Methods of treating hypertension with metabolic syndrome using manp
Patent Information
- Application Number
- EP2024760897
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-22
- Filing Date
- 2024-02-21
- Publication Date
- 2025-12-31
AI Technical Summary
Current anti-hypertensive medications fail to effectively treat hypertension associated with metabolic syndrome due to variable patient responses and lack of reliable predictors for treatment outcomes.
Administering alternatively-spliced atrial natriuretic peptides (MANP) to increase plasma cyclic guanosine monophosphate (cGMP), decrease blood pressure, and improve metabolic parameters such as insulin sensitivity and plasma non-esterified fatty acids in patients with hypertension and metabolic syndrome.
MANP administration effectively decreases blood pressure and improves metabolic parameters, providing a reliable treatment method for hypertension with metabolic syndrome by increasing plasma cGMP and enhancing insulin sensitivity.
Smart Images

Figure US2024016662_29082024_PF_FP_ABST
Abstract
Description
METHODS OF TREATING HYPERTENSION WITH METABOLIC SYNDROMEUSING MANPRELATED APPLICATION
[0001] This application claims priority to U.S. Provisional Application Serial No. 63 / 486,421 filed February 22, 2023, the entirety of which is incorporated by reference hereinSTATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under HL136340 and HL 134668 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD OF THE INVENTION
[0003] The present disclosure provides methods for treating hypertension with metabolic syndrome in a patient using alternatively-spliced atrial natriuretic peptides (MANP).BACKGROUND OF THE INVENTION
[0004] Hypertension, also known as high blood pressure (BP), is a long-term medical condition in which BP in the arteries is persistently elevated. Metabolic syndrome is a constellation of cardiovascular and metabolic risk factors that predispose patients to major cardiovascular disease. Hypertension represents one of the central clinical characteristics of metabolic syndrome. Indeed, hypertension is present in 77% of patients affected by metabolic syndrome and conversely, visceral obesity is a key risk factor for the development of hypertension. Individually, hypertension and metabolic syndrome both represent significant risk factors for cardiovascular disease; when they coexist, the risk is doubled. Despite being two interrelated pathological conditions, none of the currently available anti-hypertensive medications have been reported to exert favorable metabolic effects, and no therapy has been specifically approved for treating hypertension associated with metabolic syndrome.
[0005] A difficulty in treating hypertension with metabolic syndrome may be attributed to the variable responses to potential treatments among different patients. The lack of an objective and reliable predictor of treatment outcome is one of many reasons behind theabsence of approved medications for treating hypertension with metabolic syndrome. While a published study (see, e.g., Chen et al. (2021), Hypertension, 78(6): 1859-1867) demonstrates that MANP may be administered to modulate certain symptoms of resistant hypertension, there are currently no known predictors that can reliably project a patient’s response to any hypertension treatment in the context of treating hypertension with metabolic syndrome. There remains a need for treatment methods employing reliable predictors to deliver effective treatment to patients suffering from hypertension with metabolic syndrome.SUMMARY OF THE INVENTION
[0006] The present disclosure includes methods and materials related to MANP. The present disclosure also includes methods of treating hypertension with metabolic syndrome in a patient in need thereof having a low baseline plasma cyclic guanosine monophosphate (cGMP) by administering MANP to the patient. In an aspect, the present disclosure includes where MANP is administered to a patient in need thereof to increase plasma cGMP, decrease blood pressure, or increase plasma atrial natriuretic peptides (ANP)-like peptides in the patient. In an aspect, the present disclosure also includes administering MANP to decrease plasma glucose level, increase insulin sensitivity, or increase plasma non-esterified fatty acids (NEFA) in a patient.
[0007] In an aspect, present disclosure provides for and includes a method for treating hypertension with metabolic syndrome in a patient in need thereof having baseline plasma cGMP lower than 10 pmol / mL. The method of the present disclosure comprises increasing plasma cGMP compared to the baseline by administering an effective dose of MANP to the patient. In an aspect, the present disclosure provides for, and includes, a method of decreasing BP in a patient in need thereof having baseline plasma cGMP lower than 10 pmol / mL. The method of the present disclosure comprises increasing plasma cGMP compared to the baseline by administering an effective dose of MANP to the patient. In an aspect, the present disclosure provides for, and includes, a method of increasing plasma ANP -like peptides in a patient in need thereof having baseline plasma cGMP lower than 10 pmol / mL. The method of the present disclosure comprises increasing plasma cGMP compared to the baseline by administering an effective dose of MANP to the patient. In an aspect, the present disclosure provides for, and includes, a method of decreasing plasma glucose level in a patient in needthereof comprising administering an effective dose of MANP to the patient. In an aspect, the present disclosure provides for, and includes, a method of increasing insulin sensitivity in a patient in need thereof comprising administering an effective dose of MANP to the patient. In an aspect, the present disclosure provides for, and includes, a method of increasing plasma NEFA in a patient in need thereof comprising administering an effective dose of MANP to the patient.
[0008] In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 2 to 8 pmol / mL from the baseline within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by 0. 1 to 15% compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0.1 to 5% compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 1 to 70 pg / mL compared to baseline plasma ANP-like peptides within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s updated Homeostasis Model Assessment sensitivity (H0MA2-S) value by 0.1 to 35% compared to baseline H0MA2-S value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2 -resistance (H0MA2-IR) value by 0.1 to 0.6 compared to baseline H0MA2-IR value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by 1 pM compared to baseline plasma NEFA within 1 hour after administering an effective dose of MANP.
[0009] In an aspect, the MANP can be administered subcutaneously (e.g., at a dose of about 0.1 pg / kg to 5 pg / kg, or about 6.5 pg to 750 pg). In an aspect, the MANP can be administered intravenously (e.g., at a dose of about 10 pmol / kg / minute to 100 nmol / kg / minute). In an aspect, the MANP can be administered intravenously, and subsequently administered subcutaneously. For example, the MANP can be administeredintravenously at a dose of about 10 pmol / kg / minute to about 100 nmol / kg / minute, and subsequently administered subcutaneously at a dose of about 0. 1 pg / kg to 5 pg / kg.
[0010] In as aspect, a patient in need thereof presents hypertension despite the use of at least one anti-hypertensive medication. In an aspect, a patient in need thereof presents a sitting systolic BP between 140 mmHg and 180 mmHg, or a sitting diastolic BP between 90 mmHg and 100 mmHg before administering MANP.
[0011] In an aspect, a patient in need thereof is a patient having a body mass index (BMI) higher than 25 kg / m2. In an aspect, a patient in need thereof is a male patient having a waist circumference higher than or equal to 102 cm. In an aspect, a patient in need thereof is a female patient having a waist circumference higher than or equal to 88 cm. In an aspect, a patient in need thereof is a patient having high serum triglyceride before receiving MANP in accordance with the present disclosure. In an aspect, a patient in need thereof is a patient having low HDL cholesterol before the receiving MANP in accordance with the present disclosure. In an aspect, low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in a patient who is a male. In an aspect, low HDL cholesterol is identified by HDL cholesterol lower than 50 mg / dL in the patient who is a female. In an aspect, a patient in need thereof is a patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol. In an aspect, a patient in need thereof is a patient having high fasting plasma glucose measured before receiving MANP in accordance with the present disclosure. In an aspect, high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0012] In an aspect, a patient in need thereof is not pregnant. In an aspect, a patient in need thereof is not breast-feeding. In an aspect, a patient in need thereof does not have a history (within 2 years before being administered with MANP in accordance with methods of the present disclosure) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction. In an aspect, a patient in need thereof does not have a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering. In an aspect, a patient in need thereof does not have a history of coronary artery disease, or cerebrovascular disease or syncope. In an aspect, a patient in need thereof does not have a history of epilepsy or other seizure disorder. In an aspect, a patient in need thereof does not have a history of organtransplantation. In an aspect, a patient in need thereof does not have a malignant tumor within 5 years before being administered with MANP in accordance with methods of the present disclosure. In an aspect, a patient in need thereof does not have a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries.BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The present invention is additionally disclosed with reference to the accompanying drawings, wherein:
[0014] FIG. 1 illustrates a schematic structure of MANP.
[0015] FIG. 2 illustrates a schematic summary of a study protocol investigating effects ofMANP in subjects with hypertension with metabolic syndrome in accordance with the present disclosure.
[0016] FIG. 3 A is a plot of circulating levels of ANP-like peptides in patients during 24- hour post subcutaneous administration of MANP in accordance with the present disclosure compared to placebo.
[0017] FIG. 3B is a plot of changes in circulating levels of cGMP during 24-hour post subcutaneous administration of MANP in accordance with the present disclosure compared to placebo.
[0018] FIG. 4A is a plot of changes in sitting systolic BP during 24-hour post subcutaneous administration of MANP in accordance with the present disclosure compared to placebo.
[0019] FIG. 4B is a plot of changes in sitting diastolic BP during 24-hour post subcutaneous administration of MANP in accordance with the present disclosure compared to placebo.
[0020] FIG. 4C is a plot of comparisons of changes in heart rate during 24-hour post subcutaneous administration of MANP in accordance with the present disclosure compared to placebo.
[0021] FIG. 5 A provides correlations between baseline features and mean systolic BP change in patients receiving treatments in accordance with the present disclosure.
[0022] FIG. 5B provides correlations between baseline features and mean diastolic BP change in patients receiving treatments in accordance with the present disclosure.
[0023] FIG. 6A is a plot of comparisons of the maximal ANP-like peptide increase after a single MANP injection in male (n=5) and female (n= 12) subjects in accordance with the present disclosure.
[0024] FIG. 6B is a plot of comparisons of the maximal cGMP increase after a single MANP injection in male (n=5) and female (n= 12) subjects in accordance with the present disclosure.
[0025] FIG. 6C is a plot of comparisons of the mean systolic BP change after a single MANP injection in male (n=5) and female (n= 12) subjects in accordance with the present disclosure.
[0026] FIG. 6D is a plot of comparisons of the mean diastolic BP change after a single MANP injection in male (n=5) and female (n= 12) subjects in accordance with the present disclosure.
[0027] FIG. 7A provides correlations between baseline features and maximal ANP-like peptides increase in patients receiving treatments in accordance with the present disclosure.
[0028] FIG. 7B provides correlations between baseline features and maximal cGMP increase in patients receiving treatments in accordance with the present disclosure.
[0029] FIG. 8A provides plots of a comparison of changes in H0MA2 insulin sensitivity in patients between baseline and 4 hours post administration of MANP in accordance with the present disclosure compared to placebo.
[0030] FIG. 8B provides plots of a comparison of changes in H0MA2 insulin resistance in patients between baseline and 4 hours post administration of MANP in accordance with the present disclosure compared to placebo.
[0031] Corresponding reference characters indicate corresponding parts throughout the several views. The examples set out herein illustrate embodiments of the present disclosure but should not be construed as limiting the scope of the present disclosure in any manner.DETAILED DESCRIPTION
[0032] This description is not intended to be a detailed catalog of all the different ways in which the disclosure may be implemented, or all the features that may be added to the instantdisclosure. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the disclosure contemplates that, in some aspects of the disclosure, any feature or combination of features set forth herein may be excluded or omitted. In addition, numerous variations and additions to the various aspects suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant disclosure. In other instances, well known structures, interfaces, and processes have not been shown in detail so as not to unnecessarily obscure the present disclosure. It is intended that no part of this specification be construed to effect a disavowal of any part of the full scope of the present disclosure. Hence, the following descriptions are intended to illustrate some particular aspects of the disclosure, and not to exhaustively specify all permutations, combinations, and variations thereof.
[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The terminology used in the description of the disclosure herein is for the purpose of describing particular aspects or embodiments only and is not intended to be limiting of the disclosure.
[0034] All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and / or paragraph in which the reference is presented. References to techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art. In case of conflict, the present specification, including definitions, will control.
[0035] Unless the context indicates otherwise, it is specifically intended that the various features of the disclosure described herein may be used in any combination. Moreover, the present disclosure also contemplates that in some aspects of the disclosure, any feature or combination of features set forth herein may be excluded or omitted.
[0036] The methods disclosed herein include and comprise one or more steps or actions for achieving the described method. The method steps and / or actions may be interchanged with one another without departing from the scope of the present disclosure. In other words,unless a specific order of steps or actions is required for proper operation of the embodiment, the order and / or use of specific steps and / or actions may be modified without departing from the scope of the present disclosure. Although methods and materials similar or equivalent to those described herein may also be used to practice the aspects of present disclosure, suitable methods and materials are described herein.
[0037] As used in the description of the disclosure and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
[0038] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0039] The terms “about” and “approximately” as used herein when referring to a measurable value such as a length, a frequency, or a duration and the like, is meant to encompass variations of ± 20%, ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount.
[0040] As used herein, phrases such as “between X and Y” and “between about X and Y” should be interpreted to include X and Y. As used herein, phrases such as “between about X and Y” mean “between about X and about Y” and phrases such as “from about X to Y” mean “from about X to about Y.”
[0041] As used herein, the term “exemplary” is used to mean serving as an example, instance, or illustration. Any aspect or aspect described as “exemplary” is not necessarily to be construed as preferred or advantageous over other aspects or aspects, nor is it meant to preclude equivalent structures and techniques known to those of ordinary skill in the art. Rather, use of the word exemplary is intended to present concepts in a concrete fashion, and the disclosed subject matter is not limited by such examples.
[0042] The present disclosure provides for and includes methods for treating hypertension with metabolic syndrome in a patient. Methods of the present disclosure may comprise administering an MANP as provided herein. In an aspect, methods of treatment according to the present disclosure may beneficially affect or alleviate one or more symptoms associated with a disorder, or one or more underlying causes of a disorder. In an aspect, the present disclosure provides for, and includes, methods of decreasing BP in a patient in need thereofcomprising administering an MANP to the patient. In an aspect, the present disclosure provides for, and includes, methods of increasing plasma ANP -like peptides in a patient in need thereof comprising administering an MANP to the patient. In an aspect, the present disclosure provides for, and includes, methods of decreasing plasma glucose level in a patient in need thereof comprising administering an MANP to the patient. In an aspect, the present disclosure provides for, and includes, methods of increasing insulin sensitivity in a patient in need thereof comprising administering an MANP to the patient. In an aspect, the present disclosure provides for, and includes, methods of increasing plasma NEFA in a patient in need thereof comprising administering an MANP to the patient. In an aspect, the present disclosure provides for and includes methods for treating a patient having a low baseline plasma cGMP. In an aspect, a low baseline plasma cGMP is a plasma cGMP lower than 10 pmol / mL (e.g, lower than 5 pmol / mL, lower than 1 pmol / mL, lower than 0.5 pmol / mL, lowerthan 0.1 pmol / mL, lower than 0.05 pmol / mL, or lower than 0.01 pmol / mL).
[0043] As used herein, the term “treat” or “treatment” is an approach for obtaining beneficial or desired clinical results. In an aspect, the term “treat” or “treatment” means to administer MANPs disclosed herein that partially or completely alleviate, ameliorate, relieve, inhibit, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms, features, or causes of hypertension with metabolic syndrome. The term “treat” or “treatment” includes the administration of MANPs disclosed herein to prevent or delay the onset of a symptom, complication, or biochemical indicia of hypertension with metabolic syndrome, alleviate a symptom or arrest or inhibit further development of hypertension with metabolic syndrome. Treatment may be prophylactic (to prevent or delay the onset of hypertension with metabolic syndrome), or therapeutic suppression or alleviation of a symptom after the manifestation of hypertension with metabolic syndrome.
[0044] In an aspect, the present disclosure includes methods of treatment that may beneficially affect or alleviate one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more symptoms associated with a disorder. In an aspect, the present disclosure includes methods of treatment that may beneficially affect or alleviate up to five, up to six, up to seven, up to eight, up to nine, up to ten, up to fifteen, or up to twenty symptoms associated with a disorder. In an aspect, methods of treatment according to the present disclosure may beneficially affect oralleviate one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more underlying causes of a disorder. In an aspect, the present disclosure includes methods of treatment that may beneficially affect or alleviate up to five, up to six, up to seven, up to eight, up to nine, up to ten, up to fifteen, or up to twenty underlying causes of a disorder.
[0045] As used herein, “hypertension” refers to systolic BP from 140 millimeters mercury (mmHg) to 180 mmHg or diastolic BP from 90 mmHg to 100 mmHg while sitting. In an aspect, hypertension is a BP reading of 130 mmHg of a systolic BP and 80 mmHg of a diastolic BP, or higher.
[0046] In an aspect, BP is measured by a sphygmomanometer or a blood pressure gauge. In an aspect, a sphygmomanometer comprises an inflatable cuff, a measuring unit (the mercury manometer, or aneroid gauge), and a mechanism for inflation which may be a manually operated bulb and valve or a pump operated electrically. In an aspect, a sphygmomanometer comprises a manual meter. In an aspect, a sphygmomanometer comprises a digital meter.
[0047] In an aspect, sitting BP is measured when the subject sits in a comfortable chair with the back supported for at least 5 minutes before reading. Both feet of the subject are flat on the ground and both legs are uncrossed. The arm of the subject is rested with the cuff on a table at chest height.
[0048] In an aspect, systolic BP and diastolic BP are measured using methods known in the art. In an aspect, a cuff of a sphygmomanometer is placed smoothly and snugly around an upper arm, at roughly the same vertical height as the heart while the subject is seated with the arm supported. In an aspect, the size of a cuff is selected and fitted for the patient. In an aspect, measurements are taken from both arms to determine if the pressure is significantly higher in one arm than the other. A difference of 10 mmHg may be a sign of coarctation of the aorta. If the arms read differently, the higher reading arm would be used for later readings. The cuff is inflated until the artery is completely occluded. In an aspect, with a manual instrument, listening with a stethoscope to the brachial artery, the examiner slowly releases the pressure in the cuff at a rate of approximately 2 mmHg per heart beat. As the pressure in the cuffs falls, a "whooshing" or pounding sound is heard when blood flow first starts again in the artery. The pressure at which this sound began is noted and recorded as thesystolic blood pressure. The cuff pressure is further released until the sound can no longer be heard. This is recorded as the diastolic blood pressure. In an aspect, digital instruments use a cuff which may be placed, according to the instrument, around the upper arm, wrist, or a finger, in all cases elevated to the same height as the heart. Digital instruments inflate the cuff and gradually reduce the pressure in the same way as a manual meter, and measure blood pressures by the oscillometric method.
[0049] In an aspect, the presence or extent of hypertension may be evaluated using methods known in the art, including, without limitation, general clinical examination to evaluate BP, heart rate, heart rhythm, arterial oxygen, and hemoglobin levels; echocardiography to measure ejection fraction, left ventricle (LV) and left atrial (LA) diameter, LV wall motion, LV filling pressure, and diastolic function by pulse and tissue Doppler; use of a Swan-Ganz catheter to measure cardiac output, pulmonary wedge capillary pressure, pulmonary arterial pressure, right ventricle pressure, right atrial pressure, and systemic and pulmonary vascular resistance; assessment of kidney function by determination of glomerular filtration rate, serum creatinine, and blood urea nitrogen; and measurement of biomarkers such as B-type natriuretic peptide (BNP), amino-terminal proBNP (NT-proBNP), troponin-T, troponin-I, C-reactive protein (CRP), and creatine-kinase, serum cystatin-C, albuminuria, neutrophil gelatinase associated lipocalin (NGAL), N-acetyl-beta-D- glucosaminidase (NAG), kidney injury molecule-1 (KIM-1), angiotensin-II, renin, aldosterone, and inflammatory cytokines (e.g., interleukin (IL)-6, IL-18, etc.).
[0050] As used herein, “metabolic syndrome” refers to a condition diagnosed by the criteria set out by the National Cholesterol Education Program (NCEP) Adult Treatment Panel III (ATP III). Specifically, the NCEP ATP III defines metabolic syndrome as the presence of any two of the following traits:1. Abdominal obesity, defined as a waist circumference in men > 102 cm (40 inch) and in women > 88 cm (35 inch);2. Serum triglycerides > 150 mg / dL (1.7 mmol / L);3. Serum high-density lipoprotein (HDL) cholesterol < 40 mg / dL ( 1 mmol / L) in men and < 50 mg / dL (1.3 mmol / L) in women or drug treatment for low HDL cholesterol; and4. Fasting plasma glucose > 100 mg / dL (5.6 mmol / L) or drug treatment for elevated blood glucose.In an aspect, metabolic syndrome is identified in a patient having three or more of the following risk factors as defined by American Heart Association, including high blood glucose, low levels of HDL cholesterol in the blood, high levels of triglycerides in the blood, large waist circumference, and high BP. In an aspect, a lipid profile or lipid panel is a panel of blood tests used to find abnormalities in lipids, such as cholesterol and triglycerides. Typically, the laboratory measures only three quantities, including total cholesterol, HDL, and triglycerides. From these three data LDL may be calculated. In an aspect, laboratories require patients to fast for 9-12 hours before screening. In an aspect, some diagnostic labs accept non-fasting samples.
[0051] In an aspect, the methods of treatment provided herein are methods to achieve lower BP, enhancement of insulin sensitivity, elevation of plasma non-esterified fatty acids (NEFA), decreased plasma glucose level, increased natriuresis, arterial vasodilation, suppression of renin and aldosterone, reduction of apoptosis and hypertrophy, increased lusitropy, induction of vascular regeneration, increased lipolysis, and browning of white adipocytes in a patient in need thereof.MANP
[0052] MANP, an ANP analog, is a Guanylyl Cyclase A (GC-A) / Cyclic Guanosine Monophosphate (cGMP) activator. (McKie, Paul M et al., Journal of the American College of Cardiology, 54(11): 1024-1032 (2009)). MANP is a 40-amino acid (AA) peptide containing the 28-AA of native ANP with a unique 12-AA C-terminus extension. MANP, compared to ANP, is more resistant to degradation, enhances binding to GC-A receptor, causes increased and more sustained sodium excretion, and causes more sustained suppression of aldosterone.
[0053] The methods provided herein may include, in part, treating a patient with an MANP. This disclosure provides the polypeptides or nucleic acids encoding MANP polypeptides set forth in Table 1. As used herein, “an MANP” may have the amino acid sequence set forth in SEQ ID NO:3, or may be a variant of the sequence set forth in SEQ ID NO:3. As depicted in FIG. 1, MANP is an ANP-based peptide having an amino acid sequence that includes the 28 amino acid mature human ANP sequence (SLRRSSCFGGRMDRIGAQSGLGCNSFRY; SEQ ID NO: 1) with an additional 12 amino acid carboxy terminus (RITAREDKQGWA; SEQ ID NO:2). The full length sequence ofMANP is SLRRSSCFGGRMDRIGAQSGLGCNSFRYRIT AREDKQGWA (SEQ ID N0:3).A representative nucleic acid sequence encoding MANP is 5'- agcctgcggagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactggg ctgtaacagcttccggtaccggataacagccagggaggacaagcagggctgggcctag-3' (SEQ ID NO:4).Table 1. Exemplary MANP Polypeptides or Nucleic Acids Encoding MANP Polypeptides
[0054] In an aspect, an MANP used in the methods provided herein may contain the entire amino acid sequence set forth in SEQ ID NO:3. In an aspect, an MANP may contain the amino acid sequence set forth in SEQ ID NO:3, wherein the amino acid sequence contains one or between one and ten (e.g., ten, between one and nine, between two and nine, between one and eight, between two and eight, between one and seven, between one and six, between one and five, between one and four, between one and three, two, or one) amino acidadditions, subtractions, and / or substitutions. In an aspect, an MANP may contain the amino acid sequence set forth in SEQ ID NO:3 with one, two, three, four, five, six, seven, eight, nine, or ten single amino acid residue additions, subtractions, or substitutions. In an aspect, an MANP may have one or more additions, subtractions, and / or substitutions within the C- terminal portion of SEQ ID NO:3 (e.g., the last 12 amino acids of SEQ ID NO:3). Examples of such a polypeptide may include, without limitation, a polypeptide having the amino acid sequence set forth in SEQ ID NO:3 where the threonine is deleted (SLRRSSCFGGRMDRIGAQSGLGCNSFRYRIA REDKQGWA; SEQ ID NO:5), the tryptophan is replaced with a tyrosine (SLRRSSCFGGRMDRIGAQSGLGCNSFRY RITAREDKQGYA; SEQ ID NO:6), a serine is added between the lysine and the glutamine (SLRRSSCFGGRMDRIGAQS GLGCNSFRYRITAREDKSQGWA; SEQ ID NO:7), or any combination thereof. In an aspect, an MANP may lack the last three residues of SEQ ID NO:3 (z.e., the glycine, tryptophan, and alanine residues of SEQ ID NO:3, as set forth in SEQ ID NO: 8 (SLRRSSCFGGRMDRIGAQSGLGCNSFRY RITAREDKQ). In an aspect, an MANP may have one or more additions, subtractions, and / or substitutions within the N- terminal portion of SEQ ID NO:3 (e.g., the first six amino acids of SEQ ID NO:3). Examples of such polypeptides include, without limitation, a polypeptide having the amino acid sequence set forth in SEQ ID NO:3 where four amino acids from urodilatin are added to the N-terminus (TAPRSLRRSSCFGGRMDRIGAQSGLGCNSFRYRITAREDKQGWA; SEQ ID NON), the arginine residues at positions 3 and 4 are substituted with lysine residues (SLKKSSCFGGRMD RIGAQSGLGCNSFRYRITAREDKQGWA; SEQ ID NO: 10), the D- isoform of serine is substituted at the sixth position (SLRRSSCFGGRMDRIGAQSGLGCNSFRYRITA REDKQGWA; SEQ ID NO: 11), the D-isoform of arginine is substituted at the fourth position and the serine at the fifth position is deleted (SLRRSCFGGRMDRIGAQSGL GCNSFRYRITAREDKQGWA; SEQ ID NO: 12), threonine residues are substituted for the serine residues at positions 1, 5, and 6 (TLRRTTCFGGRMDRIGAQSGLGCNSFR YRITAREDKQGWA; SEQ ID NO: 13), a tryptophan is substituted for the leucine at position 2 (SWRRSSCFGGRMDR IGAQSGLGCNSFRY RITAREDKQGWA; SEQ ID NO: 14), or any combination thereof.
[0055] In an aspect, any amino acid residue set forth in SEQ ID NO:3 may be subtracted, and any amino acid residue (e.g., any of the 20 conventional amino acid residues or any othertype of amino acid such as ornithine or citrulline) may be added to the sequence set forth in SEQ ID NO:3. In an aspect, an MANP may contain one or more chemical structures such as 8-aminohexanoic acid; hydroxylated amino acids such as 3 -hydroxyproline, 4- hydroxyproline, (5R)-5-hydroxy-L-lysine, allo-hydroxylysine, and 5-hydroxy-L-norvaline; and / or glycosylated amino acids such as amino acids containing monosaccharides (e.g., D- glucose, D-galactose, D-mannose, D-glucosamine, and D-galactosamine) or combinations of monosaccharides.
[0056] In an aspect, MANPs having one or more amino acid additions, subtractions, or substitutions relative to the representative MANP sequence set forth in SEQ ID NO:3, also referred to herein as “variant” MANPs, may be generated using any suitable method. In an aspect, amino acid substitutions may be made by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. In an aspect, naturally occurring residues may be divided into groups based on side-chain properties: (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, and threonine); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (asparagine, glutamine, histidine, lysine, and arginine); (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups may be considered conservative substitutions. Non-limiting examples of useful conservative substitutions may include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenylalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and / or leucine for valine.
[0057] Further examples of conservative substitutions that may be made at any position within an MANP useful in the methods described herein are set forth in Table 2.Table 2Examples of Conservative Amino Acid Substitutions
[0058] In an aspect, an MANP may include one or more non-conservative substitutions. Non-conservative substitutions typically entail exchanging a member of one of the classes described above for a member of another class. Such production may be desirable to provide large quantities or alternative embodiments of such compounds. Whether an amino acid change results in a functional polypeptide can readily be determined by assaying the specific activity of the polypeptide variant using, for example, a cGMP radioimmunoassay (RIA) or a cGMP ELISA assay.
[0059] In an aspect, an MANP may have a length of, in an aspect, 35 to 45 amino acid residues (e.g., 35 to 40, 40 to 45, 35 to 37, 36 to 38, 37 to 39, 38 to 40, 39 to 41, 40 to 42, 41 to 43, 42 to 44, or 43 to 45 amino acid residues). In an aspect, an MANP may include an amino acid sequence as set forth in SEQ ID NO:3, but with a particular number of amino acid substitutions. In an aspect, an MANP may have the amino acid sequence of SEQ ID NO:3,but with one, two, three, four, or five amino acid substitutions. Examples of such amino acid sequences include, without limitation, MANP with a D-amino acid replacing one or more L- amino acids within the N-terminal region of the polypeptide (e.g., with a D-serine residue at position 6, as set forth in SEQ ID NO: 11, or with a D-arginine at position 4, as set forth in SEQ ID NO: 12).
[0060] In an aspect, an MANP may include an amino acid sequence with at least 90% (e.g., at least 90%, at least 92.5%, at least 95%, at least 97.5%, or 100%) sequence identity to the reference sequence set forth in SEQ ID NO:3. Percent sequence identity is calculated by determining the number of matched positions in aligned amino acid sequences, dividing the number of matched positions by the total number of aligned amino acids, and multiplying by 100. A matched position refers to a position in which identical amino acids occur at the same position in aligned amino acid sequences. Percent sequence identity also may be determined for any nucleic acid sequence.
[0061] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ may be obtained online at fr.com / blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program may be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql.txt); - j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. In an aspect, the following command may be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a filecontaining the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. In an aspect, the following command may be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
[0062] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO:3), or by an articulated length (e.g., 20 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. In an aspect, an amino acid sequence that has 37 matches when aligned with the sequence set forth in SEQ ID NO:3 is 92.5 percent identical to the sequence set forth in SEQ ID NO:3 (z.e., 37 40 x 100 = 92.5). It is noted that the percent sequence identity value is rounded to the nearest tenth. In an aspect, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. It also is noted that the length value will always be an integer.
[0063] Isolated MANPs may be produced using any suitable method, including solid phase synthesis, and may be generated using manual techniques or automated techniques (e.g., using an Applied BioSystems (Foster City, CA) Peptide Synthesizer or a Biosearch Inc. (San Rafael, CA) automatic peptide synthesizer). Disulfide bonds between cysteine residues may be introduced by mild oxidation of the linear polypeptides using KCN as taught, e.g., in U.S. Patent No. 4,757,048. MANP may also be produced recombinantly.
[0064] The MANPs described herein typically are cyclic due to disulfide bonds between the cysteine residues (see, FIG. 1). In an aspect, a sulfhydryl group on a cysteine residue may be replaced with an alternative group (e.g, -CH2CH2-). To replace a sulfhydryl group with a -CH2- group, in an aspect, a cysteine residue may be replaced by alpha-aminobutyric acid.Such cyclic analog polypeptides may be generated, in an aspect, in accordance with the methodology of Lebl and Hruby ((1984) Tetrahedron Lett., 25:2067-2068), or by employing the procedure disclosed in U.S. Patent No. 4,161,521.
[0065] In an aspect, ester bridges may be formed by reacting the OH of serine or threonine with the carboxyl group of aspartic acid or glutamic acid to yield a bridge having the structure -CH2CO2CH2-. Similarly, an amide may be obtained by reacting the side chain of lysine with aspartic acid or glutamic acid to yield a bridge having the structure -CH2C(O)NH(CH)4-. Methods for synthesis of these bridges are known in the art (see, e.g., Schiller et al. (1985), Biochem. Biophys. Res. Comm., 127:558; and Schiller et al. (1985), Ini. J. Peptide Protein Res., 25: 171). In an aspect, one method for preparing esters of the present polypeptides, when using the Merrifield synthesis technique, is to cleave the completed polypeptide from the resin in the presence of the desired alcohol under either basic or acidic conditions, depending upon the resin. The C-terminal end of the polypeptide then may be directly esterified when freed from the resin, without isolation of the free acid.Amides of polypeptides also may be prepared using techniques (e.g., those known in the art) for converting a carboxylic acid group or precursor to an amide. One method for amide formation at the C-terminal carboxyl group includes cleaving the polypeptide from a solid support with an appropriate amine, or cleaving in the presence of an alcohol, yielding an ester, followed by aminolysis with the desired amine. Other bridge-forming amino acid residues and reactions are provided in U.S. Patent No. 4,935,492. Preparation of peptide analogs that include non-peptidyl bonds to link amino acid residues are also known in the art. See, e.g., Spatola et al. (1986), Life Sci., 38: 1243; Spatola (1983) Vega Data, 1(3); Morley (1980) Trends Pharm. Sci., 463-468; Hudson et al. (1979), Int. J. Pept. Prot. Res., 14: 177; Spatola, in Chemistry and Biochemistry of Amino Acid Peptides and Proteins, B. Weinstein, ed., Marcel Dekker, New York, p. 267 (1983); Hann (1982), J. Chem. Soc. Perkin Trans., 1:307; Almquist et al. (1980), J. Med. Chem., 23: 1392; Jennings-White et al. (1982), Tetrahedron Lett. , 23:2533; EP 45665; Holladay et al. (1983), Tetrahedron Lett., 24:4401; and Hruby (1982), Life Sci., 31: 189.
[0066] N-acyl derivatives of an amino group of a polypeptide may be prepared by utilizing an N-acyl protected amino acid for the final condensation, or by acylating a protected or unprotected peptide. O-acyl derivatives may be prepared, in an aspect, byacylation of a free hydroxy peptide or peptide resin. Either acylation may be carried out using standard acylating reagents such as acyl halides, anhydrides, acyl imidazoles, and the like. Both N- and O-acylation may be carried out together, if desired.
[0067] In an aspect, an MANP may be pegylated, acetylated, or both. In an aspect, a polypeptide may be covalently attached to oligomers, such as short, amphiphilic oligomers that enable administration or improve the pharmacokinetic or pharmacodynamic profde of the conjugated polypeptide. The oligomers may comprise water soluble polyethylene glycol (PEG) and / or lipid soluble alkyls (short, medium, or long chain fatty acid polymers, such as, without limitation, palmitic acid, myristic acid, lauric acid, capric acid, or steric acid). The fatty acid molecule may be attached to the free amino terminus or to any lysine side chain (an epsilon amino group), and a lysine residue for this attachment may be placed at either the C- terminal or N-terminal end of the peptide. Linkage to PEG or another suitable polymer, or fusion to albumin or another suitable polypeptide may result in a modified MANP having an increased half-life as compared to an unmodified MANP. Without being bound by a particular mechanism, an increased serum half-life may result from reduced proteolytic degradation, immune recognition, or cell scavenging of the modified MANP. Methods for modifying a polypeptide by linkage to PEG (also referred to as “PEGylation”) or other polymers are known in the art, and include those set forth in U.S. Patent No. 6,884,780; PCT Publication No. WO 2004 / 047871; Cataliotti et al. (2007), Trends Cardiovasc. Med., 17: 10- 14; Veronese and Mero (2008), BioDrugs, 22:315-329; Miller et al. (2006), Bioconjugate Chem., 17:267-274; and Veronese and Pasut (2005), Drug Discov. Today, 10: 1451-1458, all of which are incorporated herein by reference in their entireties. Methods for modifying a polypeptide by fusion to albumin also are known in the art, and include those set forth in U.S. Patent Publication No. 2004 / 0086976, and Wang et a / . (2004), Pharm. Res., 21:2105-2111, both of which are incorporated herein by reference in their entireties.
[0068] In an aspect, an MANP may be fused to the Fc domain of an immunoglobulin molecule (e.g., an IgGl molecule) such that active transport of the fusion polypeptide across epithelial cell barriers occurs via the Fc receptor. In an aspect, a polypeptide may be a cyclic polypeptide. A cyclic polypeptide may be obtained by bonding cysteine residues; however, the replacement of a sulfhydryl group on the cysteine residue with an alternative group is also envisioned, in an aspect, -CH2-CH2-. In an aspect, to replace sulfhydryl groups witha -CH2- group, the cysteine residues may be replaced by the analogous alpha-aminobutyric acid. These cyclic analog peptides may be formed, in an aspect, in accordance with the methodology of Lebl and Hruby, supra, or by employing the procedure disclosed in U.S. Patent No. 4,161,521.
[0069] Salts of carboxyl groups of MANPs may be prepared by contacting a polypeptide with one or more equivalents of a desired base such as, in an aspect, a metallic hydroxide base (e.g., sodium hydroxide), a metal carbonate or bicarbonate base (e.g., sodium carbonate or sodium bicarbonate), or an amine base (e.g., triethylamine, triethanolamine, and the like). Acid addition salts of polypeptides may be prepared by contacting the polypeptide with one or more equivalents of an inorganic or organic acid (e.g, hydrochloric acid).
[0070] The term “polypeptide” as used herein refers to a compound of two or more subunit amino acids, regardless of post-translational modification (e.g., phosphorylation or glycosylation). The subunits may be linked by peptide bonds or other bonds such as, in an aspect, ester or ether bonds. The term “amino acid” refers to either natural and / or unnatural or synthetic amino acids, including D / L optical isomers.
[0071] The term “isolated” as used herein with reference to a polypeptide means that the polypeptide (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source (e.g, free of human proteins), (3) is expressed by a cell from a different species, or (4) does not occur in nature. An isolated polypeptide may be, in an aspect, encoded by DNA or RNA, including synthetic DNA or RNA, or some combination thereof.
[0072] The term “substantially pure” as used herein with reference to a polypeptide means the polypeptide is substantially free of other polypeptides, lipids, carbohydrates, and nucleic acids with which it is naturally associated. A substantially pure polypeptide may be any polypeptide that is removed from its natural environment and is at least 60 percent pure. A substantially pure polypeptide may be at least about 65, 70, 75, 80, 85, 90, 95, or 99 percent pure, or about 65 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95, or 95 to 99 percent pure.Typically, a substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel. In an aspect, a substantially pure polypeptide may be a chemically synthesized polypeptide.
[0073] Any method may be used to obtain a substantially pure polypeptide. In an aspect, common polypeptide purification techniques, such as affinity chromatography and HPLC, aswell as polypeptide synthesis techniques, may be used. In addition, any material may be used as a source to obtain a substantially pure polypeptide. In an aspect, tissue from wild-type or transgenic animals may be used as a source material. In addition, tissue culture cells engineered to over-express a particular polypeptide may be used to obtain substantially pure polypeptide. Further, a polypeptide may be engineered to contain an amino acid sequence that allows the polypeptide to be captured onto an affinity matrix. In an aspect, a tag such as c-myc, hemagglutinin, polyhistidine, or Flag™ tag (Kodak) may be used to aid polypeptide purification. Such tags may be inserted anywhere within the polypeptide including at either the carboxyl or amino termini, or in between. Other fusions that may be used include enzymes that aid in the detection of the polypeptide, such as alkaline phosphatase.
[0074] MANPs (e.g. , variant MANPs having conservative and / or non-conservative substitutions with respect to SEQ ID NO:3), as well as fragments of SEQ ID NO:3 or variant MANPs (e.g., fragments of any of SEQ ID NOS:3 to 14), may be screened for biological activity using any of a number of assays. In an aspect, the activity of an MANP may be evaluated in vitro by testing its effect on cGMP production in cultured cells (e.g., cultured cardiac fibroblasts, aortic endothelial cells, or glomerular cells). Cells may be exposed to an MANP (e.g., an MANP at IO'10to 10'4M), and samples may be assayed to evaluate the polypeptide’s effects on cGMP generation. cGMP generation may be detected and measured using, in an aspect, a competitive RIA cGMP kit (Perkin-Elmer, Boston, MA).
[0075] The activity of an MANP also may be evaluated in vivo by, in an aspect, testing its effects on factors such as plasma cGMP levels, urinary cGMP excretion, net renal generation of cGMP, glomerular filtration rate, BP, heart rate, hemodynamic function such as cardiac output, pulmonary wedge pressure, systemic vascular resistance, and renal function such as renal blood flow, urine volume, and sodium excretion rate after administration to a patient (e.g., a human, non-human primate, rodent, dog, cat, pig, sheep, horse, or cow). In an aspect, such parameters may be evaluated after inducing hypertension in the patient.
[0076] The term “nucleic acid” as used herein encompasses both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The nucleic acid may be double-stranded or single-stranded. Where single-stranded, the nucleic acid may be the sense strand or the antisense strand. In addition, nucleic acid may be circular or linear.
[0077] The term “isolated” as used herein with reference to nucleic acid refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5’ end and one on the 3’ end) in the naturally-occurring genome of the organism from which it is derived. In an aspect, an isolated nucleic acid may be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences, as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid may include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
[0078] The term “isolated” as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid, since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally- occurring genome. In an aspect, a non-naturally-occurring nucleic acid, such as an engineered nucleic acid, is considered to be an isolated nucleic acid. Engineered nucleic acids may be made using common molecular cloning or chemical nucleic acid synthesis techniques. Isolated non-naturally-occurring nucleic acids may be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote. In addition, a non-naturally-occurring nucleic acid may include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence.
[0079] It will be apparent to those of skill in the art that a nucleic acid existing among hundreds to millions of other nucleic acid molecules within, in an aspect, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.
[0080] In an aspect, an isolated nucleic acid molecule may be at least about 12 bases in length (e.g, at least about 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 100, 120, 130,140, 150, 250, 500, 750, 1000, 1500, 2000, 3000, 4000, or 5000 bases in length) and may hybridize, under hybridization conditions, to the sense or antisense strand of a nucleic acid having a sequence that encodes an MANP (e.g., an MANP having the sequence set forth in SEQ ID NO: 3, or a variant thereof). The hybridization conditions may be moderately or highly stringent hybridization conditions.
[0081] As used herein, “moderately stringent hybridization conditions” mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPOr (pH 7.4), 5X SSC, 5X Denhart’s solution, 50 pg / mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng / mL probe (about 5xl07cpm / pg), while the washes are performed at about 50°C with a wash solution containing 2X SSC and 0.1% sodium dodecyl sulfate.
[0082] Highly stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO4 (pH 7.4), 5X SSC, 5X Denhart’s solution, 50 pg / mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng / mL probe (about 5xl07cpm / pg), while the washes are performed at about 65°C with a wash solution containing 0.2X SSC and 0.1% sodium dodecyl sulfate.
[0083] Isolated nucleic acid molecules encoding MANPs may be produced using standard techniques, including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. In an aspect, polymerase chain reaction (PCR) techniques may be used to obtain an isolated nucleic acid containing nucleotide sequence that encodes an MANP as provided herein. PCR refers to a procedure or technique in which target nucleic acids are enzymatically amplified. Sequence information from the ends of the region of interest or beyond typically is employed to design oligonucleotide primers that are identical in sequence to opposite strands of the template to be amplified. PCR may be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers typically are 14 to 40 nucleotides in length, but may range from 10 nucleotides to hundreds of nucleotides in length. General PCR techniques are described, in an aspect in PCR Primer: A Laboratory Manual, ed. by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. When using RNA as a source of template, reverse transcriptase may be used to synthesize complementary DNA (cDNA) strands. Ligase chainreaction, strand displacement amplification, self-sustained sequence replication, or nucleic acid sequence-based amplification also may be used to obtain isolated nucleic acids. See, in an aspect, Lewis (1992), Genetic Engineering News, 12: 1; Guatelli et al. (1990), Proc. Natl. Acad. Sci. USA, 87: 1874-1878; and Weiss (1991), Science, 254: 1292.
[0084] Isolated nucleic acids encoding MANPs also may be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3’ to 5’ direction using phosphoramidite technology) or as a series of oligonucleotides. In an aspect, one or more pairs of long oligonucleotides (e.g., >100 nucleotides) may be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then may be ligated into a vector.
[0085] In addition, isolated nucleic acids encoding MANPs may be obtained by mutagenesis. In an aspect, a reference sequence may be mutated using standard techniques including oligonucleotide-directed mutagenesis and site-directed mutagenesis through PCR. See, Short Protocols in Molecular Biology, Chapter 8, Green Publishing Associates and John Wiley & Sons, edited by Ausubel et al., 1992. Non-limiting examples of variant MANPs are provided herein.
[0086] Vectors containing nucleic acids such as those described herein also are provided. A “vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. An “expression vector” is a vector that includes one or more expression control sequences, and an “expression control sequence” is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence.
[0087] In an expression vector, a nucleic acid (e.g., a nucleic acid encoding an MANP) may be operably linked to one or more expression control sequences. As used herein, “operably linked” means incorporated into a genetic construct so that expression control sequences effectively control expression of a coding sequence of interest. Examples of expression control sequences include promoters, enhancers, and transcription terminating regions. A promoter is an expression control sequence composed of a region of a DNAmolecule, typically within 100 to 500 nucleotides upstream of the point at which transcription starts (generally near the initiation site for RNA polymerase II). To bring a coding sequence under the control of a promoter, it is necessary to position the translation initiation site of the translational reading frame of the polypeptide between one and about fifty nucleotides downstream of the promoter. Enhancers provide expression specificity in terms of time, location, and level. Unlike promoters, enhancers may function when located at various distances from the transcription site. An enhancer also may be located downstream from the transcription initiation site. A coding sequence is “operably linked” and “under the control” of expression control sequences in a cell when RNA polymerase is able to transcribe the coding sequence into mRNA, which then may be translated into the protein encoded by the coding sequence. Expression vectors thus may be useful to produce antibodies as well as other multivalent molecules.
[0088] Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, in an aspect, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalovirus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen / Life Technologies (Carlsbad, CA).
[0089] An expression vector may include a tag sequence designed to facilitate subsequent manipulation of the expressed nucleic acid sequence (e.g. , purification or localization). Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or Flag™ tag (Kodak, New Haven, CT) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags may be inserted anywhere within the polypeptide including at either the carboxyl or amino terminus.
[0090] Host cells containing vectors also are provided. The term “host cell” is intended to include prokaryotic and eukaryotic cells into which a recombinant expression vector may be introduced (e.g., vector encoding an MANP). As used herein, “transformed” and “transfected” encompass the introduction of a nucleic acid molecule (e.g., a vector) into a cell by one of a number of techniques. Although not limited to a particular technique, a number of these techniques are well established within the art. Suitable methods for transforming and transfecting host cells may be found, in an aspect, in Sambrook et al., Molecular Cloning: ALaboratory Manual (2ndedition), Cold Spring Harbor Laboratory, New York (1989). In an aspect, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral -mediated nucleic acid transfer may be used to introduce nucleic acid into cells. In addition, naked DNA may be delivered directly to cells in vivo as described elsewhere (U.S. Patent Nos. 5,580,859 and 5,589,466 both of which are incorporated by reference in their entireties). The host cells may express the encoded polypeptide, but it is noted that cells containing an isolated nucleic acid molecule provided herein are not required to express a polypeptide. The isolated nucleic acid molecule transformed into a host cell may be integrated into the genome of the cell or maintained in an episomal state. Thus, host cells may be stably or transiently transfected with a construct containing an isolated nucleic acid molecule provided herein.
[0091] Any appropriate method may be used to introduce an isolated nucleic acid molecule into a cell in vivo or in vitro. In an aspect, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral -mediated nucleic acid transfer are methods that may be used to introduce an isolated nucleic acid molecule into a cell. In addition, naked DNA may be delivered directly to cells in vivo as described elsewhere (e.g., U.S. Patent Nos. 5,580,859 and 5,589,466, and continuations thereof). Further, isolated nucleic acid molecules may be introduced into cells by generating transgenic animals.
[0092] Any appropriate method may be used to identify cells containing an isolated nucleic acid molecule that encodes an MANP. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analyses. In an aspect, immunohistochemistry and biochemical techniques may be used to determine if a cell contains a particular isolated nucleic acid molecule by detecting the expression of a polypeptide encoded by that nucleic acid molecule.
[0093] Isolated MANPs and nucleic acids encoding MANPs as described herein may be used to treat patients identified as having conditions such as hypertension with metabolic syndrome. Thus, one or more MANPs - or nucleic acids encoding one or more MANPs - may be incorporated into a composition for administration to a patient (e.g., a patient having, or at risk for having, hypertension, resistant hypertension (RH), and / or cardiorenal disease). Any suitable method may be used to formulate and subsequently administer a composition. Dosages typically are dependent on the responsiveness of the patient to the agent(s) beingadministered, with the course of treatment lasting from several days to several months or longer, or until a suitable response is achieved. Persons of ordinary skill in the art routinely determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of each agent (e.g. , an MANP and Fs), and generally may be estimated based on the ECso found to be effective in in vitro and / or in vivo animal models. Compositions containing one or more MANPs as described herein may be given once or more daily, weekly, monthly, or even less often, or may be administered continuously for a period of time (e.g. , hours, days, or weeks). In an aspect, an MANP or a composition containing am MANP may be administered to a patient at a dose of at least about 0.01 ng MANP / kg to about 100 mg MANP / kg of body mass. In an aspect, an MANP or a composition containing an MANP may be administered as an infusion for 1 to 30 days or longer (e.g., at a dose of about 1 pmol MANP / kg / minute to about 500 nmol MANP / kg / minute) .
[0094] One or more MANPs or nucleic acids encoding one or more MANPs may be admixed, encapsulated, conjugated, or otherwise associated with each other and / or other molecules, molecular structures, or mixtures of compounds such as, in an aspect, liposomes, receptor or cell targeted molecules, or oral, topical, or other formulations for assisting in uptake, distribution, and / or absorption.
[0095] In an aspect, a composition of the present disclosure may comprise an MANP (or nucleic acid encoding the MANPs) in combination with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, in an aspect, pharmaceutically acceptable solvents, suspending agents, or any other pharmacologically inert vehicles for delivering polypeptides and / or other compounds to a subject. Pharmaceutically acceptable carriers may be liquid or solid, and may be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties, when combined with one or more therapeutic compounds and any other components of a given pharmaceutical composition. Useful pharmaceutically acceptable carriers include, without limitation: water; saline solution; binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose or dextrose and other sugars, gelatin, or calcium sulfate); lubricants (e.g., starch, polyethylene glycol, orsodium acetate); disintegrates (e.g., starch or sodium starch glycolate); and wetting agents (e.g., sodium lauryl sulfate).
[0096] Compositions and formulations for parenteral, intrathecal or intraventricular administration include sterile aqueous solutions (e.g., sterile physiological saline), which also may contain buffers, diluents and other suitable additives (e.g., penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers). Compositions and formulations for oral administration include, in an aspect, powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Such compositions also may incorporate thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders.
[0097] Pharmaceutical compositions include, but are not limited to, solutions, emulsions, aqueous suspensions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, in an aspect, preformed liquids, selfemulsifying solids, and self-emulsifying semisolids. Emulsion formulations are particularly useful for oral delivery of therapeutic compositions due to their ease of formulation and efficacy of solubilization, absorption, and bioavailability. Liposomes may be particularly useful due to their specificity and the duration of action they offer from the standpoint of drug delivery.
[0098] Compositions may contain any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to a subject, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof for the relevant compound (e.g., an MANP). Accordingly, in an aspect, the present disclosure provides pharmaceutically acceptable salts of MANPs, prodrugs and pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. A prodrug is a therapeutic agent that is prepared in an inactive form and is converted to an active form (z.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions. The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the MANPs useful in the methods provided herein (z.e., salts that retain the desired biological activity of the parent compounds without imparting undesired toxicological effects). Examples of pharmaceutically acceptable salts include, but are not limited to, salts formed with cations (e.g., sodium, potassium, calcium, or polyamines such as spermine); acid addition salts formed with inorganic acids (e.g., hydrochloric acid,hydrobromic acid, sulfuric acid, phosphoric acid, or nitric acid); salts formed with organic acids (e.g., acetic acid, citric acid, oxalic acid, palmitic acid, or fumaric acid); and salts formed with elemental anions (e.g., bromine, iodine, or chlorine).
[0099] Compositions additionally may contain other adjunct components conventionally found in pharmaceutical compositions. Thus, the compositions also may include compatible, pharmaceutically active materials such as, in an aspect, antipruritics, astringents, local anesthetics, or anti-inflammatory agents, or additional materials useful in physically formulating various dosage forms of the compositions, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. Furthermore, the composition may be mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings, penetration enhancers, and aromatic substances. When added, however, such materials should not unduly interfere with the biological activities of the other components within the compositions.
[0100] In an aspect, an MANP may be formulated as a sustained release dosage form. In an aspect, an MANP may be formulated into a controlled release formulation. In an aspect, coatings, envelopes, or protective matrices may be formulated to contain one or more of the MANPs described herein. Such coatings, envelopes, and protective matrices may be used to coat indwelling devices such as stents, catheters, and peritoneal dialysis tubing. In an aspect, a polypeptide may be incorporated into polymeric substances, liposomes, microemulsions, microparticles, nanoparticles, or waxes.
[0101] Pharmaceutical formulations as disclosed herein, which may be presented conveniently in unit dosage form, may be prepared according to any suitable method, including conventional techniques known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredient(s) with the desired pharmaceutical carrier(s). Typically, the formulations may be prepared by uniformly and intimately bringing the active ingredients into association with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. Formulations may be sterilized if desired, provided that the method of sterilization does not interfere with the effectiveness of the molecule(s) contained in the formulation.
[0102] In an aspect, an MANP may be formulated for subcutaneous delivery via injection, depot polymers, drug patch, pump, or microparticle / nano particle. By way of example and not limitation, PCT Publication No. WO 2008 / 061355 discloses materials and methods for formulating a polypeptide for delivery in a hydrogel tube. The polypeptide may be mixed with one or more excipients that are pharmaceutically acceptable and are compatible with the polypeptide in amounts suitable for use in the methods described herein. In an aspect, a polypeptide may be combined with one or more excipients such as, without limitation, microcrystalline cellulose, colloidal silicon dioxide, lactose, starch, sorbitol, cyclodextrin, and combinations thereof. The excipient may be a solid, semi-solid, or liquid material that acts as a vehicle, carrier, or medium for the polypeptide. In an aspect, the polypeptide may be compressed, compacted, or extruded with one or more excipients prior to inserting it into a hydrogel tube. Such formulations may result in a pharmaceutical composition with desirable release properties, improved stability, and / or other desirable properties.
[0103] Pharmaceutical compositions may also include auxiliary agents or excipients, such as glidants, dissolution agents, surfactants, diluents, binders, disintegrants, and / or lubricants. In an aspect, dissolution agents may increase the dissolution rate of a polypeptide from a dosage formulation, and may include, in an aspect, organic acids and / or salts of organic acids (e.g., sodium citrate with citric acid). Other examples of excipients useful in such formulations include synthetic, semi-synthetic, modified, and natural polymers (e.g., lactose, dextrose, sucrose, trehalose, sorbitol, mannitol, starches, gum acacia, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, PEG, cyclodextrin, alkoxy- modified cyclodextrins, hydroxyethylcellulose, hydroxypropylcellulose, microcrystalline cellulose, albumin, dextran, malitol, xylitol, kaolin, and methyl cellulose). The polypeptide also may be mixed with a lubricating agent (e.g., talc, magnesium stearate, stearic acid, or mineral oil, calcium stearate, hydrogenated vegetable oils, sodium benzoate, sodium chloride, leucine carbowax, magnesium lauryl sulfate, or glyceryl monostearate), a wetting agent, an emulsifying and suspending agent, or a preserving agent (e.g., methyl or propyl hydroxybenzoate).
[0104] Other agents that may be added to a pharmaceutical composition may alter the pH of the microenvironment on dissolution and establishment of a therapeutically effective plasma concentration profile of an MANP compound. Such agents include salts of inorganicacids and magnesium hydroxide. Other agents that may be used include surfactants and other solubilizing materials.
[0105] Useful diluents include, in an aspect, pharmaceutically acceptable inert fillers such as microcrystalline cellulose, lactose, sucrose, fructose, glucose, dextrose, or other sugars, dibasic calcium phosphate, calcium sulfate, cellulose, ethylcellulose, cellulose derivatives, kaolin, mannitol, lactitol, maltitol, xylitol, sorbitol, or other sugar alcohols, dry starch, saccharides, dextrin, maltodextrin or other polysaccharides, inositol, or combinations thereof. In an aspect, water-soluble diluents may be particularly useful.
[0106] Glidants may be used to improve the flow and compressibility of composition ingredients during processing. Useful glidants include, in an aspect, colloidal silicon dioxide (also referred to as colloidal silica, fumed silica, light anhydrous silicic acid, silicic anhydride, and fumed silicon dioxide).
[0107] Surfactants that are suitable for use in the pharmaceutical compositions described herein include, without limitation, sodium lauryl sulphate, polyethylene stearates, polyethylene sorbitan fatty acid esters, polyoxyethylene castor oil derivatives, polyoxyethylene alkyl ethers, benzyl benzoate, cetrimide, cetyl alcohol, docusate sodium, glyceryl monooleate, glyceryl monostearate, glyceryl palmitostearate, lecithin, medium chain triglycerides, monoethanolamine, oleic acid, poloxamers, polyvinyl alcohol and sorbitan fatty acid esters.
[0108] Suitable disintegrants include, in an aspect, starches, sodium starch glycolate, crospovidone, croscarmellose, microcrystalline cellulose, low substituted hydroxypropyl cellulose, pectins, potassium methacrylate-divinylbenzene copolymer, polyvinyl alcohol), ethylamide, sodium bicarbonate, sodium carbonate, starch derivatives, dextrin, beta cyclodextrin, dextrin derivatives, magnesium oxide, clays, bentonite, and combinations thereof.
[0109] In an aspect, an MANP may be incorporated into a hydrogel delivery system. In an aspect, an MANP may be formulated for subcutaneous delivery to a patient via a xerogelhydrogel system that may release the polypeptide in a continuous sustained manner over an extended period of time. See, e.g. , U.S. Patent No. 5,226,325, and PCT Publication No. WO 2004 / 071736, both of which are incorporated by reference in their entireties.
[0110] Liquid polymerizable materials useful in the preparation of hydrogel tubes include a wide variety of polymerizable hydrophilic, and ethylenically unsaturated compounds. See, e.g., the compounds listed in PCT Publication No. WO 2008 / 061355. Mixtures of such hydrophilic monomers typically are used in the polymerization reaction. The type and proportion of monomers are selected to yield a polymer (e.g., a crosslinked homogeneous polymer) that on hydration possesses the desired characteristics (e.g., equilibrium water content (EWC) value and / or pore size) for the contemplated application or use.
[0111] In an aspect, the polymerization of hydrophilic monomeric mixtures may result in homogeneous hydrophilic copolymers which dissolve, to a varying extent, in an aqueous medium. In such cases, a small amount (e.g., up to about 3 percent) of a copolymerizable polyethylenically unsaturated crosslinking agent may be included in the monomeric mixture to obtain homogeneous crosslinked copolymers that are water-insoluble as well as water- swellable. A slightly crosslinked homopolymer of (hydroxyethyl)methacrylate (HEMA) has an EWC value of about 38%. Crosslinked copolymers of HEMA and N-(2-hydroxypropyl) methacrylamide (HPMA) have EWC values below 38%, while crosslinked copolymers of HEMA and acrylamide exhibit EWC values above 38 w / v %. Therefore, depending on the useful or effective elution rate of the polypeptide, copolymer hydrogels may be customized to elute the polypeptide at the desired rate. Typically, copolymers contain about 15 to about 70 weight % of HEMA units and from about 85 to 30 weight % of a second ethylenic monomer, and thus possess EWC values in the range of from about 20% to about 75%. In an aspect, a mixture of copolymers may further contain a small amount of a polyethylenically unsaturated crosslinking agent (e.g., ethyleneglycol dimethacrylate (“EDMA”) or trimethylolpropane trimethacrylate (“TMPTMA”)).
[0112] In an aspect, a pharmaceutical composition for controlled release delivery of an MANP in a subject may include (a) a complex of the polypeptide (where the polypeptide has at least one basic functional group) and a polyanion derived from hexahydroxycyclohexane (where the polyanion has at least two negatively charged functional groups); and (b) a pharmaceutically acceptable carrier containing a biodegradable, water-insoluble polymer. Such compositions are described in, for example, PCT Publication No. WO 2006 / 017852, and may be prepared in the form of solutions, suspensions, dispersions, emulsions, drops, aerosols, creams, semisolids, pastes, capsules, tablets, solid implants, or microparticles. Theterm “controlled release delivery,” as used herein, refers to continual delivery of a pharmaceutical agent in vivo over a period of time (e.g., several days to weeks or months) following administration. Sustained controlled release delivery of an MANP may be demonstrated by, in an aspect, continued therapeutic effects of the polypeptide over time (e.g., continued reductions in symptoms over time). Sustained delivery of the polypeptide also may be demonstrated by detecting the presence of the polypeptide in vivo over time. The compositions may provide a low initial burst delivery, followed by stable, controlled release of the polypeptide in vivo for prolonged periods of time (e.g., from days to months).
[0113] In an aspect, a physically and chemically stable complex may form upon appropriate combining of a polypeptide and a polyanion. The complex may take the form of a precipitate that is produced upon combining an aqueous preparation of the polypeptide and the polyanion. Optionally, one or more pharmaceutically acceptable excipients may be incorporated into the complex. Such excipients may function as stabilizers for the polypeptide and / or the complex. Non-limiting examples of suitable excipients include sodium bisulfite, p-aminobenzoic acid, thiourea, glycine, methionine, mannitol, sucrose, and PEG.
[0114] A stable complex between a polypeptide and a polyanion may be incorporated into a pharmaceutically acceptable carrier containing a biodegradable water-insoluble polymer, optionally with one or more excipients. The term “biodegradable water-insoluble polymer” refers to biocompatible and / or biodegradable synthetic and natural polymers that may be used in vivo. The term also is meant to include polymers that are insoluble or become insoluble in water or biological fluid at 37°C. The polymers may be purified (e.g, to remove monomers and oligomers) using techniques known in the art. See, e.g., U.S. Patent No. 4,728,721. Examples of useful polymers include, without limitation, polylactides, polyglycolides, poly(lactide-co- glycolide)s, polycaprolactones, polydioxanones, polycarbonates, polyhydroxybutyrates, polyalkylene oxalates, polyanhydrides, polyamides, polyesteramides, polyurethanes, polyacetals, polyorthocarbonates, polyphosphazenes, polyhydroxyvalerates, polyalkylene succinates, and polyorthoesters, and copolymers, block copolymers, branched copolymers, terpolymers, and combinations thereof.
[0115] Biodegradable water-insoluble polymers also may include end capped, end uncapped, or mixtures of end capped and end uncapped polymers. An end capped polymergenerally is defined as having capped carboxyl end groups, while an uncapped polymer has free carboxyl end groups.
[0116] Factors to consider when determining suitable molecular weights for the polymer may include desired polymer degradation rate, mechanical strength, and rate of dissolution of polymer in solvent. Useful molecular weights for polymers may be from about 2,000 Daltons to about 150,000 Daltons, in an aspect, with a polydispersity of from 1. 1 to 2.8, depending upon which polymer is selected for use.
[0117] The pharmaceutically acceptable carrier may be a carrier with environment responsive properties (e.g., thermosensitive, pH sensitive, or electrical sensitive), in the form of an injectable solution or suspension, particle, film, pellet, cylinder, disc, microcapsule, microsphere, nanosphere, microparticle, wafer, micelle, liposome, or any other polymeric configuration useful for drug delivery.
[0118] Methods of forming various pharmaceutically acceptable polymer carriers include those that are known in the art. See, for example, U.S. Patent Nos. 6,410,044, 5,698,213, 6,312,679, 5,410,016, 5,529,914, 5,501,863, 4,938,763, 5,278,201, and 5,278,202; and PCT Publication No. WO 93 / 16687, all of which are incorporated herein by reference in their entireties.
[0119] Compositions of the present disclosure may be produced when a polypeptide / polyanion complex is dispersed in a polymeric matrix to form a solid implant, which may be injected or implanted into a subject. Such implants may be prepared using conventional polymer melt-processing techniques, such as extrusion, compression molding, and injection molding, in an aspect. Preparations of such implants may be carried out under aseptic conditions, or alternatively by terminal sterilization by irradiation (e.g., using gamma irradiation or electron beam sterilization).
[0120] In an aspect, compositions in the form of microspheres may be produced by encapsulating a polypeptide / polyanion complex in a polymeric carrier, using various biocompatible and / or biodegradable polymers having properties that are suitable for delivery to different biological environments or for effecting specific functions. The rate of dissolution and, therefore, delivery of polypeptide is determined by factors such as the encapsulation technique, polymer composition, polymer crosslinking, polymer thickness, polymer solubility, and size and solubility of polypeptide / polyanion complex.
[0121] To prepare such microspheres, a polypeptide / polyanion complex to be encapsulated may be suspended in a polymer solution in an organic solvent, such that the polymer solution completely coats the polypeptide / polyanion complex. The suspension may then be subjected to a microencapsulation technique such as spray drying, spray congealing, emulsion, or solvent evaporation emulsion. In an aspect, the suspended complexes or microparticles along with the polymer in an organic solvent may be transferred to a larger volume of an aqueous solution containing an emulsifier, such that the organic solvent evaporates or diffuses away from the polymer and the solidified polymer encapsulates the polypeptide / polyanion complex.
[0122] Emulsifiers useful to prepare encapsulated polypeptide / polyanion complexes include poloxamers and polyvinyl alcohol, for example. Organic solvents useful in such methods include acetic acid, acetone, methylene chloride, ethyl acetate, chloroform, and other non-toxic solvents that will depend on the properties of the polymer. Solvents typically are chosen that solubilize the polymer and are ultimately non-toxic.
[0123] In an aspect, an MANP may be formulated in a depot, which may provide constantly high exposure levels and may reach high exposure levels rapidly (with a short or no lag phase). See, e.g., U.S. Publication No. 2010 / 0266704, which is incorporated herein by reference in its entirety. Depot formulations may include an MANP or a pharmaceutically- acceptable salt thereof (e.g., an acid addition salt with an inorganic acid, polymeric acid, or organic acid). Acid addition salts may exist as mono- or divalent salts, depending on whether one or two acid equivalents are added.
[0124] As described in U.S. Publication No. 2010 / 0266704, depot formulations may contain two different linear poly (lactic-co-glycolic acid) (PUGA) polymers having a molar ratio of lactide: glycolide comonomer (E:G) from 85: 15 to 65:35, where at least one of the polymers has a low inherent viscosity. Such formulations may provide sustained high plasma levels of the polypeptide for extended periods of time. Examples of suitable polymers include the linear poly(D,L-lactide) and poly(D,L-lactide-co-glycolide) polymers sold under the trade names RESOMER®, LACTEL®, and MEDISORB® by Boehringer Ingelheim Pharma GmBH & Co. KG (Ingelheim, Germany), Absorbable Polymers International (Pelham, AL), and Alkermes, Inc. (Cambridge, MA), respectively.
[0125] High exposure depot formulations for subcutaneous administration may show immediate or at least very rapid action, such that therapeutic plasma concentrations are achieved in a short time (e.g., one, two, three, four, five, six, or seven days after subcutaneous injection), and may show constantly high exposure levels over about one month or longer.
[0126] In an aspect, the depot formulations provided herein may contain two different PLGA polymers mixed or blended in a % wt. ratio of 95:5 to 50:50 (e.g., 85: 15 to 50:50, 80:20 to 60:40, 90: 10, 85: 15, 80:20, 75:25, 70:30, 65:35, 60:40, 55:45, or 50:50% wt.). In an aspect, the polymer with the higher inherent viscosity may have a higher % wt. than the polymer with the lower inherent viscosity. In an aspect, the polymer with the higher inherent viscosity may have an ester end-group. Depot formulations may contain further polymers, including other linear or star shaped PLGA polymers, or poly(D,L-lactide-co-glycolide) (PLG) or polylactic acid (PLA) polymers, provided that favorable pharmacokinetic properties are retained.
[0127] The polypeptide content of the depot formulation (the loading) may be in the range of 1% to 30% (e.g. , 10% to 25%, more preferably 15% to 20%). The loading is defined as the weight ratio of polypeptide to the total mass of the PLGA formulation.
[0128] Depot compositions may be manufactured aseptically, or may be manufactured non-aseptically and terminally sterilized (e.g., using gamma irradiation). Terminal sterilization may result in a product with the highest sterility assurance possible.
[0129] Depot compositions may also contain one or more pharmaceutical excipients that may modulate the release behavior of the polypeptide. Such excipients may be present in the composition in an amount of about 0.1% to about 50%. Suitable excipients include, without limitation, polyvinyl alcohol, polyvinyl pyrrolidone, carboxymethyl cellulose sodium, dextrin, PEG, surfactants such as poloxamers (also known as poly (oxy ethylene -block- oxypropylene), poly (oxy ethylene) -sorbitan-fatty acid esters commercially available under the trade name TWEEN®), sorbitan fatty acid esters, lecithins, inorganic salts such as zinc carbonate, magnesium hydroxide, magnesium carbonate, protamine, and natural or synthetic polymers bearing amine-residues such as polylysine.
[0130] Depot compositions may contain a mixture or blend of different polymers in terms of compositions, molecular weight, and / or polymer architectures. A polymer blend is defined herein as a solid solution or suspension of two different linear polymers in one implant ormicroparticle. A mixture of depots is defined herein as a mixture of two depot-like implants or microparticles or semisolid formulations of different compositions with one or more PLGAs in each depot. Pharmaceutical depot compositions in which two PLGAs are present as a polymer blend may be particularly useful.
[0131] Pharmaceutical depot compositions may be in the form of implants, semisolids (gels), liquid solutions, microparticles, or suspensions that solidify in situ once they are injected. The following paragraphs are focused on polymer microparticles, although the descriptions also are applicable for implants, semisolids, and liquids.
[0132] Microparticles may have a diameter from a few submicrons to a few millimeters (e.g., from about 0.01 micron to about 2 mm, about 0.1 micron to about 500 microns, about 10 to about 200 microns, about 10 to about 130 microns, or about 10 to about 90 microns).
[0133] In an aspect, microparticles may be mixed or coated with an anti-agglomerating agent. Suitable anti-agglomerating agents include, for example, mannitol, glucose, dextrose, sucrose, sodium chloride, and water-soluble polymers such as polyvinyl alcohol, polyvinyl pyrrolidone and PEG.
[0134] Microparticles may be manufactured using processes known in the art, such as coacervation or phase separation, spray drying, or water-in-oil (W / O), water-in-oil-in-water (W / O / W), or solids-in-oil-in-water (S / O / W) emulsion / suspension methods followed by solvent extraction or solvent evaporation. Emulsion / suspension methods may be particularly useful, and may include the following steps:(i) preparing an internal organic phase, comprising(a) dissolving a polymer or polymers in a suitable organic solvent (e.g., ethyl acetate, acetone, THF, acetonitrile, or a halogenated hydrocarbon such as methylene chloride, chloroform, or hexafluoroisopropanol) or solvent mixture, and optionally dissolving / dispersing suitable additives; and(b) dissolving / suspending / emulsifying a polypeptide in the polymer solution obtained in step (a);(ii) preparing an external aqueous phase containing one or more stabilizers (e.g., poly(vinylalcohol), hydroxyethyl cellulose, hydroxypropyl cellulose, poly(vinyl 38yrrolidone), or gelatin) and optionally a buffer salt;(iii) mixing the internal organic phase with the external aqueous phase to form an emulsion; and(iv) hardening the microparticles by solvent evaporation or solvent extraction, washing the microparticles (e.g., with water), collecting and drying the microparticles (e.g., by freeze-drying or drying under vacuum), and sieving the microparticles (e.g., through 140 pm).
[0135] A dry microparticle composition may be terminally sterilized by gamma irradiation, either in bulk or after dispensing into the final container. In an aspect, bulk sterilized microparticles may be resuspended in a suitable vehicle and dispensed into a suitable device such as a double chamber syringe with subsequent freeze drying.
[0136] In an aspect, microparticle depot compositions may include a vehicle to facilitate reconstitution. In addition, prior to administration, microparticles may be suspended in a suitable vehicle for injection (e.g., a water-based vehicle containing one or more pharmaceutical excipients such as mannitol, sodium chloride, glucose, dextrose, sucrose, or glycerin, and / or one or more non-ionic surfactants such as a poloxamer, poly(oxyethylene)- sorbitan-fatty acid ester, carboxymethyl cellulose sodium, sorbitol, poly(vinylpyrrolidone), or aluminum monostearate).METHODS OF ADMINISTERING MANP
[0137] In an aspect, before administering to a patient an MANP or nucleic acid encoding MANPs, or one or more compositions comprising MANP, an assessment is performed to determine whether or not the patient has a need for treatment of hypertension with metabolic syndrome. In an aspect, an assessment is performed to determine whether or not a patient has a need for treatment of hypertension with metabolic syndrome immediately prior to administering an MANP or nucleic acid encoding MANPs to the patient. In an aspect, an assessment is performed to determine whether or not a patient has a need for treatment of hypertension with metabolic syndrome 0.5 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week prior to administering an MANP or nucleic acid encoding MANPs to the patient. In an aspect, an assessment comprises one or more baseline measurements of parameters selected from the group consisting of plasma cGMP, BMI, waist circumference,serum triglyceride, HDL cholesterol, fasting plasma glucose, sitting systolic BP, sitting diastolic BP, plasma ANP-like peptides, insulin sensitivity, and plasma NEFA, in accordance with the present disclosure.
[0138] In an aspect, a patient in need thereof is a patient having a low baseline plasma cGMP measured before receiving MANP in accordance with the present disclosure. In an aspect, a low plasma baseline cGMP is lower than 10 pmol / mL. In an aspect, a low plasma baseline cGMP is lower than 8 pmol / mL. In an aspect, a low plasma baseline cGMP may be between 0. 1 to 12 pmol / mL, between 2 to 12 pmol / mL, between 4 to 12 pmol / mL, between 6 to 12 pmol / mL, between 8 to 12 pmol / mL, or between 10 to 12 pmol / mL. In an aspect, a low plasma baseline cGMP may be between 0.1 to 10 pmol / mL, between 0. 1 to 8 pmol / mL, between 0. 1 to 6 pmol / mL, between 0. 1 to 4 pmol / mL, or between 0.1 to 2 pmol / mL. In an aspect, a low plasma baseline cGMP may be between 2 to 10 pmol / mL, between 4 to 8 pmol / mL, between 2 to 6 pmol / mL, between 4 to 8 pmol / mL, or between 6 to 10 pmol / mL. In an aspect, a plasma baseline plasma cGMP is measured with a commercial enzyme-linked immunosorbent assay (ELISA) kit.
[0139] In an aspect, a patient in need thereof is a patient having a BMI higher than 25 kg / m2. In an aspect, a patient in need thereof is a patient having a BMI higher than 30 kg / m2. In an aspect, a patient in need thereof is a patient having a BMI higher than 35 kg / m2. In an aspect, a patient in need thereof is a patient having a BMI between 20 to 50 kg / m2, between 25 to 50 kg / m2, between 30 to 50 kg / m2, between 35 to 50 kg / m2, between 40 to 50 kg / m2, or between 45 to 50 kg / m2. In an aspect, the BMI may be between 20 to 45 kg / m2, between 20 to 40 kg / m2, between 20 to 35 kg / m2, or between 20 to 30 kg / m2. In an aspect, a patient in need thereof is a patient having a BMI between 25 to 35 kg / m2, 30 to 40 kg / m2, or between 35 to 45 kg / m2. In an aspect, BMI is measured by a person's weight in kilograms (or pounds) divided by the square of height in meters (or feet).
[0140] In an aspect, a patient in need thereof is a male patient having a waist circumference higher than or equal to 102 cm. In an aspect, a patient in need thereof is a male patient having a waist circumference between 90 to 300 cm, between 90 to 250 cm, between 90 to 200 cm, between 90 to 150 cm, or between 90 to 100 cm. In an aspect, a patient in need thereof is a male patient having a waist circumference between 100 to 300 cm, between 150 to 300 cm, between 200 to 300 cm, or between 250 to 300 cm. In an aspect, a patient in needthereof is a male patient having a waist circumference between 100 to 250 cm, between 150 to 200 cm, between 100 to 200 cm, or between 150 to 250 cm.
[0141] In an aspect, a patient in need thereof is a female patient having a waist circumference higher than or equal to 88 cm. In an aspect, a patient in need thereof is a female patient having a waist circumference between 80 to 300 cm, between 80 to 200 cm, between 80 to 150 cm, or between 80 to 100 cm. In an aspect, a patient in need thereof is a female patient having a waist circumference between 100 to 300 cm, between 150 to 300 cm, between 200 to 300 cm, or between 250 to 300 cm. In an aspect, a patient in need thereof is a female patient having a waist circumference between 100 to 250 cm, between 150 to 200 cm, between 100 to 200 cm, or between 150 to 250 cm.
[0142] In an aspect, a patient in need thereof is a patient having high serum triglyceride before receiving MANP in accordance with the present disclosure. In an aspect, high serum triglyceride is identified by serum triglyceride of 150 mg / dL or above. In an aspect, high serum triglyceride may be between 100 to 5000 mg / dL, between 100 to 4000 mg / dL, between 100 to 3000 mg / dL, between 100 to 2000 mg / dL, between 100 to 1000 mg / dL, between 100 to 500 mg / dL, between 100 to 300 mg / dL, or between 100 to 200 mg / dL. In an aspect, high serum triglyceride may be between 200 to 5000 mg / dL, between 300 to 5000 mg / dL, between 500 to 5000 mg / dL, between 1000 to 5000 mg / dL, between 2000 to 5000 mg / dL, between 3000 to 5000 mg / dL, or between 4000 to 5000 mg / dL. In an aspect, high serum triglyceride may be between 200 to 4000 mg / dL, between 300 to 3000 mg / dL, between 500 to 2000 mg / dL, between 1000 to 2000 mg / dL, between 200 to 500 mg / dL, between 300 to 1000 mg / dL, between 500 to 2000 mg / dL, between 1000 to 3000 mg / dL, or between 2000 to 4000 mg / dL. In an aspect, serum triglyceride is measured by a blood test after an overnight fasting.
[0143] In an aspect, a patient in need thereof is a patient having low HDL cholesterol before the receiving MANP in accordance with the present disclosure. In an aspect, low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in a patient who is a male. In an aspect, a patient in need thereof is a male patient having HDL cholesterol between 0.1 to 50 mg / dL, between 0.1 to 40 mg / dL, between 0.1 to 30 mg / dL, between 0.1 to 20 mg / dL, or between 0.1 to 10 mg / dL. In an aspect, a patient in need thereof is a male patient having HDL cholesterol between 10 to 50 mg / dL, between 20 to 50 mg / dL, between 30 to 50 mg / dL, or between 40 to 50 mg / dL. In an aspect, a patient in need thereof is a male patient havingHDL cholesterol between 10 to 40 mg / dL, between 20 to 30 mg / dL, between 10 to 30 mg / dL, or between 20 to 40 mg / dL.
[0144] In an aspect, low HDL cholesterol is identified by HDL cholesterol lower than 50 mg / dL in the patient who is a female. In an aspect, a patient in need thereof is a female patient having HDL cholesterol between 0.1 to 60 mg / dL, between 0. 1 to 50 mg / dL, between 0.1 to 40 mg / dL, between 0.1 to 30 mg / dL, between 0.1 to 20 mg / dL, between 0.1 to 10 mg / dL, between 0. 1 to 5 mg / dL, between 0.1 to 2.5 mg / dL, or between 0. 1 to 1 mg / dL. In an aspect, a patient in need thereof is a female patient having HDL cholesterol between 10 to 60 mg / dL, between 20 to 60 mg / dL, between 30 to 60 mg / dL, between 40 to 60 mg / dL, between 50 to 60 mg / dL. In an aspect, a patient in need thereof is a female patient having HDL cholesterol between 10 to 50 mg / dL, between 20 to 40 mg / dL, between 10 to 30 mg / dL, or between 30 to 50 mg / dL.
[0145] In an aspect, a patient in need thereof is a patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol. In an aspect, HDL cholesterol is measured by a blood test.
[0146] In an aspect, a patient in need thereof is a patient having high fasting plasma glucose measured before receiving MANP in accordance with the present disclosure. In an aspect, high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient. In an aspect, a patient in need thereof is a patient having fasting plasma glucose between 80 to 200 mg / dL, between 80 to 180 mg / dL, between 80 to 160 mg / dL, between 80 to 140 mg / dL, between 80 to 120 mg / dL, or between 80 to 100 mg / dL. In an aspect, a patient in need thereof is a patient having fasting plasma glucose between 100 to 200 mg / dL, between 120 to 200 mg / dL, between 140 to 200 mg / dL, between 160 to 200 mg / dL, or between 180 to 200 mg / dL. In an aspect, a patient in need thereof is a patient having fasting plasma glucose between 100 to 180 mg / dL, between 120 to 160 mg / dL, or between 100 to 140 mg / dL. In an aspect, a patient in need thereof is a patient who is taking drug treatment for elevated blood glucose to decrease blood glucose. In an aspect, fasting plasma glucose is measured by using the Roche Glucose Reagent (Indianapolis, IN) after an overnight fast.
[0147] In as aspect, a patient in need thereof presents hypertension despite the use of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, atleast eight, at least nine, or at least ten anti-hypertensive medications. In an aspect, a patient in need thereof presents hypertension despite the use of one to ten, one to eight, one to six, one to four, one to two, two to ten, four to ten, six to ten, eight to ten, two to eight, four to six, one to three, two to four, three to five, six to eight, seven to nine, or nine to ten antihypertensive medications. In an aspect, an anti-hypertensive medication is selected from the group consisting of diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin 2 receptor blockers (ARBs), calcium channel blockers, beta blockers, renin inhibitors, alpha blockers, alpha-beta blockers, central-acting agents, vasodilators, aldosterone antagonists, and a combination thereof.
[0148] In an aspect, a patient in need thereof does not present any known hypersensitivity or allergy to MANP or its components, carperitide, other natriuretic peptides, or related compounds. In an aspect, a patient in need thereof is not pregnant. In an aspect, a patient in need thereof is not breast-feeding. In an aspect, a patient in need thereof does not have a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries. In an aspect, a patient in need does not have a history of severe allergies. In an aspect, a patient in need thereof is a patient not consuming a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before administration of MANP in accordance to the present disclosure.
[0149] In an aspect, a patient in need thereof does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breastfeeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0150] In an aspect, a patient in need thereof does not have a history (within 2 years before being administered with MANP in accordance with methods of the present disclosure) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction. In an aspect, a patient in need thereof does not have a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering. In an aspect, a patient in need thereof does not havea history of coronary artery disease, or cerebrovascular disease or syncope. In an aspect, a patient in need thereof does not have a history of epilepsy or other seizure disorder. In an aspect, a patient in need thereof does not have a history of organ transplantation. In an aspect, a patient in need thereof does not have a malignant tumor within 5 years before being administered with MANP in accordance with methods of the present disclosure. In an aspect, a malignant tumor refers to any kind of malignant tumor, including, but not limited to bladder cancer, breast cancer, colon and rectal cancer, endometrial cancer, kidney cancer, leukemia, osteosarcoma, chordomas, glioblastoma, astrocytoma, skin cancer.
[0151] After identifying a patient as being in need of a treatment of hypertension with metabolic syndrome, the patient may be treated with a composition as described herein according to a method as described herein. In an aspect, a composition comprising MANP may be administered to a patient in need thereof in any amount, at any frequency, and for any duration effective to achieve a desired outcome (e.g., to reduce BP in the patient, or to prevent or delay further elevation of BP in the patient).
[0152] In an aspect, a method of treating hypertension with metabolic syndrome in a patient in need thereof having a low baseline plasma cGMP comprises increasing plasma cGMP by administering an effective dose of MANP parenterally to the patient.
[0153] In an aspect, a method of treating hypertension with metabolic syndrome in a patient in need thereof having a baseline plasma cGMP lower than 10 pmol / mL comprises administering an effective dose of MANP parenterally to the patient. In an aspect, a method of treating hypertension with metabolic syndrome in a patient in need thereof having a baseline plasma cGMP lower than 8 pmol / mL comprises administering an effective dose of MANP parenterally to the patient.
[0154] In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 2 to 8 pmol / mL from the baseline within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP between 0.1 to 10 pmol / mL, between 0.1 to 8 pmol / mL, between 0.1 to 6 pmol / mL, between 0.1 to 4 pmol / mL, or between 0.1 to 2 pmol / mL from the baseline within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP between 2 to 10 pmol / mL, between 4 to 10 pmol / mL, between 6 to 10 pmol / mL, or between 8 to 10 pmol / mL from baseline within 0.5hour after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP between 2 to 8 pmol / mL, between 4 to 6 pmol / mL, between 2 to 6 pmol / mL, or between 4 to 8 pmol / mL from baseline within 0.5 hour after administering an effective dose of MANP.
[0155] In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 1 to 5 pmol / mL from the baseline within 4 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP between 0.1 to 6 pmol / mL, between 0. 1 to 4 pmol / mL, or between 0.1 to 2 pmol / mL from baseline within 4 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP between 2 to6 pmol / mL, between 4 to 6 pmol / mL, or between 2 to 4 pmol / mL from baseline within 4 hours after administering an effective dose of MANP.
[0156] In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 0. 1 to 10 pmol / mL from baseline within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours,7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 0. 1 to 10 pmol / mL from baseline within between 0.1 to 6 hours, between 0.1 to 5 hours, between 0.1 to 4 hours, between 0.1 to 3 hours, between 0. 1 to 2 hours, or between 0. 1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure increases plasma cGMP in a patient in need thereof by 0. 1 to 10 pmol / mL from baseline within between 1 to 6 hours, between 2 to 6 hours, or between 4 to 6 hours. The time after the administering may be between 1 to 5 hours, between 2 to 4 hours, between 3 to 4 hours, between 0.5 to 2 hours, or between 1 to 3 hours after administering an effective dose of MANP.
[0157] As used herein, “parenteral drug administration” refers to drugs given by routes other than the digestive tract. The term parenteral is usually used for drugs given by injection or infusion. In an aspect, administration by parenteral administration is selected from the group consisting of subcutaneous administration (under the skin), intramuscularadministration (in a muscle), intravenous administration (in a vein), and intrathecal administration (around the spinal cord).
[0158] In an aspect, a method of treating hypertension with metabolic syndrome in a patient in need thereof having a low baseline plasma cGMP comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g, about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0. 1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg) of body mass, although other dosages may also provide beneficial results. In an aspect, parenteral administration is subcutaneous administration. In an aspect, a composition comprising MANP may be administered parenterally (e.g, by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g, about 1 to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about 500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0159] In an aspect, a method of decreasing BP in a patient in need thereof having a low baseline plasma cGMP comprises increasing plasma cGMP compared to the baseline by administering an effective dose of MANP parenterally to the patient. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by 0. 1 to 15% compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by between 0.1 to 20%, between 0.1 to 15%, between 0.1 to 10%, between 0.1 to 5%, between 0.1 to 2.5%, or between 0. 1 to 1% compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by between 5 to 20%, between 10 to 20%, or between 15 to 20% compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by between 5 to 15%, or between 10 to 15% compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP.
[0160] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by 0.1 to 20% from baseline sitting systolic BP within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure decreases sitting systolic BP in a patient in need thereof by 0. 1 to 20% from baseline sitting systolic BP within between 0.1 to 15 hours, between 0.1 to 12 hours, between 0.1 to 9 hours, between 0.1 to 6 hours, or between 0. 1 to 3 hours after administering an effective dose of MANP. In an aspect, In an aspect, a method of the present disclosure decreases sitting systolic BP in a patient in need thereof by 0.1 to 20% from baseline sitting systolic BP within between 3 to 15 hours, between 6 to 15 hours, between 9 to 15 hours, or between 12 to 15 hours after administering an effective dose of MANP. In an aspect, a method of the present disclosure decreases sitting systolic BP in a patient in need thereof by 0.1 to 20% from baseline sitting systolic BP within between 3 to 12 hours, between 6 to 9hours, between 3 to 9 hours, or between 6 to 12 hours after administering an effective dose of MANP.
[0161] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP by 0.1 to 30 mmHg compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases systolic BP by between 0. 1 to 40 mmHg, between 0.1 to 30 mmHg, between 0.1 to 20 mmHg, between 0.1 to 10 mmHg, between 0.1 to 5 mmHg, between 0.1 to 2.5 mmHg, or between 0.1 to 1 mmHg compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases systolic BP by between 10 to 40 mmHg, between 20 to 40 mmHg, or between 30 to 40 mmHg compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases systolic BP by between 10 to 30 mmHg, between 10 to 20 mmHg, between 20 to 30 mmHg, or between 15 to 25 mmHg compared to baseline sitting systolic BP within 12 hours after administering an effective dose of MANP.
[0162] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP in a patient in need thereof by 0. 1 to 40 mmHg from baseline systolic BP within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hours, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP in a patient in need thereof by 0. 1 to 40 mmHg from baseline systolic BP within between 0. 1 to 15 hours, between 0.1 to 12 hours, between 0.1 to 9 hours, between 0.1 to 6 hours, or between 0.1 to 3 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP in a patient in need thereof by 0. 1 to 40 mmHg from baseline systolic BP within between 3 to 15 hours, between 6 to 15 hours, between 9 to 15 hours, or between 12 to 15 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting systolic BP in a patient in need thereof by 0.1 to 40 mmHg frombaseline systolic BP within between 3 to 12 hours, between 6 to 9 hours, between 3 to 9 hours, or between 6 to 12 hours after administering an effective dose of MANP.
[0163] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0. 1 to 15% compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by between 0.1 to 20%, between 0.1 to 15%, or between 0.1 to 10%, between 0.1 to 5%, between 0.1 to 2.5 mmHg, or between 0.1 to 1 mmHg compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by between 5 to 20%, between 10 to 20%, or between 15 to 20% within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by between 5 to 15%, or between 10 to 15% within 6 hours after administering an effective dose of MANP.
[0164] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0.1 to 20% from baseline sitting diastolic BP within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0.1 to 20% from baseline sitting diastolic BP within between 0.1 to 8 hours, between 0.1 to 7 hours, between 0.1 to 6 hours, between 0.1 to 5 hours, between 0.1 to 4 hours, between 0.1 to 3 hours, between 0.1 to 2 hours, or between 0.1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0.1 to 20% from baseline sitting diastolic BP within the time after the administering may be between 1 to 8 hours, between 2 to 8 hours, between 3 to 8 hours, between 4 to 8 hours, between 5 to 8 hours, between 6 to 8 hours, or between 7 to 8 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0.1 to 20% from baseline sitting diastolic BP within the time after the administering may be between 2 to 6 hours, or between 2 to 4 hours after administering an effective dose of MANP.
[0165] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP by 0. 1 to 30 mmHg compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases diastolic BP by between 0.1 to 40 mmHg, between 0.1 to 30 mmHg, between 0.1 to 20 mmHg, between 0.1 to 10 mmHg, between 0.1 to 5 mmHg, between 0.1 to 2.5 mmHg, or between 0.1 to 1 mmHg compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases diastolic BP by between 10 to 40 mmHg, between 20 to 40 mmHg, or between 30 to 40 mmHg compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases diastolic BP by between 10 to 30 mmHg compared to baseline sitting diastolic BP within 6 hours after administering an effective dose of MANP.
[0166] In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP in a patient in need thereof by 0.1 to 40 mmHg from baseline diastolic BP within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP in a patient in need thereof by 0. 1 to 40 mmHg from baseline diastolic BP within between 0.1 to 8 hours, between 0.1 to 7 hours, between 0.1 to 6 hours, between 0.1 to 5 hours, between 0.1 to 4 hours, between 0.1 to 3 hours, between 0.1 to 2 hours, or between 0. 1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP in a patient in need thereof by 0. 1 to 40 mmHg from baseline diastolic BP within between 1 to 8 hours, between 2 to 8 hours, between 3 to 8 hours, between 4 to 8 hours, between 5 to 8 hours, between 6 to 8 hours, or between 7 to 8 hours after administering an effective dose of MANP. In an aspect, a method of decreasing BP in a patient in need thereof decreases sitting diastolic BP in a patient in need thereof by 0.1 to 40 mmHg from baseline diastolic BP within between 2 to 6 hours, or between 2 to 4 hours after administering an effective dose of MANP.
[0167] In an aspect, a method of decreasing BP in a patient in need thereof having a low baseline plasma cGMP comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g., about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0.1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg), although other dosages may also provide beneficial results. In an aspect, a composition comprising MANP may be administered parenterally (e.g., by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g., about 1 to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about 500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0168] In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof having a low baseline plasma cGMP comprises increasing plasma cGMP compared to the baseline by administering an effective dose of MANP parenterally to the patient. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereofincreases plasma ANP-like peptides by 1 to 70 pg / mL compared to baseline plasma ANP-like peptides within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by between 0.1 to 100 pg / mL, between 0.1 to 90 pg / mL, between 0.1 to 80 pg / mL, between 0.1 to 70 pg / mL, between 0.1 to 60 pg / mL, between 0.1 to 50 pg / mL, between 0. 1 to 40 pg / mL, between 0. 1 to 30 pg / mL, between 0.1 to 20 pg / mL, between 0. 1 to 10 pg / mL, between 0.1 to 5 pg / mL, between 0.1 to 2.5 pg / mL, or between 0.1 to 1 pg / mL compared to baseline plasma ANP-like peptides within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by between 10 to 100 pg / mL, between 20 to 100 pg / mL, between 30 to 100 pg / mL, between 40 to 100 pg / mL, between 50 to 100 pg / mL, between 60 to 100 pg / mL, between 70 to 100 pg / mL, between 80 to 100 pg / mL, or between 90 to 100 pg / mL compared to baseline plasma ANP-like peptides within 0.5 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by between 10 to 90 pg / mL, between 20 to 80 pg / mL, between 30 to 70 pg / mL, between 40 to 60 pg / mL, between 10 to 30 pg / mL, between 20 to 40 pg / mL, between 30 to 50 pg / mL, between 40 to 60 pg / mL, between 50 to 70 pg / mL, between 60 to 80 pg / mL, or between 70 to 90 pg / mL compared to baseline plasma ANP-like peptides within 0.5 hour after administering an effective dose of MANP.
[0169] In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to 100 pg / mL from baseline plasma ANP- like peptides within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to 100 pg / mL from baseline plasma ANP-like peptides within between 0.1 to 2 hours, between 0.1 to 1.5 hours, or between 0.1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to100 pg / mL from baseline plasma ANP-like peptides within between 0.5 to 2 hours, between 1 to 2 hours, or between 1.5 to 2 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to 100 pg / mL from baseline plasma ANP-like peptides within between 0.5 to 1.5 hours after administering an effective dose of MANP.
[0170] In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 1 to 40 pg / mL compared to baseline plasma ANP-like peptides within 1 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by between 0.1 to 60 pg / mL, between 0.1 to 50 pg / mL, between 0. 1 to 40 pg / mL, between 0.1 to 30 pg / mL, between 0.1 to 20 pg / mL, or between 0.1 to 10 pg / mL compared to baseline plasma ANP-like peptide within 1 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides may be between 10 to 60 pg / mL, between 20 to 60 pg / mL, between 30 to 60 pg / mL, between 40 to 60 pg / mL, between 50 to 60 pg / mL, between 10 to 30 pg / mL, between 20 to 40 pg / mL, or between 30 to 50 pg / mL compared to baseline plasma ANP-like peptides within 1 hour after administering an effective dose of MANP.
[0171] In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0.1 to 60 pg / mL compared to baseline plasma ANP-like peptides within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to 60 pg / mL compared to baseline plasma ANP-like peptides within between 0.1 to 2 hours, between 0. 1 to 1.5 hours, or between 0. 1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0.1 to 60 pg / mL compared to baseline plasma ANP-like peptides within between 0.5 to 2 hours, between 1 to 2 hours, or between 1.5 to 2 hours after administering an effective doseof MANP. In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof increases plasma ANP-like peptides by 0. 1 to 60 pg / mL compared to baseline plasma ANP-like peptides within between 0.5 to 1.5 hours after administering an effective dose of MANP.
[0172] In an aspect, levels of plasma ANP-like peptides are measured using established ANP radioimmunoassay (RIA) (Mayo Clinic (Rochester, MN) and Phoenix Pharmaceuticals, Mountain View, CA).
[0173] In an aspect, a method of increasing plasma ANP-like peptides in a patient in need thereof having baseline plasma cGMP lower than 10 pmol / mL comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g, about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0. 1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg), although other dosages may also provide beneficial results. In an aspect, a composition comprising MANP may be administered parenterally (e.g, by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g, about 1to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about 500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0174] In an aspect, a method of decreasing plasma glucose in a patient in need thereof comprises administering an effective dose of MANP parenterally to the patient. In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after administering an effective dose of MANP. In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose level by between 0. 1 to 20 mg / mL, between 0.1 to 15 mg / mL, between 0.1 to 10 mg / mL, between 0.1 to 5 mg / mL, or between 0.1 to 1 mg / mL compared to baseline plasma glucose within 4 hours after administering an effective dose of MANP. In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose level by between 5 to 20 mg / mL, between 10 to 20 mg / mL, or between 15 to 20 mg / mL compared to baseline plasma glucose within 4 hours after administering an effective dose of MANP. In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose level by between 5 to 15 mg / mL, between 5 to 10 mg / mL, between 10 to 15 mg / mL, or between 7.5 to 12.5 mg / mL compared to baseline plasma glucose within 4 hours after administering an effective dose of MANP.
[0175] In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose level by 0. 1 to 20 mg / mL compared to baseline plasma glucose within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of decreasing plasma glucose levels in a patient in need thereof decreases plasma glucose level by 0.1 to 20 mg / mL compared to baseline plasma glucose within between 0. 1 to 6 hours, between 0. 1 to 5 hours, between 0. 1 to 4 hours, between 0. 1 to 3 hours, between 0. 1 to 2 hours, or between 0.1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of decreasing plasma glucose levels in a patient in needthereof decreases plasma glucose level by 0. 1 to 20 mg / mL compared to baseline plasma glucose within between 1 to 6 hours, between 2 to 6 hours, between 3 to 6 hours, between 4 to 6 hours, between 5 to 6 hours, between 2 to 4 hours, or between 3 to 5 hours after administering an effective dose of MANP.
[0176] In an aspect, plasma glucose is measured using the Roche Glucose Reagent (Indianapolis, IN) after an overnight fasting.
[0177] In an aspect, a method of decreasing plasma glucose in a patient in need thereof comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g., about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0.1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg), although other dosages may also provide beneficial results. In an aspect, a composition comprising MANP may be administered parenterally (e.g., by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g., about 1 to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0178] In an aspect, a method of increasing insulin sensitivity in a patient in need thereof comprises administering an effective dose of MANP parenterally to the patient. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-insulin sensitivity (HOMA2-S) value by 0.1 to 35% compared to baseline H0MA2- S value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s HOMA2-S value by between 0.1 to 40%, between 0.1 to 30%, between 0.1 to 20%, between 0.1 to 10%, between 0.1 to 5%, between 0.1 to 2.5%, or between 0.1 to 1% compared to baseline H0MA2-S value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-S value by between 10 to 40%, between 20 to 40%, or between 30 to 40% compared to baseline H0MA2-S value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-S value by between 10 to 30%, between 10 to 20%, between 20 to 30%, or between 15 to 25% compared to baseline H0MA2-S value within 4 hours after administering an effective dose of MANP.
[0179] In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-S value by between 0. 1 to 40% compared to baseline H0MA2-S value within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-S value by between 0. 1 to 40% compared to baseline H0MA2-S value within between 0.1 to 6 hours, between 0.1 to 5 hours, between 0.1 to 4 hours, between 0.1 to 3 hours, between 0. 1 to 2 hours, or between 0. 1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof increases the patient’s H0MA2-S value by between 0.1 to 40% compared to baseline H0MA2-S value within between 1 to 6 hours, between 2 to 6hours, between 3 to 6 hours, between 4 to 6 hours, between 5 to 6 hours, between 2 to 5 hours, between 3 to 4 hours, between 1 to 3 hours, between 2 to 4 hours, or between 3 to 5 hours after administering an effective dose of MANP.
[0180] In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2 -insulin resistance (H0MA2-IR) value by 0.1 to 0.6 compared to baseline H0MA2-IR value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0. 1 to 1, between 0. 1 to 0.8, between 0.1 to 0.6, between 0.1 to 0.4, or between 0. 1 to 0.2 compared to baseline H0MA2-IR value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0.2 to 1, between 0.4 to 1, between 0.6 to 1, or between 0.8 to 1 compared to baseline H0MA2-IR value within 4 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0.2 to 0.8, between 0.4 to 0.6, between 0.2 to 0.6, or between 0.4 to 0.8 compared to baseline H0MA2-IR value within 4 hours after administering an effective dose of MANP.
[0181] In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0.1 to 1 compared to baseline H0MA2- IR value within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0.1 to 1 compared to baseline H0MA2-IR value within between 0.1 to 6 hours, between 0.1 to 5 hours, between 0. 1 to 4 hours, between 0. 1 to 3 hours, between 0. 1 to 2 hours, or between 0. 1 to 1 hours after administering an effective dose of MANP. In an aspect, a method of increasing insulin sensitivity in a patient in need thereof decreases the patient’s H0MA2-IR value by between 0.1 to 1 compared to baseline H0MA2-IR value within between 1 to 6 hours, between 2 to 6 hours, between 3 to 6 hours, between 4 to 6 hours, between 5 to 6 hours, between 2 to 5 hours, between 3 to 4 hours,between 1 to 3 hours, between 2 to 4 hours, or between 3 to 5 hours after administering an effective dose of MANP.
[0182] In an aspect, H0MA2-S value and H0MA2-IR value are calculated by the H0MA2 Calculator software released by the Oxford Centre for Diabetes, Endocrinology and Metabolism. See Wallace et al. (2004), Diabetes Care., 1487-1495.
[0183] In an aspect, a method of increasing insulin sensitivity in a patient in need thereof comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g., about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0.1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg), although other dosages may also provide beneficial results. In an aspect, a composition comprising MANP may be administered parenterally (e.g., by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g., about 1 to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0184] In an aspect, a method of increasing plasma NEFA in a patient in need thereof comprises administering an effective dose of MANP parenterally to the patient. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by 1 pM compared to baseline plasma NEFA within 1 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by between 0.01 to 2 pM, between 0.01 to 1.5 pM, between 0.01 to 0.5 pM, between 0.01 to 0.2 pM, or between 0.01 to 0.1 pM compared to baseline plasma NEFA within 1 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA may be between 0. 1 to 2 pM, between 0.2 to 2 pM, between 0.5 to 2 pM, between 1 to 2 pM, or between 1.5 to 2 pM compared to baseline plasma NEFA within 1 hour after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA may be between 0. 1 to 1.5 pM, between 0.2 to 1 pM, between 0.5 to 1 pM, between 0. 1 to 0.5 pM, between 0.2 to 1 pM, or between 0.5 to 1.5 pM compared to baseline plasma NEFA within 1 hour after administering an effective dose of MANP.
[0185] In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by between 0.01 to 2 pM compared to baseline plasma NEFA within 0.1 hours, 0.2 hours, 0.3 hours, 0.4 hours, 0.5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hours, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 12 hours, or 24 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by between 0.01 to 2 pM compared to baseline plasma NEFA within between 0.1 to 2 hours, between 0.1 to 1.5 hours, between 0.1 to 1 hours, or between 0.1 to 0.5 hours after administering an effective dose of MANP. In an aspect, a method of increasing plasma NEFA in a patient in need thereof increases plasma NEFA by between 0.01 to 2 pM compared to baseline plasma NEFA within between 0.5 to 2 hours, between 1 to 2 hours, or between 1.5 to 2 hours after administering an effective dose of MANP. In an aspect, a method ofincreasing plasma NEFA in a patient in need thereof increases plasma NEFA by between 0.01 to 2 pM compared to baseline plasma NEFA within between 0.5 to 1.5 hours, between 0.5 to 1 hours, or between 1 to 1.5 hours after administering an effective dose of MANP.
[0186] In an aspect, plasma NEFA is determined as an index for lipolysis and is measured using the commercial kit (Zem-Bio, Inc., Durham, NC) following manufacturer’s instruction after an overnight fasting.
[0187] In an aspect, a method of increasing plasma NEFA in a patient in need thereof comprises administering an effective dose of MANP parenterally at a dose of about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g., about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0.1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, about 10 ng / polypeptide / kg to about 50 ng polypeptide / kg, about 50 ng polypeptide / kg to about 100 pg polypeptide / kg, about 1 pg polypeptide / kg to about 10 pg polypeptide / kg, about 1 pg polypeptide / kg to about 5 pg polypeptide / kg, about 3 pg polypeptide / kg to about 7 pg polypeptide / kg, about 5 pg polypeptide / kg to about 10 pg polypeptide / kg, about 10 pg polypeptide / kg to about 20 pg polypeptide / kg, or about 20 pg polypeptide / kg to about 100 pg polypeptide / kg), although other dosages may also provide beneficial results. In an aspect, a composition comprising MANP may be administered parenterally (e.g., by injection, such as subcutaneous injection, or by oral ingestion) at a dose of about 0.5 ng polypeptide to about 20 g polypeptide (e.g., about 500 ng polypeptide to about 10 g polypeptide, about 1 pg polypeptide to about 2 g polypeptide, about 5 ng polypeptide to about 4 pg polypeptide, about 150 ng polypeptide to about 2 pg polypeptide, about 0.5 pg / polypeptide to about 10 pg polypeptide, about 2.5 pg polypeptide to about 20 mg polypeptide, about 50 pg polypeptide to about 2 mg polypeptide, about 50 pg polypeptide to about 1 mg polypeptide, about 150 pg polypeptide to about 1.4 mg polypeptide, about 250 pg polypeptide to about 2 mg polypeptide, about 0.5 mg polypeptide to about 4 mg polypeptide, or about 1 mg polypeptide to about 20 mg polypeptide), although other dosages may also provide beneficial results. In an aspect, an MANP may be administered by infusion at a dose of, for example, about 1 pmol / kg / minute to about 500 nmol / kg / minute (e.g., about 1 to 10 pmol / kg / minute, about 10 to 100 pmol / kg / minute, about 100 to 300 pmol / kg / minute, about 250 to 500 pmol / kg / minute, about500 pmol / kg / minute to about 1 nmol / kg / minute, about 1 to 10 nmol / kg / minute, about 10 to 100 nmol / kg / minute, about 100 to 300 nmol / kg / minute, or about 250 to 500 nmol / kg / minute).
[0188] In an aspect, a method of the present disclosure comprises administering an effective dose of MANP once (e.g., by implantation or injection of a depot composition), or more than once (e.g., by repeated injections or oral administrations). When administered more than once, the frequency of administration may range from one or more times a day (e.g., one, two, three, four, or more times a day) to about once every other month (e.g., three to five times a week, about once a week, about twice a month, about once a month, or about once every other month). In an aspect, a method of the present disclosure comprises administering MANP via a first route (e.g., intravenously) for a first period of time, and then may be administered via another route (e.g. , subcutaneously) for a second period of time. In an aspect, a method of the present disclosure comprises administering MANP intravenously to a patient (e.g., a human) at a dose of about 1 pmol / kg / minute to about 500 nmol / kg / minute for 1 hour to 7 days (e.g., 1 to 2 hours, 2 to 4 hours, 4 to 6 hours, 6 to 8 hours, 8 to 12 hours, 12 to 24 hours, 24 to 48 hours, 48 to 36 hours, 3 to 4 days, 4 to 4 days, 4 to 6 days, or 6 to 7 days), and subsequently may be subcutaneously administered to the patient at a dose of about 0.01 ng / kg to about 100 mg / kg, one to three times daily, for 5 to 30 days or more (e.g., 5 to 7 days, 7 to 10 days, 10 to 14 days, 14 to 21 days, 21 to 28 days, 28 to 30 days, or more than 30 days).
[0189] An effective dose of an MANP (or a nucleic acid encoding an MANP) administered to a patient is an amount that is sufficient to alter a selected parameter (e.g. , BP) by at least 10%. In an aspect, an effective dose of an MANP is an amount that reduces BP in a patient identified as having hypertension by at least 10% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 90%, or at least 100%), as compared to the BP in the patient prior to administration of the MANP. In an aspect, an effective dose of an MANP is an amount that reduces BP in a patient identified as having hypertension by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the BP in the patient prior to administration of the MANP.
[0190] In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma cGMP level in a patient by at least 10% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100%), as compared to the plasma cGMP level in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma cGMP level in a patient by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the plasma cGMP level in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma ANP-like peptides by at least 10% (e. g. , at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100%), as compared to the level of plasma ANP-like peptides in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma ANP-like peptides by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the level of plasma ANP-like peptides in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to decrease plasma glucose level by at least 10% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100%), as compared to the plasma glucose level in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to decrease plasma glucose level by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the plasma glucose level in the same patient prior totreatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase insulin sensitivity by at least 10% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100%), as compared to the insulin sensitivity in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase insulin sensitivity by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the insulin sensitivity in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma NEFA by at least 10% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100%), as compared to the plasma NEFA level in the same patient prior to treatment. In an aspect, an effective dose of an MANP is an amount that is sufficient to increase plasma NEFA by 10 to 100%, 20 to 100%, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100%, 10 to 90%, 10 to 80%, 10 to 70%, 10 to 60%, 10 to 50%, 10 to 40%, 10 to 30%, 10 to 20%, 20 to 90%, 30 to 80%, 40 to 60%, 20 to 40%, 30 to 50%, 40 to 60%, 50 to 70%, 60 to 80%, or 70 to 90%, as compared to the plasma NEFA level in the same patient prior to treatment.
[0191] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to treat hypertension with metabolic syndrome while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0192] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to decrease blood pressure while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0193] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to increase plasma ANP-like peptides while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0194] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to decrease plasma glucose levels while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0195] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to increase insulin sensitivity while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold,five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0196] In an aspect, the amount and frequency of MANP administration to a patient may be titrated in order to, for example, identify a dosage that is most effective to increase plasma NEFA while having the least amount of adverse effects. If a patient fails to respond to a particular amount, then the amount may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments in the dosage and / or frequency of administration may be made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0197] In an aspect, a frequency of administration may be any frequency that reduces a symptom of, for example, cardiovascular or cardiorenal disease within a patient, without producing significant toxicity in the patient. In an aspect, the frequency of administration may be from about four times a day to about once every 3 months, or from about twice a day to about once every other month, or from about once a day to about once a month, or from about once every other day to about once a week. In addition, the frequency of administration may remain constant or may be variable during the duration of treatment. As with the effective dose, various factors may influence the actual frequency of administration used for a particular application. In an aspect, the effective dose, duration of treatment, route of administration, and severity of renal condition may require an increase or decrease in administration frequency.
[0198] An effective duration of administration may be any duration that reduces hypertension or a symptom of metabolic syndrome within a patient without producing significant toxicity in the patient. In an aspect, an effective duration of administration may be any duration that decreases blood pressure without producing significant toxicity in the patient. In an aspect, an effective duration of administration may be any duration that increases plasma ANP-like peptides without producing significant toxicity in the patient. Inan aspect, an effective duration of administration may be any duration that decreases plasma glucose level without producing significant toxicity in the patient. In an aspect, an effective duration of administration may be any duration that increases insulin sensitivity without producing significant toxicity in the patient. In an aspect, an effective duration of administration may be any duration that increases plasma NEFA without producing significant toxicity in the patient. The effective duration may vary from one to several days, to several weeks, months, or years. In general, the effective duration may range in duration from several days to several months. In an aspect, an effective duration may range from about 1 to 2 weeks to about 36 months, or even longer. In an aspect, treatment may last throughout an individual patient’s lifetime. Multiple factors may influence the actual effective duration used for a particular treatment regimen. In an aspect, an effective duration may vary with the frequency of administration, amount administered, route of administration, and severity of a condition.
[0199] After administering an MANP as described herein to a patient, the patient may be monitored to determine whether or not the disorder has improved. In an aspect, the patient may be monitored for several hours, for several days, for several months, or for several years after administering an MANP as described herein. In an aspect, patient characteristics that may be monitored comprise systolic BP, diastolic BP, plasma cGMP, plasma ANP-like peptides, plasma glucose level, insulin sensitivity, and plasma NEFA.
[0200] In an aspect, a patient may be assessed after treatment to determine whether or not one or more symptoms of the patient’s disorder have been reduced (e.g., whether the patient’s BP has decreased). If a patient fails to respond to particular doses of an MANP, then the amounts of one or both may be increased by, for example, two-fold, three-fold, five-fold, or ten-fold. After receiving this higher concentration, the patient may be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments made accordingly. The effective dose may remain constant or may be adjusted as a sliding scale or variable dose depending on the patient’s response to treatment.
[0201] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.EXAMPLESEXAMPLE 1: STUDY DESIGN AND PATIENTS OF THE STUDY INVESTIGATING EFFECTS OF MANP IN SUBJECTS WITH HYPERTENSION WITH METABOLIC SYNDROMEStudy Design
[0202] A study consists of a screening visit (defined as 1st visit on day 0, see also details below), one 7-day period of diet and fluid restriction, and drug treatment as shown in FIG. 2. A total of 22 patients with hypertension and metabolic syndrome are enrolled. On day 1 all subjects are initiated on a moderate sodium (3.0 g / day) diet with restriction on fluid intake at 2.5 L / day, which is continued for 7 days until dismissal from the clinic. On day 5, subjects are admitted to the clinic (2nd visit) and sodium urinary content is assessed in order to establish adherence to the sodium diet. On day 6, 17 subjects receive a single subcutaneous injection of MANP (2.5 pg / kg subcutaneous) and 5 subjects receive injection of a placebo (0.9% saline). All patients are under observation for the 24 hours following MANP or placebo administration. BP and heart rate are measured, together with the collection of blood samples, at baseline and at several intervals after MANP or placebo administration. On day 7, upon completion of the 24-hour observation, subjects undergo physical examination and are dismissed from the clinic. Subjects are withdrawn from their anti-hypertensive medications only on day 6 and 7 until dismissal from the clinic. Seven days after MANP / placebo injection, laboratory tests are performed and assessed. Subjects are contacted by phone to review laboratory tests results and assess the onset of any potential side effect following the MANP / placebo administration.Patients
[0203] Hypertension is defined as 140 mmHg < systolic BP < 180 mmHg or 90 mmHg < diastolic BP < 100 mmHg while sitting, despite the use of at least one anti -hypertensive medication. Metabolic syndrome is defined in accordance with the criteria of the National Cholesterol Education Program (NCEP) Adult Treatment Panel III (ATP III). Specifically, metabolic syndrome is defined as the presence of any two of the following traits:1. Abdominal obesity, defined as a waist circumference in men > 102 cm (40 inch) and in women > 88 cm (35 inch);2. Serum triglycerides > 150 mg / dL (1.7 mmol / L);3. Serum high-density lipoprotein (HDL) cholesterol < 40 mg / dL (1 mmol / L) in men and < 50 mg / dL (1.3 mmol / L) in women or drug treatment for low HDL cholesterol; and4. Fasting plasma glucose > 100 mg / dL (5.6 mmol / L) or drug treatment for elevated blood glucose.
[0204] The detailed enrollment inclusion criteria are as follows:1. Hypertension of 140 mmHg < systolic BP < 180 mmHg or 90 mmHg < diastolic BP < 100 mmHg while sitting, despite anti -hypertensive medical therapy;2. Metabolic Syndrome with the presence of any two of the following traits: a) Abdominal obesity, with a waist circumference in men > 102 cm (40 inch) and in women > 88 cm (35 inch); b) Serum triglycerides > 150 mg / dL (1.7 mmol / L); c) Serum HDL cholesterol < 40 mg / dL (1 mm / L) in men and < 50 mg / dL (1.3 mmol / L) in women or drug treatment for low HDL cholesterol; and d) Fasting plasma glucose > 100 mg / dL (5.6 mmol / L) or drug treatment for elevated blood glucose;3. Between the ages of 18 and 75 years;4. Use of antihypertensive medications at a stable dose for 30 days preceding the screening visit; and5. Use of statins, ezetimibe, or combinations, at a stable dose for 60 days preceding the screening visit.
[0205] The detailed enrollment exclusion criteria are as follows:1. Known hypersensitivity or allergy to MANP or its components, carperitide, other natriuretic peptides, or related compounds;2. Women who are pregnant or breast-feeding;3. Having received any investigational drug or device within 30 days prior to entry into the study;4. A history (within the last 2 years) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction;5. A history of difficulty with donating blood, or donated blood or blood products within 45 days prior to enrollment;6. Having a clinically significant new illness, in the opinion of the investigator, within 1 month before screening;7. History of severe allergies;8. History of coronary artery disease, or cerebrovascular disease or syncope;9. History of epilepsy or other seizure disorder;10. History of organ transplantation;11. Malignant tumor within 5 years of the screening visit;12. Having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and13. Consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours of receiving MANP.
[0206] Subjects who meet the enrollment criteria based on their electronic clinical records are invited via mail with a letter describing the study and inquiring as to their willingness to participate. At a screening visit, medical history is collected, a physical examination is performed, and a history of laboratory examinations is screened. Electrocardiogram, BP, and heart rate are recorded, and screening laboratory tests are performed. Verification of BP enrollment criteria is obtained by the average of 3 sitting BP measurements.Randomization to Double-Blind Treatment
[0207] Random treatment assignments are made by the use of a randomization code that is sent directly from statisticians to the Mayo Research Pharmacy. The study pharmacist, who is blind to data analysis, assists in the preparation of MANP and a placebo. A total of 22 patients are randomized to receive either a placebo or MANP for a single subcutaneous injection.Statistical Methods
[0208] Data for patients are summarized at baseline and after MANP or placebo injection. Distributions of data are examined for normality, and no data are excluded for analyses. All adverse events are summarized as count (percentage). Continuous variables are presented as mean ± standard deviation or median (interquartile range (IQR)). For pharmacokinetics and pharmacodynamics data, repeated measures analysis of variance (ANOVA) is used tocompare the main group effects between placebo and MANP, and group differences at specific time points are evaluated. Comparison to baseline levels within a single group are also conducted. Multiple comparison correction is done using Scheffe’s method. Pharmacokinetic and pharmacodynamic analyses are conducted using an R package (PKNCA).
[0209] The Cmax of plasma ANP-like peptides and plasma cGMP are determined by the greatest values observed during the 24-hour period post treatment. The mean change in systolic BP and diastolic BP are determined by the average change in systolic BP and diastolic BP occurring during the 24-hour period post treatment in comparison with baseline values. Analysis of these MANP-responsive indices between gender is conducted using unpaired t-test assuming unequal variance. Spearman rank method is leveraged to evaluate the correlations between these MANP-responsive indices and continuous baseline variables. All statistical analyses are performed with SAS version 9.4 and Graphpad Prism 9, and a 2- sided P < 0.05 is considered statistically significant.EXAMPLE 2: SAFETY AND TOLERABILITY OF MANP
[0210] Subjects recruited in accordance with Example 1 are followed-for up to 7 days post MANP / placebo injection. Throughout the study, safety indices are examined for each subject, including adverse events, vital signs measurements, electrocardiograms, clinical laboratory results, and other safety variables.
[0211] Stopping rules are defined as when two subjects meet one or both of the following criteria:1. The occurrence of clinically significant hypotension, defined as a decrease from baseline in clinical systolic BP > 30 mmHg, or a decrease in sitting systolic BP to < 90 mmHg, or light headedness or dizziness or visual symptoms for 5 minutes with repeated BP measurement; or2. Any other safety results or adverse experiences that, in the opinion of the investigator, would raise concerns about the safety or tolerability of the administered dose.
[0212] The clinical characteristics, overall and by treatment group, are summarized in Table 3. Among them, 17 are randomized to MANP and 5 to placebo. In the entire study cohort, mean systolic BP levels are 149 ± 8 mmHg and mean diastolic BP levels are 83 ± 11 mmHg at baseline, though all of them are at least on one anti-hypertension medication. Meanvalues of BMI and waist circumference are 36 ± 5 kg / m2 and 113 ± 9 cm, respectively, showing that the cohort was characterized by both general and abdominal obesity.Table 3: Baseline Characteristics of 22 Subjects with Hypertension with Metabolic Syndrome* eGFR = estimated glomerular filtration rate; BUN = blood urea nitrogen; NT-proBNP = N- terminal prohormone B-type natriuretic peptide; ACEI = angiotensin converting enzyme inhibitor; ARB = angiotensin receptor blocker; CCB = calcium channel blocker.
[0213] As shown in Table 4, during the 24-hour period following MANP / placebo subcutaneous injection, no significant changes in electrocardiographic findings are observed, nor did drug-related, clinically relevant changes in safety laboratory parameters occur. All 22 patients complete the treatment, and none of the stopping criteria are met. Table 5 summarizes all adverse events (AEs) associated with the treatment during the 7-day followup period following MANP / placebo injection. No serious AEs are observed, and orthostatichypotension and vasovagal syncope are observed in only two different patients receiving MANP.Table 4. Safety Laboratory Parameters at 24 Hours Post MANP AdministrationTable 5. Adverse EventsEXAMPLE 3. PLASMA ANP-LIKE PEPTIDES AND CGMP IN RESPONSE TO ADMINISTERING MANP
[0214] To measure plasma ANP-like peptides and cGMP in the subjects of Example 1, blood is drawn into EDTA tubes and centrifuged at 4 °C and 2,500 rpm for 10 minutes, 1 mL plasma is then aliquoted and stored at -80 °C until assayed. The assay detects both ANP and MANP which are defined as ANP-like peptides throughout these Examples. The crossreactivity of this assay is < 1% with NT-proANP, BNP, C-type natriuretic peptide (CNP), endothelin, and adrenomedullin. Plasma cGMP is measured with a commercial ELISA kit (Enzo Life Sciences, Farmingdale, NY) following the manufacturer’s instructions. Both plasma ANP-like peptides and cGMP are measured in samples collected at baseline, 0.5, 1, 2, 4, 6, 12, and 24 hours post MANP or placebo administration. Cmax represents the highest concentration detected in the plasma during the 24-hour follow-up post MANP administration. Tmax represents the time it takes to reach Cmax during the 24-hour follow-up post MANP administration.
[0215] As shown in Table 6 and FIG. 3, in patients receiving MANP, a rapid and significant increase in plasma ANP-like peptides occurs 30 minutes after injection (increase from baseline: 48.9 ± 19.5 pg / mL, P = 0.03), and elevated levels of plasma ANP-likepeptides persists at 1 hour post-injection (increase from baseline: 26.4 ± 12.8 pg / mL, P = 0.06). Meanwhile, a concurrent and significant elevation of plasma cGMP is also observed in the MANP group at 30 minutes (increase from baseline: 4.8 ± 2.0 pmol / mL, P = 0.02) and 1 hour (increase from baseline: 2.9 ± 1.3 pmol / mL, P = 0.03) after administration; a trend of increase persists until almost 4 hours post injection. No significant changes in plasma ANP- like peptides or cGMP levels occur in the placebo group when compared to baseline.Table 6. Pharmacokinetics and Pharmacodynamics Indices of MANP in Subjects with Hypertension and Metabolic SyndromeEXAMPLE 4. SITTING BP IN RESPONSE TO ADMINISTERING MANP
[0216] To measure BP and heart rate in the subjects of Example 1, on the day in which the study drug (MANP or placebo) is administered, BP and heart rate are monitored continuously. Sitting BP and heart rate are recorded before MANP or placebo injection and at 0.5, 1, 2, 4, 6, 12 and 24 hours after administration of MANP or placebo.
[0217] As shown in FIG. 4, in the MANP group, sitting systolic BP is reduced compared to baseline with the greatest reduction occurring at 6 hours post injection (change from baseline: -5.7 ± 2.9 mmHg, P = 0.06). At 12 hours post MANP dosing, systolic BP remains lower than baseline. In contrast, no reduction of systolic BP is observed in the placebo group. Sitting diastolic BP tends to be lower than baseline at 6 hours after MANP administration (change from baseline: -2.2 ± 1.2 mmHg, P = 0.09). A slight and not statistically significant increase in heart rate is observed in both groups at 6 hours post injection and thereafter. There is no difference in heart rate between the MANP group and the placebo group at any time point.EXAMPLE 5. INDIVIDUAL RESPONSE TO MANP
[0218] MANP response in the subjects of Example 1 is evaluated by (1) Cmax of plasma ANP-like peptides, (2) Cmax of plasma cGMP, (3) mean change in systolic BP, and (4) meanchange in diastolic BP, during the 24-hour follow-up period post MANP injection. The results are shown in Table 7.
[0219] While an increase in plasma ANP-like peptides is observed in all 17 patients, the baseline ANP level positively associates with Cmax of plasma ANP-like peptides (p = 0.53, P = 0.03) after MANP administration. Furthermore, Cmax of plasma ANP-like peptides positively associates with waist circumference (p = 0.51, P = 0.04), but not BMI (p = 0.28, P = 0.28). As shown in FIG. 6A and FIG. 7A, age, gender, and baseline cGMP have no correlation with Cmax of plasma ANP-like peptides. Meanwhile, among these 17 patients, only 2 patients are found with no enhancement in circulating levels of cGMP at any measured timepoint. As shown in FIG. 6B and FIG. 7B, Cmax of plasma cGMP has no correlation with age, gender, BMI, waist circumference, baseline plasma ANP, and baseline plasma cGMP. Each circle represents one subject with solid circles indicating male and empty circles indicating female.
[0220] The reduction in systolic BP is observed in all patients and the reduction in diastolic BP are observed in 15 out of 17 patients who received MANP. The mean changes in systolic BP and diastolic BP are -3.4 (IQR: -8.0 - -3.0) mmHg and -2.4 (IQR: -3.3 - 0.7) mmHg, respectively. As shown in FIG. 6C and FIG. 6D, the mean change in systolic BP is more prominent in male than in female (P = 0.008), while the mean change in diastolic BP is similar between the two genders (P = 0.25). As shown in FIG. 5A and FIG. 5B, the mean systolic BP change positively associates baseline plasma cGMP, according to which those patients with lower baseline plasma cGMP levels have greater reduction in mean systolic BP over a 24-hour period after MANP injection (p = 0.66, P = 0.005). Each circle represents one subject with solid circles indicating male and empty circles indicating female. This significant association is further validated by repeating the same analysis using median BP changes as shown in Table 8 (Baseline cGMP vs. Median systolic BP change: p = 0.73, P = 0.0008) or maximal BP changes as shown in Table 9 (Baseline cGMP vs. Maximal systolic BP change: p = 0.59, P = 0.01). For each subject, median BP (systolic or diastolic) change is defined as the median value of BP change among 0.5, 1, 2, 4, 6, 12, and 24 hours post MANP administration. For each subject, maximal BP (systolic or diastolic) change is defined as the most extreme value of BP change among 0.5, 1, 2, 4, 6, 12, and 24 hours post MANP administration. The mean diastolic BP change appears to not be affected by baseline plasmaANP, baseline plasma cGMP, age, or waist circumference, and has a weak trend for a negative association with BMI (p = -0.44, P = 0.08).Table 7. Test and Baseline Features in MANP GroupTable 8. Correlations between Baseline Features and Median BP Change in MANP GroupTable 9. Correlations between Baseline Features and Maximal BP Changes in MANP GroupEXAMPLE 6. METABOLIC EFFECTS OF MANP
[0221] To measure plasma metabolic parameters, following an overnight fast, plasma metabolites including glucose, insulin, NEFA, glycerol, triglycerides, and adiponectin aremeasured at baseline, 0.5, 1, 2, and 4 hours after MANP or placebo administration while subjects continued fasting.
[0222] Plasma glucose is measured using the Roche Glucose Reagent (Indianapolis, IN). Plasma insulin is measured with the Roche Insulin Assay (Indianapolis, IN), which is a 2-site immunometric assay using electrochemiluminescence immunoassay “ELCIA” detection. Plasma NEFA and glycerol are determined as indices for lipolysis and are measured using the commercial kit (Zem-Bio, Inc., Durham, NC) following the manufacturer’s instructions. Plasma triglycerides are measured by an automated enzymatic method using Roche Triglyceride Reagent (Indianapolis, IN), as this method is referenced by the Centers for Disease Control and Prevention’s (CDC) standardized method performed in the Cardiovascular Risk Assessment Laboratory. Plasma adiponectin is measured using a commercial kit (Millipore Sigma, Burlington, MA) following the manufacturer’s protocol.
[0223] As shown in Table 10, plasma glucose levels do not alter significantly in the placebo group, whereas we observe a trend for a reduction in plasma glucose levels at 1 hour after MANP administration (change from baseline: -3.1 ± 1.5 mg / mL, P = 0.06) and, importantly, plasma glucose levels significantly decrease at both 2 hours (change from baseline: -4.7 ± 2.1 mg / mL, P = 0.04) and 4 hours (change from baseline: -13.1 ± 3.9 mg / mL, P = 0.003) post MANP administration. In the placebo group, plasma insulin increases at 1 hour and 2 hours post injection, whereas levels of plasma insulin remain stable in MANP group. The variation in insulin levels of the MANP versus placebo group reaches statistical significance at both 1 hour (P = 0.02) and 2 hours (P = 0.03) post injection. We also observe a trend of increase in plasma NEFA in the MANP group, and the increase reaches statistical significance at 1 hour post MANP administration (P = 0.01). The levels of plasma glycerol, triglycerides, and adiponectin have no significant changes during the first 4 hours post MANP injection.
[0224] As shown in Table 11, H0MA2 values are calculated, as indirect and surrogate indices, for the first 4 hours post injection. Before treatment, there is no difference in H0MA2 insulin sensitivity (HOMA2-S) values (P = 0.99) and H0MA2 insulin resistance (H0MA2-IR) values (P = 0.36) between the placebo and MANP groups. From baseline to 4 hours post-injection, there is an overall increase in HOMA2-S values in the MANP group, but not placebo group as shown in FIG. 8A [median change from baseline: 13.7% (IQR:4.2%, 32.7%) in MANP group; median change from baseline: -12.4% (IQR: -30.6%, 2.0%) in placebo group] . In line with this, there is also a reduction in H0MA2-IR values in MANP group, but not placebo group as shown in FIG. 8B [median change from baseline: -0.485 (IQR: -0.682, -0.148) in MANP group; median change from baseline: 0.485 (IQR: -0.148, 1.022) in placebo group] .Table 10. Plasma Levels of Metabolites Before and After MANP / PlaceboAdministrationTable 11. HOMA2 Indices Before and After MANP / placebo AdministrationOTHER EMBODIMENTS
[0225] It is to be understood that, while the present disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
[0226] Embodiment 1. A method of treating hypertension with metabolic syndrome in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising, consisting essentially of, or consisting of increasing plasma cGMP compared to the baseline by administering an effective dose of alternatively- spliced atrial natriuretic peptides (MANP) to the patient.
[0227] Embodiment 2. The method of Embodiment 1, where the baseline plasma cGMP is lower than 8 pmol / mL.
[0228] Embodiment 3. The method of Embodiment 1 or 2, where the increasing is increasing the plasma cGMP by 2 to 8 pmol / mL from the baseline within 0.5 hour after the administering.
[0229] Embodiment 4. The method of Embodiment 1 or 2, where the increasing is increasing the plasma cGMP by 1 to 5 pmol / mL from the baseline within 0.5 to 4 hours after the administering.
[0230] Embodiment 5. The method of any one of Embodiments 1 to 4, where the MANP is administered subcutaneously.
[0231] Embodiment 6. The method of Embodiment 5, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0232] Embodiment 7. The method of Embodiment 6, where the effective dose is 2.5 P / kg-
[0233] Embodiment 8. The method of Embodiment 5, where the effective dose is from 6.5 pg to 750 pg.
[0234] Embodiment 9. The method of Embodiment 8, where the effective dose is from 162.5 ig to 375 pig.
[0235] Embodiment 10. The method of any one of Embodiments 1 to 4, where the MANP is administered intravenously.
[0236] Embodiment 11. The method of Embodiment 10, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0237] Embodiment 12. The method of any one of Embodiments 1 to 4, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0238] Embodiment 13. The method of Embodiment 12, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0. 1 pg / kg to 5 pg / kg.
[0239] Embodiment 14. The method of Embodiment 13, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0240] Embodiment 15. The method of Embodiment 12, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0241] Embodiment 16. The method of Embodiment 15, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
[0242] Embodiment 17. The method of any one of Embodiments 1 to 16, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0243] Embodiment 18. The method of any one of Embodiments 1 to 17, where the patient has a BMI higher than 30 kg / m2.
[0244] Embodiment 19. The method of any one of Embodiments 1 to 18, where the patient has a BMI higher than 35 kg / m2.
[0245] Embodiment 20. The method of any one of Embodiments 1 to 19, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0246] Embodiment 21. The method of Embodiment 20, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0247] Embodiment 22. The method of Embodiment 20 or 21, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0248] Embodiment 23. The method of any one of Embodiments 20 to 22, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0249] Embodiment 24. The method of any one of Embodiments 20 to 22, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0250] Embodiment 25. The method of any one of Embodiments 20 to 24, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0251] Embodiment 26. The method of any one of Embodiments 20 to 24, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0252] Embodiment 27. The method of any one of Embodiments 1 to 26, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0253] Embodiment 28. The method of any one of Embodiments 1 to 27, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0254] Embodiment 29. The method of any one of Embodiments 1 to 28, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries;consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering; having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering; having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0255] Embodiment 30. The method of any one of Embodiments 1 to 29, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0256] Embodiment 31. The method of any one of Embodiments 1 to 30, where sitting systolic blood pressure of the patient decreases by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0257] Embodiment 32. The method of any one of Embodiments 1 to 31, where sitting diastolic blood pressure of the patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0258] Embodiment 33. The method of any one of Embodiments 1 to 32, where plasma glucose of the patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0259] Embodiment 34. The method of any one of Embodiments 1 to 33, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
[0260] Embodiment 35. A method of decreasing blood pressure in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising, consisting essentially of, or consisting of increasing plasma cGMP compared to the baseline by administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to the patient.
[0261] Embodiment 36. The method of Embodiment 35, where the baseline plasma cGMP is lower than 8 pmol / mL.
[0262] Embodiment 37. The method of Embodiment 35 or 36, where the increasing is increasing the plasma cGMP by 2 to 8 pmol / mL from the baseline within 0.5 hour after the administering.
[0263] Embodiment 38. The method of Embodiment 35 or 36, where the increasing is increasing the plasma cGMP by 1 to 5 pmol / mL from the baseline within 0.5 to 4 hours after the administering.
[0264] Embodiment 39. The method of any one of Embodiments 35 to 38, where the decreasing is decreasing sitting systolic blood pressure of the patient by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0265] Embodiment 40. The method of any one of Embodiments 35 to 38, where the decreasing is decreasing sitting diastolic blood pressure of the patient by 0. 1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0266] Embodiment 41. The method of any one of Embodiments 35 to 40, where the MANP is administered subcutaneously.
[0267] Embodiment 42. The method of Embodiment 41, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0268] Embodiment 43. The method of Embodiment 42, where the effective dose is 2.5 lig / kg-
[0269] Embodiment 44. The method of Embodiment 41, where the effective dose is from6.5 ig to 750 pig.
[0270] Embodiment 45. The method of Embodiment 44, where the effective dose is from162.5 pig to 375 pig.
[0271] Embodiment 46. The method of any one of Embodiments 35 to 40, where the MANP is administered intravenously.
[0272] Embodiment 47. The method of Embodiment 46, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0273] Embodiment 48. The method of any one of Embodiments 35 to 40, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0274] Embodiment 49. The method of Embodiment 48, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0. 1 pg / kg to 5 pg / kg.
[0275] Embodiment 50. The method of Embodiment 49, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0276] Embodiment 51. The method of Embodiment 48, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0277] Embodiment 52. The method of Embodiment 51, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
[0278] Embodiment 53. The method of any one of Embodiments 35 to 52, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0279] Embodiment 54. The method of any one of Embodiments 35 to 53, where the patient has a BMI higher than 30 kg / m2.
[0280] Embodiment 55. The method of any one of Embodiments 35 to 54, where the patient has a BMI higher than 35 kg / m2.
[0281] Embodiment 56. The method of any one of Embodiments 35 to 55, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0282] Embodiment 57. The method of any one of Embodiments 35 to 56, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0283] Embodiment 58. The method of any one of Embodiments 35 to 57, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0284] Embodiment 59. The method of Embodiment 58, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0285] Embodiment 60. The method of Embodiment 58 or 59, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0286] Embodiment 61. The method of any one of Embodiments 58 to 60, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0287] Embodiment 62. The method of any one of Embodiments 58 to 60, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0288] Embodiment 63. The method of any one of Embodiments 58 to 62, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0289] Embodiment 64. The method of any one of Embodiments 58 to 62, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0290] Embodiment 65. The method of any one of Embodiments 35 to 64, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering; having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering; having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0291] Embodiment 66. The method of any one of Embodiments 35 to 65, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; andconsumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0292] Embodiment 67. The method of any one of Embodiments 35 to 66, where plasma glucose of the patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0293] Embodiment 68. The method of any one of Embodiments 35 to 67, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
[0294] Embodiment 69. A method of increasing plasma atrial natriuretic peptide (ANP)- like peptides in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising, consisting essentially of, or consisting of increasing plasma cGMP compared to the baseline by administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to the patient.
[0295] Embodiment 70. The method of Embodiment 69, where the baseline plasma cGMP is lower than 8 pmol / mL.
[0296] Embodiment 71. The method of Embodiment 69 or 70, where the increasing plasma cGMP is increasing the plasma cGMP by 2 to 8 pmol / mL from the baseline within 0.5 hour after the administering.
[0297] Embodiment 72. The method of Embodiment 69 or 70, where the increasing plasma cGMP is increasing the plasma cGMP by 1 to 5 pmol / mL from the baseline within 0.5 to 4 hours after the administering.
[0298] Embodiment 73. The method of any one of Embodiments 69 to 72, where the increasing ANP-like peptides is increasing the ANP-like peptides by 1 to 70 pg / mL from baseline ANP-like peptide within 0.5 hour after the administering.
[0299] Embodiment 74. The method of any one of Embodiments 69 to 72, where the increasing ANP-like peptides is increasing the ANP-like peptides by 1 to 40 pg / mL from baseline ANP-like peptides within 1 hour after the administering.
[0300] Embodiment 75. The method of any one of Embodiments 69 to 74, where the MANP is administered subcutaneously.
[0301] Embodiment 76. The method of Embodiment 75, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0302] Embodiment 77. The method of Embodiment 76, where the effective dose is 2.5 lig / kg-
[0303] Embodiment 78. The method of Embodiment 75, where the effective dose is from6.5 ig to 750 pig.
[0304] Embodiment 79. The method of Embodiment 78, where the effective dose is from162.5 pig to 375 pig.
[0305] Embodiment 80. The method of any one of Embodiments 69 to 74, where the MANP is administered intravenously.
[0306] Embodiment 81. The method of Embodiment 80, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0307] Embodiment 82. The method of any one of Embodiments 69 to 74, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0308] Embodiment 83. The method of Embodiment 82, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0. 1 pg / kg to 5 pg / kg.
[0309] Embodiment 84. The method of Embodiment 83, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0310] Embodiment 85. The method of Embodiment 82, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0311] Embodiment 86. The method of Embodiment 85, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
[0312] Embodiment 87. The method of any one of Embodiments 69 to 86, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0313] Embodiment 88. The method of any one of Embodiments 69 to 87, where the patient has a BMI higher than 30 kg / m2.
[0314] Embodiment 89. The method of any one of Embodiments 69 to 88, where the patient has a BMI higher than 35 kg / m2.
[0315] Embodiment 90. The method of any one of Embodiments 69 to 89, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0316] Embodiment 91. The method of any one of Embodiments 69 to 90, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0317] Embodiment 92. The method of any one of Embodiments 69 to 91, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0318] Embodiment 93. The method of Embodiment 92, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0319] Embodiment 94. The method of Embodiment 92 or 93, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0320] Embodiment 95. The method of any one of Embodiments 92 to 94, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0321] Embodiment 96. The method of any one of Embodiments 92 to 94, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0322] Embodiment 97. The method of any one of Embodiments 92 to 96, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0323] Embodiment 98. The method of any one of Embodiments 92 to 96, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0324] Embodiment 99. The method of any one of Embodiments 69 to 98, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering; having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering; having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0325] Embodiment 100. The method of any one of Embodiments 69 to 99, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; andconsumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0326] Embodiment 101. The method of any one of Embodiments 69 to 100, where sitting systolic blood pressure of the patient decreases by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0327] Embodiment 102. The method of any one of Embodiments 69 to 101, where sitting diastolic blood pressure of the patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0328] Embodiment 103. The method of any one of Embodiments 69 to 102, where plasma glucose of the patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0329] Embodiment 104. The method of any one of Embodiments 69 to 103, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
[0330] Embodiment 105. A method of decreasing the plasma glucose level in a patient in need thereof, comprising, consisting essentially of, or consisting of administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to the patient.
[0331] Embodiment 106. The method of Embodiment 105, where the decreasing is decreasing the plasma glucose level by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0332] Embodiment 107. The method of Embodiment 105 or 106, where the MANP is administered subcutaneously.
[0333] Embodiment 108. The method of Embodiment 107, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0334] Embodiment 109. The method of Embodiment 108, where the effective dose is 2.5Pg / kg-
[0335] Embodiment 110. The method of Embodiment 107, where the effective dose is from 6.5 pg to 750 pg.
[0336] Embodiment 111. The method of Embodiment 110, where the effective dose is from 162.5 pg to 375 pg.
[0337] Embodiment 112. The method of Embodiment 105 or 106, where the MANP is administered intravenously.
[0338] Embodiment 113. The method of Embodiment 112, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0339] Embodiment 114. The method of Embodiment 105 or 106, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0340] Embodiment 115. The method of Embodiment 114, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
[0341] Embodiment 116. The method of Embodiment 115, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0342] Embodiment 117. The method of Embodiment 114, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0343] Embodiment 118. The method of Embodiment 117, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
[0344] Embodiment 119. The method of any one of Embodiments 105 to 118, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0345] Embodiment 120. The method of any one of Embodiments 105 to 119, where the patient has a BMI higher than 30 kg / m2.
[0346] Embodiment 121. The method of any one of Embodiments 105 to 120, where the patient has a BMI higher than 35 kg / m2.
[0347] Embodiment 122. The method of any one of Embodiments 105 to 121, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0348] Embodiment 123. The method of any one of Embodiments 105 to 122, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0349] Embodiment 124. The method of any one of Embodiments 105 to 123, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0350] Embodiment 125. The method of Embodiment 124, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0351] Embodiment 126. The method of Embodiment 124 or 125, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0352] Embodiment 127. The method of any one of Embodiments 124 to 126, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0353] Embodiment 128. The method of any one of Embodiments 124 to 126, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0354] Embodiment 129. The method of any one of Embodiments 124 to 128, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0355] Embodiment 130. The method of any one of Embodiments 124 to 128, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0356] Embodiment 131. The method of any one of Embodiments 105 to 130, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering;having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering; having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0357] Embodiment 132. The method of any one of Embodiments 105 to 131, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0358] Embodiment 133. The method of any one of Embodiments 105 to 131, where sitting systolic blood pressure of the patient decreases by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0359] Embodiment 134. The method of any one of Embodiments 105 to 132, where sitting diastolic blood pressure of the patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0360] Embodiment 135. The method of any one of Embodiments 105 to 133, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
[0361] Embodiment 136. A method of increasing insulin sensitivity in a patient in need thereof, comprising, consisting essentially of, or consisting of administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to the patient.
[0362] Embodiment 137. The method of Embodiment 136, where the increasing the insulin sensitivity is increasing the patient’s updated Homeostasis Model Assessment model insulin sensitivity (HOMA2-S) value by 0.1 to 35% compared to baseline HOMA2-S value within 4 hours after the administering.
[0363] Embodiment 138. The method of Embodiment 136, where the increasing the insulin sensitivity is decreasing the patient’s updated Homeostasis Model Assessment model insulin resistance (H0MA2-IR) value by 0.1 to 0.6 from baseline H0MA2-IR value within 4 hours after the administering.
[0364] Embodiment 139. The method of any one of Embodiments 136 to 138 where the MANP is administered subcutaneously.
[0365] Embodiment 140. The method of Embodiment 139, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0366] Embodiment 141. The method of Embodiment 140, where the effective dose is 2.5Pg / kg-
[0367] Embodiment 142. The method of Embodiment 139, where the effective dose is from 6.5 pg to 750 pg.
[0368] Embodiment 143. The method of Embodiment 142, where the effective dose is from 162.5 pg to 375 pg.
[0369] Embodiment 144. The method of any one of Embodiments 136 to 138, where the MANP is administered intravenously.
[0370] Embodiment 145. The method of Embodiment 144, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0371] Embodiment 146. The method of any one of Embodiments 136 to 138, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0372] Embodiment 147. The method of Embodiment 146, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0. 1 pg / kg to 5 pg / kg.
[0373] Embodiment 148. The method of Embodiment 147, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0374] Embodiment 149. The method of Embodiment 146, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0375] Embodiment 150. The method of Embodiment 149, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
[0376] Embodiment 151. The method of any one of Embodiments 136 to 150, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0377] Embodiment 152. The method of any one of Embodiments 136 to 151, where the patient has a BMI higher than 30 kg / m2.
[0378] Embodiment 153. The method of any one of Embodiments 136 to 152, where the patient has a BMI higher than 35 kg / m2.
[0379] Embodiment 154. The method of any one of Embodiments 136 to 153, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0380] Embodiment 155. The method of any one of Embodiments 136 to 154, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0381] Embodiment 156. The method of any one of Embodiments 136 to 155, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0382] Embodiment 157. The method of Embodiment 156, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0383] Embodiment 158. The method of Embodiment 156 or 157, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0384] Embodiment 159. The method of any one of Embodiments 156 to 158, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0385] Embodiment 160. The method of any one of Embodiments 156 to 158, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0386] Embodiment 161. The method of any one of Embodiments 156 to 160, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0387] Embodiment 162. The method of any one of Embodiments 156 to 160, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0388] Embodiment 163. The method of any one of Embodiments 136 to 162, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering; having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering;having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0389] Embodiment 164. The method of any one of Embodiments 136 to 163, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0390] Embodiment 165. The method of any one of Embodiments 136 to 164, where sitting systolic blood pressure of the patient decreases by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0391] Embodiment 166. The method of any one of Embodiments 136 to 165, where sitting diastolic blood pressure of the patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0392] Embodiment 167. The method of any one of Embodiments 136 to 166, where plasma glucose of the patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0393] Embodiment 168. The method of any one of Embodiments 136 to 167, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
[0394] Embodiment 169. A method of increasing plasma non-esterified fatty acids (NEFA) in a patient in need thereof, comprising, consisting essentially of, or consisting of administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to the patient.
[0395] Embodiment 170. The method of Embodiment 169, where the increasing is increasing the plasma NEFA by 1 pM from baseline NEFA within 1 hour after the administering.
[0396] Embodiment 171. The method of Embodiment 169 or 170, where the MANP is administered subcutaneously.
[0397] Embodiment 172. The method of Embodiment 171, where the effective dose is from 0.1 pg / kg to 5 pg / kg.
[0398] Embodiment 173. The method of Embodiment 172, where the effective dose is 2.5 Pg / kg-
[0399] Embodiment 174. The method of Embodiment 171, where the effective dose is from 6.5 pg to 750 pg.
[0400] Embodiment 175. The method of Embodiment 174, where the effective dose is from 162.5 pg to 375 pg.
[0401] Embodiment 176. The method of Embodiment 169 or 170, where the MANP is administered intravenously.
[0402] Embodiment 177. The method of Embodiment 176, where the effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
[0403] Embodiment 178. The method of Embodiment 169 or 170, where the MANP is administered intravenously, and subsequently is administered subcutaneously.
[0404] Embodiment 179. The method of Embodiment 178, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0. 1 pg / kg to 5 pg / kg.
[0405] Embodiment 180. The method of Embodiment 179, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
[0406] Embodiment 181. The method of Embodiment 178, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
[0407] Embodiment 182. The method of Embodiment 181, where the MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 qg to 375 qg.
[0408] Embodiment 183. The method of any one of Embodiments 169 to 182, where the patient has a body mass index (BMI) higher than 25 kg / m2.
[0409] Embodiment 184. The method of any one of Embodiments 169 to 183, where the patient has a BMI higher than 30 kg / m2.
[0410] Embodiment 185. The method of any one of Embodiments 169 to 184, where the patient has a BMI higher than 35 kg / m2.
[0411] Embodiment 186. The method of any one of Embodiments 169 to 185, where the patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before the administering.
[0412] Embodiment 187. The method of any one of Embodiments 169 to 186, where the patient consumed antihypertensive medications for 30 days before the administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before the administering.
[0413] Embodiment 188. The method of any one of Embodiments 169 to 187, where the patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
[0414] Embodiment 189. The method of Embodiment 188, where the abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in the patient who is a male, or higher than or equal to 88 cm in the patient who is a female.
[0415] Embodiment 190. The method of Embodiment 188 or 189, where the high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in the patient before the administering.
[0416] Embodiment 191. The method of any one of Embodiments 188 to 190, where the low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in the patient who is a male, or lower than 50 mg / dL in the patient who is a female.
[0417] Embodiment 192. The method of any one of Embodiments 188 to 190, where the low HDL cholesterol is identified in the patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
[0418] Embodiment 193. The method of any one of Embodiments 188 to 192, where the high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in the patient.
[0419] Embodiment 194. The method of any one of Embodiments 188 to 192, where the high fasting plasma glucose is identified in the patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
[0420] Embodiment 195. The method of any one of Embodiments 169 to 194, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering; having received any investigational drug or device within 30 days prior to the administering; having a history (within 2 years before the administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before the administering; having a clinically significant new illness within 1 month before the administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder;having a history of organ transplantation; and having a malignant tumor within 5 years before the administering.
[0421] Embodiment 196. The method of any one of Embodiments 169 to 195, where the patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to the MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase-5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before the administering.
[0422] Embodiment 197. The method of any one of Embodiments 169 to 196, where sitting systolic blood pressure of the patient decreases by 0. 1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after the administering.
[0423] Embodiment 198. The method of any one of Embodiments 169 to 197, where sitting diastolic blood pressure of the patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after the administering.
[0424] Embodiment 199. The method of any one of Embodiments 169 to 198, where plasma glucose of the patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after the administering.
[0425] Embodiment 200. The method of any one of Embodiments 169 to 199, further comprising, consisting essentially of, or consisting of administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
Claims
CLAIMS:
1. A method of treating hypertension with metabolic syndrome in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising increasing plasma cGMP compared to said baseline by administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
2. The method of claim 1, wherein said baseline plasma cGMP is lower than 8 pmol / mL.
3. The method of claim 1 or 2, wherein said increasing is increasing said plasma cGMP by 2 to 8 pmol / mL from said baseline within 0.5 hour after said administering.
4. The method of claim 1 or 2, wherein said increasing is increasing said plasma cGMP by 1 to 5 pmol / mL from said baseline within 0.5 to 4 hours after said administering.
5. The method of any one of claims 1 to 4, wherein said MANP is administered subcutaneously.
6. The method of claim 5, wherein said effective dose is from 0.1 pg / kg to 5 pg / kg.
7. The method of claim 6, wherein said effective dose is 2.5 pg / kg.
8. The method of claim 5, wherein said effective dose is from 6.5 pg to 750 pg.
9. The method of claim 8, wherein said effective dose is from 162.5 pg to 375 pg.
10. The method of any one of claims 1 to 4, wherein said MANP is administered intravenously.
11. The method of claim 10, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
12. The method of any one of claims 1 to 4, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
13. The method of claim 12, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
14. The method of claim 13, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
15. The method of claim 12, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
16. The method of claim 15, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
17. The method of any one of claims 1 to 16, wherein said patient has a body mass index (BMI) higher than 25 kg / m218. The method of any one of claims 1 to 17, wherein said patient has a BMI higher than 30 kg / m2.
19. The method of any one of claims 1 to 18, wherein said patient has a BMI higher than 35 kg / m2.
20. The method of any one of claims 1 to 19, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
21. The method of claim 20, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
22. The method of claim 20 or 21, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
23. The method of any one of claims 20 to 22, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
24. The method of any one of claims 20 to 22, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
25. The method of any one of claims 20 to 24, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
26. The method of any one of claims 20 to 24, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
27. The method of any one of claims 1 to 26, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
28. The method of any one of claims 1 to 27, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
29. The method of any one of claims 1 to 28, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries;consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering; having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
30. The method of any one of claims 1 to 29, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
31. The method of any one of claims 1 to 30, wherein sitting systolic blood pressure of said patient decreases by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
32. The method of any one of claims 1 to 31, wherein sitting diastolic blood pressure of said patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
33. The method of any one of claims 1 to 32, wherein plasma glucose of said patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
34. The method of any one of claims 1 to 33, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
35. A method of decreasing blood pressure in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising increasing plasma cGMP compared to said baseline by administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
36. The method of claim 35, wherein said baseline plasma cGMP is lower than 8 pmol / mL.
37. The method of claim 35 or 36, wherein said increasing is increasing said plasma cGMP by 2 to 8 pmol / mL from said baseline within 0.5 hour after said administering.
38. The method of claim 35 or 36, wherein said increasing is increasing said plasma cGMP by 1 to 5 pmol / mL from said baseline within 0.5 to 4 hours after said administering.
39. The method of any one of claims 35 to 38, wherein said decreasing is decreasing sitting systolic blood pressure of said patient by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
40. The method of any one of claims 35 to 38, wherein said decreasing is decreasing sitting diastolic blood pressure of said patient by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
41. The method of any one of claims 35 to 40, wherein said MANP is administered subcutaneously.
42. The method of claim 41, wherein said effective dose is from 0.1 pg / kg to 5 pg / kg.
43. The method of claim 42, wherein said effective dose is 2.5 pg / kg.
44. The method of claim 41, wherein said effective dose is from 6.5 pg to 750 pg.
45. The method of claim 44, wherein said effective dose is from 162.5 pg to 375 pg.
46. The method of any one of claims 35 to 40, wherein said MANP is administered intravenously.
47. The method of claim 46, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
48. The method of any one of claims 35 to 40, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
49. The method of claim 48, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
50. The method of claim 49, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
51. The method of claim 48, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
52. The method of claim 51, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
53. The method of any one of claims 35 to 52, wherein said patient has a body mass index (BMI) higher than 25 kg / m254. The method of any one of claims 35 to 53, wherein said patient has a BMI higher than 30 kg / m2.
55. The method of any one of claims 35 to 54, wherein said patient has a BMI higher than 35 kg / m2.
56. The method of any one of claims 35 to 55, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
57. The method of any one of claims 35 to 56, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
58. The method of any one of claims 35 to 57, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
59. The method of claim 58, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
60. The method of claim 58 or 59, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
61. The method of any one of claims 58 to 60, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
62. The method of any one of claims 58 to 60, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
63. The method of any one of claims 58 to 62, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
64. The method of any one of claims 58 to 62, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
65. The method of any one of claims 35 to 64, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering; having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope;having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
66. The method of any one of claims 35 to 65, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
67. The method of any one of claims 35 to 66, wherein plasma glucose of said patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
68. The method of any one of claims 35 to 67, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
69. A method of increasing plasma atrial natriuretic peptide (ANP)-like peptides in a patient in need thereof having baseline plasma cyclic guanosine monophosphate (cGMP) lower than 10 pmol / mL, comprising increasing plasma cGMP compared to said baseline by administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
70. The method of claim 69, wherein said baseline plasma cGMP is lower than 8 pmol / mL.
71. The method of claim 69 or 70, wherein said increasing plasma cGMP is increasing said plasma cGMP by 2 to 8 pmol / mL from said baseline within 0.5 hour after said administering.
72. The method of claim 69 or 70, wherein said increasing plasma cGMP is increasing said plasma cGMP by 1 to 5 pmol / mL from said baseline within 0.5 to 4 hours after said administering.
73. The method of any one of claims 69 to 72, wherein said increasing ANP-like peptides is increasing said ANP-like peptides by 1 to 70 pg / mL from baseline ANP-like peptide within 0.5 hour after said administering.
74. The method of any one of claims 69 to 72, wherein said increasing ANP-like peptides is increasing said ANP-like peptides by 1 to 40 pg / mL from baseline ANP-like peptides within 1 hour after said administering.
75. The method of any one of claims 69 to 74, wherein said MANP is administered subcutaneously.
76. The method of claim 75, wherein said effective dose is from 0.1 pg / kg to 5 pg / kg.
77. The method of claim 76, wherein said effective dose is 2.5 pg / kg.
78. The method of claim 75, wherein said effective dose is from 6.5 pg to 750 pg.
79. The method of claim 78, wherein said effective dose is from 162.5 pg to 375 pg.
80. The method of any one of claims 69 to 74, wherein said MANP is administered intravenously.
81. The method of claim 80, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
82. The method of any one of claims 69 to 74, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
83. The method of claim 82, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
84. The method of claim 83, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
85. The method of claim 82, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
86. The method of claim 85, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
87. The method of any one of claims 69 to 86, wherein said patient has a body mass index (BMI) higher than 25 kg / m288. The method of any one of claims 69 to 87, wherein said patient has a BMI higher than 30 kg / m2.
89. The method of any one of claims 69 to 88, wherein said patient has a BMI higher than 35 kg / m2.
90. The method of any one of claims 69 to 89, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
91. The method of any one of claims 69 to 90, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
92. The method of any one of claims 69 to 91, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
93. The method of claim 92, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
94. The method of claim 92 or 93, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
95. The method of any one of claims 92 to 94, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
96. The method of any one of claims 92 to 94, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
97. The method of any one of claims 92 to 96, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
98. The method of any one of claims 92 to 96, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
99. The method of any one of claims 69 to 98, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries;consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering; having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
100. The method of any one of claims 69 to 99, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
101. The method of any one of claims 69 to 100, wherein sitting systolic blood pressure of said patient decreases by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
102. The method of any one of claims 69 to 101, wherein sitting diastolic blood pressure of said patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
103. The method of any one of claims 69 to 102, wherein plasma glucose of said patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
104. The method of any one of claims 69 to 103, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
105. A method of decreasing the plasma glucose level in a patient in need thereof, comprising administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
106. The method of claim 105, wherein said decreasing is decreasing said plasma glucose level by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
107. The method of claim 105 or 106, wherein said MANP is administered subcutaneously.
108. The method of claim 107, wherein said effective dose is from 0.1 pg / kg to 5 lig / kg.
109. The method of claim 108, wherein said effective dose is 2.5 pg / kg.
110. The method of claim 107, wherein said effective dose is from 6.5 pg to 750 pg.
111. The method of claim 110, wherein said effective dose is from 162.5 pg to 375 pg.
112. The method of claim 105 or 106, wherein said MANP is administered intravenously.
113. The method of claim 112, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
114. The method of claim 105 or 106, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
115. The method of claim 114, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
116. The method of claim 115, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
117. The method of claim 114, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
118. The method of claim 117, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
119. The method of any one of claims 105 to 118, wherein said patient has a body mass index (BMI) higher than 25 kg / m2.
120. The method of any one of claims 105 to 119, wherein said patient has a BMI higher than 30 kg / m2.
121. The method of any one of claims 105 to 120, wherein said patient has a BMI higher than 35 kg / m2.
122. The method of any one of claims 105 to 121, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
123. The method of any one of claims 105 to 122, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
124. The method of any one of claims 105 to 123, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
125. The method of claim 124, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
126. The method of claim 124 or 125, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
127. The method of any one of claims 124 to 126, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
128. The method of any one of claims 124 to 126, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
129. The method of any one of claims 124 to 128, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
130. The method of any one of claims 124 to 128, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
131. The method of any one of claims 105 to 130, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering; having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
132. The method of any one of claims 105 to 131, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding;having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
133. The method of any one of claims 105 to 132, wherein sitting systolic blood pressure of said patient decreases by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
134. The method of any one of claims 105 to 133, wherein sitting diastolic blood pressure of said patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
135. The method of any one of claims 105 to 134, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
136. A method of increasing insulin sensitivity in a patient in need thereof, comprising administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
137. The method of claim 136, wherein said increasing said insulin sensitivity is increasing said patient’s updated Homeostasis Model Assessment model insulin sensitivity (H0MA2-S) value by 0.1 to 35% compared to baseline H0MA2-S value within 4 hours after said administering.
138. The method of claim 136, wherein said increasing said insulin sensitivity is decreasing said patient’s updated Homeostasis Model Assessment model insulin resistance (H0MA2-IR) value by 0.1 to 0.6 from baseline H0MA2-IR value within 4 hours after said administering.
139. The method of any one of claims 136 to 138, wherein said MANP is administered subcutaneously.
140. The method of claim 139, wherein said effective dose is from 0.1 pg / kg to 5 lig / kg.
141. The method of claim 140, wherein said effective dose is 2.5 pg / kg.
142. The method of claim 139, wherein said effective dose is from 6.5 pg to 750 pg.
143. The method of claim 142, wherein said effective dose is from 162.5 pg to 375 pg.
144. The method of any one of claims 136 to 138, wherein said MANP is administered intravenously.
145. The method of claim 144, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
146. The method of any one of claims 136 to 138, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
147. The method of claim 146, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
148. The method of claim 147, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
149. The method of claim 146, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
150. The method of claim 149, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
151. The method of any one of claims 136 to 150, wherein said patient has a body mass index (BMI) higher than152. The method of any one of claims 136 to 151, wherein said patient has a BMI higher than 30 kg / m2153. The method of any one of claims 136 to 152, wherein said patient has a BMI higher than 35 kg / m2.
154. The method of any one of claims 136 to 153, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
155. The method of any one of claims 136 to 154, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
156. The method of any one of claims 136 to 155, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
157. The method of claim 156, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
158. The method of claim 156 or 157, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
159. The method of any one of claims 156 to 158, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
160. The method of any one of claims 156 to 158, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
161. The method of any one of claims 156 to 160, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
162. The method of any one of claims 156 to 160, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
163. The method of any one of claims 136 to 162, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering; having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope;having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
164. The method of any one of claims 136 to 163, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
165. The method of any one of claims 136 to 164, wherein sitting systolic blood pressure of said patient decreases by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
166. The method of any one of claims 136 to 165, wherein sitting diastolic blood pressure of said patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
167. The method of any one of claims 136 to 166, wherein plasma glucose of said patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
168. The method of any one of claims 136 to 167, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).
169. A method of increasing plasma non-esterified fatty acids (NEFA) in a patient in need thereof, comprising administering an effective dose of alternatively-spliced atrial natriuretic peptides (MANP) to said patient.
170. The method of claim 169, wherein said increasing is increasing said plasma NEFA by 1 pM from baseline NEFA within 1 hour after said administering.
171. The method of claim 169 or 170, wherein said MANP is administered subcutaneously.
172. The method of claim 171, wherein said effective dose is from 0.1 pg / kg to 5 lig / kg.
173. The method of claim 172, wherein said effective dose is 2.5 pg / kg.
174. The method of claim 171, wherein said effective dose is from 6.5 pg to 750 pg.
175. The method of claim 174, wherein said effective dose is from 162.5 pg to 375 pg.
176. The method of claim 169 or 170, wherein said MANP is administered intravenously.
177. The method of claim 176, wherein said effective dose is from 10 pmol / kg / minute to 100 nmol / kg / minute.
178. The method of claim 169 or 170, wherein said MANP is administered intravenously, and subsequently is administered subcutaneously.
179. The method of claim 178, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 0.1 pg / kg to 5 pg / kg.
180. The method of claim 179, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 2.5 pg / kg.
181. The method of claim 178, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 6.5 pg to 750 pg.
182. The method of claim 181, wherein said MANP is administered intravenously at a dose of 10 pmol / kg / minute to 100 nmol / kg / minute, and subsequently is administered subcutaneously at a dose of 162.5 pg to 375 pg.
183. The method of any one of claims 169 to 182, wherein said patient has a body mass index (BMI) higher than 25 kg / m2.
184. The method of any one of claims 169 to 183, wherein said patient has a BMI higher than 30 kg / m2.
185. The method of any one of claims 169 to 184, wherein said patient has a BMI higher than 35 kg / m2.
186. The method of any one of claims 169 to 185, wherein said patient presents a sitting systolic blood pressure between 140 mmHg and 180 mmHg, or a sitting diastolic blood pressure between 90 mmHg and 100 mmHg before said administering.
187. The method of any one of claims 169 to 186, wherein said patient consumed antihypertensive medications for 30 days before said administering, or consumed statins, ezetimibe, or combinations thereof for 60 days before said administering.
188. The method of any one of claims 169 to 187, wherein said patient presents at least two traits selected from the group consisting of abdominal obesity, high serum triglycerides, low serum high-density lipoprotein (HDL) cholesterol, and high fasting plasma glucose.
189. The method of claim 188, wherein said abdominal obesity is identified by a waist circumference higher than or equal to 102 cm in said patient who is a male, or higher than or equal to 88 cm in said patient who is a female.
190. The method of claim 188 or 189, wherein said high serum triglycerides is identified by serum triglycerides of 150 mg / dL or above in said patient before said administering.
191. The method of any one of claims 188 to 190, wherein said low HDL cholesterol is identified by HDL cholesterol lower than 40 mg / dL in said patient who is a male, or lower than 50 mg / dL in said patient who is a female.
192. The method of any one of claims 188 to 190, wherein said low HDL cholesterol is identified in said patient who is taking drug treatment for low HDL cholesterol to increase HDL cholesterol.
193. The method of any one of claims 188 to 192, wherein said high fasting plasma glucose is identified by fasting plasma glucose of 100 mg / dL or above in said patient.
194. The method of any one of claims 188 to 192, wherein said high fasting plasma glucose is identified in said patient who is taking drug treatment for elevated blood glucose to decrease blood glucose.
195. The method of any one of claims 169 to 194, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering; having received any investigational drug or device within 30 days prior to said administering;having a history (within 2 years before said administering) of alcohol abuse, illicit drug use, significant mental illness, physical dependence on any opioid, or any history of drug abuse or addiction; having a history of difficulty with donating blood, or donated blood or blood products within 45 days before said administering; having a clinically significant new illness within 1 month before said administering; having a history of severe allergies; having a history of coronary artery disease, or cerebrovascular disease or syncope; having a history of epilepsy or other seizure disorder; having a history of organ transplantation; and having a malignant tumor within 5 years before said administering.
196. The method of any one of claims 169 to 195, wherein said patient does not present any trait selected from the group consisting of known hypersensitivity or allergy to said MANP or its components, carperitide, other natriuretic peptides, or related compounds; being pregnant or breast-feeding; having a clinically significant intrinsic renal disease, renal artery stenosis, or a history of fibromuscular dysplasia of the renal arteries; and consumption of a phosphodiesterase- 5 inhibitor (sildenafil, vardenafil, or tadalafil) within 72 hours before said administering.
197. The method of any one of claims 169 to 196, wherein sitting systolic blood pressure of said patient decreases by 0.1 to 15% compared to baseline sitting systolic blood pressure within 12 hours after said administering.
198. The method of any one of claims 169 to 197, wherein sitting diastolic blood pressure of said patient decreases by 0.1 to 5% compared to baseline sitting diastolic blood pressure within 6 hours after said administering.
199. The method of any one of claims 169 to 198, wherein plasma glucose of said patient decreases by 1 to 17 mg / mL compared to baseline plasma glucose within 4 hours after said administering.
200. The method of any one of claims 169 to 199, further comprising administering a second drug selected from the group consisting of a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), and a calcium channel blocker (CCB).