C5-20 alkyl; X1is -CH2-; and X2and X3are each -C(O)-. In some embodiments, the compound of Formula (III) is: isomer thereof. c. Phospholipids The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties. PATENT ATTORNEY DOCKET NO.50858-145WO3 A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue. Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye). Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. In some embodiments, a phospholipid of the present disclosure comprises 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1- oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn- glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine,1,2- diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero- 3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1- glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. PATENT ATTORNEY DOCKET NO.50858-145WO3 In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV): (IV), or a salt thereof, wherein: each R1is independently optionally substituted alkyl; or optionally two R1are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the Formula: each instance of L2is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, - C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), - NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), - S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the Formula: , PATENT ATTORNEY DOCKET NO.50858-145WO3 wherein each instance of R2is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl. In some embodiments, the phospholipids may be one or more of the phospholipids described in U.S. Application No.62 / 520,530. i. Phospholipid Head Modifications In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IV), at least one of R1is not methyl. In certain embodiments, at least one of R1is not hydrogen or methyl. In certain embodiments, the compound of Formula (IV) is of one of the following Formulae: or a salt thereof, wherein: each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1, 2, or 3. In certain embodiments, a compound of Formula (IV) is of Formula (IV-a): (IV-a), or a salt thereof. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present disclosure is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IV) is of Formula (IV-b): , (IV-b), or a salt thereof. PATENT ATTORNEY DOCKET NO.50858-145WO3 ii. Phospholipid Tail Modifications In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is DSPC, or analog thereof, with a modified tail. As described herein, a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is of Formula (IV-a), or a salt thereof, wherein at least one instance of R2is each instance of R2is optionally substituted C1-30 alkyl, wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, - OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O. In certain embodiments, the compound of Formula (IV) is of Formula (IV-c): (IV-c), or a salt thereof, wherein: each x is independently an integer between 0-30, inclusive; and each instance is G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, - OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, - S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O. Each possibility represents a separate embodiment of the present disclosure. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, a compound of Formula (IV) is of one of the following Formulae: PATENT ATTORNEY DOCKET NO.50858-145WO3 , or a salt thereof. iii. Alternative Lipids In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid is useful. In certain embodiments, an alternative lipid is used in place of a phospholipid of the present disclosure. In certain embodiments, an alternative lipid of the present disclosure is oleic acid. In certain embodiments, the alternative lipid is one of the following: , , , PATENT ATTORNEY DOCKET NO.50858-145WO3 . d. Structural Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term "structural lipid" refers to sterols and also to lipids containing sterol moieties. Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol. In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No.62 / 520,530. e. Polyethylene Glycol (PEG)-Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more polyethylene glycol (PEG) lipids. As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)-modified lipids. Non- limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2-diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG- DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid includes, but not limited to 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C14 to about C22, preferably from about C14 to about C16. In some embodiments, a PEG moiety, for example an mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some embodiments, the PEG-lipid is PEG2k-DMG. In some embodiments, the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE. PEG-lipids are known in the art, such as those described in U.S. Patent No.8,158,601 and International Publ. No. WO 2015 / 130584 A2, which are incorporated herein by reference in their entirety. In general, some of the other lipid components (e.g., PEG lipids) of various Formulae, described herein may be synthesized as described International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety. The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG- modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG- DPPC, or a PEG-DSPE lipid. In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure: In some embodiments, PEG lipids useful in the present disclosure can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy- PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In PATENT ATTORNEY DOCKET NO.50858-145WO3 certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an –OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present disclosure. In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (V). Provided herein are compounds of Formula (V): (V), or salts thereof, wherein: R3is –ORO; ROis hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L1is optionally substituted C1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10 alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), - NRNC(O)O, or NRNC(O)N(RN); D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the Formula: each instance of L2is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, - C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), - NRNC(S), NRNC(S)N(RN), S(O) , OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), - S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2. In certain embodiments, the compound of Formula (V) is a PEG-OH lipid (i.e., R3is –ORO, and ROis hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH): PATENT ATTORNEY DOCKET NO.50858-145WO3 (V-OH), or a salt thereof. In certain embodiments, a PEG lipid useful in the present disclosure is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (VI). Provided herein are compounds of Formula (VI): (VI), or a salts thereof, wherein: R3is–ORO; ROis hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R5is optionally substituted C10-40 alkyl, optionally substituted C10-40 alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), - NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), - C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), - OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O; and each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group. In certain embodiments, the compound of Formula (VI) is of Formula (VI-OH): (VI-OH), or a salt thereof. In some embodiments, r is 45. In yet other embodiments the compound of Formula (VI) is: or a salt thereof. In one embodiment, r is 40-50. In some embodiments, the compound of Formula (VI) is (Compound P-I). In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid. PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No.62 / 520,530. In some embodiments, a PEG lipid of the present disclosure comprises a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and / or PEG-DPG. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of , and a PEG lipid comprising Formula VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of , and an alternative lipid comprising oleic acid. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of PATENT ATTORNEY DOCKET NO.50858-145WO3 , an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of , a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the present disclosure comprises an N:P ratio of from about 2:1 to about 30:1. In some embodiments, a LNP of the present disclosure comprises an N:P ratio of about 6:1. In some embodiments, a LNP of the present disclosure comprises an N:P ratio of about 3:1. In some embodiments, a LNP of the present disclosure comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1. In some embodiments, a LNP of the present disclosure comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of about 20:1. In some embodiments, a LNP of the present disclosure comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of about 10:1. In some embodiments, a LNP of the present disclosure has a mean diameter from about 50nm to about 150nm. In some embodiments, a LNP of the present disclosure has a mean diameter from about 70nm to about 120nm. PATENT ATTORNEY DOCKET NO.50858-145WO3 As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1-14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups. As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18 alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups. As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups. As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon- carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refer to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles. As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings PATENT ATTORNEY DOCKET NO.50858-145WO3 may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles. As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and / or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls. As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, - CH(OH)-, -P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups. Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=O), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(OR)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-), a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)2OH), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-), a sulfonyl (e.g., S(O)2 ), an amide PATENT ATTORNEY DOCKET NO.50858-145WO3 (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., OC(O)NR2, OC(O)NRH, or OC(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein. Compounds of the disclosure that contain nitrogens can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen- containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N-oxide derivative (which can be designated as N→O or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives. f. Other Lipid Composition Components The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No.2005 / 0222064. Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof). A polymer can be included in and / or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and / or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt / wt). PATENT ATTORNEY DOCKET NO.50858-145WO3 In some embodiments, the ratio between the lipid composition and the polynucleotide can be about 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1 (wt / wt). In some embodiments, the wt / wt ratio of the lipid composition to the polynucleotide encoding a therapeutic agent is about 20:1 or about 15:1. In some embodiments, the pharmaceutical composition disclosed herein can contain more than one polypeptide. For example, a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA). In some embodiments, the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid:polynucleotide weight ratio of 5:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1 or 70:1, or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1, from about 5:1 to about 15:1, from about 5:1 to about 20:1, from about 5:1 to about 25:1, from about 5:1 to about 30:1, from about 5:1 to about 35:1, from about 5:1 to about 40:1, from about 5:1 to about 45:1, from about 5:1 to about 50:1, from about 5:1 to about 55:1, from about 5:1 to about 60:1, from about 5:1 to about 70:1, from about 10:1 to about 15:1, from about 10:1 to about 20:1, from about 10:1 to about 25:1, from about 10:1 to about 30:1, from about 10:1 to about 35:1, from about 10:1 to about 40:1, from about 10:1 to about 45:1, ...

Claims

PATENT ATTORNEY DOCKET NO.50858-145WO3 CLAIMS 1. A nucleic acid comprising: (i) a modified 5’ region and / or a modified 3’region; and (ii) an internal ribosome entry site (IRES) operably linked to an open reading frame encoding a polypeptide; wherein the nucleic acid does not comprise a 5’ cap.

2. A nucleic acid comprising (i) a modified 5’ region and / or a modified 3’ region; and (ii) an IRES operably linked to an open reading frame encoding a polypeptide; wherein the nucleic acid is translatable in the absence of a 5’ cap.

3. The nucleic acid of claim 1 or 2, wherein the IRES comprises one or more polynucleotide tracts enriched in uridine or a modified uridine.

4. The nucleic acid of claim 3, wherein the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine.

5. The nucleic acid of claim 4, wherein the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine, optionally wherein the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

6. The nucleic acid of claim 5, wherein the IRES comprises 3 of the polynucleotide tracts enriched in uridine or a modified uridine.

7. The nucleic acid of claim 5, wherein the IRES comprises 4 of the polynucleotide tracts enriched in uridine or a modified uridine.

8. The nucleic acid of claim 5, wherein the IRES comprises 5 of the polynucleotide tracts enriched in uridine or a modified uridine.

9. The nucleic acid of claim 5, wherein the IRES comprises 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

10. The nucleic acid of any one of claims 1-9, wherein at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

11. The nucleic acid of claim 10, wherein at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.PATENT ATTORNEY DOCKET NO.50858-145WO3 12. The nucleic acid of claim 11, wherein at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

13. The nucleic acid of claim 12, wherein at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

14. The nucleic acid of claim 13, wherein at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

15. The nucleic acid of claim 14, wherein at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

16. The nucleic acid of claim 15, wherein all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.

17. The nucleic acid of any one of claims 1-16, wherein each polynucleotide tract, independently, is from 5 to 20 nucleosides in length.

18. The nucleic acid of claim 17, wherein each polynucleotide tract, independently, is from 6 to 15 nucleosides in length.

19. The nucleic acid of claim 18, wherein each polynucleotide tract, independently, is from 7 to 11 nucleosides in length.

20. The nucleic acid of claim 19, wherein each polynucleotide tract is 9 nucleosides in length.

21. The nucleic acid of any one of claims 1-20, wherein each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides.

22. The nucleic acid of claim 21, wherein each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides.

23. The nucleic acid of claim 22, wherein each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides.

24. The nucleic acid of any one of claims 1-23, wherein each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides.

25. The nucleic acid of claim 24, wherein each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.PATENT ATTORNEY DOCKET NO.50858-145WO3 26. The nucleic acid of any one of claims 1-25, wherein each polynucleotide tract is enriched in the modified uridine.

27. The nucleic acid of any one of claims 1-26, wherein the modified uridine is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1- methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O- methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5- carbamoylmethyl-2′-O-methyl-uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine.

28. The nucleic acid of claim 27, wherein the modified uridine is 1-methylpseudouridine.

29. The nucleic acid of any one of claims 1-28, wherein the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame.

30. The nucleic acid of claim 29, wherein the open reading frame is further operably linked to a 3’ UTR.

31. The nucleic acid of any one of claims 1-30, wherein the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides.PATENT ATTORNEY DOCKET NO.50858-145WO3 32. The nucleic acid of claim 31, wherein each of the spacers, independently, comprises from 10 to 40 nucleosides.

33. The nucleic acid of claim 32, wherein each of the spacers, independently, comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 nucleosides.

34. The nucleic acid of any one of claims 1-33, wherein the IRES is represented by the formula: [(N)n – (U’)m]p wherein: each N is, independently, any nucleoside residue; each U’ is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.

35. The nucleic acid of claim 34, wherein each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

36. The nucleic acid of claim 35, wherein each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

37. The nucleic acid of claim 35 or 36, wherein the modified uridine of N is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1- methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-PATENT ATTORNEY DOCKET NO.50858-145WO3 methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5- carbamoylmethyl-2′-O-methyl-uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine.

38. The nucleic acid of claim 37, wherein the modified uridine of N is 1-methylpseudouridine.

39. The nucleic acid of any one of claims 35, 37, and 38, wherein the modified cytidine of N is 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1- methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl-cytidine, 5,2′-O-dimethyl-cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl-2′-O-methyl- cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐ cytidine.

40. The nucleic acid of any one of claims 35 and 37-39, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl-adenosine, N6,N6,2′-O- trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1-thio- adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐adenosine, or N6‐(19‐ amino‐pentaoxanonadecyl)-adenosine.

41. The nucleic acid of any one of claims 35 and 37-40, wherein the modified guanosine of N is inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2,PATENT ATTORNEY DOCKET NO.50858-145WO3 N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl-guanosine, N2-methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl-guanosine, 1-methyl-2′-O-methyl- guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl-inosine, 2′-O- ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐guanosine, or 2’‐F‐guanosine.

42. The nucleic acid of any one of claims 34-41, wherein the modified uridine of U’ is 1- methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1- methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O- methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5- carbamoylmethyl-2′-O-methyl-uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine.

43. The nucleic acid of claim 42, wherein the modified uridine of U’ is 1-methylpseudouridine.

44. The nucleic acid of any one of claims 34-43, wherein each n is, independently, an integer from 10 to 40.

45. The nucleic acid of claim 44, wherein each n is, independently, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38.

46. The nucleic acid of any one of claims 34-45, wherein each m is, independently, an integer from 2 to 15.

47. The nucleic acid of claim 46, wherein each m is, independently, an integer from 7 to 11.PATENT ATTORNEY DOCKET NO.50858-145WO3 48. The nucleic acid of claim 47, wherein each m is 9.

49. The nucleic acid of any one of claims 34-48, wherein p is an integer from 2 to 10.

50. The nucleic acid of claim 49, wherein p is an integer from 3 to 6, optionally wherein p is 3 or 6.

51. The nucleic acid of claim 1 or 2, wherein the IRES comprises three polynucleotide tracts, wherein each of the three polynucleotide tracts comprises 9 contiguous 1-methylpseudouridine residues, and wherein each tract is separated from one another by two 13-nucleoside spacers.

52. The nucleic acid of claim 1 or 2, wherein the IRES has the nucleic acid sequence of SEQ ID NO:

4.

53. The nucleic acid of claim 1 or 2, wherein the IRES is a CVB3 IRES.

54. The nucleic acid of any one of claims 1-53, wherein the nucleic acid is RNA.

55. The nucleic acid of any one of claims 1-54, wherein the nucleic acid is linear.

56. The nucleic acid of any one of claims 1-54, wherein the nucleic acid is circular.

57. The nucleic acid of any one of claims 1-56, wherein the open reading frame consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

58. The nucleic acid of claim 57, wherein the open reading frame consists of nucleosides selected from adenosine, uridine, a modified uridine, thymidine, a modified thymidine, guanosine, and cytidine.

59. The nucleic acid of claim 57 or 58, wherein the modified uridine of the open reading frame is 1-methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio- 5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-PATENT ATTORNEY DOCKET NO.50858-145WO3 taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1- methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O- methyl-pseudouridine, 2-thio-2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5- carbamoylmethyl-2′-O-methyl-uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’‐F‐ara‐uridine, 2’‐F‐uridine, 2’‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, or 5‐[3‐(1‐E‐propenylamino)uridine.

60. The nucleic acid of claim 59, wherein the modified uridine of the open reading frame is 1- methylpseudouridine.

61. The nucleic acid of any one of claims 57, 59, and 60, wherein the modified cytidine of the open reading frame is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl- cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl- cytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5- methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O- methyl-cytidine, 5,2′-O-dimethyl-cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5- formyl-2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2’‐F‐ara‐cytidine, 2’‐F‐cytidine, or 2’‐OH‐ara‐cytidine.

62. The nucleic acid of any one of claims 57 and 59-61, wherein the modified adenosine of the open reading frame is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2- amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino- purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1- methyl-adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6- isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6- threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6- threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2- methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2- methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, N6,2′-O-dimethyl- adenosine, N6,N6,2′-O-trimethyl-adenosine, 1,2′-O-dimethyl-adenosine, 2′-O-ribosyladenosine, 2-amino-PATENT ATTORNEY DOCKET NO.50858-145WO3 N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2’‐F‐ara‐adenosine, 2’‐F‐adenosine, 2’‐OH‐ara‐ adenosine, or N6‐(19‐amino‐pentaoxanonadecyl)-adenosine.

63. The nucleic acid of any one of claims 57 and 59-62, wherein the modified guanosine of the open reading frame is inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7- aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7- deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7- methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl- guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo- guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α- thio-guanosine, 2′-O-methyl-guanosine, N2-methyl-2′-O-methyl-guanosine, N2,N2-dimethyl-2′-O-methyl- guanosine, 1-methyl-2′-O-methyl-guanosine, N2,7-dimethyl-2′-O-methyl-guanosine, 2′-O-methyl-inosine, 1,2′-O-dimethyl-inosine, 2′-O-ribosylguanosine, 1-thio-guanosine, O6-methyl-guanosine, 2’‐F‐ara‐ guanosine, or 2’‐F‐guanosine.

64. The nucleic acid of any one of claims 1-63, wherein the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane- bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.

65. The nucleic acid of any one of claims 2-64, wherein the nucleic acid does not comprise a 5’ cap.

66. The nucleic acid of any one of claims 2-55 and 57-64, wherein the nucleic acid comprises a 5’ cap.

67. The nucleic acid of any one of claims 1-66, wherein the nucleic acid comprises a modified 5’ region.

68. The nucleic acid of any one of claims 1-67, wherein the nucleic acid comprises a modified 3’ region.

69. The nucleic acid of any one of claims 1-68, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modification selected from the group consisting of a terminal group, a modified internucleoside linkage, and a modified ribose.

70. The nucleic acid of claim 69, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modified ribose.PATENT ATTORNEY DOCKET NO.50858-145WO3 71. The nucleic acid of claim 70, wherein the at least one modified ribose is a 2’-deoxyribose, a 2’-OMe ribose, a 2’-O-methoxyethyl ribose (2’-MOE), a 2’-F ribose, a 2’-NH2 ribose, a 2’fluoroarabino ribose (FANA), a locked nucleic acid (LNA), or a 4’-S ribose.

72. The nucleic acid of claim 70 or 71, wherein the at least one modified ribose is a 2’-OMe ribose, an LNA, or a 2'-deoxyribose.

73. The nucleic acid of any one of claims 70-72, wherein the at least one modified ribose is an LNA.

74. The nucleic acid of any one of claims 70-72, wherein the at least one modified ribose is a 2’- deoxyribose.

75. The nucleic acid of any one of claims 70-72, wherein the at least one modified ribose is a 2’- OMe ribose.

76. The nucleic acid of any one of claims 70-75, wherein the modified 5’region and / or the modified 3’ region comprises at least 2 modified riboses.

77. The nucleic acid of any one of claims 1-76, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modified internucleoside linkage.

78. The nucleic acid of claim 77, wherein the at least one modified internucleoside linkage is a phosphorothioate, a phosphoroselenate, a boranophosphate, a boranophosphate ester, a hydrogen phosphonate, a phosphoramidate, a phosphorodiamidate, an alkyl phosphonate, an aryl phosphonate, a phosphotriester, a phosphorodithioate, a bridged phosphoramidate, a bridged phosphorothioate, a bridged methylene-phosphonate, or an α-thio phosphate.

79. The nucleic acid of claim 78, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

80. The nucleic acid of any one of claims 77-79, wherein the modified 5’ region and / or the modified 3’ region comprises at least two modified internucleoside linkages.

81. The nucleic acid of any one of claims 1-80, wherein the modified 5’ region and / or the modified 3’ region comprises a terminal group.

82. The nucleic acid of claim 81, wherein the terminal group is a 5' triphosphate, a 5’ phosphate, a 5’ hydroxyl, a biotinylated phosphate, an inverted nucleobase, spacer 18, cap1, or a poly adenosine.PATENT ATTORNEY DOCKET NO.50858-145WO3 83. The nucleic acid of claim 81 or 82, wherein the terminal group is a 5’ triphosphate.

84. The nucleic acid of claim 81 or 82, wherein the terminal group is a 5’ hydroxyl.

85. The nucleic acid of claim 81 or 82, wherein the terminal group is Cap1.

86. The nucleic acid of claim 81 or 82, wherein the terminal group is spacer 18.

87. The nucleic acid of claim 81 or 82, wherein the terminal group is a 5’ phosphate.

88. The nucleic acid of claim 81 or 82, wherein the terminal group is an inverted nucleobase.

89. The nucleic acid of claim 88, wherein the inverted nucleobase is an inverted deoxythymidine.

90. The nucleic acid of claim 88 or 89, wherein the inverted nucleobase comprises the structure of Formula XI:or a salt thereof; wherein each X is, independently O or S; and A represents adenine and T represents thymine.

91. The nucleic acid of any one of claims 1-90, wherein the modified 5’ region has the structure of Formula XLIX: A -N1-L1-N2-(L2)a-(N3)b-(L3)c-(N4)d-(L4)e-(N5)f-(L5)g-(N6)h- Formula XLIX wherein Q is a terminal group; each of N1, N2, N3, N4, N5, and N6 is, independently, a nucleoside or a modified nucleoside; each of L1, L2, L3, L4, and L5 is, independently, an internucleoside linkage; and each of a, b, c, d, e, f, g, and h is, independently, 0 or 1.

92. The nucleic acid of claim 91, wherein Q is a 5’ triphosphate.

93. The nucleic acid of claim 91, wherein Q is a 5’ phosphate.

94. The nucleic acid of claim 91, wherein Q is spacer 18.PATENT ATTORNEY DOCKET NO.50858-145WO3 95. The nucleic acid of claim 91, wherein Q is cap1.

96. The nucleic acid of claim 91, wherein Q is hydroxyl.

97. The nucleic acid of claim 91, wherein Q is a biotinylated phosphate.

98. The nucleic acid of claim 91, wherein Q is inverted deoxythymidine.

99. The nucleic acid of any one of claims 91-98, wherein each of N1, N2, N3, N4, N5, and N6 is, independently, guanosine, modified guanosine, adenosine, modified adenosine, cytosine, or modified cytosine.

100. The nucleic acid of any one of claims 91-99, wherein N1 is guanosine, modified guanosine, adenosine, or modified adenosine.

101. The nucleic acid of any one of claims 91-100, wherein N2 is guanosine, modified guanosine, cytosine, modified cytosine, adenosine, or modified adenosine.

102. The nucleic acid of any one of claims 91-101, wherein N3 is cytosine, modified cytosine, adenosine, modified adenosine, guanosine, or modified guanosine.

103. The nucleic acid of any one of claims 91-102, wherein N4 is adenosine, modified adenosine, guanosine, or modified guanosine.

104. The nucleic acid of any one of claims 91-103, wherein N5 is guanosine, modified guanosine, adenosine, or modified adenosine.

105. The nucleic acid of any one of claims 91-104, wherein N6 is adenosine, modified adenosine, cytosine, or modified cytosine.

106. The nucleic acid of any one of claims 91-105, wherein each of N1, N2, N3, N4, N5, and N6 is, independently, an unmodified ribonucleoside, a 2’-deoxy ribonucleoside, a 2’-methoxy ribonucleoside, or a locked nucleic acid (LNA).

107. The nucleic acid of any one of claims 91-106, wherein N1 is an unmodified ribonucleoside.

108. The nucleic acid of any one of claims 91-106, wherein N1 is a 2’-methoxy ribonucleoside.

109. The nucleic acid of any one of claims 91-106, wherein N1 is a 2’-deoxyribonucleoside.PATENT ATTORNEY DOCKET NO.50858-145WO3 110. The nucleic acid of any one of claims 91-106, wherein N1 is an LNA.

111. The nucleic acid of any one of claims 91-110, wherein N2 is an unmodified ribonucleoside.

112. The nucleic acid of any one of claims 91-110, wherein N2 is a 2’-methoxy ribonucleoside.

113. The nucleic acid of any one of claims 91-110, wherein N2 is a 2’-deoxyribonucleoside.

114. The nucleic acid of any one of claims 91-110, wherein N2 is an LNA.

115. The nucleic acid of any one of claims 91-114, wherein N3 is an unmodified ribonucleoside.

116. The nucleic acid of any one of claims 91-114, wherein N3 is a 2’-methoxy ribonucleoside.

117. The nucleic acid of any one of claims 91-114, wherein N3 is an LNA.

118. The nucleic acid of any one of claims 91-117, wherein N4 is an unmodified ribonucleoside.

119. The nucleic acid of any one of claims 91-117, wherein N4 is a 2’-methoxy ribonucleoside.

120. The nucleic acid of any one of claims 91-117, wherein N4 is an LNA.

121. The nucleic acid of any one of claims 91-120, wherein N5 is an unmodified ribonucleoside.

122. The nucleic acid of any one of claims 91-120, wherein N5 is a 2’-methoxy ribonucleoside.

123. The nucleic acid of any one of claims 91-120, wherein N5 is an LNA.

124. The nucleic acid of any one of claims 91-123, wherein N6 is an unmodified ribonucleoside.

125. The nucleic acid of any one of claims 91-123, wherein N6 is a 2’-methoxy ribonucleoside.

126. The nucleic acid of any one of claims 91-123, wherein N6 is an LNA.

127. The nucleic acid of any one of claims 91-126, wherein each of L1, L2, L3, L4, and L5 is, independently, a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

128. The nucleic acid of claim 127, wherein L1 and L2 are each a phosphorothioate internucleoside linkage.PATENT ATTORNEY DOCKET NO.50858-145WO3 129. The nucleic acid of claim 127 or 128, wherein L3 is a phosphorothioate internucleoside linkage.

130. The nucleic acid claim 127 or 128, wherein L3 is a phosphodiester internucleoside linkage.

131. The nucleic acid of any one of claims 127-130, wherein L4 and L5 are phosphodiester internucleoside linkages.

132. A nucleic acid comprising: (i) a modified 5’ region and / or a modified 3’ region; and (ii) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (eIF4G), eukaryotic translation initiation factor 4G2 (eIF4G2), eukaryotic translation initiation factor 3 (eIF3), La protein, or an IRES trans-acting factors (ITAf)), or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf) fused to an RNA-binding protein; operably linked to (iii) an open reading frame encoding a polypeptide wherein the nucleic acid does not comprise a 5’ cap.

133. A nucleic acid comprising: (i) a modified 5’ region and / or a modified 3’ region; and (ii) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (eIF4G), eukaryotic translation initiation factor 4G2 (eIF4G2), eukaryotic translation initiation factor 3 (eIF3), La protein, or an IRES trans-acting factors (ITAf)), or a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf) fused to an RNA-binding protein; operably linked to (iii) an open reading frame encoding a polypeptide wherein the nucleic acid is translatable in the absence of a 5’ cap 134. The nucleic acid of claim 132 or 133, wherein the one or more polynucleotides specifically bind eIF4G.

135. The nucleic acid of claim 134, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1-methylpseudouridine.

136. The nucleic acid of claim 135, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1-methylpseudouridine.PATENT ATTORNEY DOCKET NO.50858-145WO3 137. The nucleic acid of claim 132 or 133, wherein the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides comprise one or more MS2 RNA hairpins.

138. The nucleic acid of any one of claims 133-137, wherein the nucleic acid does not comprise a 5’ cap.

139. The nucleic acid of any one of claims 133-137, wherein the nucleic acid comprises a 5’ cap.

140. The nucleic acid of any one of claims 132-139, wherein the nucleic acid comprises a modified 5’ region.

141. The nucleic acid of any one of claims 132-140, wherein the nucleic acid comprises a modified 3’ region.

142. The nucleic acid of any one of claims 132-141, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modification selected from the group consisting of a terminal group, a modified internucleoside linkage, and a modified ribose.

143. The nucleic acid of claim 142, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modified ribose.

144. The nucleic acid of claim 143, wherein the at least one modified ribose is a 2’-deoxyribose, a 2’-OMe ribose, a 2’-O-methoxyethyl ribose (2’-MOE), a 2’-F ribose, a 2’-NH2 ribose, a 2’fluoroarabino ribose (FANA), a locked nucleic acid (LNA), or a 4’-S ribose.

145. The nucleic acid of claim 143 or 144, wherein the at least one modified ribose is a 2’-OMe ribose, an LNA, or a 2'-deoxyribose.

146. The nucleic acid of any one of claims 143-145, wherein the at least one modified ribose is an LNA.

147. The nucleic acid of any one of claims 143-145, wherein the at least one modified ribose is a 2’-deoxyribose.

148. The nucleic acid of any one of claims 143-145, wherein the at least one modified ribose is a 2’-OMe ribose.PATENT ATTORNEY DOCKET NO.50858-145WO3 149. The nucleic acid of any one of claims 143-148, wherein the modified 5’region and / or the modified 3’ region comprises at least 2 modified riboses.

150. The nucleic acid of any one of claims 132-149, wherein the modified 5’ region and / or the modified 3’ region comprises at least one modified internucleoside linkage.

151. The nucleic acid of claim 150, wherein the at least one modified internucleoside linkage is a phosphorothioate, a phosphoroselenate, a boranophosphate, a boranophosphate ester, a hydrogen phosphonate, a phosphoramidate, a phosphorodiamidate, an alkyl phosphonate, an aryl phosphonate, a phosphotriester, a phosphorodithioate, a bridged phosphoramidate, a bridged phosphorothioate, a bridged methylene-phosphonate, or an α-thio phosphate.

152. The nucleic acid of claim 151, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

153. The nucleic acid of any one of claims 149-152, wherein the modified 5’ region and / or the modified 3’ region comprises at least two modified internucleoside linkages.

154. The nucleic acid of any one of claims 132-153, wherein the modified 5’ region and / or the modified 3’ region comprises a terminal group.

155. The nucleic acid of claim 154, wherein the modified terminal group is a 5' triphosphate, a 5’ phosphate, a 5’ hydroxyl, a biotinylated phosphate, an inverted nucleobase, spacer 18, cap1, or a poly adenosine.

156. The nucleic acid of claim 154 or 155, wherein the modified terminal group is a 5’ triphosphate.

157. The nucleic acid of claim 154 or 155, wherein the modified terminal group is a 5’ hydroxyl.

158. The nucleic acid of claim 154 or 155, wherein the modified terminal group is Cap1.

159. The nucleic acid of claim 154 or 155, wherein the modified terminal group is spacer 18.

160. The nucleic acid of claim 154 or 155, wherein the modified terminal group is a 5’ phosphate.

161. The nucleic acid of claim 154 or 155, wherein the modified terminal group is an inverted nucleobase.

162. The nucleic acid of claim 161, wherein the inverted nucleobase is an inverted deoxythymidine.PATENT ATTORNEY DOCKET NO.50858-145WO3 163. The nucleic acid of claim 161 or 162, wherein the inverted nucleobase comprises the structure of Formula XI:or a salt thereof; wherein each X is, independently O or S; and A represents adenine and T represents thymine.

164. The nucleic acid of any one of claims 132-163, wherein the modified 5’ region and / or the modified 3’ region has the structure of Formula XLIX: A -N1-L1-N2-(L2)a-(N3)b-(L3)c-(N4)d-(L4)e-(N5)f-(L5)g-(N6)h-Z Formula XLIX wherein Q is a terminal group; Z is a bond between the 5’ region or the 3’ region and the rest of the nucleic acid; each of N1, N2, N3, N4, N5, and N6 is, independently, a nucleoside or a modified nucleoside; each of L1, L2, L3, L4, and L5 is, independently, an internucleoside linkage; and each of a, b, c, d, e, f, g, and h is, independently, 0 or 1.

165. The nucleic acid of claim 164, wherein Q is a 5’ triphosphate.

166. The nucleic acid of claim 164, wherein Q is a 5’ phosphate.

167. The nucleic acid of claim 164, wherein Q is spacer 18.

168. The nucleic acid of claim 164, wherein Q is cap1.

169. The nucleic acid of claim 164, wherein Q is hydroxyl.

170. The nucleic acid of claim 164, wherein Q is a biotinylated phosphate.

171. The nucleic acid of claim 164, wherein Q is inverted deoxythymidine.

172. The nucleic acid of any one of claims 164-171, wherein each of N1, N2, N3, N4, N5, and N6 is, independently, guanosine, modified guanosine, adenosine, modified adenosine, cytosine, or modified cytosine.PATENT ATTORNEY DOCKET NO.50858-145WO3 173. The nucleic acid of any one of claims 164-172, wherein N1 is guanosine, modified guanosine, adenosine, or modified adenosine.

174. The nucleic acid of any one of claims 164-173, wherein N2 is guanosine, modified guanosine, cytosine, modified cytosine, adenosine, or modified adenosine.

175. The nucleic acid of any one of claims 164-174, wherein N3 is cytosine, modified cytosine, adenosine, modified adenosine, guanosine, or modified guanosine.

176. The nucleic acid of any one of claims 164-175, wherein N4 is adenosine, modified adenosine, guanosine, or modified guanosine.

177. The nucleic acid of any one of claims 164-176, wherein N5 is guanosine, modified guanosine, adenosine, or modified adenosine.

178. The nucleic acid of any one of claims 164-177, wherein N6 is adenosine, modified adenosine, cytosine, or modified cytosine.

179. The nucleic acid of any one of claims 164-178, wherein each of N1, N2, N3, N4, N5, and N6 is, independently, an unmodified ribonucleoside, a 2’-deoxy ribonucleoside, a 2’-methoxy ribonucleoside, or a locked nucleic acid (LNA).

180. The nucleic acid of any one of claims 164-179, wherein N1 is an unmodified ribonucleoside.

181. The nucleic acid of any one of claims 164-179, wherein N1 is a 2’-methoxy ribonucleoside.

182. The nucleic acid of any one of claims 164-179, wherein N1 is a 2’-deoxyribonucleoside.

183. The nucleic acid of any one of claims 164-179, wherein N1 is an LNA.

184. The nucleic acid of any one of claims 164-183, wherein N2 is an unmodified ribonucleoside.

185. The nucleic acid of any one of claims 164-183, wherein N2 is a 2’-methoxy ribonucleoside.

186. The nucleic acid of any one of claims 164-183, wherein N2 is a 2’-deoxyribonucleoside.

187. The nucleic acid of any one of claims 164-183, wherein N2 is an LNA.

188. The nucleic acid of any one of claims 164-183, wherein N3 is an unmodified ribonucleoside.

189. The nucleic acid of any one of claims 164-183, wherein N3 is a 2’-methoxy ribonucleoside.PATENT ATTORNEY DOCKET NO.50858-145WO3 190. The nucleic acid of any one of claims 164-183, wherein N3 is an LNA.

191. The nucleic acid of any one of claims 164-190, wherein N4 is an unmodified ribonucleoside.

192. The nucleic acid of any one of claims 164-190, wherein N4 is a 2’-methoxy ribonucleoside.

193. The nucleic acid of any one of claims 164-190, wherein N4 is an LNA.

194. The nucleic acid of any one of claims 164-193, wherein N5 is an unmodified ribonucleoside.

195. The nucleic acid of any one of claims 164-193, wherein N5 is a 2’-methoxy ribonucleoside.

196. The nucleic acid of any one of claims 164-193, wherein N5 is an LNA.

197. The nucleic acid of any one of claims 164-196, wherein N6 is an unmodified ribonucleoside.

198. The nucleic acid of any one of claims 164-196, wherein N6 is a 2’-methoxy ribonucleoside.

199. The nucleic acid of any one of claims 164-196, wherein N6 is an LNA.

200. The nucleic acid of any one of claims 164-199, wherein each of L1, L2, L3, L4, and L5 is, independently, a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

201. The nucleic acid of claim 200, wherein L1 and L2 are each a phosphorothioate internucleoside linkage.

202. The nucleic acid of claim 200 or 201, wherein L3 is a phosphorothioate internucleoside linkage.

203. The nucleic acid of claim 200 or 201, wherein L3 is a phosphodiester internucleoside linkage.

204. The nucleic acid of any one of claims 200-203, wherein L4 and L5 are phosphodiester internucleoside linkages.

205. A polypeptide expression system comprising: (i) the nucleic acid of any one of claims 132-204; and (ii) a nucleic acid comprising an open reading frame that encodes a translation initiation factor (e.g., eIF4G, eIF4G2, eIF3, La protein, or an ITAf).PATENT ATTORNEY DOCKET NO.50858-145WO3 206. The polypeptide expression system of claim 205, wherein the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.

207. The polypeptide expression system of claim 205 or 206, wherein the nucleic acid of (ii) comprises, from 5’ to 3’: (i) a 5’ UTR; (ii) the open reading frame encoding the eIF4G, La protein, or functional variant thereof; and (iii) a 3’ UTR.

208. The polypeptide expression system of claim 207, wherein the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.

209. A host cell comprising the nucleic acid of any one of claims 1-204 or the polypeptide expression system of any one of claims 205-208.

210. The host cell of claim 209, wherein the host cell is a eukaryotic cell.

211. The host cell of claim 210, wherein the eukaryotic cell is a mammalian cell.

212. The host cell of claim 211, wherein the mammalian cell is a human cell.

213. A method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid of any one of claims 1-204 or the polypeptide expression system of any one of claims 205-208.

214. A method of expressing a polypeptide in a cell or population of cells, the method comprising providing to the cell or population of cells the nucleic acid of any one of claims 1-204 or the polypeptide expression system of any one of claims 205-208.

215. A method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid of any one of claims 1- 204 or the polypeptide expression system of any one of claims 205-208, wherein the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.

Images