Methods of treating viral infection
Patent Information
- Application Number
- EP2023918913
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-01-31
- Publication Date
- 2025-12-10
AI Technical Summary
Current antiviral therapies are insufficient in completely eliminating viral infections, particularly latent viral infections, as viruses hide within cells, making them difficult targets for the immune system and existing treatments.
Modulating intracellular calcium signaling to disrupt viral synapse formation and promote viral protein ubiquitination and degradation, thereby exposing viral peptides to the immune system, using modulators such as Bcl-2 inhibitors, PD-1/PD-L1 pathway inhibitors, and calcium channel blockers.
This approach enhances immune recognition and treatment of viral infections by inhibiting viral synapse formation and promoting the degradation of viral proteins, potentially leading to improved immune response and reduced viral load.
Smart Images

Figure AU2023050059_08082024_PF_FP
Abstract
Description
[0001] METHODS OF TREATING VIRAL INFECTIONS
[0002] FIELD
[0003] The present disclosure relates to the field of therapeutic methods for the treatment of viral infections, and more particularly latent viral infections, using modulators of intracellular calcium signalling.
[0004] BACKGROUND
[0005] Viral infections cause serious epidemics affecting millions of individuals every year (e.g., HIV, 2009 H1N1 pandemic flu, COVID-19) and are of major concern for human health. Viruses pose a considerable challenge to the body’s immune system because they hide inside cells. This makes it difficult for antibodies to reach them. Some special immune system cells, called T- lymphocytes, can recognise and kill cells containing viruses, since the surface of infected cells is changed when the virus begins to multiply.
[0006] Treatment of viral infections is still a major challenge as viruses do not have easy targets to attack. Virus-infected cells harbor invaders that control their biosynthetic machinery, and need to be eliminated, cured, or restored. Current antiviral therapies include many drugs, however, these are often not sufficient to completely eliminate the virus.
[0007] Thus, there remains a need for improved therapies for treating viral infections, particularly latent viral infections.
[0008] SUMMARY
[0009] In producing the present invention, the inventors surprisingly identified that local intracellular calcium signalling is important for the polarised targeting of viral complexes during synapse formation. The inventors have found that modulation of intracellular calcium signalling can lead to disruption of viral synapse formation and subsequent viral protein ubiquitination and degradation, which may result in surface presentation of viral peptides. This process potentially exposes the viral peptides to the immune system in what would normally be a covert process.
[0010] The findings by the inventors provide the basis for methods of the present disclosure described herein.
[0011] Accordingly, in a first aspect, the present disclosure relates to a method of promoting immune recognition of a cell comprising a virus in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0012] In a second aspect, the present disclosure relates to a method of inhibiting or disrupting viral synapse formation by a virus in a cell of a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling. In a third aspect, the present disclosure relates to a method of treating a viral infection in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0013] In a fourth aspect, the present disclosure relates to the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for promoting immune recognition of a cell comprising a virus.
[0014] In a fifth aspect, the present disclosure relates to the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for inhibiting viral synapse formation by a virus in a cell.
[0015] In a sixth aspect, the present disclosure relates to the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for treating a viral infection.
[0016] In a seventh aspect, the present disclosure relates to a method for identifying, designing or producing an agent for use in treating a viral infection, said method including the steps of:
[0017] (a) contacting a cell infected with a virus with a candidate agent; and
[0018] (b) determining whether the candidate agent promotes immune recognition and / or inhibits viral synapse formation of the virus.
[0019] In an eighth aspect, the present disclosure relates to an agent produced according to the method of the seventh aspect, for use in the treatment of a viral infection in a subject.
[0020] Referring to each of the above aspects, the virus or viral infection suitably has a latent phase.
[0021] Referring to each of the above aspects, the virus or viral infection is suitably selected from the group consisting of human immunodeficiency virus (HIV), dengue virus (DENV), hepatitis B virus (HBV), zika virus (ZIKV) and combinations thereof.
[0022] In various examples, the present methods of the first, second and third aspects, further include the step of administering a therapeutically effective amount of an antiviral agent.
[0023] In some examples, the medicament of the fourth, fifth and sixth aspects may further comprise an antiviral agent and / or be formulated to be administered in combination with an antiviral agent.
[0024] Suitably, the antiviral agent is or comprises anti-retroviral therapy (ART).
[0025] In some examples, the ART is selected from the group consisting of highly active antiretroviral therapy (HAART), a protease inhibitor, a fusion inhibitor, an integrase inhibitor, a co-receptor specific agent, a non-nucleoside analogue reverse transcriptase inhibitor, a nucleoside analogue reverse transcriptase inhibitor and combinations thereof.
[0026] Referring to the first aspect, the modulator suitably inhibits or disrupts formation of a viral synapse in the cell.
[0027] In some examples, the modulator is an inhibitor of a calcium-viral protein interaction.
[0028] In various examples, the modulator induces ubiquitination and / or degradation of a structural viral protein.
[0029] In certain examples, the modulator is selected from the group consisting of a B-cell lymphoma 2 (Bcl-2) inhibitor, a programmed cell death protein 1 (PD-l) / programmed cell death ligand 1 (PD-L1) pathway inhibitor, a cyclooxygenase-2 (COX-2) inhibitor, a calcium channel blocker and / or antagonist, a kinase inhibitor, a P-Hydroxy -methylglutaryl-CoA (HMG-CoA) reductase inhibitor and combinations thereof.
[0030] Suitably, the Bcl-2 inhibitor is selected from the group consisting of ABT-737, Venetoclax and combinations thereof.
[0031] In particular examples, the PD-1 / PD-L1 pathway inhibitor is selected from the group consisting of pembrolizumab, nivolumab and combinations thereof.
[0032] In certain examples, the COX-2 inhibitor is celecoxib.
[0033] In some examples, the MAPK pathway inhibitor is trametinib.
[0034] In various examples, the AKT pathway inhibitor is selected from the group consisting of ipatasertib, capivasertib and combinations thereof.
[0035] For the aforementioned aspects, the cell is an immune cell. Suitably, the immune cell is a T cell or a B cell, preferably a CD4+ T cell.
[0036] Referring to the seventh aspect, the method further comprises comparing the efficacy of at least two candidate agents to identify an optimal candidate agent.
[0037] In various examples, step (b) of the seventh aspect includes determining whether the candidate agent promotes ubiquitination of a viral protein of the virus.
[0038] Referring to the seventh aspect, the method further includes one or more of the steps of:
[0039] (i) selecting the candidate agent that promotes immune recognition and / or inhibits viral synapse formation of the virus;
[0040] (ii) formulating the candidate agent into a pharmaceutical formulation; and
[0041] (iii) adding the candidate agent or the pharmaceutical formulation to packaging and / or a container.
[0042] BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The following figures form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these figures in combination with the detailed description of specific examples presented herein. It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the above-described examples, without departing from the broad general scope of the present disclosure. The present examples are, therefore, to be considered in all respects as illustrative and not restrictive.
[0044] Figure 1 is a series of graphical representations showing that calcium cation binds specifically to HIV Gag and promotes Gag-Gag assembly. (A, B) Distribution of Pr55Gag- imCherry (red) and Ca2+(green) in elongated (a) and round (B) peripheral blood lymphocytes (PBLs) are shown. DIC, single fluorescent and merged images are included. Scale bar 10 pm. (C) Fractional areas and detectable signals of Pr55Gag-imCherry (red) and Ca2+(green) in elongated and round PBLs expressing Pr55Gagare shown. Medians are highlighted (n = 75 cells per arm). (D) Ca2+binds to Pr55Gagin SPR. (E) SPR estimated dissociation constant (Kd) between cations and Pr55Gagare listed (n > 3). (F) ITC binding profiles between Pr55Gagand Ca2+or other cations (Mg2+, Zn2+, Na+, and K+) (n > 3). (G) ITC thermodynamic parameters between Pr55Gagand cation interaction are listed (n > 3). (H) ITC profiles of Pr55Gagbinding with cations in the presence of 20 pM of 20mers DNA oligonucleotides (4x 5'-GAGAA-3') are shown (n > 3). (I) ITC thermodynamic parameters between Pr55Gagand cation in the presence of 20 pM of 20 mers DNA oligonucleotides (4x 5'-GAGAA-3') are shown (n > 3). (J) CDMS of the assembly reaction of Pr55Gagcontaining 4: 1 molar ratio of Pr55Gag / DNA oligonucleotides (4x 5'-GAGAA-3'), plus 2 pM IP5 and 1 mM cationic cofactors, such as Na+, K+, Zn2+, Mg2+, and Ca2+. Ion counts are normalized to 100; the y-axis is truncated to reveal the broad extent of oligomerization (n > 3). (K) CDMS quantification of Pr55Gagoligomerization as a function of Ca2+concentration from the absence of Ca2+(front) to 25 mM Ca2+(rear). Only ions above 500 kDa are shown, and counts are normalized to 100 (n > 3). (L) Distribution of Ca2+(green), mitochondria (magenta), Pr55Gag- imCherry (red), and nucleus (blue) in CD4+T-lymphocytes from three different time points are shown. DIC, single fluorescent and merged images are included. Scale bar 10 pm.
[0045] Figure 2 is a series of graphical and schematic representations showing that p6Gagis an important determinant of Ca2+binding and enhances Gag-Gag interactions. (A) shows domains in Pr55Gagand its derivatives (Pr50GagAp6, p | 5C-sl>|-Pyaild p7NC). (B) p6Gagcontributes to in vitro Ca2+-induced high-order Gag oligomerization in CDMS (n > 3). (C) Ca2+promotes SPR-detected homodimerization of Pr55Gagbut not with Pr50GagAp6(n > 3). (D) ITC Ca2+binding profiles of Pr55Gag(and its derivatives) show that p6Gagcontributes to Ca2+interaction. Zoom-In ITC profiles are presented for pl5NC SP2 p6and p7NC(n > 3). (E) ITC thermodynamic parameters are obtained between Pr55Gag(or its derivatives) and Ca2+(n > 3). (F, H, I) Distribution of Pr50GagAp6-imCherry (red) and Ca2+(green) in elongated (F, H, I) and round (G) PBLs are shown. DIC, single fluorescent and merged images are included. Scale bar 10 pm. (J) Fractional areas and detectable signals of Pr50GagAp6-im Cherry (left) and Ca2+(right) in elongated and round PBLs expressing Pr50GagAp6are shown. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against Pr55Gagare with two-sample Kolmogorov-Smirnov test.
[0046] Figure 3 is a series of graphical and schematic representations showing that conserved p6GagE / D residues influence Ca2+-Pr55Gaginteractions. (A) Nine E / D residues in p6Gag are identified. Seven out of nine conserved E / D residues are highlighted in rainbow shadow, and the same color scheme is used for both this figure and Figure 4. Both PTAP and LXXLF motifs are denoted with a gray background. Conservation scores are in red. (B, C) Distribution of Pr55Gagp6-7aa-imCherry (red) and Ca2+(green) in elongated (B) and round (C) PBLs is shown. DIC, single fluorescent and merged images are included. Scale bar 10 pm. (D) Fractional areas and detectable signals of Pr55Gag p6 7aa-imCherry (red) and Ca2+(green) in elongated and round PBLs expressing Pr55Gag p6-7aaare shown. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against Pr55Gagare with a two-sample Kolmogorov-Smirnov test. (E) SPR estimated dissociation constants (Kd) are Ca2+induced homodimerization impacted by Ca2+binding site mutations (n > 3). (F) ITC Ca2+binding profiles of Pr55Gagp6Gag E / Dpoint mutants are shown (n > 3). (G) ITC thermodynamic parameters are obtained between Pr55Gagp6Gag E / Dpoint mutant and Ca2+(n > 3). (H) CD spectra of recombinant Pr55Gag E468Aanj pr55Gag E477Aare s|10 n(n > 3). Figure 4 is a series of graphical representations showing that p6GagCa2+binding sites contribute to homo / hetero-oligomerization of proteins. (A) Ubiquitination of Pr55Gagis associated with Ca2+binding site mutations (n > 3). (B) Deletion of p6Gagand mutations of p6GagCa2+binding sites reduces particle release (n > 3). (C, D) Deletion of p6Gagand mutations of p6GagCa2+binding sites are associated with defects in Pr55Gagprocessing and Prl60GagPo1packaging. Increasing concentrations of indinavir (at 0, 0.5, 5, 50 pM) are used to slow down Prl60GagPol-mediated proteolytic processing (n > 3). (E) Relative infectivity of p6GagCa2+binding site mutants against wild-type control are shown for T-cell line and PBLs. (F) Virion protein profdes among wild-type (NL4-3WT) and mutant HIV (NL4-3E454G, NL4-3E460G, NL4-3E461G, NL4-3E468G, NL4-3E477G, NL4- 3E482G, NL4-3E496G, NL4-3E468G+E477G, and NL4-3E482G+E496G). HIV patient sera is the source of antibodies (n > 3). (G, H) Virion protein profdes of dual mutants (NL4-3E468G+E477Gand NL4- 3E482G+E496G) jncomparison with NL4-3WT. Virion proteins are probed with anti-p24CA(G) and anti-p66 / 51RT(H) antibodies. (I) Virion-associated Prl60GagPo1are compared between NL4-3WTand NL4-3E468G+E477Gparticles that have been produced with increasing concentrations of the viral protease inhibitor indinavir (at 0, 0.5, 5, 50 pM). Virion proteins are probed with anti-p24CA(n > 3) . (J) SPR analyses of Ca2+-Pr68GagPRbinding and effects of Ca2+on Pr68GagPRhomodimerization (n > 3). (K) Coimmunoprecipitation on the stability of Pr55Gag / Prl60GagPo1complexes in the presence of EGTA and quantifications of relative Pr55Gag / Prl60GagPo1ratio (n > 3).
[0047] Figure 5 is a series of graphical representations showing coomassie stained purified recombinant Gag and derivatives. The purity and quality of recombinant proteins were verified by Coomassie stain. (A) The molecule weight of Pr55Gag, Pr50GagAp6. p l 5C-sl>2-p6.anj pyNCwere56.85 kDa, 51.06 kDa, 15.0 kDa, and 7.38 kDa, respectively. (B) The molecular weight of Pr55GagP6 E / G-Amutants(pr55Gag E460A pr55Gag E461A p^Gag E468A p^Gag E477A p^Gag E482A pr55GagD496A) were 56.79 kDa. (C) The molecular weight of Pr68Gag'PRwas 66.21 kDa. (n>3)
[0048] Figure 6 is a series of graphical representations showing SPR binding curves of Pr55Gaginteraction with cations. (A-E). Pr55Gagwas immobilized on the CM5 sensor chip and different concentrations of specific cations were injected to obtain the SPR binding responses. Sensor curve for Pr55Gaginteraction with increasing concentrations of - sodium acetate, Na+ (A); potassium acetate, K+(B); magnesium acetate, Mg2+(C); zinc acetate, Zn2+(D); calcium acetate, Ca2+(E) (n>3).
[0049] Figure 7 is a series of graphical representations showing the thermodynamics of Ca2+- Pr55Gaginteraction via ITC. (A) The four major domains of Pr55Gagare shown in different colors with abbreviations. MA for matrix, CA for capsid, NC for nucleocapsid and p6 domain. 20 pM of Pr55Gagwas loaded onto the sample-cell and 200 pM of Ca2+(or corresponding cation) was titrated through an automated syringe. 2.5 pl of 200 pM cation titrate at an interval of 150 seconds was injected into sample-cell containing 300 pl of 20 pM of Pr55Gag. The changes of heat from titration of cation due to cation- Pr55Gaginteraction and / or Pr55Gag- Pr55Gaginteractions were recorded by ITC. Samples were checked after each experiment to ensure no precipitate was detected. Ca2+(B), Zn2+(C), Mg2+(D), Na+(E), or K+(F) was injected into Pr55Gagcontaining sample-cells. Ca2+ (G), Mg2+(H), or Na+(I) was injected into sample-cells containing 20 pM Pr55Gagin the presence of 20 pM 20mers DNA, respectively. Each experiment was carried out at 25 °C with (n>3).
[0050] Figure 8 is a series of graphical representations showing CDMS analyses of Ca2+induced in vitro oligomerization of Pr55Gag. (A) CDMS schematic. Step 1, The Pr55Gagassembly reaction is loaded into a needle and a high voltage (~1.7 kV) is applied to generate an aerosol of charged particles containing Pr55Gagoligomers. The ions are then directed into a home-built mass spectrometer containing a charge detector (step 2). The charge on the ion induces a signal on a conducting cylinder, the duration of the signal is related to the mass-to-charge ratio (m / z) of the ion and the amplitude of the signal is related to charge. Multiplying m / z and z gives the mass of the ion. The measured mass of each individual ion is counted and binned into mass windows to generate the mass histogram in step 3. (B-F) Charge vs Mass scatterplots for the assembly of Pr55Gaghigh-order oligomers in CDMS with cations. 4: 1 molar ratio of 20mers DNA oligonucleotides (4x 5’-GAGAA-3’) to Pr55Gag, containing 2 mM IP5 and ImM cationic cofactors: 1 mM calcium acetate, Ca2+(S5b); 1 mM magnesium acetate, Mg2+(C); 1 mM zinc acetate, Zn2+(D); 1 mM sodium acetate, Na+(E); or 1 mM potassium acetate, K+(F). (G-J) Charge vs Mass scatterplots for the assembly of Pr55Gaghigh-order oligomers in CDMS with various concentration of Ca2+cations. 4: 1 molar ratio of 20mers DNA oligonucleotides (4x 5 -GAGAA- 3’) to Pr55Gag. containing 2 mM IP5 and calcium acetate, Ca2+at: 25 mM (G); 5 mM (H); 1 mM (I); or 0. I mM (J) 352 (n>3)
[0051] Figure 9 is a series of graphical representations showing SPR homodimerization binding curves of Pr55Gagor Pr50GagAp6in the presence or absence of Ca2+. The Biacore (T200 Evaluation Software 2.0) was used to calculate the equilibrium dissociation constant (Kd) for homodimerization of Pr55Gagor its derivative Pr50GagAp6. Pr55Gagwas immobilized on the CM5 sensor chip in the absence (A) or presence (B) of 2 mM of calcium acetate, and Pr55Gagin the absence (A) or presence (B) of 2 mM of calcium acetate were flowed over. Pr50GagAp6was immobilized on the CM5 sensor chip in the absence (C) or presence (D) of 2 mM of calcium acetate, and Pr50GagAp6in the absence (C) or presence (D) of 2 mM of calcium acetate were flowed over (n>3).
[0052] Figure 10 is a series of graphical representations showing ITC analyses of Gag derivatives and Ca2+. Recombinant Gag derivatives: (A) 20 pM Pr50GagAp6, (B) 20 pM pl5NC_SP2_p6; 20 pM p7NC were loaded individually into the sample cell and titrated with 2.5 pL of 200 pM calcium acetate (Ca2+) with an injection interval of 150 second into sample-cell containing 300 pL of 20 pM of these recombinant Gag derivatives. Plots showed the rate of heat exchanges resulted from Ca2+-Gag derivatives interactions. Experiments were carried out at 25°C (n>3).
[0053] Figure 11 is a series of graphical representations showing SPR homodimerization binding curves of Pr55Gagand point 400 mutants in the presence or absence of Ca2+. Point mutants are Pr55Gag E460A(C-D), Pr55Gag E461A(E-F), Pr55Gag E468A(G-H), Pr55Gag E477A(I- J), Pr55Gag E482A(K- L), and Pr55Gag D496A(M-N). The Biacore (T200 Evaluation Software 2.0) was used to calculate the equilibrium dissociation constant (Kd) for homodimerization of Pr55Gagor its derivative point mutants. Pr55Gagor point mutants were immobilized on the CM5 sensor chip in the absence (A, C, E, G, I, K, AND M) or presence (b, D, F, H, J, L, AND N) of 2 mM of calcium acetate, and Pr55Gagor point mutants in the absence (A, C, E, G, I, K, AND M) or presence (B, D, F, H, J, L, AND N) of 2 mM of calcium acetate were flown over (n>3).
[0054] Figure 12 is a series of graphical representations showing ITC analyses of Pr55Ga" point mutants and Ca2+. Recombinant Gag point mutants: (A) 20 pM Pr55Gag H460A. (B) 20 pM Pr55GagE461A, (C) 20 pM Pr55Gag E468A, (D) 20 pM Pr55Gag E477A, (E) 20 pM Pr55Gag E482A, and (F) 20 pM Pr55Gag D496Awere loaded individually into the sample cell and titrated with 2.5 pl of 200 pM calcium acetate (Ca2+) with an injection interval of 150 second into sample-cell containing 300 pl of 20 pM of these recombinant Gag derivatives. Plots showed the rate of heat exchanges resulted from Ca2+-Gag derivatives interactions. Experiments were carried out at 25°C (n>3).
[0055] Figure 13 is a series of graphical representations showing Gag-Pol interactions with Ca2+and Gag. SPR binding curves of Pr68Gag'PRinteraction with cations (A-E) with cations. Pr68Gag_pRwas immobilized on the CM5 sensor chip and different concentrations of specific cations were injected to obtain the SPR binding responses. Sensor curve for Pr68Gag_pRinteraction with increasing concentrations of: sodium acetate, Na+(A); potassium acetate, K+(B); magnesium acetate, Mg2+(C); zinc acetate, Zn2+(D); calcium acetate, Ca2+(E) (n>3). Co-immunoprecipitation of Pr55Gag:Prl60GagPo1complexes (F). Quantitative analysis of stability of Pr55Gag:Prl60GagPo1complexes in the presence or absence of 100 mM EDTA via co-immunoprecipitation (n=4).
[0056] Figure 14 is a series of graphical representations showing the effect of no treatment (far left), 0.1 pM ABT-737 (left), 1 pM ABT-737 (middle), 0.1 pM Venetoclax (right), and 1 pM Venetoclax (far right) in elongated and round PBLs on (A) signal intensity of calcium per cell; (B) fractional area occupancy of calcium signal per cell; (C) signal intensity of HIV protein per cell; and (D) fractional area occupancy of HIV protein signal per cell. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against untreated are with two-sample Kolmogorov-Smirnov test. (E) Western analyses from left to right of no treatment, ABT-737 (0.1, 0.5, 1.0, 2.0 pM) and Venetoclax (0.1, 0.5, 1.0, 2.0 pM).
[0057] Figure 15 is a series of graphical representations showing the effect of no treatment (far left), 15 pg / mL Nivolumab (left), 150 pg / mL Nivolumab (right), and 100 pg / mL Pembrolizumab (far right) in elongated and round PBLs on (A) signal intensity of calcium per cell; (B) fractional area occupancy of calcium signal per cell; (C) signal intensity of HIV protein per cell; and (D) fractional area occupancy of HIV protein signal per cell. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against untreated are with two-sample Kolmogorov-Smirnov test.
[0058] Figure 16 is a series of graphical representations showing the effect of no treatment (left) and 1.0 pM Celecoxib (right) in elongated and round PBLs on (A) signal intensity of calcium per cell; (B) fractional area occupancy of calcium signal per cell; (C) signal intensity of HIV protein per cell; and (D) fractional area occupancy of HIV protein signal per cell. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against untreated are with two-sample Kolmogorov-Smirnov test. (E) Western analyses from left to right of no treatment and Celecoxib (0.1, 0.5, 1.0, 2.0 pM). Figure 17 is a series of graphical representations showing the effect of no treatment (left) and 1 ng / mL Trametinib (right) in elongated and round PBLs on (A) signal intensity of calcium per cell; (B) fractional area occupancy of calcium signal per cell; (C) signal intensity of HIV protein per cell; and (D) fractional area occupancy of HIV protein signal per cell. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against untreated are with two- sample Kolmogorov-Smirnov test.
[0059] Figure 18 is a series of graphical representations showing the effect of no treatment (left), 2 pg / mL Capivasertib (middle) and 1 pg / mL Ipatasertib (right) in elongated and round PBLs on (A) signal intensity of calcium per cell; (B) fractional area occupancy of calcium signal per cell; (C) signal intensity of HIV protein per cell; and (D) fractional area occupancy of HIV protein signal per cell. Medians are highlighted (n = 75 cells per arm). Statistical distribution analyses against untreated are with two-sample Kolmogorov-Smirnov test.
[0060] Figure 19 is a graphical representation showing how proliferation of PHA and IL-2 activated peripheral blood derived lymphocytes (PBLs) stained with carboxyfluorescein succinimidyl ester (CFSE) is compared to activated non-stained PBLs proliferation, non-activated CFSE stained / non-stained PBLs proliferation, and activated, stained and DMSO treated PBLs proliferation (top left and bottom left). Bcl-2 or COX-2 targeting small molecules treated PBLs proliferations are described (top right comer). PD-1 / PD-L1 interaction inhibiting monoclonal antibodies treated PBLs proliferations are described (bottom right comer).
[0061] Figure 20 is a schematic representation of (A) potential phosphorylation sites binding to calcium; and (B) p6Gag & p6Pol sequences in which calcium binding residues (D / E / N / Q) (light blue shading) and putative PO4-S / T (red text) are highlighted. P04-sites that are: (i) known (green); (ii) novel (yellow); and (iii) selected for study (@; pink) are shown.
[0062] DETAILED DESCRIPTION
[0063] General
[0064] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e., one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter.
[0065] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.
[0066] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the present disclosure.
[0067] Any example of the present disclosure herein shall be taken to apply mutatis mutandis to any other example of the disclosure unless specifically stated otherwise. Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in immunology, immunohistochemistry, protein chemistry, and biochemistry).
[0068] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilised in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Uaboratory Manual, Cold Spring Harbour Uaboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRE Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0069] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
[0070] Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0071] Methods of promoting immune recognition
[0072] The inventors surprisingly identified modulators of intracellular calcium signalling can disrupt intracellular viral protein trafficking and lead to viral protein ubiquitination and / or degradation, that may result in the surface presentation of viral peptides, and / or defects in the production of infectious viral particles (which could lead to the production of defective viruses). This process exposes cells comprising the virus to the immune system, which can then be eliminated by the immune system and / or virus-mediated cell lysis. It is contemplated that this process would be applicable to a broad range of viruses and not just latent viruses. For example, viruses that cause acute, chronic or persistent infections.
[0073] Accordingly, the present disclosure provides a method of promoting immune recognition of a cell comprising a virus, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0074] It is contemplated that the present method may be performed in vitro (e.g., in cell culture). In alternative examples, the present method is performed in vivo, and more particularly in a subject.
[0075] As such, in another form, the present disclosure provides a method of promoting immune presentation of a viral protein by a cell comprising a virus, said method including the step of contacting the cell with an effective amount of a modulator of intracellular calcium signalling. The present disclosure also provides the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for promoting immune recognition of a cell comprising a virus in a subject.
[0076] In a related form, the present disclosure provides a modulator of intracellular calcium signalling for use in promoting immune recognition of a cell comprising a virus in a subject.
[0077] The term “promote immune recognition” as used herein refers to administration of the modulator described herein to supplement, amplify and / or induce one or more elements of the immune system to recognise, interact and / or bind with a viral protein, viral peptide and / or viral cell. For example, a modulator may assist in the recognition of cells comprising a latent virus by e.g., exposing viral peptides or defective viruses to the immune system. In the present context, promoting immune recognition may also include promoting immune presentation of a viral protein by the cell so as to be “recognised” by the subject’s immune system.
[0078] In some examples, immune recognition comprises recognition, interaction and / or binding of a viral protein, a viral peptide and / or a virally infected cell by a component of the subject’s immune system. In certain examples, immune recognition leads to an immune response, such as a humoral immune response, adaptive immune response and / or a cell mediated immune response. For example, including recognition, interaction and / or binding and neutralisation of the viral proteins, viral peptides and / or viral cells.
[0079] According to particular examples, the immune recognition described herein includes or involves one or more elements of the immune system, such as T cells, B cells, antibodies, neutrophils, dendritic cells inclusive of plasmacytoid dendritic cells, cytokines and / or chemokines, other antigen presenting cells, as well as several different molecules, primarily antigens, MHC molecules, T- and B cell receptors and many more.
[0080] In one example, the immune response is or comprises an adaptive immune response. By way of non-limiting example, the adaptive immune response includes the development of immunological memory. In one example, the immune response is mediated by a class I major histocompatibility complex (MHC-1) molecule.
[0081] The term “therapeutically effective amount” is at least the minimum concentration required to effect a measurable improvement of a particular disease or infection. The amount to be administered to a subject will depend on the particular characteristics of the condition to be treated, the type and stage of condition being treated, the mode of administration, and the characteristics of the subject, such as general health, other diseases, age, sex, genotype, and body weight. A person skilled in the art will be able to determine appropriate dosages depending on these and other factors. Accordingly, this term is not to be construed to limit the present disclosure to a specific quantity, e.g., weight or amount of modulator(s), rather the present disclosure encompasses any amount of the modulator(s) sufficient to achieve the stated result in a subject.
[0082] Ideally, a therapeutically effective amount of an agent is an amount sufficient to induce the desired result without causing a substantial cytotoxic effect in the subject. The effective amount of an agent useful for reducing, alleviating and / or preventing the viral infection described herein will be dependent on the subject being treated, the type and severity of any associated disease, disorder and / or condition (e.g., disease progression), and the manner of administration of the therapeutic composition.
[0083] As used herein, the term “subject” shall be taken to mean any animal including humans, for example a mammal. Exemplary subjects include, but are not limited to, humans, non-human primates, performance animals (such as horses, camels, greyhounds), livestock (such as cows, sheep, horses) and companion animals (such as cats and dogs). In one example, the subject is a human. In another example, the subject is a cat. In alternative examples, the subject is a reptile, a bird, or a fish. For example, the subject is a mouse, a cow, a chicken, a horse or a sheep.
[0084] The present disclosure further provides a method of promoting ubiquitination and / or degradation of a viral protein in a cell comprising a virus in a subject, said method including the step administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0085] The present disclosure also provides the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for promoting ubiquitination and / or degradation of a viral protein in a cell comprising a virus.
[0086] In a related form, the present disclosure also provides a modulator of intracellular calcium signalling for use in promoting ubiquitination and / or degradation of a viral protein in a cell comprising a virus.
[0087] In another form, the present disclosure relates to a method of promoting ubiquitination and / or degradation of a viral protein in a cell comprising a virus, said method including the step of contacting the cell with an effective amount of a modulator of intracellular calcium signalling.
[0088] As used herein, the term “ubiquitination” shall be understood to mean attachment of the ubiquitin molecule to a protein marking said protein for degradation.
[0089] The term “degradation” as used herein in reference to proteins shall be understood to refer to the process of proteolysis, e.g., the protein being broken down by the cell, such as by way of ubiquitin-proteasome pathway or the lysosomal proteolysis pathway. In some examples, degradation of the protein is partial. In other examples, degradation of the protein is complete.
[0090] It is contemplated that the cell described herein may be on any cell type as is known in the art that comprises or is infected with a virus. For example, the cell is an immune cell, a skin cell, skin fibroblasts, a buccal mucosal cell, a blood cell, such as erythrocytes, lymphocytes and lymphoblastoid cells, a glial cell (e.g., astrocytes, oligodendrocytes, microglia, ependymal cells and Schwann cells). In relation to the methods described herein, the cell may be contacted with the modulator in vitro, ex vivo or in vivo.
[0091] Suitably, the cell is an immune cell. For example, the immune cell is a lymphocyte, such as a T cell, a B cell or a natural killer cell. In various examples, the T cell is a CD4+ T cell. In some examples, the T cell is a CD8+ T cell. In other examples, the T cell is a cytolytic T cell. In further examples, the T cell is a helper T cell. In particular examples, the T cell is a natural killer T cell. According to certain examples, the T cell is a gamma delta T cell. For some examples, the T cell is an alpha beta T cell. In particular examples, the immune cell is a B cell. For example, the B cell is an IgA B cell. In other examples, the B cell is an IgG B cell. Viral Synapse Formation
[0092] The present disclosure provides a method of inhibiting or disrupting viral synapse formation by a virus in a cell of a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0093] It is envisaged that the present method may be performed in vitro (e.g., in cell culture). In other examples, the present method is performed in vivo, and more particularly in a subject, such as a human subject.
[0094] As such, in one particular form, the present disclosure relates to a method of inhibiting or disrupting viral synapse formation by a virus in a cell, said method including the step of contacting the cell with an effective amount of a modulator of intracellular calcium signalling.
[0095] The present disclosure also provides the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for inhibiting viral synapse formation by a virus in a cell.
[0096] In another form, the present disclosure provides a modulator of intracellular calcium signalling in the manufacture of a medicament for inhibiting viral synapse formation by a virus in a cell.
[0097] In a related form, the present disclosure provides a method of preventing establishment of viral latency or a latent viral infection in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0098] In a further form, the present disclosure provides for the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for preventing establishment of viral latency or a latent viral infection in a subject.
[0099] According to another form, the present disclosure relates to a modulator of intracellular calcium signalling for use in preventing establishment of viral latency or a latent viral infection in a subject.
[0100] As used herein, the terms “inhibit” or “inhibits” shall be taken to mean hinder, reduce, restrain or prevent a molecular activity, such as a virally-infected cell’s ability to form a viral synapse. Suitably, the ability of a virally-infected cell to form viral synapses in the presence of the modulator of calcium signalling is less than about 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0.0001% of the ability of a control or reference cell to form viral synapses in the absence of the modulator of calcium signalling.
[0101] The terms “disrupt” or “disrupts” as used herein refers to administering a modulator described herein to at least partly induce dissociation or disintegration of existing viral synapses in a cell.
[0102] As used herein, the term “viral synapse” is used to describe a cellular junction that allows cell-to-cell transmission between cells. For example, a viral synapse allows a virus to covertly spread directly from cell to cell. In one example, viral synapse transmission allows for the maintenance of cells comprising latent viruses. The term “formation” as used herein in reference to viral synapses shall be understood to mean the action of forming or the process of forming the viral synapse connection.
[0103] Treatment of a Viral Infection
[0104] The present disclosure also provides a method of treating a viral infection in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
[0105] The present disclosure further provides the use of a modulator of intracellular calcium signalling in the manufacture of a medicament for treating a viral infection in a subject.
[0106] In another form, the present disclosure provides a modulator of intracellular calcium signalling for use in treating a viral infection in a subject.
[0107] As used herein, “treating”, “treat” or “treatment” refers to a therapeutic intervention that at least partly ameliorates, eliminates, or reduces a symptom or pathological sign of a pathogen- associated disease, disorder or condition, such as an infection (e.g., a viral infection) by the virus, after it has begun to develop. Treatment need not be absolute to be beneficial to the subject. The beneficial effect can be determined using any methods or standards known to the ordinarily skilled artisan.
[0108] It is envisaged that the methods described herein can improve the prognosis of the subject being treated. For example, administration of a modulator to the subject with a viral infection may reduce the probability of a clinical worsening event (e.g., hospitalization for the viral infection, initiation of additional therapy or a combination thereof) during the treatment period.
[0109] In some examples, the methods described herein provide a reduction of at least about 25%, at least about 50%, at least about 75% or at least about 80%, in probability of a clinical worsening event during the treatment period.
[0110] The various therapeutic agents provided herein, including the modulators of intracellular calcium signalling and the antiviral agents, can be formulated in a composition that optionally includes a pharmaceutically acceptable carrier, excipient or diluent, such as those described herein.
[0111] Modulators of intracellular calcium signalling
[0112] As used here in the “modulator” refers to a molecule or agent that can agonise (e.g., amplify, activate, or enhance) or antagonise (e.g., reduce, inhibit, or diminish) the function of a molecular target. Accordingly, in some examples, the intracellular calcium signalling modulator is an intracellular calcium signalling agonist. In alternative examples, the intracellular calcium signalling modulator is an intracellular calcium signalling antagonist or inhibitor. As contemplated by the present disclosure, the modulator can take any of a variety of forms including natural modulators, chemical small molecule modulators or biological modulators or macromolecules. Exemplary modulators include, but are not limited to, B-cell lymphoma 2 (Bcl-2) inhibitor, a programmed cell death protein 1 (PD-l) / programmed cell death ligand 1 (PD-L1) pathway inhibitor, a cyclooxygenase-2 (COX-2) inhibitor, a kinase inhibitor (e.g., a MAPK pathway inhibitor, an AKT pathway inhibitor, an mTOR inhibitor), a calcium channel blocker and / or antagonist, a P-Hydroxy -methylglutaryl-CoA (HMG-CoA) reductase inhibitor, and combinations thereof.
[0113] The term “intracellular calcium signalling” as used herein is used to describe the pathway (or sub-cellular local calcium concentration) related to calcium pathways located or occurring within a cell. For example, the signalling system is based on transient rises, sparks, waves or oscillations of a cytoplasmic calcium concentration. In particular examples, the modulator of intracellular calcium signalling modulates (e g., inhibits or promotes) these transient rises, sparks, waves or oscillations of a cytoplasmic calcium concentration.
[0114] The term “intracellular calcium” or “intracellular Ca2+” generally refers to “cytosolic calcium” in a cell. Suitably, intracellular calcium signalling can involve the release of calcium from intracellular calcium stores and / or the uptake or reuptake of calcium into intracellular calcium stores. For example, the intracellular calcium release can be related to a transient rise of calcium within sub-cellular area that are within 1 micron in diameter. Typically, there is a 20,000- fold gradient maintained by cells between their intracellular (~100 nM) and extracellular (mM) calcium concentrations. There are also various types of calcium leakage, including calcium sparks and calcium waves.
[0115] A “calcium spark” is the microscopic release of calcium from a calcium store. This process can assist in modulating calcium concentration within the cell. Calcium sparks may also be important for controlling calcium concentration at the subcellular level, to signal both local changes, as well as whole cell changes. In particular examples, the modulator of intracellular calcium signalling modulates (e.g., inhibits or promotes) the generation of calcium sparks and / or calcium waves within the cell.
[0116] The terms “calcium store” or “intracellular calcium stores” generally refer to calcium that is sequestered in the endoplasmic reticulum, mitochondria, acidic vacuoles, or other organelles in a cell.
[0117] In some examples, the modulator of intracellular calcium signalling inhibits a calcium- viral protein interaction. In certain examples, the modulator of intracellular calcium signalling disrupts intracellular calcium homeostasis.
[0118] The present inventors have determined that transient releases of intracellular calcium are important for the polarized targeting and intracellular trafficking of viral complexes during synapse formation. Thus, modulating or altering intracellular calcium signalling can inhibit and / or disrupt this process leading to viral protein ubiquitination and degradation, and the surface presentation of viral peptides that would not generally be able to be detected by the immune system.
[0119] In some examples, this may comprise the modulator binding to, interacting with, or contacting a viral protein comprising a virion assembly or packaging protein. A viral assembly or packaging protein is a protein that organises and contributes to the maintenance of virus structure. Viral assembly and packaging proteins usually interact directly with cellular membranes and can be involved in the budding process. Viral core proteins are proteins that make up part of the nucleocapsid and typically are directly associated with the viral nucleic acid. Examples include DENV NS3 proteins, retrovirus GAG proteins, and retrovirus GAG-POL proteins.
[0120] As used herein, the term “binds” in reference to the interaction of a modulator with the intracellular calcium signalling pathway means that the interaction is dependent upon the presence of a particular structure or molecule in the pathway.
[0121] The term “contacting”, “contact” and / or “contacted” in reference to the modulator described herein shall be understood to mean an association or communication with a molecule, for example, a viral protein.
[0122] The term “protein” shall be taken to include a single polypeptide chain, i.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (i.e., a polypeptide complex). For example, the series of polypeptide chains can be covalently linked using a suitable chemical or a disulphide bond. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions. In some examples, the protein is a fusion protein. As used herein, a “fusion protein” is a protein comprising at least two domains that have been j oined so that they are translated as a single unit, producing a single protein.
[0123] In other examples, the modulator of intracellular calcium signalling modulates the release of calcium from intracellular calcium stores. For example, the modulator of intracellular calcium signalling may promote or stimulate the release of calcium from intracellular calcium stores. Alternatively, the modulator of intracellular calcium signalling may inhibit or prevent the release of calcium from intracellular calcium stores.
[0124] In certain examples, the modulator of intracellular calcium signalling modulates the uptake or reuptake of calcium into intracellular calcium stores. For example, the modulator of intracellular calcium signalling may promote or stimulate the uptake or reuptake of calcium into intracellular calcium stores. Alternatively, the modulator of intracellular calcium signalling may inhibit or prevent the uptake or reuptake of calcium into intracellular calcium stores.
[0125] Suitably, the modulator of intracellular calcium signalling at least partly inhibits, prevents, or interferes with intracellular calcium molecules binding to, interacting with, or contacting a viral protein, such as a virion assembly or packaging protein.
[0126] In particular examples, the modulator of intracellular calcium signalling modulates the phosphorylation of one or more amino acids of a viral protein of the virus. Without being bound by any theory, it is believed that phosphorylated residues, and more particularly phosphorylated serine and / or threonine residues may act as putative binding sites for calcium molecules on viral proteins. Accordingly, in some examples, the modulator of intracellular calcium signalling inhibits the phosphorylation of one or more amino acids of a viral protein of the virus. In various examples, the one or more amino acids of the viral protein of the virus are or comprise one or more serine and / or threonine residues. In certain examples, the one or more amino acids of the viral protein of the virus are adjacent an endosomal sorting complexes required for transport (ESCRT) motif therein. As used herein “phosphorylating”, “phosphorylation" and / or “phosphorylated” shall be understood to mean the transfer of phosphate molecules to a protein. Phosphorylation of a protein typically involves the addition of a phosphate group to a Ser, Thr, or Tyr residue thereof. The process may be mediated by a large number of enzymes known collectively as protein kinases. Phosphorylation normally modifies the function of, and usually activates, a protein. Homeostasis requires that phosphorylation be a transient process, which is reversed by phosphatase enzymes that dephosphorylate the substrate protein (e.g., a viral protein). Phosphorylation can be assessed by standard methods known in the art for assessing cellular activity.
[0127] In some examples, the modulators described herein binds to or interacts with a viral assembly or packaging protein. For example, the virion assembly or packaging protein is a Gag polyprotein and / or a Gag-Pol polyprotein.
[0128] In other examples, the modulators described binds to or interacts with a p6 domain of a Gag polyprotein and / or a p6 domain of a Gag-Pol polyprotein. For example, the modulator binds to or interacts with one or more residues within a p6 domain of a Gag polyprotein and / or a p6 domain of a Gag-Pol polyprotein. In certain examples, the modulator binds to or interacts with one or more residues within the C-terminus of a p6 domain of the Gag polyprotein and / or a p6 domain of the Gag-Pol polyprotein. In various examples, the Gag polyprotein is a Pr55Gagprotein and / or the GagPol polyprotein is a Prl60GagPo1protein.
[0129] In various examples, the modulator is selected from the group consisting of a B-cell lymphoma 2 (Bcl-2) inhibitor, a programmed cell death protein 1 (PD-l) / programmed cell death ligand 1 (PD-L1) pathway inhibitor, a cyclooxygenase-2 (COX-2) inhibitor, a kinase inhibitor, such as a serine / threonine kinase inhibitor or a tyrosine kinase inhibitor (e.g., a mitogen-activated protein kinase (MAPK) pathway inhibitor, an AKT pathway inhibitor or an mTOR inhibitor), a calcium channel blocker and / or antagonist, a P-Hydroxy -methylglutaryl-CoA (HMG-CoA) reductase inhibitor and combinations thereof.
[0130] Bcl-2 inhibitors are a family of inhibitors that are notable for their regulation of apoptosis, a form of programmed cell death, at the mitochondria. Bcl-2 inhibitors have shown to be involved in the regulation of intracellular calcium dynamics without adversely impairing calcium signalling. For example, ABT-737 and Venetoclax, have shown to be potential latency reversal agents in tissue culture-based activities.
[0131] Suitably, the modulator provided herein is a Bcl-2 inhibitor. BCL-2 inhibitors include, but are not limited to, antisense oligonucleotide drugs, such as oblimersen, small molecule inhibitors, such as ABT-737 and navitoclax (ABT-263) and mimetic drugs, such as venetoclax (ABT- 199). In various examples, the modulator is ABT-737. In alternative examples, the modulator is not ABT-737. In certain examples, the modulator is Venetoclax. In alternative examples, the modulator is not Venetoclax.
[0132] Suitably, the modulator provided herein is a PD-1 / PD-L1 pathway inhibitor. PD-1 / PD-L1 pathway inhibitors, such as pembrolizumab, nivolumab and other related mAbs, have been shown to function as HIV latency reversal agent both in vitro and in vivo. Illustrative PD-1 / PD-L1 pathway inhibitors include pembrolizumab (anti-PD-1 monoclonal antibody), nivolumab (anti- PD-1 antibody), durvalumab (anti-PD-Ll antibody), pidilizumab (humanized anti-PD-1 monoclonal antibody), BMS-936559 (anti-PD-Ll antibody), atezolizumab (human Fc-optimized anti-PD-Ll monoclonal antibody) and avelumab (human anti-PD-Ll antibody). It has also been shown that PD-1 / PD-L1 pathway inhibitors, such as pembrolizumab and nivolumab, can alter intracellular calcium dynamics. In various examples, the modulator is pembrolizumab. In alternative examples, the modulator is not pembrolizumab. In certain examples, the modulator is nivolumab. In alternative examples, the modulator is not nivolumab. In other examples, the modulator is a monoclonal antibody (mAB). In alternative examples, the modulator is not a mAB.
[0133] COX-2 inhibitors are typically non-steroidal anti-inflammatory drug (NS AID) used to treat inflammatory diseases. Celecoxib for example, is used to treat pain and inflammation with demonstrated safety profile. Accordingly, in some examples, the modulator is a COX-2 inhibitor. It is contemplated that the COX-2 inhibitor may be a non-selective COX inhibitor (i.e., both a COX-1 and a COX-2 inhibitor) or a selective COX-2 inhibitor. Non-selective COX inhibitors include, but are not limited to, salicylic acid derivatives (e.g., aspirin, sodium salicylates, choline magnesium trisalicylate, salsalate, diflunisal, sulfasalazine, mesalamine, and olsalazine), paraaminophenol derivatives (e.g., acetaminophen), indole and indene acetic acids (e.g., tolmetin, diclofenac, and ketorolac), heteroaryl acetic acids (e.g., flurbiprofen, ketoprofen, fenprofen, ibuprofen, naproxen, and oxaprozin), anthranilic acids or fenamates (e.g., mefenamic acid and meclofenamic acid), enolic acids (e.g., piroxicam and meloxicam), and alkanones (e.g., nabumetone). Selective COX-2 inhibitors include, but are not limited to, diaryl-substituted pyrazoles (e.g., celecoxib), indole acetic acids (e.g., etodolac), and sulfonanilides (e.g., nimesulide). In certain examples, the modulator is a selective COX-2 inhibitor. In various examples, the modulator is celecoxib. In alternative examples, the modulator is not celecoxib.
[0134] Suitably, the modulator is a kinase inhibitor. In some examples, the modulator is a serine / threonine kinase inhibitor (e.g., an AKT inhibitor). In other examples, the modulator is a tyrosine kinase inhibitor (e.g., a MEK1 / 2 inhibitor). For example, the kinase inhibitor is a mitogen- activated protein kinase (MAPK) pathway inhibitor, an AKT pathway inhibitor, a mechanistic target rapamycin (mTOR) kinase inhibitor or a tyrosine kinase inhibitor.
[0135] In certain examples, the modulator is a mechanistic target rapamycin (mTOR) kinase inhibitor. In various examples, the modulator is a tyrosine kinase inhibitor.
[0136] In various examples, the modulator is a MAPK pathway inhibitor. In some examples, the MAPK pathway inhibitor is a MAPK inhibitor. Mitogen-activated protein kinases (MAPKs), include ERK, p38, and JNK MAPK subfamilies, which are crucial regulators of cellular physiology, cell pathology, and many diseases including cancers. Certain MAPK pathway inhibitors, for example trametinib, are used for the treatment of melanoma and target mitogen- activated protein kinase-kinase enzyme MEK1 and MEK2. Accordingly, the MAPK pathway inhibitor can be or comprise a MEK inhibitor. Examples of MEK inhibitors include antroquinonol, binimetinib, cobimetinib, MT-144, selumetinib, sorafenib, trametinib, PD-0325901, pimasertib, LTT462, AS703988, CC-90003 and refametinib. In various examples, the modulator is trametinib. In alternative examples, the modulator is not trametinib. In some examples, the modulator is binimetinib. In alternative examples, the modulator is not binimetinib.
[0137] In various examples, the modulator provided herein is an AKT pathway inhibitor. The AKT pathway is a growth-regulating cellular signaling pathway. AKT genes are known to encode serine and threonine protein kinases. It is appreciated that calcium dynamics are regulated by AKT kinase, including modulation of calcium release from endoplasmic reticulum (i.e., an intracellular calcium storage compartment).
[0138] AKT pathway inhibitors may include PKA / B and / or PKB inhibitors (i.e., AKT inhibitors), PI3K inhibitors, mTOR inhibitors, and / or calmodulin inhibitors (forkhead translocation inhibitors). Suitably, the AKT pathway inhibitor is or comprises an AKT inhibitor. Illustrative AKT inhibitors include perifosine, ipatasertib, uprosertib, afuresertib, MK-2206, MK-8156, AT13148, capivasertib (AZD5363), triciribine, Enzastaurin, XL-418, GSK-690693, and RX-0201.
[0139] In various examples, the modulator is ipatasertib. In alternative examples, the modulator is not ipatasertib. In certain examples, the modulator is capivasertib. In alternative examples, the modulator is not capivasertib.
[0140] Suitably, the modulator provided herein is a calcium channel blocker and / or antagonist. Calcium channel blockers and / or antagonists may include ryanodine receptor inhibitors, inositol 1,4, 5 -triphosphate (IP3) receptor inhibitors, amlodipine (i.e., Norvasc), diltiazem (i.e., Cardizem, Tiazac), felodipine, isradipine, nicardipine, nifedipine (i.e., Procardia), nisoldipine (i.e., Sular) and verapamil.
[0141] Suitably, the modulator provided herein is a HMG-CoA reductase inhibitor (i.e, statins). Statins are lipid-lowering medications and typically used in the primary and secondary prevention of coronary heart disease.
[0142] HMG-CoA reductase inhibitors include Altoprev, Amlodipine / atorvastatin, Atorvastatin, Caduet, Crestor, Ezallor Sprinkle, Fluvastatin, Lescol, Lescol XL, Lipitor, Livalo, Lovastatin, Mevacor, Pitavastatin, Pravachol, Pravastatin, Rosuvastatin, Simcor, Simvastatin, Simvastatin / ezetimibe, Simvastatin / niacin, Vytorin, Zocor and Zypitamag
[0143] Virus
[0144] The term “virus” as used herein, refers to a small infectious agent that replicates only inside the living cells of other organisms. A virus contains its own genetic material but uses the machinery of the host to reproduce. The virus may reproduce immediately, whereby the resulting virions destroy a host cell to attack additional cells. This process is the viral lytic cycle. Alternatively, a virus may establish a quiescent infection in a host cell, lying dormant (e.g., latent) until environmental stimuli trigger re-entry into the active replication cycle.
[0145] As used herein the term “viral infection” shall be understood to mean any infection or illness as a result of a virus.
[0146] In one example, the virus or viral infection described herein is or is caused by a virus is from a class I, class II, class III, class IV, class V, class VI and / or class VII virus. In one example, the vims is selected from a retrovirus, an adenovirus, a herpesvirus, a poxvirus, an adeno-associated vims, a geminivims, a bacteriophage, a parvovirus, a hepamavims, a hepadnavims, a circoviridae vims, a papovaviridae vims, an influenza vims, a respiratory syncytial vims, a parainfluenza vims, a metapneumovims, a rhinovims, a coronavims, an adenovims, a bocavims, or flavivirus. For example, the vims is a cytomegalovirus (CMV), Epstein-Barr vims (EBV), adenovims (AdV), varicella zoster vims (VZV), influenza and BK vims (BKV), John Cunningham (JC) vims, respiratory syncytial vims (RSV), parainfluenza vims, rhinovims, human metapneumovims, human immunodeficiency vims (HIV), herpes simplex vims (HSV) 1, HSV II, human herpes vims (HHV) 6, HHV 8, hepatitis A vims, hepatitis B vims, hepatitis C vims, hepatitis E vims, rotavims, papillomavirus, parvovirus, dengue vims (DENV) or zika vims (ZIKV).
[0147] In certain examples, the vims is a retrovims. For example, the retrovims is a human immunodeficiency vims (HIV), human T-cell lymphotropic vims type 1 and 2 (HTLV-1 and HTLV-2), a human foamy vims, a feline leukaemia vims, a feline immunodeficiency vims, a murine leukaemia vims, a bovine leukaemia vims, a rous sarcoma vims, a gammaretrovims, an avian sarcoma leukosis vims, a xenotropic murine leukemia vims-related vims, a mouse mammary tumor vims, a spumaretrovims, or a jaagsiekte sheep retrovims.
[0148] In alternative example, the vims is not a retrovims. For example, the vims is not HIV.
[0149] In some examples, the vims is latent in a cell. In one example, the viral infection is a latent viral infection. In certain examples, the viral infection is an acute viral infection. In various examples, the viral infection is a chronic viral infection. In other examples, the viral infection is a persistent viral infection.
[0150] As used herein the terms “latent vims” or “latent viral infection” refer to a pathogenic vims that is dormant within a cell or an animal host. For example, the vims is present in the subject but remains inactive. As would be understood by the skilled artisan latent vimses are typically hidden from the immune system.
[0151] Combination Therapies
[0152] In one example, a modulator of intracellular calcium signalling of the present disclosure is administered in combination (simultaneously or sequentially) with an antiviral agent useful for treating a viral infection or standard of care therapy useful for treating a viral infection, either as combined or additional treatment steps of as additional components of a therapeutic formulation. For example, the methods or uses described herein further include the step of administering a therapeutically effective amount of the antiviral agent.
[0153] As used herein the terms "antiviral agent", "antiretroviral agent", "antiretroviral compound" refer to a compounds or agent used to treat a viral infection in a subject.
[0154] Combinations of modulators and antiviral agents are typically selected based on the vims to be treated. Antiviral Agents
[0155] The terms “antiviral agent” and “antivirals” as used herein is intended to mean an agent that can effectively inhibit the formation and / or replication of a virus in a human, including but not limited to agents that interfere with either host or viral mechanisms necessary for the formation and / or replication of a virus in a human.
[0156] The terms “antiviral agent” and “antivirals” include, for example, an HIV integrase catalytic site inhibitor selected from the group consisting: raltegravir (ISENTRESS®; Merck); elvitegravir (Gilead); soltegravir (GSK; ViiV); GSK 1265744 (GSK744) (GSK; ViiV) and dolutegravir; an HIV nucleoside reverse transcriptase inhibitor selected from the group consisting of: abacavir (ZIAGEN®; GSK); didanosine (VIDEX®; BMS); tenofovir disoproxil fumarate (VIREAD®; Gilead); tenofovir alafenamide (TAF); emtricitabine (EMTRIVA®; Gilead); lamivudine (EPIVIR®; GSK / Shire); stavudine (ZERIT®; BMS); zidovudine (RETROVIR®; GSK); abacavir, elvucitabine (Achillion); CMX-157 (Chimerix), and festinavir (Oncolys); an HIV non-nucleoside reverse transcriptase inhibitor selected from the group consisting of: nevirapine (VIRAMUNE®; Bl); efavirenz (SUSTIVA®; BMS); etravirine (INTELENCE®; J&J); rilpivirine (TMC278, R278474; J&J); fosdevirine (GSK; ViiV); MK-1439 (Merck), and lersivirine (Pfizer ViiV); an HIV protease inhibitor selected from the group consisting of: atazanavir (REYATAZ®; BMS); darunavir (PREZISTA®; J&J); indinavir (CRIXIVAN®; Merck); lopinavir (KELETRA®; Abbott); nelfmavir (VIRACEPT®; Pfizer); saquinavir (INVIRASE®; Hoffmann-LaRoche); tipranavir (APTIVUS®; Bl); ritonavir (NORVIR®; Abbott); and fosamprenavir (LEXIVA®; GSK; Vertex); an HIV entry inhibitor selected from: maraviroc (SELZENTRY®; Pfizer); enfiivirtide (FUZEON®; Trimeris); and BMS-663068 (BMS); an HIV maturation inhibitor selected from: bevirimat (Myriad Genetics) and combinations thereof. A boosting agent, such as cobicistat or ritonavir, is included within the terms “antiviral agent” and “antivirals” when used in combination with one or more of the antiviral agents described herein.
[0157] Antiretroviral Agents
[0158] Suitably, the modulators described herein can be combined with any one or more of a suitable antiretroviral agent.
[0159] The terms “antiretroviral therapy” or “ART” refers to combinations of antiretroviral medications used to treat human viral infections, including HIV infections. ART combinations and regimens commonly include multiple, often three or more, drugs such as nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (Pls), fusion inhibitors, CCR5 agonists, and / or integrase inhibitors.
[0160] In certain examples, the ART is selected from the group comprising or consisting of highly active antiretroviral therapy (HAART), a protease inhibitor, a fusion inhibitor, an integrase inhibitor, a co-receptor specific agent, a non-nucleoside analogue reverse transcriptase inhibitor, a nucleoside analogue reverse transcriptase inhibitor and combinations thereof
[0161] In other examples, the modulator is used in combination with a protease inhibitor. For example, the protease inhibitor is selected from the group comprising or consisting of amprenavir, atazanavir, fosamprenavir, indinavir, lopinavir, ritonavir, lopinavir + ritonavir, nelfmavir, saquinavir, tipranavir, brecanavir, darunavir, TMC-126, mozenavir (DMP-450), JE-2147 (AG1776), AG1859, DG35, L-756423, R00334649, KN1-272, DPC-681, DPC-684, and GW640385X, DG17, PPL-100.
[0162] In further examples, the modulator is used in combination with a non-nucleoside inhibitor of reverse transcriptase. For example, the non-nucleoside inhibitor of reverse transcriptase is selected from the group comprising or consisting of capravirine, emivirine, delaviridine, efavirenz, nevirapine, (+) calanolide A, etravirine, GW5634, DPC-083, DPC-961, DPC-963, MIV-150, and TMC-120, TMC-278 (rilpivirine), efavirenz, BILR 355 BS, VRX 840773, UK-453,061, RDEA806, MK-1439 and combinations thereof.
[0163] In yet other examples, the modulator is used in combination with a nucleoside inhibitor of reverse transcriptase. For example, the a nucleoside inhibitor of reverse transcriptase is selected from the group comprising or consisting of zidovudine, emtricitabine, didanosine, stavudine, zalcitabine, lamivudine, abacavir, amdoxovir, elvucitabine, alovudine, MIV-210, racivir ( -FTC), D-d4FC, emtricitabine, phosphazide, fozivudine tidoxil, fosalvudine tidoxil, apricitibine (AVX754), amdoxovir, KP-1461, abacavir + lamivudine, abacavir + lamivudine + zidovudine, zidovudine + lamivudine; 4) a HIV nucleotide inhibitor of reverse transcriptase, e.g., tenofovir, tenofovir disoproxil fumarate + emtricitabine, tenofovir disoproxil fumarate + emtricitabine + efavirenz, and adefovir, CMX-157, and TAF;
[0164] In further examples, the modulator is used in combination with an integrase inhibitor. For example, the integrase inhibitor is selected from the group comprising or consisting of curcumin, derivatives of curcumin, chicoric acid, derivatives of chicoric acid, 3,5-dicaffeoylquinic acid, derivatives of 3,5-dicaffeoylquinic acid, aurintricarboxylic acid, derivatives of aurintricarboxylic acid, caffeic acid phenethyl ester, derivatives of caffeic acid phenethyl ester, tyrphostin, derivatives of tyrphostin, quercetin, derivatives of quercetin, S-I360, zintevir (AR-177), L- 870812, and L-870810, MK-0518 (raltegravir), BMS-707035, MK-2048, BA-011, BMS-538158, GSK364735C, GSK1265744 (GSK744), dolutegravir and combinations thereof.
[0165] In various examples, the modulator is used in combination with a non-catalytic site, or allosteric, integrase inhibitors (NCINI) including, but not limited to, Bl-224436, CX0516, CX05045, CX 14442, compounds disclosed in WO 2009 / 062285 (Boehringer Ingelheim), WO 2010 / 130034 (Boehringer Ingelheim), WO 2013 / 159064 (Gilead Sciences), WO 2012 / 145728 (Gilead Sciences), WO 2012 / 003497 (Gilead Sciences), WO 2012 / 003498 (Gilead Sciences), and WO 2012 / 145729, each of which is incorporated by references in its entirety herein and combinations thereof.
[0166] In other examples, the modulator is administered in combination with a gp41 inhibitor. For example, the gp41 inhibitor is selected from the group comprising or consisting of enfuvirtide, sifuvirtide, FB006M, TR1-1144, SPC3, DES6, Locus gp41, CovX, REP 9 and combinations thereof.
[0167] In certain examples, the modulator is administered in combination with a CXCR4 inhibitor. For example, the CXCR4 inhibitor is AMD-070. In further examples, the modulator is administered in combination with an entry inhibitor. For example, the entry inhibitor is SP01A or TNX-355.
[0168] In other examples, the modulator is administered in combination with a gpl20 inhibitor. For example, the gpl20 inhibitor is BMS- 488043 or BlockAide / CR.
[0169] In particular examples, the modulator is administered in combination with a G6PD and NADH-oxidase inhibitor. For example, the G6PD and NADH-oxidase inhibitor is immunitin.
[0170] In some examples, the modulator is administered in combination with a CCR5 inhibitor. For example, the aplaviroc, vicriviroc, INCB9471, PRO-140, INCB15050, PF-232798, CCR5mAb004, maraviroc and combinations thereof.
[0171] In various examples, the modulator is administered in combination with an interferon. For example, the interferon is pegylated rIFN-alpha 2b, pegylated rIFN-alpha 2a, rIFN-alpha 2b, IFN alpha-2b XL, rIFN-alpha 2a, consensus IFN alpha, infergen, rebif, locteron, AVI-005, PEG- infergen, pegylated IFN-beta, oral interferon alpha, feron, reaferon, intermax alpha, r-IFN-beta, infergen + actimmune, IFN-omega with DUROS, albuferon and combinations thereof.
[0172] In further examples, the modulator is administered in combination with a ribavirin analog. For example, the ribavirin analog is rebetol, copegus, levovirin, VX-497, viramidinem (taribavirin).
[0173] In other examples, the modulator is administered in combination with an NS5a inhibitor. For example, the NS5a inhibitor is BMS-790052, GS-5885, GSK62336805, ACH-2928 AZD2836, AZD7295, BMS-790052, BMS-824393, GS-5885, PP1-1301, PP1-461, A-831, A-689 and combinations thereof.
[0174] In some examples, the modulator is administered in combination with an NS5b polymerase inhibitor. For example, the NS5b polymerase inhibitor isIDX-375, NM-283, valopicitabine, R1626, PS1-6130 (R1656), HIV-796, BILB 1941, MK-0608, NM-107, R7128, VCH-759, PF- 868554, GSK625433, setrobuvir (ANA598), sofosbuvir, XTL-2125 and combinations thereof.
[0175] In particular examples, the modulator is administered in combination with an NS3 protease inhibitor. For example, the NS3 protease inhibitor is SCH-503034 (SCH-7), VX-950 (Telaprevir), ITMN-191, BILN-2065 and combinations thereof.
[0176] In certain examples, the modulator is administered in combination with analpha- glucosidase 1 inhibitor. For example, the alpha-glucosidase 1 inhibitor is MX-3253 (celgosivir) or UT-2318.
[0177] In various examples, the modulator is administered in combination with a hepatoprotectant. For example, the hepatoprotectant is IDN-6556, ME 3738, MitoQ, LB-84451 and combinations thereof.
[0178] In other examples, the modulator is administered in combination with a non-nucleoside inhibitor of HIV. For example, the non-nucleoside inhibitor of HIV is benzimidazole derivatives, benzo- 1,2, 4- thiadiazine derivatives, phenylalanine derivatives and combinations thereof.
[0179] In further examples, the modulator is administered in combination with a further anti-HIV agent. For example, the further anti-HIV agent are zadaxin, nitazoxanide (alinea), BIVN-401 (virostat), DEBI0-025, VGX-410C, EMZ-702, AVI 4065, bavituximab, oglufanide, PYN-17, KPE02003002, actilon (CPG-10101 ), KRN-7000, civacir, Gl-5005, ANA-975 (isatoribine), XTL- 6865, ANA 971, NOV-205, tarvacin, EHC-18, NIM811 and combinations thereof.
[0180] In certain examples, the modulator is administered in combination with a pharmacokinetic enhancer. For example, the pharmacokinetic enhancer is BAS-100 or SP1452.
[0181] In some examples, the modulator is administered in combination with anRNAse H inhibitor. For example, the RNAse H inhibitor is ODN-93 or ODN-112.
[0182] In varoius examples, the modulator is administered in combination with other anti-HIV agents. For example, the other anti-HIV agents are VGV-1, PA-457 (bevirimat), ampligen, HRG214, cytolin, polymun, VGX-410, KD247, AMZ 0026, CYT 99007, A-221 HIV, BAY 50- 4798, MDX010 (iplimumab), PBS119, ALG889, PA-1050040 and combinations thereof.
[0183] Additional agents for use in the methods herein include monoclonal antibodies that target, and small molecule inhibitors of, Arginase- 1, adenosine deaminase, adenosine receptors, IL-4, IL- 6 (such as siltuximab / Sylvant™), IL-10, IL-12, IL-18, IL-21, C-Kit, stem cell factor (SCF), granulocyte -macrophage colony-stimulating factor (GM-CSF), transforming growth factor beta (TGF-P), vascular endothelial growth factor (VEGF), histone methyltransferases (HMT), glycogen synthase kinase 3 (GSK3), and CD32b.
[0184] Also contemplated for use with the modulator provided herein are famesyltransferase inhibitors, such as Lonafamib (SCH66336, Sarasar™), Chaetomellic acid A, FPT Inhibitors I, II, and Ill, FTase Inhibitors I (GAS 149759-96-6) and 11 (GAS 156707-43-6), FT1-276 trifluoroacetate salt, FT1-277 trifluoroacetate salt, FT1-2153, GGT1-297, Gingerol, Gliotoxin, L- 744,832 Dihydrochloride, Manumycin A, Tipifamib (R115777, Zamestra), a-hydroxy Famesyl Phosphonic Acid, BZA-58, Manumycin A, hydroxyfamesylphosphonic acid, butanoic acid, 2- [[(2S)-2-[(2S,3S)-2-[[(2R)-2-amino-3-mercaptopropyl]amino]-3-methylpentyl]oxy-l-oxo-3- phenylpropyl]amino]-4-(methylsulfonyl)-,l-methylethylester,(2S)-(9cl), BMS-214662, BMS- 316810, dichlorobenzoprim(2,4-diamino-5-(4-(3,4-dichlorobenzylamino)-3-nitrophenyl)-6- ethylpyrimidine), B-581,B-956(N-(8(R)-amino-2(S)-benzyl-5(S)-isopropyl-9-sulfanyl-3(Z),6(E)- nonadienoyl)-L-methionine), OS1-754, perillylalcohol( 1 -cyclohexene- 1 -methanol, 4-( 1 - methylethenyl)-, RPR-114334, Sch-48755, Sch-226374,(7,8-dichloro-5H- dibenzo(b,e)(l,4)diazepin-l l-yl)-pyridin-3-ylmethylamine, J-104126, L-639749, L-
[0185] 731734(pentanamide, 2-((2-((2-amino-3-mercaptopropyl)amino)-3-methylpentyl)amino)-3- methyl-N-(tetrahydro-2-oxo-3-furanyl)-,(3S-(3R*(2R*(2R*(S*),3S*),3R* )))-), L-744832
[0186] (butanoicacid,2-((2-((2-((2-amino-3 -mercaptopropyl)amino)-3-methylpentyl)oxy)-l -oxo-3- phenylpropyl)amino)-4-(methylsulfonyl)-, 1 -methylethylester, (2S-(1 (R*(R*)),2R*(S*),3R*))-), L-745631 ( 1 -piperazinepropanethiol, P-amino-2-(2-methoxyethyl)-4-( 1 -naphthalenylcarbonyl)- ,(PR,2S)-), N-acetyl-N-naphthylmethyl-2(S)-((l-(4-cyanobenzyl)-l H-imidazol-5- yl)acetyl)amino-3(S)-methylpentamine, (2alpha)-2 -hydroxy-24, 25-dihydroxylanost-8-en-3-one, UCF-l-C (2,4-decadienamide, N-(5-hydroxy-5-(7,4(2-hydroxy-5-oxo-l-cyclopenten-l-yl)amino- oxo-l,3,5-heptatrienyl)-2-oxo-7-oxabicyclo(4.1 ,0)hept-3-en-3-yl)-2,4,6-trimethyl-, (1 S-(l alpha,3(2E,4E,6S*),5 alpha, 5(1E,3E,5E)6 alpha))-), UCF-116-B, ARGLABIN (3H- oxireno[8,8a]azuleno[4,5-b]furan-8(4aH)-one, and 5,6,6a, 7,9a,9b-hexahydro-l,4a-dimethyl-7- methylene-,(3aR,4aS,6aS,9aS,9bR)-).
[0187] Also useful in the methods and combinations herein are inhibitors of 26S proteasome, such as Lactacystin, Bortezomib (PS-341), ritonavir, MG-132 (Z-Leu-Leu-Leu-CHO), MG-115 (Z-LL- Nva-CHO), Proteasome Inhibitor I (Z-lle-Glu(OtBu)-Ala-Leu-CHO), and Proteasome Inhibitor II (Z-LLF-CHO).
[0188] The modulators provided herein may also be used in combination with inhibitors of E3 ubiquitin ligase, including proTAME, RITA (5,5'-(2,5-Furandiyl)bis-2-thiophenemethanol), HLI 373 (5-[[3-Dimethylamino)propyl]amino]-3, 1 O-dimethylpyrimido[4,5-b]quinoline-2,4(3H, 10H)-dione dihydrochloride), Nutlin-3 ((±)-4-[4,5-Bis(4-ch lorophenyl)-2-(2-isopropoxy-4-m ethoxy-phenyl)-4, 5-d ihyd ro-im idazole-1 -carbonyl] -piperazi n-2-one), SMER3 (9H-lndeno[l,2- e][I,2,5]oxadiazolo[3,4-b]pyrazin-9-one), NSC 66811 (2-Methyl-7-[Phenyl(phenylam ino)methyl]-8-quinolinol), TAME HCI (N2-[(4-Methylphenyl)sulfonyl]-L-arginine methyl ester hydrochloride), Heclin (N-(4-Acetylphenyl)-3-(5-ethyl-2-furanyl)-2-propenamide), PRT 4165 (2- (3-Pyridinylmethylene)-I H-l ndene-l,3(2H)-dione), NAB 2 (N-[(2-Chlorophenyl)methyl]-l- (2,5 -dimethylphenyl)- 1 H-benzim idazole-5-carboxam ide), SP 141 (6-Methoxy-l-(l- naphthalenyl)-9H-pyrido[3,4-b]indole), SZL Pl-41 (3-(2-Benzothiazolyl)-6-ethyl-7-hydroxy-8- (I-piperidinylmethyl)-4H-l-benzopyran-4-one), PTC 209 (N-(2,6-Dibromo-4-methoxyphenyl)-4- (2-methylim idazo[I,2-a]pyrimidin-3-yl)-2-thiazolam ine), SKPCI(2-[4-Bromo-2-[[4-oxo-3-(3- pyridinylmethyl)-2-thioxo-5-thiazolidinylidene]methyl]phenoxy]acetic acid), A01([4-[[4-Chloro- 3-(trifluoromethyl)phenyl] sulfonyl] - 1 -piperazinyl] [4 -( 5 -methyl- IH-pyrazol- 1 - yl)phenyl] methanone) and Apcin.
[0189] The modulators provided herein may also be used in combination with agonists of protein kinase C (PKG), including midostaurin (PKC412, CGP41251, 4'-N-benzoyl staurosporine), ruboxistaurin (LY 333531 HCI, (9S)-9-[(Dimethylamino)methyl]-6,7, 10, l l-tetrahydro-9H, 18H- 5,21: 12, 17-dimethenodibenzo[e,k]pyrrolo[3,4-h][l,4, 13]oxadiazacyclohexadecine-18,20(19H)- dione hydrochloride), sotrastaurin (AEB071), enzastaurin (L Y317615 HCI), sotrastaurin (AEB071), CGP60474, chelerythrine chloride (HY-12048), Fasudil HCI (HY-10341, Go 6983 (HY-13689), and Zoledronic acid (CGP 42446). include phorbol esters, such as PMA, prostratin, and 12-deoxyphorbol 13 -phenylacetate (OPP), and non-phorbol ester compounds including bryostatin compounds, including Bryostatin-1, diacylglycerol (DAG) analogs such as LMC03 and LMC07, including DAG lactones, such as HK654, HK434, HK602, and HK204, ingenol derivatives, including ITA, ingenol-3 -hexanoate (IngB), and 1-3-A,, as well as ingol diterpenes, such as 8-methoxyingol 7, 12-diacetate 3 -phenylacetate, 8-methoxyingol 7, 12-diacetate 3- phenylacetate (SJ23B), (5aS, 7S,8aR,E)-l, 1,4, 7, 10-pentamethyl-2-(((E)-2-methylbut-2- enoyl)oxy)-9-oxo-I, la, 2, 3, 6, 7, 8, 9, 10, 1 Oa-decahydro-5a,8a-epoxycyclopenta[a]cyclopropa [e][l O]annulene-6, 1 Oa-diyl diacetate, and gnidimacrin. Administration and formulation
[0190] In various examples, the modulator described herein and optionally a suitable antiviral agent are administered to a subject as a pharmaceutical composition comprising a pharmaceutically acceptable carrier, diluent or excipient. Any dosage form and route of administration, such as those provided herein, may be employed for providing a subject with the composition provided herein.
[0191] Accordingly, the present disclosure provides a composition or medicament comprising a modulator of intracellular calcium signalling, optionally one or more antiviral agents and optionally a pharmaceutically acceptable carrier, diluent or excipient for use in the treatment, of a viral infection.
[0192] The term “pharmaceutically-acceptable carrier, diluent or excipient” as used herein is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration. Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulfate, liposomes and other lipid-based carriers, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline and salts such as mineral acid salts including hydrochlorides, bromides and sulfates, organic acids such as acetates, propionates and malonates and pyrogen-free water.
[0193] A useful reference describing pharmaceutically acceptable carriers, diluents and excipients is Remington's Pharmaceutical Sciences (Mack Publishing Co. N.J. USA, 1991), which is incorporated herein by reference. Any safe route of administration may be employed for providing a patient with the composition of the present disclosure. For example, oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, periocular, retrobulbar, intravitreal, subretinal, intraperitoneal, intracerebroventricular, transdermal and the like may be employed.
[0194] Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aerosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release may be effected by using other polymer matrices, liposomes and / or microspheres.
[0195] Compositions of the present disclosure suitable for oral or parenteral administration may be presented as discrete units such as capsules, sachets or tablets each containing a pre-determined amount of one or more therapeutic agents of the present disclosure, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in-oil liquid emulsion. Such compositions may be prepared by any of the methods of pharmacy, but all methods include the step of bringing into association one or more agents as described above with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the agents of the present disclosure with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
[0196] The above compositions may be administered in a manner compatible with the dosage formulation, and in such an amount as is pharmaceutically effective. The dose administered to a patient, in the context of the present disclosure, should be sufficient to effect a beneficial response in a patient over an appropriate period of time. The quantity of agent(s) to be administered may depend on the subject to be treated inclusive of the age, sex, weight and general health condition thereof, factors that will depend on the judgement of the practitioner.
[0197] Kits
[0198] Another example of the disclosure provides kits containing compounds useful for promoting immune recognition of a cell comprising a latent virus, inhibiting or disrupting viral synapse formation by a virus and / or the treatment of a viral infection as described herein.
[0199] In one example, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; and (b) a package insert with instructions for promoting immune recognition of a cell comprising a virus in a subject.
[0200] In an alternative example, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; (b) a container comprising at least one antiviral agent and (c) a package insert with instructions for promoting immune recognition of a cell comprising a virus in a subject.
[0201] In one example, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; and (b) a package insert with instructions for inhibiting or disrupting viral synapse formation by a virus in a cell in a subject.
[0202] In various examples, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; (b) a container comprising at least one antiviral agent and (c) a package insert with instructions for inhibiting or disrupting viral synapse formation by a virus in a cell in a subject.
[0203] In one example, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; and (b) a package insert with instructions for the treatment of a viral infection in a subject.
[0204] In certain examples, the kit comprises (a) a container comprising a modulator of intracellular calcium signalling as described herein, optionally in a pharmaceutically acceptable carrier or diluent; (b) a container comprising at least one antiviral agent and (c) a package insert with instructions for the treatment of a viral infection in a subject. It is envisaged that the modulator of intracellular calcium signalling and the at least one antiviral agent can be formulated as discrete agents, such as in separate containers or the like of a kit. In alternative examples, the modulator of intracellular calcium signalling and the at least one antiviral agent can be formulated in combination as a single composition or included in the same container or the like of a kit.
[0205] In accordance with these examples of the disclosure, the package insert is on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds or contains a composition that is effective for promoting immune recognition of a cell comprising a latent virus, inhibiting or disrupting viral synapse formation by a latent virus and / or the treatment of an infection with a latent virus as described herein and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is the modulator of intracellular calcium signalling. The label or package insert indicates that the composition is administered to a subject eligible for treatment, e.g., one having an infection with a latent virus as described herein, with specific guidance regarding dosing amounts and intervals of compound and any other medicament being provided. The kit may further comprise an additional container comprising a pharmaceutically acceptable diluent buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and / or dextrose solution. The kit may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
[0206] Methods for identifying, designing or producing Modulators of Intracellular Calcium Signalling
[0207] The skilled person will understand that it would be beneficial to be able to screen available and approved candidate agents, as well as newly designed candidate agents, for treating a viral infection. The inventors’ solution to this problem is to provide a method of identifying, designing or producing an agent for use in treating a viral infection.
[0208] Accordingly, the present disclosure further provides a method for identifying, designing or producing an agent for use in treating a viral infection, said method including the steps of:
[0209] (a) contacting a cell infected with a virus with a candidate agent; and
[0210] (b) determining whether the candidate agent promotes immune recognition and / or inhibits viral synapse formation of the virus.
[0211] It will be apparent to the skilled person from the disclosure herein that successful candidate agents promote immune recognition and / or inhibits or disrupts viral synapse formation of the virus. For example, the candidate agent binds to, interacts with or contacts a viral protein comprising a viral assembly or packaging protein in the cell.
[0212] As used herein, “agents” or “candidate agent” are compounds identified using the methods of screening disclosed herein. Agents may be able to promote immune recognition and / or inhibits or disrupts viral synapse formation of the virus. Agents may be subsequently chemically modified to optimize or enhance their activity for use in pharmaceutical compositions for promoting immune recognition and / or inhibition or disruption of viral synapse formation of the virus. For example, the agents may be selected from the modulators of intracellular calcium signalling described herein or other modulators of intracellular calcium signalling as are known in the art.
[0213] With respect to the agents described for the present disclosure, it will be appreciated that they refer to a compound or a substance that suitably modulates, at least in part, intracellular calcium signalling. As such, such methods may include contacting a cell, such as an immune cell infected with a virus and determining whether the agent modulates intracellular calcium signalling. Accordingly, the present method may include an initial or earlier step of measuring or detecting a change in intracellular calcium signalling in the cell infected with the virus in response to the candidate agent(s) prior to the step of determining whether the candidate agent promotes immune recognition and / or inhibits viral synapse formation of the virus. Methods of measuring or detecting changes in intracellular calcium signalling would be apparent to the skilled artisan, such as those described herein.
[0214] Accordingly, in one particular form, the present disclosure further provides a method for identifying, designing or producing an agent for use in treating a viral infection, said method including the steps of:
[0215] (a) contacting a cell infected with a virus with a candidate agent;
[0216] (b) determining whether the candidate agent modulates intracellular calcium signalling in the cell; and
[0217] (c) determining whether the candidate agent promotes immune recognition and / or inhibits viral synapse formation of the virus.
[0218] In the context of immune recognition, this may be assessed by determining a level of immune presentation of a viral protein by the virally-infected cell.
[0219] Suitably, the immune presentation or immune recognition of the viral proteins in the presence of the modulator of calcium signalling is more than about 100%, 105%, 110%, 115%, 120%, 125%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200%, or even more than about 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% or 700% greater than that of a control or reference cell to promote immune presentation or immune recognition in the absence of the modulator of calcium signalling.
[0220] Suitably, viral synapse formation in the presence of the modulator of calcium signalling is less than about 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0.0001% of the ability of a control or reference cell to form viral synapses in the absence of the modulator of calcium signalling.
[0221] In one example, identifying, designing or producing an agent for use in treating a viral infection is determined by comparing the efficacy of at least two candidate agents to identify an optimal candidate agent.
[0222] As used herein the term “optimal” shall be understood to refer to the agent that has better efficacy. For example, an optimal candidate agent may promote a higher level of immune recognition and / or more completely inhibit viral synapse formation of the virus leading to a better treatment outcome.
[0223] In other examples, the present method further includes the step of contacting the cell with a candidate agent, and determining whether the candidate agent promotes ubiquitination and / or degradation of a viral protein. Methods of determining ubiquitination and / or degradation would be apparent to the skilled artisan and / or described herein.
[0224] As such, in one broad form, the the present disclosure further provides a method for identifying, designing or producing an agent for use in treating a viral infection, said method including the steps of:
[0225] (a) contacting a cell infected with a virus with a candidate agent; and
[0226] (b) determining whether the candidate agent promotes ubiquitination and / or degradation of a viral protein.
[0227] Such a method, may also include the initial or earlier step of determining whether the candidate agent modulates intracellular calcium signalling in the cell.
[0228] For example, biophysical and biochemical techniques which measure or detect changes in intracellular calcium and / or determine ubiquitination and / or degradation include competitive radioligand binding assays, co-immunoprecipitation, fluorescence-based assays including fluorescence resonance energy transfer (FRET) binding assays, electrophysiology, analytical ultracentrifugation, label transfer, chemical cross-linking, mass spectroscopy, microcalorimetry, surface plasmon resonance and optical biosensor-based methods, such as provided in Chapter 20 of CURRENT PROTOCOLS IN PROTEIN SCIENCE Eds. Coligan ei 1., (John Wiley & Sons, 1997) Biochemical techniques such as two-hybrid and phage display screening methods are provided in Chapter 1 of CURRENT PROTOCOLS IN PROTEIN SCIENCE Eds. Coligan et al, (John Wiley & Sons, 1997).
[0229] Suitably, the ubiquitination of the viral proteins in the presence of the modulator of calcium signalling is more than about 100%, 105%, 110%, 115%, 120%, 125%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200%, or even more than about 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% or 700% greater than that of the ability of a control or reference cell to promote ubiquitination in the absence of the modulator of calcium signalling.
[0230] In certain examples, the degradation levels of the viral proteins in the presence of the modulator of calcium signalling is more than about 100%, 105%, 110%, 115%, 120%, 125%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200%, or even more than about 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% or 700% greater than that of the ability of a control or reference cell to promote degradation in the absence of the modulator of calcium signalling.
[0231] Typically, the modulatory activity of an agent may be assessed by in vitro, ex vivo and / or in vivo assays, such as assays that detect or measure intracellular calcium activity, viral protein ubiquitination and / or degradation, immune recognition and / or viral synapse formation in the presence of the agent. Accordingly, the screening methods described herein may include the initial step of contacting a cell comprising a virus, such as expressed within a suitable test cell or animal, with an effective amount of a candidate agent. Suitably, if the candidate agent modulates intracellular calcium, viral protein ubiquitination and / or degradation, immune recognition and / or viral synapse formation, the candidate agent is identified as an agent that modulates intracellular calcium, viral protein ubiquitination and / or degradation, immune recognition and / or viral synapse formation.
[0232] Suitably, the agent possesses or displays little or no significant off-target and / or nonspecific effects.
[0233] The modulators can be small organic molecule inhibitors. This may involve screening of large compound libraries, numbering hundreds of thousands to millions of candidate agents (chemical compounds including synthetic, small organic molecules or natural products, such as inhibitory peptides or proteins) which may be screened or tested for biological activity at any one of hundreds of molecular targets in order to find potential new drugs, or lead compounds. Screening methods may include, but are not limited to, computer-based (" / « silico") screening and high throughput screening based on in vitro assays.
[0234] Typically, the active compounds, or “hits”, from this initial screening process are then tested sequentially through a series of other in vitro and / or in vivo tests to further characterize the active compounds. A progressively smaller number of the “successful” compounds at each stage are selected for subsequent testing, eventually leading to one or more drug tests being selected to proceed to being tested in human clinical trials.
[0235] At the clinical level, screening a candidate agent may include obtaining samples from test subjects before and after the subjects have been exposed to a candidate agent. The intracellular calcium may then be measured and analysed to determine whether the levels, activity and / or spatial presence thereof changes after exposure to a candidate agent. By way of example, product levels in the samples may be determined by mass spectrometry, western blot, ELISA, electrochemistry and / or by any other appropriate means known to one of skill in the art.
[0236] In this regard, candidate agents that are identified of being capable of modulating intracellular calcium signalling, viral protein ubiquitination and / or degradation, immune recognition and / or viral synapse formation may then be administered to patients who are suffering from a viral infection. For example, the administration of a candidate agent which modulates intracellular calcium signalling, viral protein ubiquitination and / or degradation, immune recognition and / or viral synapse formation may treat the viral infection and / or decrease the risk or progression of the viral infection, if the increased activity and / or expression of the viral infection is responsible, at least in part, for the progression and / or onset of said viral infection.
[0237] Additionally, the method may further include one or more of the steps of:
[0238] (i) selecting the candidate agent that promotes immune recognition and / or inhibits viral synapse formation of the virus;
[0239] (ii) formulating the candidate agent into a pharmaceutical formulation; and
[0240] (iii) adding the candidate agent or the pharmaceutical formulation to packaging and / or a container.
[0241] Further provided herein are agents produced according to such screening methods. The present disclosure includes the following non-limiting Examples.
[0242] EXAMPLES
[0243] Example 1: Modelling of intracellular calcium gradient
[0244] Materials and Methods
[0245] Cell Biology Imaging Analyses
[0246] Fluorescent imaging analyses of intracellular trafficking of HIV Gag
[0247] HIV Gag was labelled with mCherry by replacing the mEOS coding sequences in pNL43APolAEnv-Gag-mEOS2 to generate Gag-imCherry expression vector. The Gag-imCherry gene was delivered into PBLs using a lentiviral vector delivery system. Lentiviral vectors were generated by co-transfecting HIVNL GagPol, pNL43APolAEnv-Gag-mCherry, and VSV-G construct into HEK293T to produce lentiviral particles. Fluorescent-Pr50GagDp6and -Pr55Gag p6-7aawere produced by engineering corresponding mutations into pNL43APolAEnv- Gag-mCherry expression vectors. The quantity of lentiviral particles was determined by p24CAELISA (XpressBio, XB1010), and similar amounts of concentrated VLP supernatants were used to transduce 3-day old PHA and IL-2 activated PBLs. Only Gag-imCherry expressing PBLs at 48hrs post-transduction were included for analyses. Non-transduced PBLs and Gag imCherry / Fluo-4 dye labelled PBLs were used as controls.
[0248] At 48 hours post-transduction, visible cell clumps were removed for single cells analyses. Intracellular Ca2+was labelled with Fluo-4 dye (Invitrogen, F 14201) dye and washed with HBSS wash buffer containing 2 mM probenecid (Invitrogen, P36400) according to manufacturer’s instructions. Briefly, cells and Fluo-4 dye were incubated for 1 hour at 37° C, after which they were fixed with 4% paraformaldehyde (PF A). Cells were washed to remove PFA and then placed into an 8-well chamber slide (Ibidi, 80826) for imaging. Imaging was carried out via the confocal microscope Nikon Eclipse Ti A1R+ with NIS Element software. Images were obtained with 60X Oil (NA 1.4) objective and lasers 488 nm and 561 nm. Imaging data were analyzed with Fiji (ImageJ) software. Aspect ratio of 1.2 was used as a cut-off to assign cells as ‘elongated’ (>1.2) or ‘round’ (<1.2). Statistical analyses were done using Prism software, and two-sample Kolmogorov-Smirnov test was used to compare the distribution of data between experimental conditions.
[0249] Live cell imaging of intracellular calcium
[0250] Codon-optimized HIV Gag was labelled with mCherry between the matrix (MA) and capsid (CA) by PCR. The PCR product was then ligated into the lentiviral vector pLVX-EFla - IRES Puro digested with EcoRI and BamHI followed by transformation in DH5a competent cell. Similarly, lentiviral vectors were generated by co-transfecting HIVNL GagPol, pLVX-EFla- APolAEnv-Gag-mCherry-IRES-Puro, and VSV-G construct into HEK293T to produce lentiviral particles. The quantity of lentiviral particles was determined by p24CAELISA (XpressBio, XB1010), and similar amounts of concentrated VLP supernatants were used to transduce 3-day old PHA and IL-2 activated CD4+ T-lymphocytes. At 24 hours post transduction, visible cell clumps were removed for single cells analyses. Cells were labelled with 1 pM Fluo-4 (Invitrogen, Fl 4201) to visualize the intracellular calcium, 5 nM MitoTracker Deep Red FM (Invitrogen, M22426) to visualize the mitochondria, and 0.4 pg / mL Hoechst 33342 (Invitrogen, H1399) to visualize the nucleus. Briefly, cells were incubated with the dyes for 30 minutes at 37°C, then washed 2X with HBSS wash buffer containing 2 mM probenecid. Cells were resuspended in RPMI no phenol red media (Gibco) plus 20 mM HEPES and plated on channel slide (Ibidi, 80601) for imaging. Imaging was carried out via the widefield microscope Nikon Eclipse Ti-2 on fully enclosed incubator stage set at 37° C. Images were taken with 40X (NA 0.95) objective and 1.5x magnification at 10-second intervals for 10 minutes. Fluorophores were excited at 390 nm, 475 nm, 549 nm, and 632 nm. Time-lapse data were imported into with Fiji (ImageJ) software for visualization and analysis.
[0251] Biophysical Analyses
[0252] Protein expression and purification of Gag proteins, its derivatives and Gag-PR
[0253] Recombinant Pr55Gagprotein (and its derivatives) constructs were expressed in Escherichia coli BL21 (Al) at 30°C via a pET29a vector system. Individual protein was purified by affinity chromatography IMAC column and eluted with 250 mM imidazole. Eluted protein was loaded onto 72 Superdex 200 26 / 600 column to remove imidazole and to provide an additional purification step through size execution chromatography (SEC). Chosen fractions from SEC were pooled, which was followed by addition of TEV protease in 1 : 100 ratio to cleave 6 x histidine tag. Mixture of cleaved and un-cleaved tagged proteins were separated through IMAC column. Tag- removed recombinant Pr55Gag(or its derivative and Gag-PR) were concentrated to 1-2 mg.ml’1, aliquoted, and snap frozen in liquid nitrogen before storage at -80°C. The purity of recombinant Pr55Gag(or its derivative and Gag-PR) were monitored by SDS-PAGE using Coomassie stain, while the quantity of recombinant proteins was determined by nanodrop.
[0254] SPR analyses of Gag interaction with metal cations or Gag molecules for homodimerization
[0255] SPR analyses were carried out using a Biacore T200 SPR system (Cytiva) using Series S CM5 chips for all analyses. Recombinant Gag proteins were immobilized on the sensor surface (flow cells 2-4) using amine coupling at pH 4.0 at a flow rate of 5 pl min'1for 10 minutes with an average capture level of 3200 response units. Flow cell 1 was used as the blank immobilized control with an ethanolamine surface. Analyses were carried out using a mixture of multi and single cycle kinetics. Metal cations were run across different 1:2 dilution series from 3.125 pM up to 500 pM with double reference subtraction. 10 mM EDTA was used as the regeneration solution for 10 minutes to return the Gag proteins on the chip to non-metal bound state for the analysis. Gag proteins were tested with and without a 2mM calcium enhancement step of the immobilized Gag proteins. Gag proteins were run across a 1:2 dilution series from 16 pg ml'1up to 100 pg ml- 1. All SPR experiments were performed at least in triplicate. Analyses were performed using the Biacore T200 Evaluation software package. Isothermal titration calorimetry (ITC) assay
[0256] Isothermal titration calorimetry (ITC) experiments were performed at 25 °C using a Nano ITC from TA Instruments. For each ITC experiment, the cell contained soluble Gag protein (or its derivative) at 20 pM in TBS buffer with ImM TCEP and the 98 syringe contained 200 pM of the cation. Calcium acetate, magnesium acetate, zinc acetate, potassium acetate and sodium acetate were separately used in titration. Nucleic acids were also included in some of the ITC analyses, and 20 pM Pr55Gagwere mixed with 20 pM 20mer oligonucleotides (4x 5'-GAGAA-3'), and samples were titrated with 200 pM of indicated cations to assess whether the cation-Gag interaction is associated with nucleic acid binding. All cation salts were purchased from Sigma Aldrich and DNA oligonucleotides were purchased form Macrogen. The 2.5 pl of 200 pM cations in TBS buffer were injected from a computer-controlled micro syringe at an interval of 150 second into the sample solution containing 300 pl of 20 pM Gag protein with stirring at 150 rpm. All data fitting operations were performed with NanoAnalyze v3.11.0 software.
[0257] Charge Detection Mass Spectrometry.
[0258] Assemblies of Pr55Gagand 20mer oligonucleotides (4x 5'-GAGAA-3') were measured on a home-built charge detection mass spectrometer described elsewhere. Briefly, ions were generated via nano-electrospray ionization and enter the instrument through a heated capillary. The ions were focused and energy-filtered before entering an electrostatic ion trap containing a charge detection cylinder. To trap the ions, voltages were placed on the front and rear endcaps, causing the ions to oscillate through the detector. Each ion was trapped for 100 ms, resulting in several thousand oscillations through the detector. The signal on the detector was detected by a charge sensitive preamplifier; it was then amplified, digitized, and analyzed using fast Fourier transforms. The frequency of the ion was related to the mass-to-charge ratio (m / z) and the magnitude was proportional to the charge. The charge and m / z were multiplied to determine mass.
[0259] All assembly reactions monitored by CDMS were the result of a mixture of 20mer oligonucleotides (4x 5'-GAGAA-3') (Integrated DNA Technologies) and Pr55Gag. Protein and oligonucleotides were mixed in a molar ratio of 1:4 in 150 mM ammonium acetate, pH 7.5. The assembly reaction was supplemented with 2 pM inositol pentakisphosphate ammonium salt (IP5) (Cayman Chemicals) and varying concentrations of acetate salts (Na+, K+, Zn2+, Mg2+, Ca2+, Sigma Aldrich).
[0260] Site directed mutagenesis of recombinant Pr55Gagand Pr68Gag~PR
[0261] Pr68Gag_pR(a truncated version of GagPol with deletion of reverse transcriptase (RT) and integrase (IN)) was synthesized (GenScript) with codon-modifications and introduced into the pET28a vector system via Ncol and AccIII sites. Frameshift mutation and protease active site mutations were introduced to ensure unprocessed Gag-PR expression and production, respectively. With point mutations in Pr55Gag, site-directed mutants of p6Gagamino acids with negatively charged side chain were generated with two fragments that contain mutation site. Corresponding ‘Forward Primer (FP)’ and ‘Reverse Primer (RP)’ were used for mutation introduction. Common ‘Extension FP’ and ‘Extension RP’ were used as outer primers to generate PCR fragments. For each site-directed mutation, both fragments were mixed in equal molar ratio and stitched through extension forward primer and extension reverse primer via a PCR reaction. Stitched mutant fragment and pET28a vector were digested through Ncol and BamHI followed by ligation and transformation in DH5a competent cell.
[0262] The primers used in these experiments were as follows:
[0263] Common Extension FP 5'-AACCATGGGTGCGAGAGCGTCGGTATTAAGCG-3' (SEQ ID NO: 1);
[0264] Common Extension RP 5'- GGGCTCGAGGGATCCGCTCTGAAAATACAGGTTTTC -3 (SEQ ID NO: 2);
[0265] Pr55Gag E454AFP 5'-GGGAATTTTCTTCAGAGCAGACCAGcGCCAACAGCCCCACCA-3' (SEQ ID NO: 3);
[0266] Pr55Gag E454ARP 5'-TGGTGGGGCTGTTGGCgCTGGTCTGCTCTGAAGAAAATTCCC-3' (SEQ ID NO: 4);
[0267] Pr55Gag E460AFP 5'-CCAGAGCCAACAGCCCCACCAGcAGAGAGCTTCAGGTTTGGG-3' (SEQ ID NO: 5);
[0268] Pr55Gag E460ARP 5'-CCCAAACCTGAAGCTCTCTgCTGGTGGGGCTGTTGGCTCTGG-3' (SEQ ID NO: 6);
[0269] Pr55Gag E461AFP 5'-CCAGAGCCAACAGCCCCACCAGAAGcGAGCTTCAGGTTTGGGG-3' (SEQ ID NO: 7);
[0270] Pr55Gag E461ARP 5'-CCCCAAACCTGAAGCTCgCTTCTGGTGGGGCTGTTGGCTCTGG-3' (SEQ ID NO: 8); pr55GagE468AFP 5'-AGCTTCAGGTTTGGGGAAGcGACAACAACTCCCTCTCAG-3' (SEQ ID NO: 9);
[0271] Pr55Gag E468ARP 5'-CTGAGAGGGAGTTGTTGTCgCTTCCCCAAACCTGAAGCT-3' (SEQ ID NO: 10);
[0272] Pr55Gag E477AFP 5'-ACAACTCCCTCTCAGAAGCAGGcGCCGATAGACAAGGAACTG-3' (SEQ ID NO: 11);
[0273] Pr55Gag E477ARP 5'-CAGTTCCTTGTCTATcGGCGCCTGCTTCTGAGAGGGAGTTGT-3' (SEQ ID NO: 12);
[0274] Pr55Gag E482AFP 5'-CAGGAGCCGATAGACAAGGcACTGTATCCTTTAGCTTCC-3' (SEQ ID NO: 13);
[0275] Pr55Gag E482ARP 5'-GGAAGCTAAAGGATACAGTgCCTTGTCTATCGGCTCCTG-3' (SEQ ID NO: 14);
[0276] Pr55Gag D496AFP 5'-CTCAGATCACTCTTTGGCAGCGcCCCCTCGTCACAACTCGAG-3' (SEQ ID NO: 15); and
[0277] Pr55Gag D496ARP 5'-CTCGAGTTGTGACGAGGGGgCGCTGCCAAAGAGTGATCTGAG-3' (SEQ ID NO: 16). CD spectroscopy
[0278] CD spectra were collected with a spectropolarimeter (J- 1500; Jasco) with a 1 mm optical path length cuvette. The CD spectra were acquired at 25°C with 5 pM of protein in 10 mM sodium phosphate (pH 7.6), 0.5 M NaCl, 1 mM DTT. The samples were scanned 20 times from 200 to 260 nm with a 0.5-nm interval. CD spectra were corrected for background. That is, the CD spectra of the buffer at the corresponding concentration was subtracted from the protein CD spectra. The protein secondary structure content was analyzed with K2D3.
[0279] Molecular Virology Analyses
[0280] Full-Length HIV proviral DNA with mutations in p6Gag amino acids.
[0281] Wild type NL4-3 virus was generated from an infectious molecular clone obtained from the NIH AIDS Reagent Programme. Mutants were derived from this plasmid. Generating mutants with altered p6Gagdomains were achieved by the following pair of primers. Each mutation at E to G at 454, 460, 461, 468, 477, 482 and / or D to G 172 at 496 was done in such way as to maintain the GagPol coding sequences. Mutations in the p6Gagdomain were generated by two overlapping blocks. Fragment 1 (Fl) were generated by Extension Forward Primer and Reverse Primer for each mutation, while fragment 2 (F2) for each mutation were generated by Forward Primer for each mutation and Extension Reverse Primer. The Fl and F2 were mixed in equal molar ratio and a second PCR reaction were set to stitch the complementary mutant fragment. The mutant PCR fragment were digested with Apal and Sbfl and ligated into the NL4-3 plasmid to replace the wild type parental sequences.
[0282] The primers used in this reaction were as follows:
[0283] Extension FP 5 -
[0284] CACATAGCCAAAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATG-3 ’ (SEQ ID NO: 17);
[0285] Extension RP 5 -TTTTCTGTTTTAACCCTGCAGGATGTGGTATTCCTAATTGAACTTCC C-3’ (SEQ ID NO: 18);
[0286] NL4-3E454GFP: 5’-TTTCTTCAGAGCAGACCAGGgCCAACAGCCCCACCAGAA-3’ (SEQ ID NO: 19);
[0287] NL4-3E454GRP:5’-TTCTGGTGGGGCTGTTGGCcCTGGTCTGCTCTGAAGAAA-3’ (SEQ ID NO: 20);
[0288] NL4-3E460GFP: 5’-GAGCCAACAGCCCCACCAGgAGAGAGCTTCAGGTTTGGG-3’ (SEQ ID NO: 21);
[0289] NL4-3E460GRP: 5’CCCAAACCTGAAGCTCTCTcCTGGTGGGGCTGTTGGCTC-3’ (SEQ ID NO: 22);
[0290] NL4-3E461GFP: 5’-CCAACAGCCCCACCAGAAGgGAGCTTCAGGTTTGGGGAA-3’ (SEQ ID NO: 23);
[0291] NL4-3E461GRP: 5’-TTCCCCAAACCTGAAGCTCcCTTCTGGTGGGGCTGTTGG-3’ (SEQ ID NO: 24); NL4-3E468GFP: 5’-AGCTTCAGGTTTGGGGAAGgGACAACAACTCCCTCTCAG-3’ (SEQ ID NO: 25);
[0292] NL4-3E468GRP: 5’-CTGAGAGGGAGTTGTTGTCCCTTCCCCAAACCTGAAGCT-3’ (SEQ ID NO: 26);
[0293] NL4-3E477GFP: 5’-ACTCCCTCTCAGAAGCAGGgGCCGATAGACAAGGAACTG G-3’ (SEQ ID NO: 27);
[0294] NL4-3 E477G Rp. 5’-CAGTTCCTTGTCTATCGGCCCCTGCTTCTGAGAGGGAGT-3’ (SEQ ID NO: 28);
[0295] NL4-3 E482GFp:5’CAGGAGCCGATAGACAAGGgACTGTATCCTTTAGCTTCC-3’ (SEQ ID NO: 29);
[0296] NL4-3 E482G Rp. 5’GGAAGCTAAAGGATACAGTCCCTTGTCTATCGGCTCCTG-3’ (SEQ ID NO: 30);
[0297] NL4-3 E496GFp. 5’-GCTTCCCTCAGAGGCAGCGgCCCCTCGTCACAATAAAGA-3’ (SEQ ID NO: 31); and
[0298] NL4-3 E496G RP- 5’-TCTTTATTGTGACGAGGGGCCGCTGCCTCTGAGGGAAGC-3’ (SEQ ID NO: 32).
[0299] Cell Cultures and Transfection for virus production
[0300] HEK293T were maintained in DMEM supplemented with 10% FBS, 100 U.ml’1penicillin, and 100 pg. ml-1streptomycin. MT2 cells were maintained in RMPI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 100.U ml’1penicillin, and 100 pg. ml-1streptomycin. Peripheral blood lymphocytes (PBLs) were isolated from huffy coats of healthy donors. Briefly, buffy coats were diluted in sterile PBS and layered over Lymphoprep™ (Stemcell Technologies), followed by centrifugation. The resulting PBL layer was collected and washed with sterile PBS. PBLs were cultured in RMPI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 100 U.ml’1penicillin, 100 pg.ml’1streptomycin and stimulated with 10 pg ml’1PHA and 50 U ml’1IL-2 for three days.
[0301] Viral supernatants were generated by PEI-Max (Polysciences, Inc.) transfection of HEK293T. Crude viral supernatants were harvested 48 hours post transfection and clarified by benchtop centrifugation (3000 rpm, 10 minutes) followed by filtration through a 0.45 pM nitrocellulose membrane. Virus was concentrated through a 20% (w / v) sucrose cushion (100 000 x g, 1 hour, 4°C), following which the viral pellets were resuspended in DPBS. Viral stocks were quantified by p24CAELISA (XpressBio, XB-1010) and aliquots were frozen at -80 °C.
[0302] Immunoprecipitation of Gag for ubiquitination analyses
[0303] HA-Ubiquitinated Pr55Gagdetection: The deletion of p6Gag (Pr50GagAp6) and the sevenpoint mutations (Pr55Gag p6’7aa<E®-G))wereintroduced into a protease inactive version of HIVNL GagPol for Pr55Gagexpression. HA-tagged ubiquitin expression construct was co-transfected with HIVNL GagPol PR(-) in HEK293T cells to quantify levels of ubiquitination of Pr55Gagupon manipulation of the Ca2+binding domains. Transfected cell lysates with anti-CA normalized amounts of Pr55Gag (or its mutant derivative) were immunoprecipitated with anti-HIV patient sera, which was followed by western analyses using anti-HA antibody.
[0304] Western Blotting
[0305] Viral supernatants were lysed in TBS Lysis buffer (50 mM Tris-HCl [pH7.4], 150 mM NaCl, 1% v / v NP-40, 2 mM phenylmethylsulphonylfluoride and complete protease inhibitor cocktail (Roche)). Lysates were separated by SDS-PAGE (10% Bis-Tris NuPAGE, Invitrogen) and transferred to nitrocellulose membranes (GE Healthcare). Membranes were blocked with 5% milk in TBS-tween (TBST), rinsed and then probed with either HIV-1 positive patient sera; mouse monoclonal anti-p24CA(AG3.0, NIH AIDS Reagent Programme) or mouse monoclonal anti-RT (5B2 or 11G10, NIH AIDS Reagent Programme). The awtz-human and «w / / -mousc secondary antibodies were HRP conjugated, and the blots were imaged by chemiluminescence (SuperSignal™). Imaging of the western blots was performed on a BioRad ChemiDoc XRS+.
[0306] Infectivity Assays
[0307] Infectivity of the mutant viruses was assessed by syncytia formation in MT2 cells or p24 ELISA on infected PBLs. Briefly, MT2 cells were seeded into a 96-well plate (2 x 104cells well’ ') and infected with 3 -fold serially diluted virus, starting at 18 ng of p24 equivalent (as determined by p24CAELISA (XpressBio, XB-1010). Wells were visually scored for syncytia formation 72 hours following the addition of virus. Three-day old, PHA activated, and IL-2 stimulated PBLs were seeded into 96-well plates (1 x 105cells well’1). PBLs were infected with 5 -fold serially diluted virus, starting at 50 ng p24 equivalent, and the infection allowed to proceed for 6 hours after which, the viral supernatant was removed, and the cells washed twice with ice-cold DPBS. Infected PBLs were resuspended in complete RPMI. After 72 hours, the culture supernatants were assessed for viral production by p24CAELISA.
[0308] Co-Immunoprecipitation of Gag and Gag-Pol for hetero-oligomerization analyses
[0309] Pr55Gag:Prl60GagPo1complexes: Mammalian expression vectors, pGen2.1-Gag (encoding full246 length Gag) and pGen2.1-GagPol PR(-) FLAG (encoding full length protease inactive, C terminal FLAG tagged GagPol) were codon optimized and synthesized (GenScript). VLPs were generated by transfecting HEK293T cells with pGen2.1-Gag and pGen2.1 -GagPol PR(-) FLAG at a ratio of 10: 1. VLPs were solubilized in lysis buffer (50 mM HEPES [pH7.6], 150 mM KC1, 2 mM MgCh, 0.5 mM DTT, 2% NP-40, and lx EDTA-free protease inhibitor cocktail (Roche)). 50 pl anti-FLAG magnetic beads (Sigma) were conditioned with lysis buffer before adding into solubilized VLP solution. After an overnight incubation, the VLP solutions were aliquoted and placed on a magnetic stand to remove the unbound fraction. The beads were incubated with 254 wash solutions (50 mM HEPES [pH7.6], 300 mM KC1, 2 mM MgCh, and 2% NP-40) containing different concentrations of EGTA (0 mM, 50 mM, and 100 mM) for another overnight. The beads were washed twice with corresponding wash buffers. The bound Gag- GagPol complex were eluted by boiling in LDS sample buffer before subjected to western blot analysis. Biotinylated p24 detecting antibody and streptavidin-HRP (XpressBio) were used to detect Gag and GagPol. Quantitative analysis was conducted using Image J software.
[0310] Results
[0311] Uropod Targeting and Oligomerization of HIV Gag Are Associated with Ca2+Gradient
[0312] Uropod targeting or virological synapse formation is conserved among retroviruses, and this process is associated with the oligomerization of the retroviral Gag protein. Using HIV virological synapse as a model system, our fluorescent imaging analyses show that the subcellular distributions of HIV Gag (imCherry, modified from Chen et al. 2014) in peripheral blood lymphocytes (PBUs) are copolarized and overlapped with intracellular Ca2+gradient (fluo-4) both in the elongated and round PBUs (Figures la and lb). The median area distribution of detectable HIV Gag represented 4.2 and 3.7% of cell areas in the elongated (virological synapses displaying) PBUs and the round (less-extended virological synapse forming) PBUs (Figure 1c), whereas detectable Ca2+occupied 22.0 and 25.9% areas of corresponding PBUs, respectively (Figure 1c). Surface plasmon resonance (SPR) analyses showed recombinant HIV Gag specifically binds to Ca2+with an estimated SPR dissociation constant (Kd) of 9.18 pM (Figures Id, le, 5 and 6) but has undetectable SPR binding with other cations (Na+, K+, Mg2+, and Zn2+; Figures le and 6). Isothermal titration calorimetry (ITC) has been used to record the thermodynamics of HIV Gag oligomerization events among low-order Gag oligomers. ITC showed that the inclusion of divalent cations resulted in energetically favorable reactions (AG < 0) during low-order Gag oligomerization over monovalent cations, where Ca2+stimulated the highest change in enthalpy (AH) across all cations tested (Figures If, 1g and 7). The Ca2+-induced enhancement (for both AG and AH) on the low-order Gag oligomerization in ITC was strengthened in the presence of nucleic acids (Figures Ih, li and 7). Charge detection mass spectrometry (CDMS) is a single molecule technique that can quantify high-order oligomerization (~4 MDa [120mers] of hepatitis B viral proteins) in vitro. CDMS analyses showed that in vitro high-order oligomerization of HIV Gag (with a median of 7-12 MDa [125-220mers]) is promoted by Ca2+(Figures Ij and 8) with optimal Ca2+concentrations ([Ca2+]) at 0. 1-1.0 mM (Figures Ik and 8) that mirrors the high end of intracellular Ca2+gradient. The lower “overall” 100 nM cytoplasmic [Ca2+1is in sharp contrast with the [Ca2+] needed to induce HIV Gag oligomerization. Whether it is known as “sparks” in muscle cells, “puffs” in oocytes, or “syntillas” in neurons, high [Ca2+] can be transiently released locally via intracellular organelles, such as mitochondria, ER, and acidic vacuoles. The local [Ca2+] in these storage compartments can reach 100-800 pM, which is sufficient to support the oligomerization of HIV Gag during its trafficking to virological synapses. Our time-lapse live imaging showed that stochastic Ca2+sparks occur among T-lymphocytes, and the two selected T- lymphocytes displayed spikes of Ca2+signals (via fluo-4 complex) at ~90 s with a slow decay of the Ca2+signal (Figure 11). A combination of (i) super-resolution microscopy, (ii) 3D volume imaging, (iii) time-lapse video, and (iv) alternative Ca2+dye to distinguish the flux (blink) of Ca2+will be needed to define the details of the temporal and spatial relationship between local Ca2+release and intracellular trafficking of Gag. C-Terminus p6 Domain of HIV Gag Is a Determinant of Ca2+-Associated In Vitro Gag-Gag Interaction and Intracellular Trafficking
[0313] The capsid (CA) domain within HIV Gag (Figure 2a) drives viral assembly by facilitating homo-oligomerization of Gag molecules, and in vitro assembly of virus-like-particles can occur in the absence of p6. Deletion of p6 from recombinant HIV Gag drastically reduced the quantity and the size of CDMS-detectable Ca2+-induced high-order HIV Gag oligomers (Figure 2b). SPR revealed that Gag-Gag homodimerization was strengthened up to 7-fold in the presence of Ca2+with SPR Kd (Figures 2c and 9), but this Ca2+-induced homodimerization effect disappeared when the p6 domain was removed (Figures 2c and 9). The ITC-detected Ca2+binding during low-order Gag oligomerization also vanished in the absence of p6 (Figures 2d,e and 10). As the energy exchange detected in ITC low-order Gag oligomerization is contributed in part by CA-CA -based interactions, ITC analyses with pl5NC_SP2_p6anj p yjf’ (lacking the p39MA-cA.sPidomains, Figure 2a) have mapped that the p6Gagdomain directly contributes to Ca2+binding (Figures 2d,e and 10).
[0314] If the Ca2+-p6Gaginteraction is important for intracellular trafficking of HIV Gag, removal of p6Gagshould alter the relationship between Ca2+and HIV Gag during virological synapse formation. In virological synapse displaying elongated PBLs, cell imaging analyses showed that the p6-deleted HIV Gag had a more dispersed distribution and occupied a greater fractional area when compared with that of wild-type HIV Gag (Figures 2f, h-j). In contrast, the intracellular Ca2+distributions were generally more condensed within a smaller fractional area of Pr50GagAp6expressing cells than Pr55Gagexpressing cells, a phenotype that is more noticeable in the less extended virological synapse forming round PBLs (Figures 2g, j). In elongated PBLs, an increase in Gag signal was detected in Pr50GagAp6- over Pr55Gag-expressing cells (Figures 2f, h-j), while no difference in overall Gag signal was found between Pr50GagAp6and Pr55Gaground PBLs (Figures 2g, j). The signal strength ratio of Gag to Ca2+was consistently higher in Pr50GagAp6- than in Pr55Gag-expressing cells across all PBLs (Figures 2f-j). The altered Ca2+-Gag distribution relationship between Pr50GagAp6- and Pr55Gag-expressing cells could be related to a nonsynchronous lateral movement of the Ca2+gradient and viral proteins during the reestablishment of virological synapses from the virus-laden uropod. Our data support the notion that a relationship exists between the intracellular Ca2+and the p6 domain of HIV Gag that contributes to the intracellular trafficking of HIV Gag for directional release.
[0315] Conserved Glutamic / Aspartic Acids Flanking HIV ESCRT Binding Motifs Are Ca2+Binding Sites Involved in HIV Gag Trafficking
[0316] Ca2+often acts as a coordination point that interacts with multiple oxygen atoms from the carbonyl group of amino acids with negatively charged side chains (such as glutamic (E) / aspartic (D) acids) to stabilize intra- or intermolecule interactions. Point mutations were introduced into 7 out of 9 of the most conserved E / D residues within the p6Gagto generate the Pr55Gag p6-7aamutant (Figure 3a [red conservation scores]). Imaging analyses showed that Pr55Gagp6-7aaoccupied half of the fractional area and exhibited half of the signal intensity as seen with wild-type Pr55Gag (Figures 3b d). Consistent with a role of direct Ca2+binding in HIV Gag trafficking, both the fractional area occupied and the signal intensity displayed of Ca2+were significantly lower in Pr55Gagp6-7aa-expressing cells in comparison with those of wild-type Pr55Gag-expressing cells (Figures 3b d). A single alanine point mutation was independently introduced into 6 of the putative Ca2+binding sites within the recombinant HIV Gag. Biophysical analyses showed that all 6 recombinant Pr55Gagpoint mutants displayed between 3- and 15-fold reduction in Ca2+SPR binding (Figures 3e and 11), and the enhancement of Ca2+-induced Gag-Gag homodimerization in SPR was either reduced or eliminated in 5 out of 6 recombinant Pr55Gagpoint mutants (Figures 3e and 11). Fluorescent imaging and SPR data supported a role of p6Gag E / Dresidues in Ca2+binding to facilitate intracellular trafficking. The individual contributions of these mutations on Ca2+binding during low-order Gag oligomerization were independently examined by ITC. Apart from Pr55Gag E461Athat registered indistinguishable thermodynamic properties compared to wild-type Pr55Gag3 out of 6 mutants (Pr55Gag E460A, Pr55Gag E482A,anj pr^^Gag D496,-\^ showed no ITC detectable Ca2+binding in low-order Gag-Gag homo-oligomerization in vitro (Figures 3f, g and 12). While mutant Pr55Gag E468Aand Pr55Gag E477Aretained their in vitro ITC- detectable Ca2+binding, the thermodynamic properties of these Ca2+-Gag homo-oligomer interactions were reversed from a wild-type exothermic reaction to endothermic reactions in these mutants (Figures 3f, g and 12). Circular dichroism showed that Pr55Gag E468Aand Pr55Gag E477Amaintained the same overall a-helix and P-sheet contents of Pr55Gag(Figure 3h). These data support a role for E / D amino acid residues flanking the ESCRT motifs in the HIV p6Gagas Ca2+binding sites during HIV Gag trafficking. Production of recombinant Pr55Gagwith more than one Ca2+binding site mutations was not successful thus far, making it difficult to further dissect the biophysical properties Pr55Gagcontaining combined Ca2+binding site mutations using cell-free assays.
[0317] Ca2+Binding Stabilizes HIV Gag Assembly Complexes for Directional Trafficking and Release
[0318] Reduction of fluorescent signals of Pr55Gag p6-7aasuggests that the stability of the HIV protein complex (such as the homooligomerization of Gag) might be compromised without wildtype Ca2+binding (Figures 3b-d). As ubiquitination is both important in HIV biology and a post-translational protein degradation system, we examined the impact of changes in Ca2+binding on the ubiquitination of HIV Gag protein complexes. Immunoprecipitation of Pr55Gagshowed that an increased level of ubiquitination was detected in Ca2+-binding-repressed Pr55Gag pA7aa(Figure 4a). As p6Gagis a major segment for HIV Gag ubiquitination, deletion of p6Gaghas reduced detectable ubiquitinated Pr50GagAp6 (Figure 4a). Virological assays were used as a surrogate to quantify the functional impacts of interfering with Ca2+interactions on directional trafficking of proteins in cells. Particle release from a protease inactive (PR[-] via PRD25Gmutation) and an envelope negative immature virus-like particle (VLP) system (HIVNL GagPol PR[-], modified from Schimdt et al. 2020) was used for direct comparison for uropod targeting of HIV Gag oligomeric complexes . Equivalent volumes of viral particle supernatants were pelleted for Western blot analyses. A lower number of pelleted particles was detected upon in-frame deletion of p6Gag (HIVNL GagPol GagAp6PR[-]) (Figure 4b), which was in part due to ESCRT-related membrane arrest of particle release. Lower levels of immature Pr55Gag p6-7aaVLPs (HIVNL GagPol Gagp6-7aa(E / D-G) pR[-]) supported the notion that Ca2+binding site mutations were defective in uropod particle targeting (Figure 4b), implying that the Ca2+-mediated Gag-Gag homooligomerization is a determinant of directional trafficking of HIV protein complexes in cells. Previous analyses with a different combination of glutamic acids mutations in p6Gagreported a similar ubiquitination- mediated degradation of HIV Gag.
[0319] The principle of direct Ca2+binding to regulate homooligomerization of proteins during trafficking should be applicable to hetero-oligomerization of protein complexes, that is, Camdependent interaction between Gag and non-Gag proteins. The copackaging of virion-associated proteins provides an opportunity to interrogate the role of Ca2+binding on hetero-oligomerization of proteins during the trafficking and the release of HIV particles. HIV GagPol (Prl60GagPo1) is a well-characterized cotrafficking and copackaging virion-associated protein. Prl60GagPo1represents 10% of the total virion protein and is understood to be packaged into Gag particles via interactions across the mutually shared CA domain between Gag and GagPol. Unlike the p6Gagin Pr55Gag, the amino acids of p6Po1in Prl60GagPolhave a different protein sequence due to overlapping reading frames. Pr50GagAp6and Pr55Gag p6 7aawere introduced into protease active HIV-INL GagPol constructs. The proteolytic processing of Pr50GagAp6was compromised due to deletion of both p6Po1and part of PR (Figure 4c, lane 2 vs lane 6). Site-specific mutations of E / D to G mutations in Pr55Gagp6-7aavia codon modifications have not altered the amino acid sequences of p6poiof HIVNL GagPol Gagp6-7aa (E / D G). The higher ratio of p25 / 24 CA doublets in Pr55Gagp6-7aaparticles compared to that in wild-type Pr55Gagparticles suggested that a defect of virion protein maturation may exist in the mutant HIVNL GagPol Gagp6-7aa (E / D-G)(Figure 4c, lane 2 vs lane 10). Western blot analyses of pelleted particles produced under increased concentrations of the protease inhibitors indinavir (IDV) supported the notion that the defects in Pr55Gag p6-7aaparticles could be related to reduction in virion packaging of Prl60GagPo1(Figure 4c, d [anti-CA] and [anti-RT], respectively).
[0320] Fine mutational analyses were performed to separate out Ca2+binding site mutations that induced complex instability of Gag homo-oligomers (reduction in virion particle release) from the potential defect of Gag-GagPol hetero-oligomerization (suppression in virion packaging of Prl60GagPo1). Seven single-point mutations and two double-point mutations were introduced into infectious HIVNL4-3. One mutant (HIVGagE468G+E477G) was identified to be noninfectious in both T- cell line (MT2) and PBLs (Figure 4e). Although all mutants have wild-type levels of particle release (i.e., no detectable functional impact on Gag-Gag homo-oligomerization), HIVGagE468G+E477G exhibited virion protein processing profile defects (Figure 4f) reminiscent of HIVNL GagPol Gagp6-7aa(E / D G)(Figure 4c, d, [anti-CA] and [anti-RT], respectively). The lack of functional impact from the seven single-point mutants (Figure 4e, f) and one double-point mutant (HIVGagE482G+D496G, pjgLire4C. f) suggests the redundant nature of these Ca2+binding sites in viral replication, which is consistent with the known role of multiple contact points that Ca2+-based interactions often need to stabilize protein complexes. Western blot virion analyses of the doublepoint mutant (HIVGag E468G+E477G) particles with specific anti-HIV antibodies confirmed a defect in virion Pr55Gagprocessing (Figure 4g) and a reduction of virion-associated polymerase-reverse transcriptase (Figure 4h). Unlike Pr55Gag p6-7aaparticles (Figure 4b), the defects in HIVGag E468G+E477Gwere not associated with impeded viral particle release (i.e., homooligomerization of Gag). Inclusion of virion protease inhibitor IDV during particle production confirmed that HIVGag E468G+E477Gwasdefecpveinvirion Prl60GagPo1packaging (Figure 4i), showing that the suppression of Ca2+binding via Pr55Gagcan lead to reduced heterooligomerization of Pr55Gag-Prl60GagPo1complexes during directional trafficking to the uropod for virion release. To illustrate that Prl60GagPo1can directly interact with Ca2+, a recombinant Prl60GagPo1surrogate, Pr68GagPR, was made by engineering mutations in both the Prl60GagPo1frameshift site and the protease active site to express Pr68GagPR, consisting of the natural Prl60GagPo1domains from pH^ to pl2PR[T SPR analyses showed that Pr68GagPRbound to Ca2+specifically without detectable binding against other cations tested (Figures 4j and 13). To directly examine whether Ca2+can stabilize Pr55Gag-Prl60GagPo1complexes (hetero-oligomerization), coimmunoprecipitation analyses of immature virus-like particles were done with the divalent cation chelating agent EGTA (or EDTA) via an anti-FLAG antibody and C-terminus FLAGtagged Prl60GagPo1containing virion particles. A dose-dependent reduction of detectable Pr55Gagwas seen in the presence of increasing concentrations of EGTA, Ca2+preferred chelating agent, or EDTA (Figures 4k and 13), supporting the notion that direct Ca2+interaction is a mechanism that regulates hetero-oligomerization of HIV Pr55Gag-Prl60GagPo1complexes during trafficking for directional virion release.
[0321] Example 2: Calcium modulators
[0322] Materials and Methods
[0323] Fluorescent imaging analyses of intracellular trafficking of HIV Gag
[0324] HIV Gag was labelled with mCherry by replacing the mEOS coding sequences in pNL43APolAEnv-Gag-mEOS2 to generate Gag-imCherry expression vector. The Gag-imCherry gene was delivered into PBLs using a lentiviral vector delivery system. Lentiviral vectors were generated by co-transfecting HIVNL GagPol, pNL43APolAEnv-Gag-mCherry, and VSV-G construct into HEK293T to produce lentiviral particles. Fluorescent-Pr50GagDp6and -Pr55Gag p6'7aawere produced by engineering corresponding mutations into pNL43APolAEnv- Gag-mCherry expression vectors. The quantity of lentiviral particles was determined by p24CAELISA (XpressBio, XB1010), and similar amounts of concentrated VLP supernatants were used to transduce 3 -day old PHA and IL-2 activated PBLs.
[0325] 4h post-transduction, cells were treated with one of the following: ABT-737, at 0.1 or luM, Venetoclax at 0.1 or luM (Figures 5a-d); Nivolumab at 15 or 150ug / mL (Selleckchem, A2002), Pembrolizumab at 10 or lOOug / mL (Selleckchem, A2005) (Figures 6a-d); Celecoxib at 0.1 or luM (Sigma Aldrich, SML3031-10MG) (Figures 7a-d); Trametinib at Ing / mL (Selleckchem, S2673) (Figures 8a-d); and Capivasertib at lug / mL (Selleckchem, S8019) or Ipatasertib at lug / mL (Selleckchem, S2808) (Figures 9a-d). At 48 hours post-transduction, visible cell clumps were removed for single cells analyses. Intracellular Ca2+was labelled with Fluo-4 dye (Invitrogen, F 14201) dye, nuclei were labelled with Hoechst 33342 (Invitrogen, H1399), mitochondria were labelled Mito Tracker Deep Red (Invitrogen M22426) and washed with HBSS wash buffer containing 2 mM probenecid (Invitrogen, P36400) according to manufacturer’s instructions. Briefly, cells and Fluo-4 dye were incubated for 1 hour at 37° C, after which they were fixed with 4% paraformaldehyde (PFA). Cells were washed to remove PFA and then placed into an 8-well chamber slide (Ibidi, 80826) for imaging. Imaging was carried out via the confocal microscope Nikon Eclipse Ti A1R+ with NIS Element software. Images were obtained with 10X objective and lasers 405nm, 488 nm, 561 nm and 64 nm.
[0326] Only Gag-imCherry expressing PBLs at 48hrs post-transduction were included for analyses. Non-transduced PBLs and Gag-imCherry / Fluo-4 / Hoechst / Mito Tracker dye labelled PBLs were used as controls. Imaging data were analyzed with Fiji (ImageJ) software. Aspect ratio of 1.4 was used as a cut-off to assign cells as ‘elongated’ (>1.4) or ‘round’ (<1.4). Statistical analyses were done using Prism software, and two-sample Kolmogorov-Smirnov test was used to compare the distribution of data between experimental conditions. Cells segmentation was drawn manually, and Fluo4 detectable signal per cell (Figures 14a, 15a, 16a, 17a and 18a), Fluo4 fractional area per cell (Figure 14b, 15b, 16b, 17b and 18b), Gag-mCherry detectable signal per cell (Figure 14c, 15c, 16c, 17c) and Gag-mCherry fractional area per cell (Figure 14d, 15d, 16d, 17d and 18d) were plotted in non-treated versus treated conditions.
[0327] Immunoprecipitation of Gag for ubiquitination analyses
[0328] HA-tagged ubiquitin expression construct was co-transfected with HIVNL GagPol PR(-) in HEK293T cells to quantify levels of ubiquitination of Pr55Gagupon treatments with ABT-737 at 0.1, 0.5, 1 or 2 uM and Venetoclax at 0. 1, 0.5, 1 or 2 uM (Figure 14e); Celecoxib (Sigma Aldrich, SML3031-10MG) at 0. 1, 0.5, 1 or 2uM (Figure 16e) for 20h versus non-treated transfected cells.
[0329] Transfected cell lysates with anti-CA normalized amounts of Pr55Gagwere immunoprecipitated with anti- HIV patient sera, which was followed by Western Blot analyses using anti-HA antibody. Viral supernatants were lysed in RIPA Buffer 2X in PBS (cell Signaling, 9806). Lysates were separated by SDS-PAGE (10% Bis-Tris NuPAGE, Invitrogen) and transferred to nitrocellulose membranes (GE Healthcare). Membranes were blocked with 5% milk in TBS-tween (TBST), rinsed and then probed with either rat monoclonal High Affinity anti-HA (Roche, 11867423001), or mouse monoclonal anti-p24CA(AG3.0, NIH AIDS Reagent Programme). The anti-ra and «w / / -mousc secondary antibodies were HRP conjugated, and the blots were imaged by chemiluminescence (Super Signal™). Imaging of the western blots was performed on a BioRad ChemiDoc XRS+.
[0330] Peripheral blood derived lymphocytes (PBL) proliferation
[0331] 3-4-day old PHA and IL-2 activated (or non-activated as controls) PBLs were stained (or unstained as controls) with CFSE (Figure 19 top left and bottom left) (Biolegend, 423801) for 20min at 37° C, washed and treated with one of the following: ABT-737 at 0.1 or luM, Venetoclax at 0.1 or luM, Celecoxib at 0.1 or luM (Sigma Aldrich, SML3031-10MG) (Figure 19 top right), Nivolumab at 15 or 150ug / mL (Selleckchem, A2002), Pembrolizumab at 10 or lOOug / mL (Selleckchem, A2005) (Figure 19 bottom right) or DMSO alone as a control. A proportion of these cells were collected right after CFSE staining, and 24h, 48h and 72h post-staining. These were fixed with 4% paraformaldehyde (PF A), washed to remove PFA and resuspended in PBS for Flow Cytometry analysis. Samples were run using BD LSRFortessa Cell Analyser. CFSE intensity was assessed using Blue 530_30BP-A laser. Lymphocytes were gated as the central population in a plot SSC-A vs FSC-A, and single cells were gated following a diagonal in a plot FSC-H vs FSC- A. Histograms were produced by plotting Blue 530 30BP-A signal intensity of PBLs populations, fixed after 0 to 72h post staining.
[0332] Results
[0333] Bcl-2 inhibitor
[0334] The imaging data in Figures 14a-b illustrates that both ABT-737 and Venetoclax significantly altered the dynamics of intracellular calcium release across the cells. These changes of calcium dynamics are directly correlated with intracellular dynamics of HIV proteins (Figures 14c-d). More specifically, (i) 1 uM of Venetoclax significantly reduce the detectable HIV protein signals in elongated T cells (Figure 5c); (ii) 1 uM of ABT-737, 0.1 uM Venetoclax, and 1 uM Venetoclax shrank the fractional area of HIV protein occupancy in elongated T cells (Figure 5d); and (iii) both 0.1 uM Venetoclax and 1 uM Venetoclax treatments also reduce the percentage of HIV protein occupancy in round T-cells (Figure 14d). Using immunoprecipitation, there is evidence showing that treatments with selected concentrations of ABT-737 and Veneoclax are associated with enhanced detectable levels of ubiquitination in HIV proteins (Figure 14e). Levels of ubiquitination were estimated using a proven published protocol by tagging ubiquitin with HA epitope (Friedrich et al 2016; Gottwein & Krausslich 2005; Kishor et al. 2022). CFSE labelled primary T-cells were used to illustrate concentration used with ABT-737 and Venetoclax have not adversely affected the proliferation and cell division status over 3 days (Figure 19).
[0335] PD-1 / PD-L1 pathway inhibitor
[0336] The imaging data (Fig 15a-b) illustrates that both pembrolizumab and nivolumab significantly alter the intracellular calcium dynamics in both elongated and round T-cells. Both pembrolizumab and nivolumab treatment have reduced the detectable HIV proteins in elongated T-cells using 100 ug / ml pembrolizumab and 15 ug / ml nivolumab (Fig 15c), while 150 ug / ml nivolumab treatment showed a trend of reduction of detectable HIV proteins in elongated T-cells (Fig 15c). Furthermore, nivolumab consistently shrank the fractional area of HIV protein occupancy in elongated T cells and round T-cells (Fig 15d). The 100 ug / ml pembrolizumab treatment also significantly altered HIV protein trafficking by expanding the fractional area of HIV protein occupancy in round T-cells (Fig 15d). Both pembrolizumab and nivolumab achieve disruption in HIV protein targeting during viral-synapses formation. The opposing effects between pembrolizumab and nivolumab on the fractional area partition of HIV protein in cells is likely to be the consequence of quantitative differences of these two inhibitors on intracellular calcium dynamics. CFSE labelled primary T-cells were used to illustrate concentration used with pembrolizumab and nivolumab have not adversely affected the proliferation and cell division status over 3 days (Figure 19).
[0337] COX-2 inhibitor
[0338] The imaging data illustrates that celecoxib altered the calcium dynamics by enhancing both the detectable calcium signals and the fractional area of calcium signal occupancy in elongated T cells (Fig 16a-b). Treatment with 1 uM celecoxib was also associated with a trend of increased of detectable HIV proteins in round T-cells (Fig 16c). Immunoprecipitation analyses of HIV and HA- ubiquitin co-expressing cells showed that treatment with celecoxib is associated with enhanced levels of ubiquitination on HIV proteins (Fig 16e). CFSE labelled primary T-cells were used to illustrate concentration used with celecoxib has not adversely affected the proliferation and cell division status over 3 days (Figure 19).
[0339] MAPK pathway inhibitor
[0340] The imaging data illustrates that intracellular calcium dynamics are altered upon trametinib treatment (Fig 17a-b), resulting in an increase of detectable calcium signals in elongated T cells (Fig 17a) and a trend of increase of the fractional area of calcium signal occupancy in elongated T cells (Fig 17b). Importantly, treatment of trametinib at 1 ng / ml has resulted in significant increase (>20%) of detectable HIV protein signals in elongated T cells (Fig 17c) plus an increase with the fractional area of HIV protein occupancy in both elongated- and round-T cells (Fig 17d).
[0341] AKT pathway inhibitor
[0342] The imaging data illustrates that intracellular calcium dynamics are disturbed by treatment with either ipatasertib or capivasertib (Fig 18a-b). More specifically, ipatasertib treatment decreased the detectable calcium signals in round-T cells (Fig 18a), while capivasertib increased the fractional area of calcium signal occupancy in round-T cells (Fig 18b). Treatment with ipatasertib lowered the detectable signals and the fractional area of HIV protein occupancy in elongated T-cells (Fig 18c-d), while treatment with capivasertib amplified the detectable signals (in round T-cells) and the fractional area of HIV protein occupancy (across elongated T-cells and round T-cells) (Fig 18c-d). An unexpected observation being that treatment with capivasertib have led to significant reduction of elongated T-cells (42 rather than standard 75 cells) available for analyses, implying the impacts of capivasertib on HIV protein signal detection and intracellular re-patination are likely to be under-estimated. Specifically, the lack of significance of treatment with capivasertib onto the strengthening of HIV protein signals in elongated cells is likely attributed by the lower amounts of elongated T-cells available for analyses (Fig 18c).
[0343] References Chen, et al. MicroRNA binding to the HIV-1 Gag protein inhibits Gag assembly and vims production. Proc. Natl. Acad. Sci. U.S.A. 2014, 111 (26), E2676-83.
[0344] Friedrich et al. Glutamic Acid Residues in HIV-1 p6 Regulate Vims Budding and Membrane Association of Gag. Vimses. 2016, 8(4), 117, https: / / doi.org / 10.3390 / v8040117 Gottwein & Krausslich, Analysis of Human Immunodeficiency Vims Type 1 Gag
[0345] Ubiquitination, J. Virol. 2005, 79 (14), DOI: https: / / doi.org / 10.1128 / JVI.79.14.9134-9144.2005 Kishor, et al. Calcium Contributes to Polarized Targeting of HIV Assembly Machinery by Regulating Complex Stability. JACS Au. 2022, 2, 2, 522-530; 2022, https: / / doi.org / 10.1021 / j acsau. 1 c00563 Schmidt, F.; Weisblum, Y.; Muecksch, F.; Hoffmann, H. H.; Michailidis, E.; Lorenzi, J.
[0346] C. C.; Mendoza, P.; Rutkowska, M.; Bednarski, E.; Gaebler, C.; Agudelo, M.; Cho, A.; Wang, Z.; Gazumyan, A.; Cipolla, M.; Caskey, M.; Robbiani, D. F.; Nussenzweig, M. C.; Rice, C. M.; Hatziioannou, T.; Bieniasz, P. D. Measuring SARS-CoV-2 neutralizing antibody activity using pseudotyped and chimeric vimses. J. Exp Med. 2020, 217 (11), e20201181.
Claims
CLAIMS:
1. A method of promoting immune recognition of a cell comprising a virus in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
2. The method of claim 1, wherein the modulator inhibits or disrupts formation of a viral synapse in the cell.
3. A method of inhibiting or disrupting viral synapse formation by a virus in a cell of a subj ect, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
4. A method of treating a viral infection in a subject, said method including the step of administering to the subject a therapeutically effective amount of a modulator of intracellular calcium signalling.
5. The method of any one of claims 1 to 4, wherein the virus or viral infection has a latent phase.
6. The method of any one of claims 1 to 4, wherein the virus or viral infection is selected from the group consisting of human immunodeficiency virus (HIV), dengue virus (DENV), hepatitis B virus (HBV), zika virus (ZIKV) and combinations thereof.
7. The method of any one of claims 4 to 6, further including the step of administering a therapeutically effective amount of an antiviral agent.
8. The method of claim 7, wherein the antiviral agent is or comprises anti-retroviral therapy (ART).
9. The method of claim 8, wherein the ART is highly active antiretroviral therapy (HAART), a protease inhibitor, a fusion inhibitor, a integrase inhibitor, a co-receptor specific agent, a nonnucleoside analogue reverse transcriptase inhibitor, a nucleoside analogue reverse transcriptase inhibitor and combinations thereof.
10. The method of any one of claims 1 to 9, wherein the modulator is an inhibitor of a calcium- viral protein interaction.
11. The method of any one of claims 1 to 10, wherein the modulator induces ubiquitination and / or degradation of a structural viral protein.
12. The method of any one of claims 1 to 11, wherein the modulator is selected from the group consisting of a B-cell lymphoma 2 (Bcl-2) inhibitor, a programmed cell death protein 1 (PD- l) / programmed cell death ligand 1 (PD-L1) pathway inhibitor, a cyclooxygenase-2 (COX-2)5 inhibitor, a kinase inhibitor, a calcium channel blocker and / or antagonist, a P-Hydroxy P- methylglutaryl-CoA (HMG-CoA) reductase inhibitor and combinations thereof.
13. The method of claim 12, wherein the Bcl-2 inhibitor is selected from the group consisting of ABT-737, Venetoclax and combinations thereof. ®14. The method of claim 12, wherein the PD-1 / PD-L1 pathway inhibitor is selected from the group consisting of pembrolizumab, nivolumab and combinations thereof.
15. The method of claim 12, wherein the COX-2 inhibitor is celecoxib.
516. The method of claim 12, wherein the MAPK pathway inhibitor is trametinib.
17. The method of claim 12, wherein the AKT pathway inhibitor is selected from the group consisting of ipatasertib, capivasertib and combinations thereof.
918. The method of any one of claims 1 to 17, wherein the cell is an immune cell.
19. The method of claim 18, wherein the immune cell is a T cell or a B cell, preferably a CD4+ T cell.
520. Use of a modulator of intracellular calcium signalling in the manufacture of a medicament for promoting immune recognition of a cell comprising a virus.
21. Use of a modulator of intracellular calcium signalling in the manufacture of a medicament® for inhibiting viral synapse formation by a virus in a cell.
22. Use of a modulator of intracellular calcium signalling in the manufacture of a medicament for treating a viral infection. 5 23. The use of any one of claims 20 to 22, wherein the use is modified based on the method of any one of claims 1 to 19.
24. A method for identifying, designing or producing an agent for use in treating a viral infection, said method including the steps of: ® (a) contacting a cell infected with a virus with a candidate agent; and(b) determining whether the candidate agent promotes immune recognition and / or inhibits viral synapse formation of the virus.
25. The method of claim 24, wherein the method further comprises comparing the efficacy of at least two candidate agents to identify an optimal candidate agent.
26. The method of claim 24 or 25, wherein step (b) includes determining whether the candidate agent promotes ubiquitination of a viral protein of the virus.
27. The method of any one of claims 24 to 26, further including one or more of the steps of:(i) selecting the candidate agent that promotes immune recognition and / or inhibits viral synapse formation of the virus;(ii) formulating the candidate agent into a pharmaceutical formulation; and(iii) adding the candidate agent or the pharmaceutical formulation to packaging and / or a container.
28. An agent produced according to the method of any one of Claims 24 to 27, for use in the treatment of a viral infection in a subject.