Optimised polynucleotides

EP4665857A2Pending Publication Date: 2025-12-24CENTEON LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024756421
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-22
Filing Date
2024-02-13
Publication Date
2025-12-24

AI Technical Summary

Technical Problem

Lentiviral vectors used in gene therapy often produce incomplete, non-functional RNA genomes and contain cryptic splice sites that lead to aberrant splicing events, compromising safety and efficacy.

Method used

Modification of the murine leukemia virus-derived (MND) promoter and woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to eliminate cryptic splice sites and polyA motifs, reducing the risk of premature RNA truncation and aberrant splicing.

Benefits of technology

The modified vectors enhance the production of functional RNA and improve transgene expression stability, ensuring safer and more effective gene therapy outcomes by minimizing premature termination and aberrant splicing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 000129
    Figure 000129
  • Figure 000118
    Figure 000118
  • Figure 000130
    Figure 000130
Patent Text Reader

Abstract

The present disclosure relates to optimised polynucleotides, vectors and methods of use thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] OPTIMISED POLYNUCLEOTIDES

[0002] RELATED APPLICATION DATA

[0003] The present application claims priority from United States Patent Application No. 63 / 484,555 filed 13 February 2023 entitled “Optimised polynucleotides” and United States Patent Application No. 63 / 601,879 filed 22 November 2023 entitled “Optimised polynucleotides II”. The entire contents of both applications are hereby incorporated by reference.

[0004] SEQUENCE LISTING

[0005] The present application is filed together with a Sequence Listing in electronic form. The entire contents of the Sequence Listing is hereby incorporated by reference.

[0006] FIELD

[0007] The present disclosure relates to optimised polynucleotides, vectors and methods of use thereof.

[0008] BACKGROUND

[0009] Retroviruses, e.g., lentiviruses are one of the most studied viral vectors for gene therapy. Retroviruses in general are RNA-based viruses which integrate their genetic information into the target cell chromosomes permanently. The advantages of retroviruses include long-term transgene expression in target cells, a low immunogenic potential, and the ability to transduce into dividing and non-dividing cells.

[0010] Lentiviruses are genetically engineered and usually based on human immunodeficiency virus 1 (HIV-1). To increase safety, modem vectors contain only those HIV genes which are necessary for infection and gene delivery, but the genes necessary for replication and virulence factors have been removed.

[0011] To produce lentiviruses, cells are transfected with 3-4 plasmids. These include the transfer plasmid with the gene of interest and several packaging plasmids and essential viral proteins responsible for gene integration or self-assembly. These plasmids can be transiently transfected into the cells, or a producer cell line is created with stable integration of the plasmids with inducible promoters, in which lentivirus production can be induced.

[0012] Once the vims production has been induced, the release of the vims occurs by budding after successful assembly within the cells. The lentivirus is harvested from the producer cells and subsequently purified and concentrated in the downstream process. The resultant lentivirus can be used to modify cells, such as hemopoietic stem cells or T- cells, for clinical benefit.

[0013] The capacity to integrate transgenes into the host cell genome makes retroviral vectors an attractive approach for gene therapy. Whilst lentiviral gene therapies have the potential to deliver stable, long-term transgene expression, a large proportion of lentivirus produced contains an incomplete, and therefore non-functional, RNA genome. This raises concerns about the long-term safety and efficacy of the use of such vectors for gene therapy. Additionally, the presence of cryptic splice sites within viral vector or other related gene therapy construct may result in aberrant splicing events which could affect the quality, efficacy and / or resultant transgene expression.

[0014] Thus, there is a need in the art for improved viral vectors for gene therapy, in particular production of lentiviral vectors with improved production of functional RNA and / or modified vector elements which reduce or eliminate undesired splice events. For example, there is a need for modified vector elements, such as promoters, which do not contain cryptic splice sites, and are capable of inducing constitutive expression of a desired transgene, whilst preserving safety and / or therapeutic efficacy of the resultant viral vector.

[0015] SUMMARY

[0016] In work leading up to the invention, the inventors recognised that a large proportion of lentivirus produced contains an incomplete and thus non-functional RNA genome, which reduces the safety and efficacy of the vector. To this end, the inventors sought to examine and identify sites within the vector associated with premature RNA truncation. Consequently, through RNA sequencing, the inventors identified a specific site within the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) associated with premature truncation. In particular, the inventors identified a cryptic polyA site motif within WPRE associated with premature RNA transcripts. Accordingly, the inventors sought to modify the cryptic polyA site with WPRE to produce an optimised integrating viral vectors, i.e., a lentiviral vector, with improved production of functional RNA for use in e.g., gene therapy.

[0017] The inventors also identified the presence of putative cryptic splice sites within the murine leukemia virus-derived (MND) promoter of a lentiviral vector. For example, the inventors identified two key splice donor sites (SD1 and SD2) within the MND promoter on the positive strand of the vector and a third splice donor site (SD3) on the negative strand of the vector. The inventors subsequently sought to modify these putative cryptic splice sites by silent point mutations to produce optimised MND promoters with reduced risk of aberrant splice activity for use in viral vectors and other nucleic acid constructs.

[0018] Accordingly, based on the foregoing, the present disclosure provides an isolated nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof comprising one or more putative cryptic splice sites therein mutated and / or a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0019] The present disclosure provides an isolated nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof comprising one or more putative cryptic splice sites therein mutated and a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0020] The present disclosure provides an isolated nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof comprising one or more putative cryptic splice sites therein mutated.

[0021] The present disclosure provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0022] The present disclosure provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 24.

[0023] The present disclosure also provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 25.

[0024] The present disclosure further provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 27.

[0025] The present disclosure provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 28.

[0026] The present disclosure provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 30. The present disclosure provides an isolated nucleic acid comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising a sequence set forth in SEQ ID NO: 31.

[0027] The present disclosure also provides a polynucleotide comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or a fragment thereof.

[0028] In one example, the present disclosure provides a polynucleotide comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in SEQ ID NO: 23 or a fragment thereof.

[0029] In one example, the present disclosure provides a polynucleotide comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in SEQ ID NO: 26 or a fragment thereof.

[0030] In one example, the present disclosure provides a polynucleotide comprising a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in SEQ ID NO: 29 or a fragment thereof.

[0031] It will be apparent to the skilled person from the disclosure herein that SEQ ID NO: 23 corresponds to a wild-type WPRE sequence, SEQ ID NO: 26 corresponds to a mutated functional derivative of WPRE, WPRE mut6 which contains six-point mutations and SEQ ID NO: 29 corresponds to another mutated functional derivative of WPRE, WPRE mut7 which contains an additional point mutation to WPRE mut6.

[0032] In one example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29 or a fragment thereof. For example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 ofSEQ ID NO: 23 or a fragment thereof. In one example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 26 or a fragment thereof. In another example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 29 or a fragment thereof.

[0033] In one example, the cryptic poly (A) site motif is ATTACA.

[0034] In one example, the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29. For example, the modified WPRE or fragment thereof comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 23 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 26 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 29 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises guanine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises guanine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 23 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises guanine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 26 or a fragment thereof. In one example, the modified WPRE or fragment thereof comprises guanine substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NO: 29 or a fragment thereof.

[0035] In one example, the cryptic poly (A) site motif is modified to ATTTCA or ATTGCA. For example, the cryptic poly (A) site motif is modified to ATTTCA. In another example, the cryptic poly (A) site motif is modified to ATTGCA.

[0036] In one example, the modified WPRE comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0037] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 24. For example, the modified WPRE comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of wild-type WPRE (i.e., SEQ ID NO: 23 or a fragment thereof).

[0038] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 25. For example, the modified WPRE comprises a guanine substituted for adenine at a position corresponding to nucleotide 17 of wild-type WPRE (i.e., SEQ ID NO: 23 or a fragment thereof).

[0039] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 27. For example, the modified WPRE comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of WPRE mut6 (i.e., SEQ ID NO: 26 or a fragment thereof).

[0040] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 28. For example, the modified WPRE comprises a guanine substituted for adenine at a position corresponding to nucleotide 17 of WPRE mut6 (i.e., SEQ ID NO: 26 or a fragment thereof).

[0041] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 30. For example, the modified WPRE comprises a thymine substituted for adenine at a position corresponding to nucleotide 17 of WPRE mut7 (i.e., SEQ ID NO: 29 or a fragment thereof).

[0042] In one example, the modified WPRE comprises a sequence set forth in SEQ ID NO: 31. For example, the modified WPRE comprises a guanine substituted for adenine at a position corresponding to nucleotide 17 of WPRE mut7 (i.e., SEQ ID NO: 29 or a fragment thereof).

[0043] In one example, the polynucleotide of the disclosure further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0044] In one example, the polynucleotide further comprises a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest. In one example, the promoter is selected from the group consisting of a cytomegalovirus (CMV) promoter, a CMV enhancer, a murine leukemia virus-derived (MND) promoter, a simian virus 40 (SV40) promoter with enhancer, a polyubiquitin C gene (UBC) promoter, a phosphoglycerate kinase (PGK) promoter, an elongation factor- 1 alpha (EFl A) promoter, a human P-actin (hACTB) promoter, a 7SK promoter, a cytomegalovirus immediate-early enhancer / chicken P-actin (CAG) promoter, an EM7 promoter and combinations thereof.

[0045] In one example, the promoter is a MND promoter. For example, the promoter is a modified MND promoter or fragment thereof. In one example, the promoter is a modified murine leukemia virus-derived (MND) promoter or fragment thereof comprising one or more putative cryptic splice sites therein mutated. For example, the MND promoter comprises two or three putative cryptic splice sites therein mutated.

[0046] In one example, the MND promoter is any modified MND promoter described herein or comprises a nucleotide sequence having at least about 90% sequence identity to a sequence disclosed herein.

[0047] In one example, the polynucleotide of the disclosure further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0048] In one example, the polynucleotide of the disclosure further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a modified MND promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0049] The present disclosure provides an isolated nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof comprising one or more putative cryptic splice sites therein mutated. For example, the MND promoter comprises two or three putative cryptic splice sites therein mutated.

[0050] The present disclosure additionally provides a nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises one or more of the following nucleotide substitutions relative to SEQ ID NO: 38: i) adenine substituted for thymine at a position corresponding to nucleotide 45; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260.

[0051] The present disclosure also provides a nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises an adenine substituted for thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 38.

[0052] The present disclosure further provides a nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises an adenine substituted for thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 38.

[0053] The present disclosure provides a nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises a thymine substituted for adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 38.

[0054] The present disclosure additionally provides a nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 38, and wherein the sequence of the MND promoter or fragment thereof comprises one or more of the following nucleotide substitutions relative to SEQ ID NO: 38: i) adenine substituted for thymine at a position corresponding to nucleotide 45; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260. In one example, the sequence of the MND promoter comprises the three nucleotide substitutions. For example, the sequence of the MND promoter comprises an adenine substituted for thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 38, an adenine substituted for thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 38 and a thymine substituted for adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 38.

[0055] In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is at least 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99%. In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is 95%. In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is 96%. In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is 97%. In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is 98%. In one example, the percent sequence identity of the sequence of the MND promoter to SEQ ID NO: 38 is 99%.

[0056] The present disclosure also provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in any one of SEQ ID NOs: 41, 25, 27, 28, 30, 31, 32, 33 or 34.

[0057] The present disclosure also provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 41 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0058] The present disclosure also provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 42 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0059] The present disclosure further provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 44 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0060] The present disclosure provides an isolated nucleic acid comprising a modified murine MND promoter sequence set forth in SEQ ID NO: 45 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0061] The present disclosure provides an isolated nucleic acid comprising modified MND promoter comprising a sequence set forth in SEQ ID NO: 47 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0062] The present disclosure provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 48 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0063] The present disclosure provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 49 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0064] The present disclosure provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 50 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0065] The present disclosure provides an isolated nucleic acid comprising a modified MND promoter comprising a sequence set forth in SEQ ID NO: 51 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0066] The present disclosure also provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter.

[0067] The present disclosure also provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter comprises a modification that reduces propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter.

[0068] The present disclosure further provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter has a reduced propensity to induce aberrant splicing of RNA transcripts compared to a MND promoter comprising a sequence set forth in any one of SEQ ID NOs: 38, 39, 40 or 41.

[0069] The present disclosure further provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter comprises a modification that reduces the propensity to induce aberrant splicing of RNA transcripts compared to a MND promoter comprising a sequence set forth in any one of SEQ ID NOs: 38, 39, 40 or 41. The present disclosure also provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter is modified relative to a parental sequence to remove one or more putative cryptic splice sites.

[0070] The present disclosure further provides a polynucleotide comprising a modified MND promoter or fragment thereof, wherein the modified MND promoter lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

[0071] In one example, the unmodified MND promoter is a parental sequence of the modified MND promoter. For example, the unmodified MND promoter is a parental sequence of the modified MND promoter and does not comprise one or more of the substitutions discussed above.

[0072] In one example, the unmodified MND promoter comprises a sequence set forth in any one of SEQ ID NOs: 38, 39, 40 or 41.

[0073] In one example, the modified MND promoter lacks one or more putative cryptic splice sites compared to an unmodified MND promoter comprising a sequence set forth in any one of SEQ ID NOs: 38, 39, 40 or 41.

[0074] It will be apparent from the foregoing that the modified MND promoter need not completely reduce the propensity to induce aberrant splicing of RNA transcripts, rather it need only reduce the propensity by a statistically significant amount, for example, by at least about 10% or 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95%.

[0075] It will be apparent to the skilled person from the disclosure herein that SEQ ID NO: 38 corresponds to the unmodified MND promoter sequence, SEQ ID NO: 39 corresponds to a wild-type nucleotide sequence of putative cryptic splice site 1 (SD1), SEQ ID NO: 40 corresponds to a wild-type nucleotide sequence of putative cryptic splice site 2 (SD2), and SEQ ID NO: 41 corresponds to a wild-type nucleotide sequence of putative cryptic splice site 3 (SD3).

[0076] In one example, the one or more putative cryptic splice sites are within a direct repeat sequence and / or an enhancer sequence of the MND promoter.

[0077] In one example, the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 34 to 53, nucleotides 109 to 128 and / or nucleotides 251 to 271 of SEQ ID NO: 38. In one example, the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 34 to 53 of SEQ ID NO: 38. In one example, the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 109 to 128 of SEQ ID NO: 38. In one example, the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 251 to 271 of SEQ ID NO: 38. In one example, the one or more putative cryptic splice sites comprise a sequence set forth in any one of SEQ ID NOs: 39, 40 or 41. In one example, the putative cryptic splice site comprises a sequence set forth in SEQ ID NO: 39. In one example, the putative cryptic splice site comprises a sequence set forth in SEQ ID NO: 40. In one example, the putative cryptic splice site comprises a sequence set forth in SEQ ID NO: 41.

[0078] In one example, the modified MND promoter or fragment thereof comprises a nucleotide sequence selected from the group consisting of adenine and thymine and substituted for thymine and adenine at a position corresponding to nucleotides 45, 120 and / or 260 of SEQ ID NO: 38. In one example, the modified MND promoter or fragment thereof comprises adenine substituted for a thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 38. In one example, the modified MND promoter or fragment thereof comprises adenine substituted for a thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 38. In one example, the modified MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 38.

[0079] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, 49, 50 or 51 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above.

[0080] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 42 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the modified MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 45 of wild-type MND promoter (i.e., SEQ ID NO: 38 or a fragment thereof). For example, the modified MND promoter comprises a modified putative cryptic splice site 1 (SD1) comprising thymine substituted for an adenine at a position corresponding to nucleotide 12 of the wild-type putative cryptic splice site 1 (SD1) (i.e., SEQ ID NO: 39 or a fragment thereof). For example, the modified putative cryptic splice site 1 (SD1) (i.e., SEQ ID NO: 42 or a fragment thereof), comprises thymine substituted for an adenine at a position corresponding to nucleotide 12 of the wild-type putative cryptic splice site 1 (SD1) (i.e., SEQ ID NO: 39 or a fragment thereof).

[0081] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 43 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the modified MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 120 of wild-type MND promoter (i.e., SEQ ID NO: 38 or a fragment thereof). For example, the modified MND promoter comprises a modified putative cryptic splice site 2 (SD2) comprising thymine substituted for an adenine at a position corresponding to nucleotide 12 of the wild-type putative cryptic splice site 2 (SD2) (i.e., SEQ ID NO: 40 or a fragment thereof). For example, the modified putative cryptic splice site 2 (SD2) (i.e., SEQ ID NO: 43 or a fragment thereof), comprises thymine substituted for an adenine at a position corresponding to nucleotide 12 of the wild-type putative cryptic splice site 2 (SD2) (i.e., SEQ ID NO: 40 or a fragment thereof).

[0082] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 44 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above . For example, the modified MND promoter or fragment thereof comprises adenine substituted for a thymine at a position corresponding to nucleotide 260 of wild-type MND promoter (i.e., SEQ ID NO: 38 or a fragment thereof). For example, the modified MND promoter comprises a modified putative cryptic splice site 3 (SD3) comprising adenine substituted for a thymine at a position corresponding to nucleotide 9 of the wildtype putative cryptic splice site 3 (SD3) (i.e., SEQ ID NO: 41 or a fragment thereof). For example, the modified putative cryptic splice site 3 (SD3) (i.e., SEQ ID NO: 44 or a fragment thereof), comprises adenine substituted for a thymine at a position corresponding to nucleotide 9 of the wild-type putative cryptic splice site 3 (SD3) (i.e., SEQ ID NO: 41 or a fragment thereof).

[0083] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 45 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 45, and thymine substituted for an adenine at a position corresponding to nucleotide 120 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0084] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 46 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 45, thymine substituted for an adenine at a position corresponding to nucleotide 120, and adenine substituted for a thymine at a position corresponding to nucleotide 260 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0085] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 47 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 45, and adenine substituted for a thymine at a position corresponding to nucleotide 260 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0086] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 48 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 120, and adenine substituted for a thymine at a position corresponding to nucleotide 260 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0087] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 49 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 45 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0088] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 50 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises thymine substituted for an adenine at a position corresponding to nucleotide 120 of the wild-type MND promoter (i.e., SEQ ID NO: 38).

[0089] In one example, the modified MND promoter or fragment thereof comprises a sequence set forth in SEQ ID NO: 51 or a sequence having at least 95% or 96% or 97% or 98% or 99% identity thereto and comprising one or more substitutions as discussed above. For example, the MND promoter or fragment thereof comprises adenine substituted for a thymine at a position corresponding to nucleotide 260 of the wild-type MND promoter (i.e., SEQ ID NO: 38). In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising the modified MND promoter operably linked to a nucleotide sequence comprising a transgene of interest.

[0090] In one example, the polynucleotide of the disclosure further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0091] In one example, the polynucleotide of the disclosure comprises: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a modified MND promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0092] In one example, the polynucleotide of the disclosure comprises: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a modified MND promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0093] The present disclosure provides comprising from 5’ to 3’: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a modified MND promoter as described herein operably linked to a nucleotide sequence comprising a transgene of interest; e) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof as described herein; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0094] In one example, the polynucleotide further comprises a nucleotide sequence comprising a tetracycline repressible promoter. For example, the tetracycline repressible promoter comprises a sequence set forth in SEQ ID NO: 3. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of any one of SEQ ID NO: 21, 22 or 34-37. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 21. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 22. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 34. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 35. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 36. In one example, the tetracycline repressible promoter comprises a sequence set forth in nucleotides 36-306 of SEQ ID NO: 37.

[0095] In one example, the polynucleotide further comprises a nucleotide sequence comprising a 5’ long terminal repeat (LTR). For example, the 5’LTR comprises a U3, U5 and / or R region. In one example, the 5’LTR comprises a U3 region comprising a sequence set forth in SEQ ID NO: 4. In one example, the 5’LTR comprises a R region comprising a sequence set forth in SEQ ID NO: 5. In one example, the 5’LTR comprises a U5 region comprising a sequence set forth in SEQ ID NO: 6.

[0096] In one example, the polynucleotide further comprises one or more lentiviral elements. For example, the one or more lentiviral elements are selected from the group consisting of: a nucleotide sequence comprising a packaging signal; a nucleotide sequence comprising a central polypurine tract (cPPT), a nucleotide sequence encoding a Rev response element (RRE); a nucleotide sequence encoding a multiple cloning site and combinations thereof.

[0097] In one example, the lentiviral element is a packaging signal. For example, the packaging signal is a psi packaging signal. In one example, the psi packaging signal comprises a sequence set forth in SEQ ID NO: 8.

[0098] In one example, the lentiviral element is a central polypurine tract (cPPT). An exemplary cPPT comprises a sequence set forth in SEQ ID NO: 10.

[0099] In one example, the lentiviral element is a Rev response element (RRE). For example, the RRE comprises a sequence set forth in SEQ ID NO: 11.

[0100] In one example, the polynucleotide further comprises a nucleotide sequence comprising an insulator. For example, the insulator is a chicken hypersensitive site-4 (cHS4) insulator. In one example, the insulator is a 1200 bp cHS4 insulator. In another example the insulator is 650 bp insulator. In another example, the insulator is a 400 bp cHS4 insulator. In another example, the insulator is a 250 bp insulator. In one example, the insulator is oriented in a forward direction relative to a transgene of interest. In another example, the insulator is in a reverse orientation relative to the transgene of interest. In one example, the nucleotide sequence comprising the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32 or 33. For example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32. In another example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 33. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of any one of SEQ ID NO: 21, 22 or 34-37. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 21. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 22. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 34. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 35. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 36. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4371-5035 of SEQ ID NO: 37. In one example, the nucleotide sequence comprising the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32, 33, 57, 58 or 59. For example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32. In another example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 33. In another example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 57. In another example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 58. In another example, the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 59. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4547-4956 of any one of SEQ ID NO: 54. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4547-4956 of SEQ ID NO: 55. In one example, the cHS4 insulator comprises a sequence set forth in nucleotides 4547-4956 of SEQ ID NO: 56.

[0101] In one example, the polynucleotide further comprises a nucleotide sequence comprising a 3’ LTR. For example, the 3’LTR comprises a U3, U5 and / or R region. In one example, the 3’LTR comprises a U3 region comprising a sequence set forth in SEQ ID NO: 13 and / or 14. For example, the 3’LTR comprises a U3 region comprising a sequence set forth in SEQ ID NO: 13. In another example, the 3’LTR comprises a U3 region comprising a sequence set forth in SEQ ID NO: 14. In a further example, the 3’LTR comprises a U3 region comprising a sequence set forth in SEQ ID NO: 13 and SEQ ID NO: 14. In one example, the 3 ’LTR comprises a R region comprising a sequence set forth in SEQ ID NO: 15. In one example, the 3’LTR does not comprise a U5 region.

[0102] In one example, the polynucleotide further comprises a nucleotide sequence comprising a polyA signal. In one example, the polyA signal is selected from the group consisting of a simian virus 40 (SV40) polyA, SV40 late promoter (SVLP) polyA, human growth hormone (hGH) polyA, bovine growth hormone (BGH) polyA and rabbit betaglobin polyadenylation signal (rbGlob) polyA. In one example, the polyA signal is a rabbit beta-globin polyadenylation signal (rbGlob) polyA. For example, the rbGlob polyA comprises a sequence set forth in SEQ ID NO: 16. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of any one of SEQ ID NO: 21, 22 or 34-37. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 21. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 22. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 34. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 35. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 36. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5162-5610 of SEQ ID NO: 37. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5082-5531 of any one of SEQ ID NO: 54, 55 or 56. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5082-5531 of SEQ ID NO: 54. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5082-5531 of SEQ ID NO: 55. In one example, the rbGlob polyA comprises a sequence set forth in nucleotides 5082-5531 of SEQ ID NO: 56.

[0103] In one example, the polynucleotide further comprises a nucleotide sequence comprising one or more viral origin of replication sequence(s). In one example, the one or more viral origin of replication sequence(s) is selected from the group consisting of pUC, pUK, SV40 ori and combinations thereof. In one example, the viral origin of replication sequence is a pUC viral origin of replication sequence. In another example, the viral origin of replication sequence is a SV40 origin of replication sequence. In a further example, the viral origin of replication sequence is a SV40 origin of replication sequence and a pUC viral origin of replication sequence. In one example, the SV40 viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 17 and / or the nucleotide sequence comprising the pUC viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 18. For example, the SV40 viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 17. In another example, the pUC viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 18.

[0104] In one example, the polynucleotide further comprises a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter. For example, the antibiotic resistance gene is an Amp(R) gene operably linked to an Amp(R) promoter. In one example, the nucleotide sequence encoding the Amp(R) gene comprises a sequence set forth in SEQ ID NO: 19 and / or the nucleotide sequence comprising the Amp(R) promoter comprises a sequence set forth in SEQ ID NO: 20. In one example, the nucleotide sequence encoding the Amp(R) gene comprises a sequence set forth in SEQ ID NO: 19. In another example, the nucleotide sequence comprising the Amp(R) promoter comprises a sequence set forth in SEQ ID NO: 20.

[0105] In one example, the polynucleotide comprises between about 2,000 and about 15,000 nucleotides. For example, the polynucleotide comprises between about 2,000 and about 15,000 nucleotides. For example, the polynucleotide comprises between about 3,000 nucleotides and 13,000 nucleotides. In one example, the polynucleotide comprises between about 4,000 nucleotides and 12,000 nucleotides. In one example, the polynucleotide comprises about 5,000 nucleotides and 10,000 nucleotides. For example, the polynucleotide comprises between about 5,000 and 9,000 nucleotides.

[0106] In one example, the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 21, 22 or 34-37 lacking nucleotides 2,402 to 3,635. In one example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 21, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 21. In another example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 22, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 22. In a further example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 34, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 34. In one example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 35, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 35. In another example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 36, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 36. In another example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 37, lacking nucleotides 2,402 to 3,635 (i.e., lacking the exemplary nucleotide sequence comprising a MND promoter operably linked to a nucleotide sequence comprising an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 2,401 and nucleotides 3,636 to 8,682 of SEQ ID NO: 37.

[0107] In one example, the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 54, 55 or 56 lacking nucleotides 3,098 to 3,814. In one example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 54, lacking nucleotides 3,098 to 3,814 (i.e., lacking the exemplary nucleotide sequence encoding an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 3,097 and nucleotides 3,815 to 8,580 of SEQ ID NO: 54. In one example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 55, lacking nucleotides 3,098 to 3,814 (i.e., lacking the exemplary nucleotide sequence encoding an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 3,097 and nucleotides 3,815 to 8,580 of SEQ ID NO: 55. In one example, the polynucleotide comprises a sequence set forth in SEQ ID NO: 56, lacking nucleotides 3,098 to 3,814 (i.e., lacking the exemplary nucleotide sequence encoding an eGFP transgene of interest). In one example, the polynucleotide comprises nucleotides 1 to 3,097 and nucleotides 3,815 to 8,580 of SEQ ID NO: 56.

[0108] In one example, the polynucleotide is a vector. For example, the vector is a plasmid or a virus. In one example, the virus is a retrovirus. For example, the retrovirus is a lentivirus.

[0109] The present disclosure also provides a vector comprising the polynucleotide of the present disclosure.

[0110] The present disclosure further provides a stable cell line comprising the polynucleotide or the vector of the present disclosure.

[0111] In one example, the cell line is selected from the group consisting of GPR, GPRG, GPRT, GPRGT, and GPRTG cell lines and derivatives thereof. In one example, the cell line is selected from the group consisting of Jurkat, HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT, GPRTG, K562, U-937, and CHO cell lines and derivatives thereof.

[0112] The present disclosure also provides the use of the stable cell line comprising the polynucleotide or vector of the disclosure for production of an enveloped virus, wherein the virus is for use in gene therapy.

[0113] In one example, the enveloped virus is a retrovirus. For example, the enveloped virus is a lentivirus, e.g., human immunodeficiency virus. The present disclosure further provides a method of reducing premature termination of RNA transcription in a cell, the method comprising stably integrating the polynucleotide of the disclosure into the cell.

[0114] The present disclosure further provides a method of reducing aberrant splicing of RNA transcripts in a cell, the method comprising stably integrating the polynucleotide of the disclosure into the cell.

[0115] BRIEF DESCRIPTION OF THE DRAWINGS

[0116] Figure 1 is a schematic representation showing Nanopore direct RNA sequence and site of premature termination of RNA in WPRE mut6 (arrow).

[0117] Figure 2 is a schematic representation showing Nanopore direct RNA sequence and correction of premature termination of RNA in modified WPRE mut6 (arrow).

[0118] Figure 3 is a schematic representation of an exemplary vector of the disclosure.

[0119] Figure 4 is a schematic representation of the model EGFP vector pBRNGTR17.

[0120] Figure 5 is a schematic representation of the annotated MND promoter sequence. Grey shading indicates direct repeat sequence. Black boxes indicate sequence of splice sites identified in Table 1. Bold, underlined residues indicate splice site.

[0121] Figure 6 is a schematic representation of the MND promoter with features highlighted, including direct repeat, enhancer sequence and SD1, SD2 and SD3.

[0122] Figure 7 is a schematic representation of the model Wiskott-Aldrich LV (WAS LV1).

[0123] Figure 8 is a representation of the of global fusion transcript assay.

[0124] Figure 9 is a global fusion transcript assay identifying splice donor sites in MND promoter sequence (circled) of model vector WAS LV 1.

[0125] Figure 10 is a schematic representation of the model Wiskott-Aldrich LV (WAS LV2).

[0126] Figure 11 is a Nanopore direct RNA sequencing for an exemplary Wiskott- Aldrich Syndrome LV vector (WAS LV2); A) Plot showing the sequencing coverage and splicing patterns (lines connecting splice donors and acceptors) sequenced by Nanopore direct RNA technology, B) Plot showing sequencing coverage in optimized WAS LV3 comprising two point mutations in the MND promoter to remove SD1 and SD2 and C) Reference sequence of model WAS LV vectors (WAS LV2 and WAS LV3) with various features annotated.

[0127] Figure 12 is a schematic representation of Exemplary EGFP vectors pBRNGTR17; pBRNGTRl 17 and pBRNGTRl 16. Figure 13 is a flow cytometry analysis of exemplary EGFP vectors: A) pBRNGTRl 7, B) pBRNGTRl 17 and C) pBRNGTRl 16.

[0128] KEY TO SEQUENCE LISTING

[0129] SEQ ID NO: 1 Nucleotide sequence of TL20c vector backbone

[0130] SEQ ID NO: 2 Nucleotide sequence of pUC57-TL20c transfer plasmid

[0131] SEQ ID NO: 3 Nucleotide sequence of p7tetO

[0132] SEQ ID NO: 4 Nucleotide sequence of mini U3 pro

[0133] SEQ ID NO: 5 Nucleotide sequence of R region

[0134] SEQ ID NO: 6 Nucleotide sequence of U5

[0135] SEQ ID NO: 7 Nucleotide sequence of primer binding site (pbs)

[0136] SEQ ID NO: 8 Nucleotide sequence of psi packaging signal

[0137] SEQ ID NO: 9 Nucleotide sequence of partial gag

[0138] SEQ ID NO: 10 Nucleotide sequence of cPPT

[0139] SEQ ID NO: 11 Nucleotide sequence of Rev Response Element (RRE)

[0140] SEQ ID NO: 12 Nucleotide sequence of nef partial

[0141] SEQ ID NO: 13 Nucleotide sequence of partial U3

[0142] SEQ ID NO: 14 Nucleotide sequence of partial U3

[0143] SEQ ID NO: 15 Nucleotide sequence of R

[0144] SEQ ID NO: 16 Nucleotide sequence of rabbit beta-globin polyadenylation signal

[0145] SEQ ID NO: 17 Nucleotide sequence of SV40 origin of replication

[0146] SEQ ID NO: 18 Nucleotide sequence of pUC Origin of replication

[0147] SEQ ID NO: 19 Nucleotide sequence of AmpR gene

[0148] SEQ ID NO: 20 Nucleotide sequence of AmpR promoter

[0149] SEQ ID NO: 21 Nucleotide sequence of representative vector 1 comprising mut6 WPRE optimised option 1

[0150] SEQ ID NO: 22 Nucleotide sequence of representative vector 2 comprising mut6 WPRE optimised option 2

[0151] SEQ ID NO: 23 Nucleotide sequence of WPRE WT

[0152] SEQ ID NO: 24 Nucleotide sequence of WPRE WT optimized 1

[0153] SEQ ID NO: 25 Nucleotide sequence of WPRE WT optimized 2

[0154] SEQ ID NO: 26 Nucleotide sequence of WPRE mut6

[0155] SEQ ID NO: 27 Nucleotide sequence of WPRE mut6 optimized 1

[0156] SEQ ID NO: 28 Nucleotide sequence of WPRE mut6 optimized 2

[0157] SEQ ID NO: 29 Nucleotide sequence of WPRE mut7 SEQ ID NO: 30 Nucleotide sequence of WPRE mut7 optimized 1

[0158] SEQ ID NO: 31 Nucleotide sequence of WPRE mut7 optimized 2

[0159] SEQ ID NO: 32 Nucleotide sequence of cHS4Ins650

[0160] SEQ ID NO: 33 Nucleotide sequence of cHS4Ins650 option 2

[0161] SEQ ID NO: 34 Representative vector 3 comprising WPRE mut7 optimised option 1

[0162] SEQ ID NO: 35 Representative vector 4 comprising WPRE mut7 optimised option 2

[0163] SEQ ID NO: 36 Representative vector 5 comprising wt WPRE optimised option 1

[0164] SEQ ID NO: 37 Representative vector 6 comprising wt WPRE optimised option 2

[0165] SEQ ID NO: 38 Nucleotide sequence of unmodified MND promoter

[0166] SEQ ID NO: 39 Nucleotide sequence of WT cryptic splice site 1 (SD1)

[0167] SEQ ID NO: 40 Nucleotide sequence of WT cryptic splice site 2 (SD2)

[0168] SEQ ID NO: 41 Nucleotide sequence of WT cryptic splice site 3 (SD3)

[0169] SEQ ID NO: 42 Nucleotide sequence of modified cryptic splice site 1 (SD1)

[0170] SEQ ID NO: 43 Nucleotide sequence of modified cryptic splice site 2 (SD2)

[0171] SEQ ID NO: 44 Nucleotide sequence of modified cryptic splice site 3 (SD3)

[0172] SEQ ID NO: 45 Nucleotide sequence of MND optimized option 1

[0173] (2xSDmut)

[0174] SEQ ID NO: 46 Nucleotide sequence of MND optimized option 2

[0175] (3xSDmut)

[0176] SEQ ID NO: 47 Nucleotide sequence of modified MND with SD 1 & SD3

[0177] SEQ ID NO: 48 Nucleotide sequence of modified MND with SD2 & SD3

[0178] SEQ ID NO: 49 Nucleotide sequence of modified MND with SD 1

[0179] SEQ ID NO: 50 Nucleotide sequence of modified MND with SD2

[0180] SEQ ID NO: 51 Nucleotide sequence of modified MND with SD3

[0181] SEQ ID NO: 52 Nucleotide sequence of EGFP transgene

[0182] SEQ ID NO: 53 Nucleotide sequence of WAS WT cDNA (ORF)

[0183] SEQ ID NO: 54 Nucleotide sequence of model EGFP vector 1 : PBRNGTR17 pTL20c_MND_EGFP_400

[0184] SEQ ID NO: 55 Nucleotide sequence of model EGFP vector 2: pBRNGTR117 pTL20c_2mut_MND_EGFP_400 SEQ ID NO: 56 Nucleotide sequence of model EGFP vector 3:

[0185] PBRNGTR116 pTL20c_3mut_MND_EGFP_400

[0186] SEQ ID NO: 57 Nucleotide sequence of cHS4 insulator 1200bp full sequence

[0187] SEQ ID NO: 58 Nucleotide sequence of cHS4 250bp core insulator

[0188] SEQ ID NO: 59 Nucleotide sequence of cHS4Ins400

[0189] DETAILED DESCRIPTION

[0190] General

[0191] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e., one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter.

[0192] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0193] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0194] Any example of the present disclosure herein shall be taken to apply mutatis mutandis to any other example of the disclosure unless specifically stated otherwise.

[0195] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0196] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilised in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0197] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0198] Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0199] Selected Definitions

[0200] As used herein, the term "vector" refers to a nucleic acid molecule capable of mediating entry of, e.g., transferring, transporting, etc., another nucleic acid molecule into a cell. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule. A vector may include sequences that direct autonomous replication, or may include sequences sufficient to allow integration into host cell DNA. As will be evident to one of ordinary skill in the art, viral vectors may include various viral components in addition to nucleic acid(s) that mediate entry of the transferred nucleic acid. It will be apparent to the skilled person that the term vector encompasses plasmids, as well as other naturally occurring or artificially synthesised vectors.

[0201] As used herein, the term “plasmid” will be understood to mean a small, circular, double-stranded DNA molecule which is capable of replicating independently and facilitating expression of a nucleic acid in a host cell.

[0202] As used herein, the term “nucleotide sequence” or “nucleic acid sequence” will be understood to mean a series of contiguous nucleotides (or bases) covalently linked to a phosphodiester backbone. By convention, sequences are presented from the 5’ end to the 3’ end, unless otherwise specified. As used herein, the term “5”’ indicates the end of the molecule known by convention as the "upstream" end, and the term “3”’ indicates the end of the molecule known by convention as the "downstream" end. As used herein, the term “polynucleotide” refers a molecular chain of nucleotides chemically bonded by a series of ester linkages between the phosphoryl group of one nucleotide and the hydroxyl group of the sugar in an adjacent nucleotide.

[0203] As used herein the phrase “corresponding to” in reference to the position of a nucleotide in SEQ ID NO: 1 should be understood as reference to a nucleotide residue or position with a WPRE sequence, and not necessarily a sequence comprising SEQ ID NO: 1. For example, reference to “a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 1” in a WPRE sequence comprising a 3 nucleotide N-terminal truncation would necessarily refer to nucleotides 11 to 16. In one example, the WPRE comprises a sequence set forth in SEQ ID NO: 1.

[0204] As used herein the phrase “corresponding to” in reference to the position of a nucleotide in SEQ ID NO: 21 should be understood as reference to a nucleotide residue or position within a MND promoter sequence, and not necessarily a sequence comprising SEQ ID NO: 21. In one example, the MND promoter comprises a sequence set forth in SEQ ID NO: 21.

[0205] As used herein, “nucleotide substitution(s)” or “substitution” or “substituted” refers to the replacement of a nucleotide at a particular position in the nucleotide sequence with another nucleotide.

[0206] As used herein, the term “isolated” will be understood to mean a naturally occurring nucleic acid sequence, DNA fragment, DNA molecule, coding sequence, or oligonucleotide that is removed from its natural environment, or is a synthetic molecule or cloned product.

[0207] The term “recombinant” shall be understood to mean the product of artificial genetic recombination.

[0208] As used herein, the term “encode”, “encodes” or “encoding” refers to a region of a polynucleotide capable of undergoing translation into a polypeptide.

[0209] The term “polypeptide” or “polypeptide chain” will be understood to mean a series of contiguous amino acids linked by peptide bonds. For example, a protein shall be taken to include a single polypeptide chain i.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (i.e., a polypeptide complex). The series of polypeptide chains can be covalently linked using a suitable chemical or a disulfide bond. Examples of non- covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions. As used herein, the term “operably linked to” means positioning a promoter (or other regulatory element) relative to a nucleic acid sequence such that expression of the nucleic acid is controlled or regulated by the promoter.

[0210] Modified Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element (WPRE)

[0211] The present disclosure provides an isolated polynucleotide comprising a nucleotide sequence comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE).

[0212] As used herein, the term “woodchuck hepatitis virus post-transcriptional regulatory element” or “WPRE” refers to a hepadnavirus sequence that is a c / .s-acting RNA regulatory element to increase transgene expression. In the context of the present disclosure, reference to WPRE includes reference to the wild-type sequence (as set out in SEQ ID NO: 1) or mutated functional derivatives thereof. For the purposes of nomenclature only and not limitation, an exemplary sequence of WPRE is set out in nucleotides 1094-1684 of GenBank accession number J02442 and in SEQ ID NO: 23. The skilled person will be aware that the wild-type WPRE contains the woodchuck hepatitis virus X protein (WHX) gene promoter and an open reading frame coding for the first 61 amino acids of WHX in its 3’ region. WHX has been associated with the development of liver tumours. Accordingly, in one example of the present disclosure, the WPRE is a mutated functional derivative of the wild-type WPRE sequence. Mutated functional derivatives of WPRE are known in the art and described for example in Zanta- Boussif et al., Gene Therapy (2009) 16, 605-619. In one example, the mutated functional derivative of WPRE is WPRE mut6 which contains six-point mutations located in the start codon and putative promoter region of WHX. For the purposes of nomenclature only and not limitation, an exemplary sequence of WPRE mut6 is set out in SEQ ID NO: 26. In one example, the mutated functional derivative of WPRE is WPRE mut7 which contains an additional point mutation to WPRE mut6. For the purposes of nomenclature only and not limitation, an exemplary sequence of WPRE mut7 is set out in SEQ ID NO: 29. Additional sequence of WPRE can be determined using sequences provided herein and / or in publically available databases and / or determined using standard techniques (e.g., as described in Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) or Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). As used herein, the term “fragment thereof’ refers to the fragment or part of WPRE that comprises a cryptic poly (A) site motif. For example, the fragment thereof is a truncated WPRE comprising a cryptic poly (A) site motif. Fragments includes functional fragments thereof, or core WPRE sequences comprising a cryptic poly (A) site motif.

[0213] As used herein, the term “modified” refers to a WPRE or fragment thereof (i.e., a wild-type WPRE, WPRE mut6 and / or WPRE mut7) which has undergone substitution, deletion, insertion or any other change of one or more nucleotides to remove a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to an unmodified sequence (e.g., as compared to a WPRE sequence set forth in any one of SEQ ID NO: 23, SEQ ID NO: 26 or SEQ ID NO: 29) using well known techniques including, for example, site directed mutagenesis or any other conventional method. Reference to an “unmodified” WPRE as used herein refers to a WPRE that has not undergone substitution, deletion or any other change of one or more nucleotides to remove a cryptic poly (A) site motif. For example, in the context of the present disclosure, an unmodified WPRE includes a wild-type WPRE (SEQ ID NO: 23), WPRE mut6 (SEQ ID NO: 26) and / or WPRE mut7 (SEQ ID NO: 29). It will be apparent to the skilled person from the disclosure herein that an “unmodified” WPRE may contain other mutations (e.g., point mutations) that do not remove a cryptic poly (A) site motif.

[0214] In one example, the modified WPRE comprises a sequence set forth in any one of SEQ ID NOs: 24 to 31.

[0215] In one example, a modified WPRE of the present does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or a fragment thereof.

[0216] As described herein, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 23, 26 or 29 or a fragment thereof. For example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 ofSEQ ID NO: 23 or a fragment thereof. In one example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 26 or a fragment thereof. In another example, the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NO: 29 or a fragment thereof.

[0217] In one example, the cryptic poly (A) site motif is ATTACA. In one example, the cryptic poly (A) site motif is modified to ATTTCA or ATTGCA. For example, the cryptic poly (A) site motif is modified to ATTTCA. In another example, the cryptic poly (A) site motif is modified to ATTGCA.

[0218] In one example, the modified WPRE comprises a single nucleotide substitution to remove a cryptic poly (A) site motif. Exemplary single nucleotide substitutions are described herein and include, for example, substitution of adenine (A) at a position corresponding to nucleotide 17 of SEQ ID NO: 23 with a nucleotide selected from the group consisting of thymine (T) and guanine (G). For example, the modified WPRE comprises an A to T mutation at a position corresponding to nucleotide 17 of SEQ ID NO: 23. In another example, the modified WPRE comprises an A to G mutation at a position corresponding to nucleotide 17 of SEQ ID NO: 23.

[0219] In one example, modification to the WPRE as described herein does not alter the GC content of the WPRE. For example, the modified WPRE of the disclosure has a GC content that is the same or similar compared to an unmodified WPRE sequence (e.g., as compared to a sequence set forth in SEQ ID NO: 26 or SEQ ID NO: 29).

[0220] In one example, modification to the WPRE as described herein increases the GC content of the WPRE. For example, the modified WPRE of the disclosure has an increased GC content compared to an unmodified WPRE sequence (e.g., as compared to a sequence set forth in SEQ ID NO: 26 or SEQ ID NO: 29).

[0221] Modified Murine Leukemia Virus-Derived (MND) Promoter

[0222] The present disclosure provides an isolated polynucleotide comprising a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter.

[0223] As used herein, the term “murine leukemia virus-derived promoter” or “MND promoter” refers to a retroviral sequence that is a cis-acting RNA regulatory element to increase transgene expression. In the context of the present disclosure, reference to MND includes reference to the wild-type sequence (as set out in SEQ ID NO: 38) or mutated forms thereof.

[0224] Accordingly, in one example of the present disclosure, the MND promoter is a mutated form of the wild-type MND promoter sequence. In one example, the mutated form of the MND promoter is MND optimized option 1 which contains two-point mutations compared to the wild-type MND promoter. For the purposes of nomenclature only and not limitation, an exemplary sequence of MND optimized option 1 is set out in SEQ ID NO: 45. In one example, the mutated functional derivative of the MND promoter is MND optimized option 2 which contains three-point mutations compared to the wild- type MND promoter. For the purposes of nomenclature only and not limitation, an exemplary sequence of MND optimized option 1 is set out in SEQ ID NO: 46. Additional sequences of the MND promoter can be determined using sequences provided herein and / or in publicly available databases and / or determined using standard techniques (e.g., as described in Ausubel etal., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) or Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Pre ss (1989)).

[0225] As used herein, the term “putative splice site” or “putative cryptic splice site” is used to refer to a site within the MND promoter that is generally considered or reputed to be a splice site, or a site at which splicing takes place during the processing of precursor messenger RNA into mature messenger RNA.

[0226] As used herein, the term “cryptic” in relation to a splice site refers to a motif that is present throughout the precursor messenger RNA and can be activated to induce splicing but is not yet recognized as being required for efficient splicing.

[0227] As used herein, the term “fragment thereof’ refers to the fragment or part of the MND promoter that comprises one, two or three putative cryptic splice sites. For example, the fragment thereof is a truncated MND promoter comprising one putative cryptic splice site . In another example, the fragment thereof is a truncated MND promoter comprising two putative cryptic splice sites. In another example, the fragment thereof is a truncated MND promoter comprising three putative cryptic splice sites. Fragments includes functional fragments thereof, or core MND promoter sequences comprising one or more putative cryptic splice sites.

[0228] As used herein, the term “modified” refers to a MND promoter or fragment thereof (i.e., a wild -type MND promoter) which has undergone substitution, deletion, insertion or any other change of one or more nucleotides to remove a putative cryptic splice site leading to aberrant splicing of RNA transcripts compared to an unmodified sequence (e.g., as compared to a MND promoter sequence set forth in any one of SEQ ID NO: 38 or SEQ ID NO: 54) using well known techniques including, for example, site directed mutagenesis or any other conventional method. Reference to an “unmodified” MND promoter as used herein refers to a MND promoter that has not undergone substitution, deletion or any other change of one or more nucleotides to remove a putative cryptic splice site. For example, in the context of the present disclosure, an unmodified MND promoter includes a wild-type MND (SEQ ID NO: 38) and / or model EGFP vector 1: pBRNGTR17 (SEQ ID NO: 54). It will be apparent to the skilled person from the disclosure herein that an “unmodified” MND promoter may contain other mutations (e.g., point mutations) that do not remove a putative cryptic splice site.

[0229] As described herein, the putative cryptic splice site is located at a position corresponding to nucleotides 34 to 53, 109 to 128 and / or 251 to 271 of SEQ ID NO: 38. For example, the putative cryptic splice site is GATATCTGTGGTAAGCAGTT, GATATCTGTGGTAAGCAGTT and / or TTTGAACTAACCAATCAGTTC.

[0230] In one example, the modified MND promoter comprises a single nucleotide substitution to remove a putative cryptic splice site. Exemplary single nucleotide substitutions are described herein and include, for example, substitution of adenine (A) for thymine (T) at a position corresponding to nucleotide 45 of SEQ ID NO: 38, substitution of adenine (A) for thymine (T) at a position corresponding to nucleotide 120 of SEQ ID NO: 38 and / or substitution of thymine (T) for adenine (A) at a position corresponding to nucleotide 260 of SEQ ID NO: 38. For example, the modified MND promoter comprises an A to T mutation at a position corresponding to nucleotide 45 of SEQ ID NO: 38. In another example, the modified MND promoter comprises an A to T mutation at a position corresponding to nucleotide 120 of SEQ ID NO: 38. In another example, the modified MND promoter comprises a T to A mutation at a position corresponding to nucleotide 260 of SEQ ID NO: 38.

[0231] In one example, modification to the MND promoter as described herein does not alter the GC content of the MND promoter. For example, the modified MND promoter of the disclosure has a GC content that is the same or similar compared to an unmodified MND promoter sequence (e.g., as compared to a sequence set forth in SEQ ID NO: 38 or SEQ ID NO: 54).

[0232] Polynucleotides

[0233] The present disclosure provides an isolated polynucleotide comprising a nucleotide sequence comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) or fragment thereof.

[0234] The present disclosure further provides an isolated polynucleotide comprising a nucleotide sequence comprising a modified MND promoter or fragment thereof.

[0235] The present disclosure also provides an isolated polynucleotide comprising a nucleotide sequence comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) or fragment thereof and comprising a nucleotide sequence comprising a modified MND promoter or fragment thereof.

[0236] The polynucleotide of the present disclosure includes DNA and RNA (e.g., mRNA). In one example, the polynucleotide is a DNA (e.g., DNA vector). In one example, the polynucleotide is a RNA (e.g., RNA vector).

[0237] Polynucleotides of the disclosure can be isolated or produced using any method known in the art, for example, amplification (e.g., using PCR or splice overlap extension).

[0238] For example, nucleic acid (e.g., genomic DNA or RNA that is then reverse transcribed to form cDNA) is used as a template in a polymerase chain reaction (PCR) to amplify a polynucleotide of the disclosure. Methods of PCR are known in the art and described, for example, in Dieffenbach (ed) and Dveksler (ed), 1995. Generally, for PCR two non-complementary nucleic acid primer molecules comprising at least about 20 nucleotides in length, and more preferably at least 25 nucleotides in length are hybridized to different strands of a nucleic acid template, and specific nucleic acid copies of the template are amplified enzymatically. Preferably, the primers hybridize to nucleic acid adjacent to a polynucleotide of the disclosure, thereby facilitating amplification of the entire nucleic acid.

[0239] Other methods for the production of a polynucleotide of the disclosure will be apparent to the skilled artisan, for example, in Ausubel et al 1987, Sambrook et al, 2001.

[0240] The resulting polynucleotide can then be introduced into a vector of the disclosure using a standard method in the art (such as those described in Sambrook et al, 2001). Methods for cloning a polynucleotide into a vector of the disclosure will be apparent to the skilled artisan.

[0241] Vectors

[0242] In one example, the polynucleotide of the disclosure is a vector. For example, the vector is a plasmid or a virus.

[0243] In one example, the vector is a non-integrating virus. Non-integrating viral vectors suitable for use in the present disclosure will be apparent to the skilled person and / or described herein. Exemplary non-integrating viral vectors include, adeno- associated viruses (AAV) and adenoviral vectors.

[0244] In one example, the vector is an adeno-associated viral vector.

[0245] In one example, the vector is an adenoviral vector.

[0246] In one example, the vector is an integrating viral vector. Integrating viral vectors suitable for use in the present disclosure will be apparent to the skilled person and / or described herein.

[0247] In one example, the vector is a virus. For example, the virus is a retrovirus, for example, a lentivirus. Exemplary retroviruses are from alpha retroviruses (such avian leukosis virus (ALV)), from beta retroviruses (such as mouse mammary tumor virus (MMTV)), from gamma retroviruses (such as murine leukemia virus (MLV)), from delta retroviruses (such as human T-lymphotropic virus (HTLV)), from epsilon retroviruses (such as Walleye dermal sarcoma virus (WDSV)), from spumavirus (such as human foamy virus (HFV) or simian foamy virus (SFV)), from primate lentiviruses such as the different types of human immunodeficiency viruses (HIV), the different types of simian immunodeficiency viruses (SIV), or from non-primate mammal lentiviruses such as the equine infectious anemia virus (EIAV), from the feline immunodeficiency virus (FIV), the caprine arthritis-encephalitis virus (CAEV), or the ovine visna-maedi virus (VMV).

[0248] In one example, the vector has a pUC57 backbone.

[0249] In one example, the vector has a TL20c vector backbone. For example, a TL20c vector backbone comprises a sequence set forth in SEQ ID NO: 1. The TL20c vector backbone is described in WO2016 / 183260.

[0250] In one example, the vector is based on a human immunodeficiency virus type 1 (HIV-1) based third generation, self-inactivating (SIN) lentiviral transfer plasmid ("pUC57-TL20c"). For example, a pUC57-TL20c transfer plasmid comprises a sequence set forth in SEQ ID NO: 2. The pUC57-TL20c transfer plasmid is described in WO2016 / 183260.

[0251] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 21. For example, the vector comprises a sequence set forth in SEQ ID NO: 21 lacking nucleotides 2,402 to 3,635.

[0252] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 22. For example, the vector comprises a sequence set forth in SEQ ID NO: 22 lacking nucleotides 2,402 to 3,635.

[0253] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 34. For example, the vector comprises a sequence set forth in SEQ ID NO: 34 lacking nucleotides 2,402 to 3,635.

[0254] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 35. For example, the vector comprises a sequence set forth in SEQ ID NO: 35 lacking nucleotides 2,402 to 3,635.

[0255] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 36. For example, the vector comprises a sequence set forth in SEQ ID NO: 36 lacking nucleotides 2,402 to 3,635.

[0256] In one example, the vector comprises a sequence set forth in nucleotides 1-2,401 and nucleotides 3,636-8,682 of SEQ ID NO: 37. For example, the vector comprises a sequence set forth in SEQ ID NO: 37 lacking nucleotides 2,402 to 3,635. In one example, the vector comprises a sequence set forth in nucleotides 1-3,097 and nucleotides 3,815-8,603 of SEQ ID NO: 54. For example, the vector comprises a sequence set forth in SEQ ID NO: 54 lacking nucleotides 3,098-3,814.

[0257] In one example, the vector comprises a sequence set forth in nucleotides 1-3,097 and nucleotides 3,815-8,603 of SEQ ID NO: 55. For example, the vector comprises a sequence set forth in SEQ ID NO: 55 lacking nucleotides 3,098-3,814.

[0258] In one example, the vector comprises a sequence set forth in nucleotides 1-3,097 and nucleotides 3,815-8,603 of SEQ ID NO: 56. For example, the vector comprises a sequence set forth in SEQ ID NO: 56 lacking nucleotides 3,098-3,814.

[0259] In one example, the polynucleotide of the disclosure is a vector comprising between about 2,000 nucleotides and 15,000 nucleotides. For example, the vector comprises between about 3,000 nucleotides and 13,000 nucleotides. In one example, the vector comprises between about 4,000 nucleotides and 12,000 nucleotides. In one example, the vector comprises about 5,000 nucleotides and 10,000 nucleotides. For example, the vector comprises between about 5,000 and 9,000 nucleotides.

[0260] As used herein, the term "self-inactivating" or "SIN," used interchangeably herein, refers to a vector which is modified, wherein the modification greatly reduces the ability of the vector to mobilize once it has integrated into the genome of the recipient, thereby increasing the safety of the use of the vector as a gene delivery vector.

[0261] In one example, the transfer plasmid comprises a TL20c vector backbone that does not itself comprise an internal promoter (i.e., it is "promoterless").

[0262] In one example, the transfer plasmid comprises one promoter, e.g. a tetracycline repressible promoter, upstream of the vector backbone. The skilled person will understand that the presence of a tetracycline repressible promoter upstream of the vector backbone will result in vector production only when the antibiotic doxycycline is omitted from the cell culture medium (Throm et al. (2009) Blood, Volume 113, Issue 21, pp. 5104-5110).

[0263] Suitable tetracycline repressible promoters for use in the present disclosure will be apparent to the skilled person. An exemplary tetracycline repressible promoter is comprises a sequence set forth in SEQ ID NO: 3.

[0264] Long Terminal Repeat

[0265] The polynucleotide of the present disclosure comprises a nucleotide sequence encoding a 5’ long terminal repeat (LTR); and a nucleotide sequence encoding a 3’ LTR.

[0266] As used herein, “long terminal repeat” or “LTR” shall be understood to refer to a sequence that is typically at least several hundred bases long, usually bearing inverted repeats at its termini (often starting with TGAA and ending with TTCA), and flanked with short direct repeats duplicated within the cell DNA sequences flanking an insertion site. The short inverted repeats are involved in integrating the full length viral, retrotransposon, or vector DNA into the host genome. The integration sequence is sometimes called att, for attachment. Inside the L TRs reside three distinct subregions: U3 (the enhancer and promoter region, transcribed from the 5’-LTR), R (repeated at both ends of the RNA), and U5 (transcribed from the 5’-LTR). The LTR and its associated flanking sequences (primer binding sites, splice sites, dimerization linkage and encapsidation sequences) comprise the cA-acting sequences of a retroviral vector. Sources of LTR nucleic acid sequences, e.g., nucleic acid fragments or segments, include, but are not limited to murine retroviruses, murine VL30 sequences, retrotransposons, simian retroviruses, avian retroviruses, feline retroviruses, lentiviruses, avian retroviruses and bovine retroviruses, foamy viruses.

[0267] LTRs contain regulatory elements, such as insulators, promoters and / or enhancers. In one example, the LTR is modified to reduce or increase the effectiveness of these regulatory elements. As used herein “effectiveness” can be used to refer to increased transcription, or suppression of transcription. In another example, the insulator is modified to increase the function thereof. In one example, the promoter is modified to increase the function thereof. In one example, the enhancer is modified to increase the function thereof. In other examples, regulatory elements are introduced into a LTR. For example, modified insulators, promoters and / or enhancers can be introduced into a LTR.

[0268] In one example, the LTR regions further comprise a U3 and U5 region, as well as an R region.

[0269] In one example, the transfer plasmid comprises a SIN LTR. The skilled person will understand that during the retroviral life cycle, the U3 region of the 3' LTR is duplicated to form the corresponding region of the 5' LTR in the course of reverse transcription and viral DNA synthesis. Creation of a SIN LTR is achieved by inactivating the U3 region of the 3' LTR (preferably by deletion of a portion thereof, e.g. removal of a TATA sequence). For example, the U3 region of the 3’LTR contains a full deletion of both promoter and enhancer sequences. Thus, it will be understood that after reverse transcription, any changes in the 3 ’LTR will be transferred to the 5' LTR, thus eliminating the transcriptional unit of the LTRs.

[0270] In one example, the U3 region of the 5 ’LTR comprises or consists of a sequence set forth in SEQ ID NO: 4. In one example, the nucleotide sequence comprising the U3 of the 5 ’LTR comprises of a sequence set forth in SEQ ID NO: 4. In one example, the nucleotide sequence comprising the U3 of the 5’LTR consists of a sequence set forth in SEQ ID NO: 4.

[0271] In one example, the U3 region of the 5’LTR is replaced with a heterologous promoter.

[0272] In one example, the U3 region of the 3’LTR contains a full deletion of both promoter and enhancer sequences. For example, the U3 region of the 3’LTR is a partial U3 region. In one example, the nucleotide sequence comprising the U3 of the 3’LTR comprises or consists of a sequence set forth in SEQ ID NO: 13 and / or SEQ ID NO: 14. In one example, the nucleotide sequence comprising the U3 of the 3’LTR comprises of a sequence set forth in SEQ ID NO: 13 and / or SEQ ID NO: 14. In one example, the nucleotide sequence comprising the U3 of the 3’LTR consists of a sequence set forth in SEQ ID NO: 13 and / or SEQ ID NO: 14.

[0273] In one example, the nucleotide sequence comprising the R region of the 5’LTR comprises or consists of a sequence set forth in SEQ ID NO: 5. In one example, the nucleotide sequence comprising the R region of the 5’LTR comprises of a sequence set forth in SEQ ID NO: 5. In one example, the nucleotide sequence comprising the R region of the 5’LTR consists of a sequence set forth in SEQ ID NO: 5.

[0274] In one example, the nucleotide sequence comprising the R region of the 3’LTR comprises or consists of a sequence set forth in SEQ ID NO: 15. In one example, the nucleotide sequence comprising the R region of the 3’LTR comprises of a sequence set forth in SEQ ID NO: 15. In one example, the nucleotide sequence comprising the R region of the 3’LTR consists of a sequence set forth in SEQ ID NO: 15.

[0275] In one example, the nucleotide sequence comprising the U5 region of the 5’LTR comprises or consists of a sequence set forth in SEQ ID NO: 6. In one example, the nucleotide sequence comprising the U5 region of the 5’LTR comprises of a sequence set forth in SEQ ID NO: 6. In one example, the nucleotide sequence comprising the U5 region of the 5’LTR consists of a sequence set forth in SEQ ID NO: 6.

[0276] In one example, the U5 region of the 3’LTR is substituted with a rabbit P-globin polyadenylation signal. It will be apparent to the skilled person that substitution of the U5 region of the 3’LTR with a rabbit P-globin polyadenylation signal improves safety and efficacy of the transfer plasmid (see e.g., Hanawa et al (2009) Molecular Therapy, Volume 17, Issue 4, pp. 667-674). In one example, the nucleotide sequence comprising the rabbit P-globin polyadenylation signal comprises or consists of a sequence set forth in SEQ ID NO: 16. In one example, the nucleotide sequence comprising the rabbit P- globin polyadenylation signal comprises of a sequence set forth in SEQ ID NO: 16. In one example, the nucleotide sequence comprising the rabbit P-globin polyadenylation signal consists of a sequence set forth in SEQ ID NO: 16.

[0277] Lentiviral Elements

[0278] In one example, the polynucleotide of the disclosure further comprises lentiviral elements.

[0279] As used herein, the term “lentiviral element” refers to any viral component present in lentiviruses. For example, the lentiviral elements are selected from the group consisting of: (a) a nucleotide sequence comprising a packaging signal; (b) a nucleotide sequence comprising a central polypurine tract (cPPT), (c) a nucleotide sequence encoding a Rev response element (RRE); (d) a nucleotide sequence encoding a multiple cloning site and combinations thereof.

[0280] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising a packaging signal.

[0281] Exemplary packaging signals suitable for use in the present disclosure will be apparent to the skilled person and / or are described herein.

[0282] In one example, the packaging signal comprises or consists of a psi (\| / ) packaging signal. An exemplary psi packaging signal comprises or consists of a sequence set forth in SEQ ID NO: 8. In one example, the nucleotide sequence comprising the psi packaging signal comprises a sequence set forth in SEQ ID NO: 8. In another example, the nucleotide sequence comprising the psi packaging signal consists a sequence set forth in SEQ ID NO: 8.

[0283] In one example, the packaging signal comprises a portion of the gag gene sequence and / or a portion of the pol gene sequence of wild-type HIV. In one example, the packaging signal comprises a portion of the gag gene sequence. For example, the packaging signal comprises a sequence set forth in SEQ ID NO: 9.

[0284] In one example, the packaging signal comprises a psi packaging signal and a portion of the gag gene sequence. For example, the packaging signal comprises a sequence set forth in SEQ ID NO: 8 and a sequence set forth in SEQ ID NO: 9.

[0285] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising a polypurine tract.

[0286] Exemplary polypurine tract sequences suitable for use in the present disclosure will be apparent to the skilled person and / or are described herein.

[0287] In one example, the polypurine tract is selected from the group consisting of a central polypurine tract (cPPT), a Nef sequence and combinations thereof.

[0288] In one example, the polypurine tract is a central polypurine tract (cPPT). In one example, the nucleotide sequence comprising a central polypurine tract (cPPT) comprises or consists of a sequence set forth in SEQ ID NO: 10. For example, the nucleotide sequence comprising a central polypurine tract (cPPT) comprises of a sequence set forth in SEQ ID NO: 10. In another example, the nucleotide sequence comprising a central polypurine tract (cPPT) consists of a sequence set forth in SEQ ID NO: 10.

[0289] In one example, the polypurine tract comprises aNef sequence of wild-type HIV. An exemplary Nef sequence suitable for use in the present disclosure comprises a sequence set forth in SEQ ID NO: 12.

[0290] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising a Rev response element (RRE).

[0291] Exemplary RRE sequences suitable for use in the present disclosure will be apparent to the skilled person and / or are described herein.

[0292] In one example, the nucleotide sequence comprising a RRE comprises or consists of a sequence set forth in SEQ ID NO: 11. For example, the nucleotide sequence comprising a RRE comprises of a sequence set forth in SEQ ID NO: 11. In another example, the nucleotide sequence comprising a RRE consists of a sequence set forth in SEQ ID NO: 11.

[0293] Transgenes of Interest

[0294] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence encoding a transgene of interest operably linked to a nucleotide sequence comprising a promoter.

[0295] The transgene will depend on the specific use for which the polynucleotide is intended. In one example, the transgene encodes a reporter protein or nucleic acid for use in a model system. Exemplary reporter transgenes include a transgene coding for green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), and mScarlet. In one example, the transgene is a therapeutic transgene. Exemplary transgenes include a transgene coding for a therapeutic RNA (e.g., encoding an antisense complementary RNA of a target RNA or DNA sequence), a transgene encoding for a protein that is deficient or absent in a subject affected with a pathology, or a transgene used for vaccination with DNA, i.e., a transgene coding for a protein, the expression of which will induce vaccination of the recipient body against said protein. In some examples, the transgene encodes a protein or nucleic acid useful for treating a hemoglobinopathy, e.g., sickle cell disease or a thalassemia. In some examples, the transgene encodes a protein or nucleic acid useful for treating a primary immunodeficiency (PID). For example, the PID may include Activated PI3K Delta Syndrome (APDS), X-linked Agammaglobulinemia (XLA), Ataxia Telangiectasia, Chronic Granulomatous Disease (CGD) and Other Phagocytic Cell Disorders, Common Variable Immune Deficiency (CVID), Complement Deficiencies, DiGeorge Syndrome, Hemophagocytic Lymphohistiocytosis (HLH), Hyper IgE Syndrome, Hyper IgM Syndromes, IgG Subclass Deficiency, Innate Immune Defects, Toll-like Receptor (TLR) Deficiencies (including MyD88 Deficiency, IRAK4 Deficiency, UNC93B Deficiency and TLR3 Mutations), Human Natural Killer Cell Deficiencies, Defects in Interferon-y (IFN-y) and Interleukin- 12 (IL-12) Signaling, Leukocyte Adhesion Deficiency (LAD), NEMO Deficiency Syndrome, Selective IgA Deficiency, Selective IgM Deficiency, Severe Combined Immune Deficiency (SCID) and Combined Immune Deficiency, Specific Antibody Deficiency, Transient Hypogammaglobulinemia of Infancy, WHIM Syndrome (Warts, Hypogammaglobulinemia, Infections, and Myelokathexis), Wiskott-Aldrich Syndrome, Antibody Deficiency with Normal or Elevated Immunoglobulins, Immunodeficiency with Thymoma (Good’s Syndrome), Transcobalamin II Deficiency, Kappa Chain Deficiency, Heavy Chain Deficiencies, Post-Meiotic Segregation (PMS2) Disorder, Unspecified Hypogammaglobulinemia, Chronic Mucocutaneous Candidiasis (CMC), Cartilage Hair Hypoplasia (CHH), X-linked Lymphoproliferative (XLP) Syndromes 1 and 2, X-linked Immune Dysregulation with Polyendocrinopathy (IPEX) Syndrome, Veno-occlusive Disease (VODI), Hoyeraal-Hreidarsson Syndrome (Dyskeratosis Congenita), Immunodeficiency with Centromeric Instability and Facial Anomalies (ICF), Schimke Syndrome, Comel-Netherton Syndrome, Diamond Blackfan Anemia, Schwachmann Diamond Syndrome, Deficiency of Adenosine Deaminase 2 (ADA2), Krabbe Disease (GLD), Alpha-mannosidosis, Nijmegen Breakage Syndrome, or graft- versus-host disease (GvHD), deficiency of interleukin- 1-receptor antagonist (IL-IRA), scleroderma, homozygous familial hypercholesterolemia (HoFH), systemic lupus erythematosus (SLE), or chronic inflammatory demyelinating polyneuropathy (CIDP). In some examples, the transgene encodes a protein or nucleic acid useful for treating Wiskott-Aldrich Syndrome (WAS). In some examples, the transgene encodes a protein or nucleic acid useful for treating X linked agammaglobulinemia. In some examples, the transgene encodes an enhanced green fluorescent protein (EGFP) or a nucleic acid encoding enhanced green fluorescent protein (EGFP).

[0296] As used herein, the term “promoter” is to be taken in its broadest context and refers to synthetic or naturally-derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and / or to alter the spatial expression and / or temporal expression of a nucleic acid in a cell. A promoter may also comprise distal enhancer or repressor elements, which may be located as much as several thousand base pairs, or anywhere in the genome, from the start site of transcription. A promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, hormones, toxins, drugs, pathogens, metal ions, or inducing agents.

[0297] A promoter may be “endogenous” or “exogenous” or “heterologous.” An “endogenous” promoter is one which is naturally linked with a given gene in the genome . An “exogenous” or “heterologous” promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of that gene is directed by the linked promoter.

[0298] Examples of promoters include a cytomegalovirus (CMV) promoter, a CMV enhancer, a MND promoter, a simian virus 40 (SV40) promoter with enhancer, a UBC promoter, a PGK promoter, a EFl A promoter, a hACTB promoter, a CAG promoter or a bla promoter.

[0299] Insulator

[0300] In one example, the polynucleotide of the disclosure further comprises an insulator.

[0301] The term “insulator” as used herein refers to a genetic boundary element that blocks the interaction between enhancers and promoters. Insulators are an exogenous DNA sequence that can be added to prevent, upon integration of the construct into the genome of a host cell, nearby genomic sequences from influencing expression of the integrated polynucleotides, and prevent the integrated construct from influencing the expression of nearby genomic sequences.

[0302] By residing between the enhancer and promoter, the insulator may inhibit their subsequent interactions. Insulators can determine the set of genes an enhancer can influence. Insulators shield genes from inappropriate cA-regulatory signals, e.g., enhancer elements. Insulator activity is thought to occur primarily through the 3D structure of DNA mediated by proteins including CCCTC-binding factor (CTCF). CTCF is the main insulator-binding protein in vertebrates and also provides chromatin barrier functions. Barrier insulators may prevent the spread of heterochromatin from a silenced gene to an actively transcribed gene. Insulators may also provide increased expression levels of a transgene in a construct of interest.

[0303] In one example, the insulator is duplicated upon integration of the plasmid into the host cell genome, such that the insulator flanks the integrated construct (e.g., within the LTR region) and acts to insulate the integrated polynucleotide sequences.

[0304] The insulators include insulators from an a-globin locus, for example, chicken hypersensitive site-4 (cHS4), or from a P-globin locus (see Chung et al., 1993. Cell 74:505; Chung et al., 1997. PNAS 94:575; Bell et al., 1999. Cell 98:387; and PCT / US2015 / 020369, incorporated by reference herein).

[0305] In one example, the insulator is a chicken hypersensitive site-4 (cHS4) insulator. In one example, the insulator is a 1200 bp cHS4 insulator. In another example the insulator is 650 bp insulator. In another example, the insulator is a 400 bp cHS4 insulator. In another example, the insulator is a 250 bp insulator. In one example, the insulator is oriented in a forward direction relative to a transgene of interest. In another example, the insulator is in a reverse orientation relative to the transgene of interest. For example, the cHS4 insulator comprises or consists of a sequence set forth in SEQ ID NO: 32, 33, 57, 58 or 59 . In one example, the cHS4 insulator comprises of a sequence set forth in SEQ ID NO: 32 or SEQ ID NO: 33 or SEQ ID NO: 57 or SEQ ID NO: 58 or SEQ ID NO: 59. In one example, the cHS4 insulator consists of a sequence set forth in SEQ ID NO: 32.

[0306] In one example, the cHS4 insulator consists of a sequence set forth in SEQ ID NO: 33.

[0307] In one example, the cHS4 insulator consists of a sequence set forth in SEQ ID NO: 57.

[0308] In one example, the cHS4 insulator consists of a sequence set forth in SEQ ID NO: 58.

[0309] In one example, the cHS4 insulator consists of a sequence set forth in SEQ ID NO: 59.

[0310] Polyadenylation signal

[0311] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising a polyA signal.

[0312] As used herein, the term “polyadenylation signal” or “polyA signal” refers to a nucleotide sequence which directs both termination and polyadenylation. Polyadenylation is typically understood to be the addition of a polyA sequence to a polynucleotide. The polyadenylation signal may be located within a nucleotide sequence at the 3 ’-end of the polynucleotide to be polyadenylated. The polyA signal can be “heterologous” or “endogenous”. An endogenous poly A signal is one that is found naturally at the 3 ’ end of the coding region of a given gene in the genome. A heterologous polyA signal is one which is one which is isolated from one gene and placed 3 ’ of another gene. Suitable polyA signal for use in the present disclosure will be apparent to the skilled person and / or are described herein. For example, the polyA signal can include a SV40 polyA, SVLP polyA, hGH polyA, BGH polyA or rbGlob polyA.

[0313] In one example, the polyA signal comprises a rabbit beta-globin polyadenylation signal. For example, the rabbit beta-globin polyA comprises a sequence set forth in SEQ ID NO: 16.

[0314] Origin of Replication

[0315] In one example, the polynucleotide of the disclosure comprises a nucleotide sequence comprising one or more origin of replication sequence(s).

[0316] As used herein, the term “origin of replication” shall be understood to refer to a nucleic acid sequence at which replication is initiated on a chromosome, plasmid or virus. The origin of replication sequence is necessary to permit replication of the plasmid in a host cell. In general, such plasmid will contain at least one origin of replication sufficient to permit the autonomous stable replication of the plasmid in a host cell. For example, the origin of replication sequence is a pUC, pUK, pMBl, pMBl (derivative), pBR322, CoIEl, R6K, pl5A, pSClOl, SV40 ori or Fl. In one example, the origin of replication sequence is a viral origin of replication sequence.

[0317] In one example, the origin of replication sequence is a viral origin of replication sequence.

[0318] In one example, the viral origin of replication sequence is a pUC viral origin of replication sequence. For example, the pUC origin of replication sequence comprises or consists of a sequence set forth in SEQ ID NO: 18. In one example, the pUC origin of replication sequence comprises of a sequence set forth in SEQ ID NO: 18. In another example, the pUC origin of replication sequence consists of a sequence set forth in SEQ ID NO: 18.

[0319] In another example, the viral origin of replication sequence is a pUK viral origin of replication sequence.

[0320] In one example, the viral origin of replication sequence is a SV40 origin of replication sequence. For example, the SV40 origin of replication sequence comprises or consists of a sequence set forth in SEQ ID NO: 17. In one example, the SV40 origin of replication sequence comprises of a sequence set forth in SEQ ID NO: 17. In another example, the SV40 origin of replication sequence consists of a sequence set forth in SEQ ID NO: 17.

[0321] In one example, the polynucleotide comprises a viral origin of replication sequence comprising a SV40 origin of replication sequence and a pUC origin of replication sequence. For example, the polynucleotide comprises a SV40 origin of replication sequence comprising a sequence set forth in SEQ ID NO: 17 and a pUC origin of replication sequence comprising a sequence set forth in SEQ ID NO: 18.

[0322] Antibiotic Resistance Genes

[0323] In one example, the polynucleotide comprises a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0324] Exemplary antibiotic resistance genes suitable for use in the present disclosure will be apparent to the skilled person and / or are described herein.

[0325] In one example, the antibiotic resistance gene is an Amp(R) gene. For example, the nucleotide sequence encodes an Amp(R) gene operably linked to a nucleotide sequence comprising an Amp(R) promoter.

[0326] In one example, the nucleotide sequence encoding the Amp(R) gene comprises or consists of a sequence set forth in SEQ ID NO: 19. For example, the nucleotide sequence encoding the Amp(R) gene comprises of a sequence set forth in SEQ ID NO: 19. In another example, the nucleotide sequence encoding the Amp(R) gene consists of a sequence set forth in SEQ ID NO: 19.

[0327] In one example, the nucleotide sequence comprising the promoter comprises or consists of a sequence set forth in SEQ ID NO: 20. For example, the nucleotide sequence comprising the promoter comprises or consists of a sequence set forth in SEQ ID NO: 20. In another example, the nucleotide sequence comprising the promoter comprises or consists of a sequence set forth in SEQ ID NO: 20.

[0328] Production of Stable Cell Lines

[0329] The present disclosure also provides a stable cell line comprising a polynucleotide of the disclosure.

[0330] Methods of the disclosure are applicable to small-, mid- and large-scale productions. The methods are particularly useful for their ability to be scaled up for manufacturing pharmaceutical products at commercial scale.

[0331] Methods for the production of cell lines of the disclosure will be apparent to the skilled artisan and / or described, for example, in Ansorge et al., (2010) Biochem. Eng. J. 48: 362-377; Schweizer and Merten (2010) Curr. Gene Ther. 10: 474-486; and Rodrigues et al., (2011) Viral Gene Therapy. Xu, InTech. Chapter 2: 15-40. Cell lines

[0332] The present disclosure provides a cell (or cell line) for producing an enveloped virus, wherein the cell (or cell line) comprises a polynucleotide of the disclosure.

[0333] As used herein, the terms “cell,” and “cell line,” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, “host cell” refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that is capable of replicating a plasmid and / or expressing a polynucleotide encoded by the plasmids described herein. A host cell may be “transfected” or “transformed”.

[0334] In one example, the polynucleotide of the disclosure is stably integrated into the cell line.

[0335] In one example, the cell is transfected with a polynucleotide of the disclosure.

[0336] In one example, the cell is a GPR, GPRG, GPRT, GPRG, GPRT-G or derivatives thereof. In one example, the cell is a HEK293 cell, HEK293T cell, HEK293T / 17 cell, GPR cell, GPRG cell, GPRT cell, GPRG cell, GPRT-G cell, or a derivative thereof.

[0337] As used herein, the term “cell culture” will be understood to refer to the collective of the cell culture fluid or medium and the cultured cells or cell line.

[0338] The cells are cultivated in a medium suitable for cultivation of mammal cells and for producing an enveloped virus (i.e., a lentivirus). The cells can be cultivated in an adherent environment, e.g., while attached to a surface, or in a suspension environment, e.g., suspended in the medium. The medium may moreover be supplemented with additives known in the field such as antibiotics, serum (notably fetal calf serum, etc.) added in suitable concentrations. The medium may be supplemented with GlutaMax™, Pluronic™ F-68 (ThermoFisher), LONG® R3 IGF-I (Sigma-Aldrich), Cell Boost™ 5, and / or an antidumping agent. The medium used may notably comprise serum or be serum-free. Culture media for mammal cells are known and include, for example, DMEM (Dulbecco’s Modified Eagle’s medium) medium, RPMI1640 or a mixture of various culture media, including for example DMEM / F12, or a serum -free medium like optiMEM®, optiPRO®, optiPRO-SFM®, CD293® (ThermoFisher), TransFx™ (Cytiva), BalanCD® (Irvine), Freestyle F17® (Life Technologies), or Ex-Cell® 293 (Sigma- Aldrich).

[0339] Cells can be cultured using methods known in the art, such as those described in, for example, Goodman et al., J. of Virol., 92(1): e01639-17 (2018) and Ryu et al. Blood, 111(4): 1866-75 (2007). According to one example, the cell is selected from a human cell (HEK293, HEK293T, HEK293FT, HEK293OX, Te671, HT1080, CEM), amusteli cell (NIH-3T3), a mustelidae cell (Mpf), a canid cell (DI 7), and derivatives thereof. According to one example, the cell is selected from CHO cells, BHK cells, MDCK cells, C3H 10T1 / 2 cells, FLY I, Psi-2 cells, BOSC 23 cells, PA317 cells, WEHI cells, COS cells, BSC 1 cells, BSC 40 cells, BMT 10 cells, VERO cells, W138 cells, MRC5 cells, A549 cells, HT1080 cells, B-50 cells, 3T3 cells, NIH3T3 cells, HepG2 cells, Saos-2 cells, Huh7 cells, HeLa cells, W163 cells, 211 cells, and 211 A cells, and derivatives thereof. According to another example, the cell is selected from a human cell (HEK293, HEK293T, HEK293T / 17, HEK293FT, HEK293OX, Te671, HT1080, CEM, Jurkat, GPR, GPRG, GPRT, GPRGT, GPRTG, K562, U-937), a musteli cell (NIH-3T3), a mustelidae cell (Mpf), a canid cell (DI 7), and derivatives thereof. According to one example, the cell is selected from CHO cells, BHK cells, MDCK cells, C3H 10T1 / 2 cells, FLY I, Psi-2 cells, BOSC 23 cells, PA317 cells, WEHI cells, COS cells, BSC 1 cells, BSC 40 cells, BMT 10 cells, VERO cells, W138 cells, MRC5 cells, A549 cells, HT1080 cells, B-50 cells, 3T3 cells, NIH3T3 cells, HepG2 cells, Saos-2 cells, Huh7 cells, HeLa cells, W163 cells, 211 cells, and 211 A cells, and derivatives thereof.

[0340] In one example, the cell is selected from the GPR, GPRG, GPRT, GPRGT, and GPRTG cell lines. In another example, the cell is selected from the Jurkat, HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT, GPRTG, K562, U-937, and CHO cell lines. In another example, the cell is selected from a cell line derived from any of the above cell lines.

[0341] Methods of integrating polynucleotides of the disclosure will be apparent to the skilled person and / or described herein. For example, methods of integrating polynucleotides into a cell include, transient transfection of one or more polynucleotides of the disclosure into a cell, or by use of stable producing cells.

[0342] In one example, the enveloped virus is produced from stable producer cells. Stable producer cells can be derived from packaging cell lines, including as any of the cell lines disclosed herein. In some embodiments the packaging cell lines are GPRG or GPRTG cell lines (Throm et al. (2009) Blood 113(21):5104-5110; and Bonner et al. (2015) Molecular Therapy, Vol. 23, Suppl. 1, S35).

[0343] In one example, the stable producer cell line is produced by a method comprising: (a) synthesizing a vector by cloning one or more genes into a polynucleotide as described herein, e.g. pUC57-TL20c comprising a modified WPRE; (b) generating DNA fragments from the synthesized vector; (c) forming a concatemeric array from the generated DNA fragments of the synthesized vector and from DNA fragments from an antibiotic resistance cassette plasmid; (d) transfecting a packaging cell line (e.g., a GPR, GPRG, GPRT, GPRGT or GPRT-G cell line or a derivative thereof) with the formed concatemeric array; and (e) isolating one or more stable producer cell line clones.

[0344] In one example, the stable producer cell line is produced by a method comprising: (a) synthesizing a vector by cloning one or more genes into a polynucleotide as described herein, e.g. pUC57-TL20c comprising a eGFP; (b) generating DNA fragments from the synthesized vector; (c) forming a concatemeric array from the generated DNA fragments of the synthesized vector and from DNA fragments from an antibiotic resistance cassette plasmid; (d) transfecting a packaging cell line (e.g., a HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT or GPRT-G cell line or a derivative thereof) with the formed concatemeric array; and (e) isolating one or more stable producer cell line clones.

[0345] In one example, the method further comprises inducing the stable producer cell line to produce the vector.

[0346] As used herein, the term "producer cell" refers to a cell which contains all the elements necessary for production of lentiviral vector particles.

[0347] As used herein, the term "packaging cell "refers to a cell which contains those elements necessary for production of infectious recombinant virus which are lacking in a recombinant viral vector or lentiviral transfer vector plasmid. Typically, such packaging cells contain one or more expression cassettes which are capable of expressing viral structural proteins (such as gag, pol and env) but they do not contain a packaging signal.

[0348] Host cells

[0349] The present disclosure provides a “host cell” which refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that is capable of being “transduced” with a polynucleotide or vector in order to express the transgene of interest. A host cell may also be a primary cell derived from the tissue of a patient. For example, the host cell is an autologous cell.

[0350] In one example, the cell is selected from a hematopoietic progenitor or stem cell (e.g. CD34+ cell), a monocyte, a macrophage, a peripheral blood mononuclear cell, a hepatocyte, a CD4+ T lymphocyte, a CD8+ T lymphocyte, a dendritic cell, or a derivative thereof. Use

[0351] In one example, the stable cell line described herein is used for producing an enveloped virus, such as a lentivirus, in a cell culture system e.g., for gene therapy.

[0352] In another example, the host cell transduced with a polynucleotide or vector described herein is used for expressing the transgene of interest.

[0353] The term “gene therapy” as used herein refers to a general method for treating a pathologic condition in a subject by inserting an exogenous nucleic acid into an appropriate cell(s) within the subject. The nucleic acid is inserted into the cell in such a way as to maintain its functionality, e.g., maintain the ability to express a particular polypeptide. In certain cases, insertion of the heterologous nucleic acid results in the expression of a therapeutically effective amount of a particular polypeptide.

[0354] As used herein, the term “subject” shall be taken to mean any animal including humans, for example a mammal. Exemplary subjects include but are not limited to humans and non-human primates. For example, the subject is a human.

[0355] Embodiments of the Disclosure

[0356] The invention is further disclosed in the following numbered paragraphs:

[0357] 1. A nucleic acid comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0358] 2. A polynucleotide comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or a fragment thereof.

[0359] 3. The polynucleotide of paragraph 2, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29.

[0360] 4. The polynucleotide of paragraph 2 or 3, wherein the cryptic poly (A) site motif is ATTACA.

[0361] 5. The polynucleotide of any one of paragraphs 2 to 4, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29.

[0362] 6. The polynucleotide of any one of paragraphs 2 to 5, wherein the modified WPRE comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0363] 7. The polynucleotide of any one of paragraphs 2 to 6, wherein the polynucleotide further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0364] 8. A polynucleotide comprising, in order from 5’ to 3’: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter. 9. A polynucleotide comprising, in order from 5’ to 3’: i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5 ’ LTR; iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof operably linked to a nucleotide sequence comprising a transgene of interest; v) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; vi) a nucleotide sequence comprising an insulator; vii) a nucleotide sequence comprising a 3 ’ LTR; viii) a nucleotide sequence comprising a polyA signal; ix) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and x) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0365] 10. The polynucleotide of paragraphs 8 or 9, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

[0366] 11. The polynucleotide of paragraph 10, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

[0367] 12. The polynucleotide of paragraphs 10 or 11 , wherein the cryptic poly (A) site motif is ATTACA.

[0368] 13. The polynucleotide of any one of paragraphs 8 to 112, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29 or fragment thereof. 14. The polynucleotide of any one of paragraphs 8 to 13 , wherein the modified WPRE or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0369] 15. The polynucleotide of any one of paragraphs 7 to 14, wherein the one or more lentiviral elements are selected from the group consisting of: a nucleotide sequence comprising a packaging signal; a nucleotide sequence comprising a central polypurine tract (cPPT), a nucleotide sequence encoding a Rev response element (RRE); a nucleotide sequence encoding a multiple cloning site and combinations thereof.

[0370] 16. The polynucleotide of any one of paragraphs 7 to 15, wherein the insulator is a chicken hypersensitive site-4 (cHS4) insulator.

[0371] 17. The polynucleotide of paragraph 16, wherein the nucleotide sequence comprising the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32, 33, 57, 58 or 59.

[0372] 18. The polynucleotide of any one of paragraphs 7 to 17, wherein the polyA signal is selected from the group consisting of a simian virus 40 (SV40) polyA, SV40 late promoter (SVLP) polyA, human growth hormone (hGH) polyA, bovine growth hormone (BGH) polyA and rabbit beta-globin polyadenylation signal (rbGlob) polyA.

[0373] 19. The polynucleotide of paragraph 18, wherein the rabbit beta-globin polyadenylation signal comprises a sequence set forth in SEQ ID NO: 16.

[0374] 20. The polynucleotide of any one of paragraphs 7 to 19, wherein the one or more viral origin of replication sequence(s) is selected from the group consisting of pUC, pUK, SV40 ori and combinations thereof.

[0375] 21. The polynucleotide of paragraph 20, wherein the SV40 viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 17 and / or the nucleotide sequence comprising the pUC viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 18

[0376] 22. The polynucleotide of any one of paragraphs 7 to 21, wherein the antibiotic resistance gene is an Amp(R) gene operably linked to an Amp(R) promoter. 23. The polynucleotide of paragraph 22, wherein the nucleotide sequence encoding the Amp(R) gene comprises a sequence set forth in SEQ ID NO: 19 and / or the nucleotide sequence comprising the Amp(R) promoter comprises a sequence set forth in SEQ ID NO: 20.

[0377] 24. A nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 38, and wherein the sequence of the MND promoter or fragment thereof comprises one or more of the following nucleotide substitutions relative to SEQ ID NO: 38 i) adenine substituted for thymine at a position corresponding to nucleotide 45; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260.

[0378] 25. A nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter comprising a sequence set forth in any one of SEQ ID NOs: 42 to 51.

[0379] 26. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter.

[0380] 27. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

[0381] 28. The polynucleotide of paragraphs 26 or 27, wherein the unmodified MND promoter comprises a sequence set forth in any one of SEQ ID NOs: 38, 39, 40 or 41.

[0382] 29. The polynucleotide of paragraphs 27 or 28, wherein the one or more putative cryptic splice sites are within a direct repeat sequence and / or an enhancer sequence of the MND promoter. 30. The polynucleotide of any one of paragraphs 27 to 29, wherein the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 34 to 53, nucleotides 109 to 128 and / or nucleotides 251 to 271 of SEQ ID NO: 38.

[0383] 31. The polynucleotide of any one of paragraphs 27 to 30, wherein the one or more putative cryptic splice sites comprise a sequence set forth in any one of SEQ ID NOs: 39 to 41.

[0384] 32. The polynucleotide of any one of paragraphs 26 to 31, wherein the modified MND promoter or fragment thereof comprises a nucleotide sequence selected from the group consisting of: i) adenine substituted for thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 38; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 38; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 38.

[0385] 33. The polynucleotide of any one of paragraphs 26 to 32, wherein the modified MND promoter or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 42 to 51.

[0386] 34. The polynucleotide of any one of paragraphs 26 to 33, wherein the modified MND promoter is operably linked to a nucleotide sequence comprising a transgene of interest.

[0387] 35. The polynucleotide of any one of paragraphs 2 to 23 or 25 to 34, wherein the polynucleotide comprises between about 2,000 and about 15,000 nucleotides.

[0388] 36. The polynucleotide of any one of paragraphs 2 to 23, or 25 to 35, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 21, 22 or 34- 37 lacking nucleotides 2,402 to 3,635.

[0389] 37. The polynucleotide of any one of paragraphs 25 to 35, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 54 to 56 lacking nucleotides 3,098 to 3,814. 38. The polynucleotide of any one of paragraphs 2 to 23 or 25 to 37, wherein the polynucleotide is a vector.

[0390] 39. The polynucleotide of paragraph 38, wherein the vector is a plasmid or a virus.

[0391] 40. A vector comprising the polynucleotide of any one of paragraphs 2 to 23 or 25 to 39.

[0392] 41. A stable cell line comprising the polynucleotide of any one of paragraphs 2 to 23 or 25 to 39 or the vector of paragraph 40.

[0393] 42. The stable cell line of paragraph 41, wherein the cell line is selected from the group consisting of HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT, and GPRTG cell lines and derivatives thereof.

[0394] 43. Use of the stable cell line of paragraph 42 for production of an enveloped virus.

[0395] 44. A method of reducing premature termination of RNA transcription in a cell, the method comprising stably integrating the polynucleotide of any one of paragraphs 2 to 23, 35, 36, 38 or 39 into the cell.

[0396] 45. A method of reducing aberrant splicing of RNA transcripts in a cell, the method comprising stably integrating the polynucleotide of any one of paragraphs 25 to 39 into the cell.

[0397] 46. A host cell transduced with the polynucleotide of any one of paragraphs 25 to 39 or the vector of paragraph 40.

[0398] The invention is further disclosed in the following numbered paragraphs:

[0399] 1. A nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 21, and wherein the sequence of the MND promoter or fragment thereof comprises one or more of the following nucleotide substitutions relative to SEQ ID NO: 21 i) adenine substituted for thymine at a position corresponding to nucleotide 45; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260.

[0400] 2. A nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter comprising a sequence set forth in any one of SEQ ID NOs: 25 to 34.

[0401] 3. A nucleic acid comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0402] 4. A polynucleotide comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or a fragment thereof.

[0403] 5. The polynucleotide of paragraph 4, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29.

[0404] 6. The polynucleotide of paragraph 4 or 5, wherein the cryptic poly (A) site motif is ATTACA.

[0405] 7. The polynucleotide of any one of paragraphs 4 to 6, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29.

[0406] 8. The polynucleotide of any one of paragraphs 4 to 7, wherein the modified WPRE comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0407] 9. The polynucleotide of any one of paragraphs 4 to 8, wherein the polynucleotide further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0408] 10. A polynucleotide comprising, in order from 5’ to 3’: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0409] 11. The polynucleotide of paragraphs 9 or 10, wherein the promoter is a murine leukemia virus-derived (MND) promoter or fragment thereof.

[0410] 12. The polynucleotide of paragraph 11, wherein the MND promoter is a modified MND promoter or fragment thereof, wherein the modified MND promoter or fragment thereof: a) has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter; and / or b) lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

[0411] 13. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter.

[0412] 14. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

[0413] 15. The polynucleotide of any one of paragraphs 12 to 14, wherein the unmodified MND promoter comprises a sequence set forth in any one of SEQ ID NOs: 21, 22, 23 or 24.

[0414] 16. The polynucleotide of any one of paragraphs 12, 14 or 15, wherein the one or more putative cryptic splice sites are within a direct repeat sequence and / or an enhancer sequence of the MND promoter.

[0415] 17. The polynucleotide of any one of paragraphs 12 or 14 to 16, wherein the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 34 to 53, nucleotides 109 to 128 and / or nucleotides 251 to 271 of SEQ ID NO: 21.

[0416] 18. The polynucleotide of any one of paragraphs 12 or 14 to 17, wherein the one or more putative cryptic splice sites comprise a sequence set forth in any one of SEQ ID NOs: 22 to 24.

[0417] 19. The polynucleotide of any one of paragraphs 12 to 18, wherein the modified MND promoter or fragment thereof comprises a nucleotide sequence selected from the group consisting of: i) adenine substituted for thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 21; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 21; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 21.

[0418] 20. The polynucleotide of any one of paragraphs 12 to 19, wherein the modified MND promoter or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 25 to 34.

[0419] 21. The polynucleotide of any one of paragraphs 12 to 20, wherein the modified MND promoter is operably linked to a nucleotide sequence comprising a transgene of interest.

[0420] 22. The polynucleotide of any one of paragraphs 13 to 21 , wherein the polynucleotide further comprises one or more of the following: i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; v) a nucleotide sequence comprising an insulator; vi) a nucleotide sequence comprising a 3 ’ LTR; vii) a nucleotide sequence comprising a polyA signal; viii) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or ix) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0421] 23. A polynucleotide comprising, in order from 5 ’ to 3 ’ : i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5 ’ LTR; iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof operably linked to a nucleotide sequence comprising a transgene of interest; v) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; vi) a nucleotide sequence comprising an insulator; vii) a nucleotide sequence comprising a 3 ’ LTR; viii) a nucleotide sequence comprising a polyA signal; ix) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and x) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0422] 24. The polynucleotide of paragraphs 22 or 23, wherein the WPRE or fragment thereof is a modified WPRE or fragment thereof.

[0423] 25. A polynucleotide comprising, in order from 5 ’ to 3 ’ : i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5 ’ LTR; iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof operably linked to a nucleotide sequence comprising a transgene of interest; v) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; vi) a nucleotide sequence comprising an insulator; vii) a nucleotide sequence comprising a 3 ’ LTR; viii) a nucleotide sequence comprising a polyA signal; ix) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and x) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

[0424] 26. The polynucleotide of paragraphs 10 to 12 or 24 to 25, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

[0425] 27. The polynucleotide of paragraph 26, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29 or fragment thereof. 28. The polynucleotide of paragraphs 26 or 27, wherein the cryptic poly (A) site motif is ATTACA.

[0426] 29. The polynucleotide of any one of paragraphs 10 to 12 or 24 to 28, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

[0427] 30. The polynucleotide of any one of paragraphs 10 to 12 or 24 to 29, wherein the modified WPRE or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

[0428] 31. The polynucleotide of any one of paragraphs 9 to 12 or 22 to 30, wherein the one or more lentiviral elements are selected from the group consisting of: a nucleotide sequence comprising a packaging signal; a nucleotide sequence comprising a central polypurine tract (cPPT), a nucleotide sequence encoding a Rev response element (RRE); a nucleotide sequence encoding a multiple cloning site and combinations thereof.

[0429] 32. The polynucleotide of any one of paragraphs 9 to 12 or 22 to 31, wherein the insulator is a chicken hypersensitive site-4 (cHS4) insulator.

[0430] 33. The polynucleotide of paragraph 32, wherein the nucleotide sequence comprising the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32, 33, 57, 58 or 59.

[0431] 34. The polynucleotide of any one of paragraphs 9 to 12 or 22 to 33, wherein the polyA signal is selected from the group consisting of a simian virus 40 (SV40) polyA, SV40 late promoter (SVLP) polyA, human growth hormone (hGH) polyA, bovine growth hormone (BGH) polyA and rabbit beta-globin polyadenylation signal (rbGlob) polyA.

[0432] 35. The polynucleotide of paragraph 34, wherein the rabbit beta-globin polyadenylation signal comprises a sequence set forth in SEQ ID NO: 16.

[0433] 36. The polynucleotide of any one of paragraphs 9 to 12 or 22 to 35, wherein the one or more viral origin of replication sequence(s) is selected from the group consisting of pUC, pUK, SV40 ori and combinations thereof. 37. The polynucleotide of paragraph 36, wherein the SV40 viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 17 and / or the nucleotide sequence comprising the pUC viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 18

[0434] 38. The polynucleotide of any one of paragraphs 9 to 12 or 22 to 37, wherein the antibiotic resistance gene is an Amp(R) gene operably linked to an Amp(R) promoter.

[0435] 39. The polynucleotide of paragraph 38, wherein the nucleotide sequence encoding the Amp(R) gene comprises a sequence set forth in SEQ ID NO: 19 and / or the nucleotide sequence comprising the Amp(R) promoter comprises a sequence set forth in SEQ ID NO: 20.

[0436] 40. The polynucleotide of any one of paragraphs 4 to 39, wherein the polynucleotide comprises between about 2,000 and about 15,000 nucleotides.

[0437] 41. The polynucleotide of any one of paragraphs 4 to 12, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 21, 22 or 34-37 lacking nucleotides 2,402 to 3,635.

[0438] 42. The polynucleotide of any one of paragraphs 13 to 40, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 54 to 56 lacking nucleotides 3,098 to 3,814.

[0439] 43. The polynucleotide of any one of paragraphs 4 to 42, wherein the polynucleotide is a vector.

[0440] 44. The polynucleotide of paragraph 43, wherein the vector is a plasmid or a virus.

[0441] 45. A vector comprising the polynucleotide of any one of paragraphs 4 to 44.

[0442] 46. A stable cell line comprising the polynucleotide of any one of paragraphs 4 to 44 or the vector of claim 45. 47. The stable cell line of paragraph 46, wherein the cell line is selected from the group consisting of HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT, and GPRTG cell lines and derivatives thereof.

[0443] 48. Use of the stable cell line of paragraph 47 for production of an enveloped virus.

[0444] 49. A method of reducing premature termination of RNA transcription in a cell, the method comprising stably integrating the polynucleotide of any one of paragraphs 4 to 12 or 26 to 41, 43 or 44 into the cell.

[0445] 50. A method of reducing aberrant splicing of RNA transcripts in a cell, the method comprising stably integrating the polynucleotide of any one of paragraphs 13 to 40, or 42 to 44 into the cell.

[0446] 51. A host cell transduced with the polynucleotide of any one of paragraphs 4 to 43 or the vector of claim 44.

[0447] SEQUENCES OF THE DISCLOSURE

[0448] The present disclosure includes the following non-limiting Examples.

[0449] EXAMPLES

[0450] Example 1: Materials and Methods

[0451] Lentiviral production & purification

[0452] Lentiviruses were produced by transfection of the transfer plasmid containing the construct of interest into the GPRTG producer cell line and removal of doxycycline from the culture medium to initiate expression of viral components. After two days, viruscontaining supernatants were harvested, filtered and layered onto a sucrose cushion before ultracentrifugation. Pelleted virus was resuspended and stored at -70°C. Viral RNA was purified using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's instructions.

[0453] Sequencing

[0454] PacBio sequencing was performed according to the Iso-Seq protocol.

[0455] Nanopore libraries were prepared from 1 pg RNA using the nanopore DRS Kit (SQK-RNA002, Oxford Nanopore Technologies) according to manufacturer’s instructions. The poly(T) adapter was ligated to the mRNA using T4 DNA ligase (New England Biolabs) in the Quick Ligase reaction buffer (New England Biolabs) for 15 min at room temperature. First-strand cDNA was synthesized by SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) using the oligo(dT) adapter. The RNA-cDNA hybrid was then purified using Agencourt RNAClean XP magnetic beads (Beckman Coulter). The sequencing adapter was ligated to the mRNA using T4 DNA ligase (New England Biolabs) in the Quick Ligase reaction buffer (New England Biolabs) for 15 min at room temperature followed by a second purification step using Agencourt beads (as described above). Libraries were loaded onto R9.4 SpotON Flow Cells (Oxford Nanopore Technologies) and sequenced using a 48 hour run time.

[0456] Bioinformatics

[0457] Reads were aligned to the vector reference sequences and human genome using minimap2. Sequencing coverage was computed using samtools depth and splicing was visualised with ggsashimi. Plots were constructed in R using the ggplot2, gggenes and cowplot packages.

[0458] Example 2: Identification of WPRE cryptic polyA site motif

[0459] Analysis of RNA transcripts produced using Nanopore direct RNA sequencing revealed sharp changes in coverage suggesting the presence of slicing or cryptic polyA site usage.

[0460] As shown in Figure 1, the peaks indicate premature read termination at around 4,600 base pairs. Canonical AATAAA polyA motifs are represented by stars and it was found that there was none near this premature termination site. Screening for unique polyA motifs (using the PolyASite database 2.0), the cryptic polyA site motif ATTACA was observed near the termination site at approximately 4,630 base pairs, around 10-20 base pairs upstream of the premature termination site.

[0461] To confirm this was a polyA site and not endogeneous transcript from the gene of interest, the 3’UTR of the gene of interest were aligned at that location. None of the reads aligned to the 3’UTR. Thus, the transcripts terminating at -4650 bp were found to be transcribed from the vector.

[0462] Example 3: Correcting the cryptic polyA site motif

[0463] Two alternative point mutations were made to the cryptic polyA site as follows:

[0464] A vector comprising modified WPRE (option 1) was generated and sequences using induro and superscript III. As shown in Figure 2, modification of the cryptic polyA site was sufficient to remove premature termination of the RNA transcripts.

[0465] Example 4: Exemplary vector of the disclosure

[0466] An exemplary vector of the disclosure comprising modified WPRE (Option 1) is shown in Figure 3.

[0467] Example 5: Identification of MND cryptic splice sites

[0468] Bioinformatic splice site prediction analysis (Netgene2) was used to identify potential splice sites in a model EGFP vector, pBRNGTR17, comprising an EGFP transgene driven by an unmodified MND promoter in a TL20c backbone. The vector further comprises a cHS4 400bp Insulator and a WPRE. A schematic diagram of the model EGFP vector is shown in Figure 4.

[0469] Two key splice donor sites (splice donor site 1 (SD1), splice donor site 2 (SD2)), were identified in the MND on the positive strand of the vector with levels of confidence ranging from 0.8 to 0.92. A third splice donor site (splice donor site 3 (SD3)) was identified in the MND promoter on the negative strand of the vector with levels of confidence of 0.71. These three potential sites were considered particularly prone to the induction of aberrant splicing. Table 1 below sets forth the details of SD1, SD2 and SD3.

[0470] Table 1. In silico Netgene2 analysis of model EGFP vector pBRNGTR17, identifying cryptic splice donor sites, SD1, SD2 and SD3.

[0471] SD1 and SD2, the two sites with the highest scores, are almost identical sites within the direct repeat of the MPSV enhancer sequence on the MND promoter. Figure 5 depicts the MND promoter with the predicted SD and SA sites.

[0472] Example 6: Global fusion transcript assay

[0473] Cryptic splice sites, SD1, SD2 and SD3. were further investigated using a global fusion transcript assay. A model Wiskott-Aldrich Syndrome LV vector (WAS LV1; Figure 7) was used in the initial study. This model vector comprises a WAS transgene driven by an MND promoter in a TL20c backbone. The vector further comprises a WPRE and a cHS4 650 bp insulator sequence.

[0474] The MND promoter sequence of WASLV 1 is identical to model EGFP LV vector, pBRNGTR17.

[0475] The Global fusion transcript assay comprises an enrichment and sequencing protocol similar to that described in WO2022232191. Specifically, a lentiviral target enrichment kit was designed with custom baits targeting the entire lentiviral sequence. The protocol described in WO2022232191 was used for enrichment and sequencing of mRNAs containing LV sequence from complex RNA Seq samples (Figure 8), enabling aberrant splice events to be assessed throughout the entire lentiviral sequence. Chimeric reads mapping to both the LV sequence and a sequence on a human autosome were extracted, followed by filtering out reads with junctions defined as canonical splice junctions (presence of the intronic GU and AG motifs), followed by mapping of the splice junctions between LV sequence and human genome onto the LVV pro virus sequence (masking the first LTR). The mapped junction positions were divided into splice donors and splice acceptors, summed up and normalized to the library size.

[0476] As shown in Figure 9 and Table 2 a model WAS LV2, comprising an unmodified MND promoter, exhibited splicing at splice donor sites at SD 1 or SD2 in a global fusion transcript assay. Correction (inactivation) of the cryptic splice donor sites at SD1 and SD2 is considered to reduce splicing activity at SD 1 and SD2 when compared with the unmodified MND promoter.

[0477] Table 2. Identified splice donor sites in MND promoter sequence of model vector WAS LV1.

[0478] Example 7: RNA Seq Nanopore direct sequencing

[0479] RNA SEQ Nanopore Direct Sequencing was conducted on a second model vector a Wiskott-Aldrich Syndrome LV vector (WAS LV2; Figure 10). Like WAS LV1, this model vector comprises a WAS transgene driven by an MND promoter in a TL20c backbone. The vector further comprises a WPRE and a cHS4 650 bp insulator sequence.

[0480] The MND promoter sequence of WAS LV2 is identical to model EGFP LV vector, pBRNGTR17 and model WAS vector, WAS LV1. Analysis of WAS LV2 by RNA SEQ Nanopore Direct Sequencing was designed to investigate the presence of SD 1 , SD2 and / or SD3 in the MND promoter of an alternative vector.

[0481] Analysis of RNA transcripts produced using Nanopore direct RNA sequencing revealed sharp changes in coverage suggesting the presence of splicing or cryptic polyA site usage. A new and highly abundant splicing pattern was identified in a model WAS LV (WAS LV2) comprising a WAS transgene driven by an MND promoter sequence in a TL20c backbone. The splicing pattern was shown to remove most of the MND promoter and a small part of the start of the transgene. In this analysis approx. 20% of WAS LV reads were affected by this splicing pattern, which occurs between the MND promoter and the transgene. The main splicing event detected was between the predicted splice donor site within the first MPSV enhancer sequence (SD1, position 2445; approx. 12% splice events) and a splice acceptor in the transgene CDS. Splicing events involving the splice donor site within the second MPSV enhancer sequence (SD2; position 2520; approx. 8% splice events) were also detected, although at a lower frequency (Figure 11; Table 3 and Table 4). These correspond to MND SD1 and SD2 also identified in EGFP model vector pBRNRGT17 via in silico analysis and global fusion transcript assay described above.

[0482] Table 3. Identified splice donor sites in MND promoter sequence of model vector WAS LV2.

[0483] Table 4. Percentage splicing observed for model vector WAS LV2. Example 8: Optimised MND promoters and Exemplary vectors

[0484] Following identification of donor splice sites SD1, SD2 and SD3 in an MND promoter. The following point mutations were proposed to correct or reduce splice activity at each of these cryptic splice donor sites, shown below in Table 5.

[0485] Table 5. Splice donor site corrections in MND promoter.

[0486] Correction of the identified splice donor sites provided two optimised MND promoter sequences (Table 6) incorporating corrections to SD1 and SD2 (option 1) or SD1, SD2 and SD3 (option 2), as per Table 5.

[0487] Table 6. Optimised MND promoter sequences incorporating corrections to SD1, SD2 and / or SD3.

[0488] Bolded nucleotides are the splice donor sites (GT motif) in forward orientation. Underlined nucleotides are the splice donor site (GT motif) in reverse orientation. Bolded and underlined nucleotides are point mutations to correct identified cryptic splice donors sites.

[0489] Exemplary model EGFP LV vectors were prepared comprising optimised MND promoters (Options 1 and 2). Exemplary EGFP vectors include correction of i) the two highest scoring SD sites (SD1 and SD2); to provide model EGFP plasmid pBRNGTRl 17, and ii) all three high scoring SD sites (SD1, SD2 and SD3); to provide model EGFP plasmid pBRNGTRl 16.

[0490] These modifications were made within a lentiviral construct driving EGPF from the MND promoters (pBRNGTRl 7). Details of optimised vectors are highlighted in Figure 12 and Table 7 and Table 8 below.

[0491] Table 7. Improved EGFP model vectors with introduced mutations relative to pBRNGTRl 7.

[0492] Table 8. Table with element positions and orientations for EGFP model vectors pBRNGTR17, pBRNGTRl 16, pBRNGTRl 17.

[0493] Plasmid transfection and flow cytometry analysis experiments were conducted to confirm that optimised MND promoter variants Option 1 and Option 2 were still active in driving EGFP expression in pBRNGTRl 17 and pBRNGTRl 16 (Figure 13).

[0494] Preliminary experiments indicate optimised MND promoter Option 1 and Option 2 are active in driving EGFP transgene expression. A small reduction in activity was observed (<10%).

Claims

CLAIMS1. A nucleic acid comprising a modified MND promoter or fragment thereof, wherein the MND promoter comprises a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 21, and wherein the sequence of the MND promoter or fragment thereof comprises one or more of the following nucleotide substitutions relative to SEQ ID NO: 21 i) adenine substituted for thymine at a position corresponding to nucleotide 45; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260.

2. A nucleic acid comprising a modified murine leukemia virus-derived (MND) promoter comprising a sequence set forth in any one of SEQ ID NOs: 25 to 34.

3. A nucleic acid comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

4. A polynucleotide comprising a modified woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) or fragment thereof, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or a fragment thereof.

5. The polynucleotide of claim 4, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29.

6. The polynucleotide of claim 4, wherein the cryptic poly (A) site motif is ATTACA.

7. The polynucleotide of claim 4, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29.

8. The polynucleotide of claim 4, wherein the modified WPRE comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

9. The polynucleotide of claim 4, wherein the polynucleotide further comprises one or more of the following: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a nucleotide sequence comprising an insulator; f) a nucleotide sequence comprising a 3 ’ LTR; g) a nucleotide sequence comprising a polyA signal; h) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or i) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

10. A polynucleotide comprising, in order from 5’ to 3’: a) a nucleotide sequence comprising a tetracycline repressible promoter; b) a nucleotide sequence comprising a 5 ’ LTR; c) a nucleotide sequence comprising one or more lentiviral elements; d) a nucleotide sequence comprising a promoter operably linked to a nucleotide sequence comprising a transgene of interest; e) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; f) a nucleotide sequence comprising an insulator; g) a nucleotide sequence comprising a 3 ’ LTR; h) a nucleotide sequence comprising a polyA signal; i) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and j) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

11. The polynucleotide of claim 9, wherein the promoter is a murine leukemia virus- derived (MND) promoter or fragment thereof.

12. The polynucleotide of claim 11, wherein the MND promoter is a modified MND promoter or fragment thereof, wherein the modified MND promoter or fragment thereof: a) has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter; and / or b) lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

13. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof has a reduced propensity to induce aberrant splicing of RNA transcripts compared to an unmodified MND promoter.

14. A polynucleotide comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof, wherein the modified MND promoter or fragment thereof lacks one or more putative cryptic splice sites compared to an unmodified MND promoter.

15. The polynucleotide of claim 12, wherein the unmodified MND promoter comprises a sequence set forth in any one of SEQ ID NOs: 21, 22, 23 or 24.

16. The polynucleotide of claim 12, wherein the one or more putative cryptic splice sites are within a direct repeat sequence and / or an enhancer sequence of the MND promoter.

17. The polynucleotide of claim 12, wherein the one or more putative cryptic splice sites are located at a position corresponding to nucleotides 34 to 53, nucleotides 109 to 128 and / or nucleotides 251 to 271 of SEQ ID NO: 21.

18. The polynucleotide of claim 12, wherein the one or more putative cryptic splice sites comprise a sequence set forth in any one of SEQ ID NOs: 22 to 24.

19. The polynucleotide of claim 12, wherein the modified MND promoter or fragment thereof comprises a nucleotide sequence selected from the group consisting of:i) adenine substituted for thymine at a position corresponding to nucleotide 45 of SEQ ID NO: 21; and / or ii) adenine substituted for thymine at a position corresponding to nucleotide 120 of SEQ ID NO: 21; and / or iii) thymine substituted for adenine at a position corresponding to nucleotide 260 of SEQ ID NO: 21.

20. The polynucleotide of claim 12, wherein the modified MND promoter or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 25 to 34.

21. The polynucleotide of claim 12, wherein the modified MND promoter is operably linked to a nucleotide sequence comprising a transgene of interest.

22. The polynucleotide of claim 13, wherein the polynucleotide further comprises one or more of the following: i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5’ long terminal repeat (LTR); iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; v) a nucleotide sequence comprising an insulator; vi) a nucleotide sequence comprising a 3 ’ LTR; vii) a nucleotide sequence comprising a polyA signal; viii) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and / or ix) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

23. A polynucleotide comprising, in order from 5 ’ to 3 ’ : i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5 ’ LTR; iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof operably linked to a nucleotide sequence comprising a transgene of interest;v) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; vi) a nucleotide sequence comprising an insulator; vii) a nucleotide sequence comprising a 3 ’ LTR; viii) a nucleotide sequence comprising a polyA signal; ix) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and x) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

24. The polynucleotide of claim 22, wherein the WPRE or fragment thereof is a modified WPRE or fragment thereof.

25. A polynucleotide comprising, in order from 5 ’ to 3 ’ : i) a nucleotide sequence comprising a tetracycline repressible promoter; ii) a nucleotide sequence comprising a 5 ’ LTR; iii) a nucleotide sequence comprising one or more lentiviral elements; iv) a nucleotide sequence comprising a modified murine leukemia virus-derived (MND) promoter or fragment thereof operably linked to a nucleotide sequence comprising a transgene of interest; v) a modified woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or fragment thereof; vi) a nucleotide sequence comprising an insulator; vii) a nucleotide sequence comprising a 3 ’ LTR; viii) a nucleotide sequence comprising a polyA signal; ix) a nucleotide sequence comprising one or more viral origin of replication sequence(s); and x) a nucleotide sequence encoding an antibiotic resistance gene operably linked to a nucleotide sequence comprising a promoter.

26. The polynucleotide of claim 10, wherein the modified WPRE or fragment thereof does not comprise a cryptic poly (A) site motif leading to premature termination of RNA transcripts compared to a WPRE comprising a sequence set forth in any one of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

27. The polynucleotide of claim 26, wherein the cryptic poly (A) site motif is located at a position corresponding to nucleotides 14 to 19 of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

28. The polynucleotide of claim 26, wherein the cryptic poly (A) site motif is ATTACA.

29. The polynucleotide of claim 10, wherein the modified WPRE or fragment thereof comprises a nucleotide selected from the group consisting of thymine and guanine and substituted for adenine at a position corresponding to nucleotide 17 of SEQ ID NOs: 23, 26 or 29 or fragment thereof.

30. The polynucleotide of claim 10, wherein the modified WPRE or fragment thereof comprises a sequence set forth in any one of SEQ ID NOs: 24, 25, 27, 28, 30 or 31.

31. The polynucleotide of claim 9, wherein the one or more lentiviral elements are selected from the group consisting of: a nucleotide sequence comprising a packaging signal; a nucleotide sequence comprising a central polypurine tract (cPPT), a nucleotide sequence encoding a Rev response element (RRE); a nucleotide sequence encoding a multiple cloning site and combinations thereof.

32. The polynucleotide of claim 9, wherein the insulator is a chicken hypersensitive site -4 (cHS4) insulator.

33. The polynucleotide of claim 32, wherein the nucleotide sequence comprising the cHS4 insulator comprises a sequence set forth in SEQ ID NO: 32, 33, 57, 58 or 59.

34. The polynucleotide of claim 9, wherein the polyA signal is selected from the group consisting of a simian virus 40 (SV40) polyA, SV40 late promoter (SVLP) polyA, human growth hormone (hGH) polyA, bovine growth hormone (BGH) polyA and rabbit beta-globin polyadenylation signal (rbGlob) polyA.

35. The polynucleotide of claim 34, wherein the rabbit beta-globin polyadenylation signal comprises a sequence set forth in SEQ ID NO: 16.

36. The polynucleotide of claim 9, wherein the one or more viral origin of replication sequence(s) is selected from the group consisting of pUC, pUK, SV40 ori and combinations thereof.

37. The polynucleotide of claim 36, wherein the SV40 viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 17 and / or the nucleotide sequence comprising the pUC viral origin of replication sequence comprises a sequence set forth in SEQ ID NO: 1838. The polynucleotide of claim 9, wherein the antibiotic resistance gene is an Amp(R) gene operably linked to an Amp(R) promoter.

39. The polynucleotide of claim 38, wherein the nucleotide sequence encoding the Amp(R) gene comprises a sequence set forth in SEQ ID NO: 19 and / or the nucleotide sequence comprising the Amp(R) promoter comprises a sequence set forth in SEQ ID NO: 20.

40. The polynucleotide of claim 4, wherein the polynucleotide comprises between about 2,000 and about 15,000 nucleotides.

41. The polynucleotide of claim 4, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 21, 22 or 34-37 lacking nucleotides 2,402 to 3,635.

42. The polynucleotide of claim 13, wherein the polynucleotide comprises a sequence set forth in any one of SEQ ID NOs: 54 to 56 lacking nucleotides 3,098 to 3,814.

43. The polynucleotide of claim 4, wherein the polynucleotide is a vector.

44. The polynucleotide of claim 43, wherein the vector is a plasmid or a virus.

45. A vector comprising the polynucleotide of claim 4.

46. A stable cell line comprising the vector of claim 45.

47. The stable cell line of claim 46, wherein the cell line is selected from the group consisting of HEK293, HEK293T, HEK293T / 17, GPR, GPRG, GPRT, GPRGT, and GPRTG cell lines and derivatives thereof.

48. Use of the stable cell line of claim 47 for production of an enveloped virus.

49. A method of reducing premature termination of RNA transcription in a cell, the method comprising stably integrating the polynucleotide of claim 4 into the cell.

50. A method of reducing aberrant splicing of RNA transcripts in a cell, the method comprising stably integrating the polynucleotide of claim 13 into the cell.

51. A host cell transduced with the vector of claim 44.