Immunogenic compositions and uses thereof

EP4680276A1Pending Publication Date: 2026-01-21FLAGSHIP PIONEERING INNOVATIONS VI LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024716066
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-15
Filing Date
2024-03-15
Publication Date
2026-01-21

AI Technical Summary

Technical Problem

Current immunogenic compositions for vaccines lack enhanced stability and expression of immunogens, leading to suboptimal immune responses.

Method used

Development of circular polyribonucleotides with specific structural elements such as post-circularization elements, translation enhancers, stability elements, and spacer elements that improve the stability and expression of immunogens by forming circularization junctions and incorporating polyA regions.

Benefits of technology

The circular polyribonucleotides exhibit increased stability and prolonged detection in subjects, resulting in enhanced expression of immunogens, potentially leading to more effective immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024020317_19092024_PF_FP_ABST
    Figure US2024020317_19092024_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure features compositions including polyribonucleotides having one or more expression augmenting elements or spacer elements. The polyribonucleotides described herein may increase the stability of the polyribonucleotide and / or may increase the expression of a polynucleotide cargo encoded by the polyribonucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

IMMUNOGENIC COMPOSITIONS AND USES THEREOFBACKGROUNDVaccination has made an enormous contribution to both human and animal health. Since the invention of the first vaccine in 1796, vaccines have come to be considered the most successful method for preventing many infectious diseases by provoking an immune response in a subject. According to the World Health Organization, immunization currently prevents 2-3 million deaths every year across all age groups. Today, vaccines have been developed to prevent and control the spread of more than 20 infectious diseases, including diphtheria, tetanus, pertussis, influenza, and measles, and have led to the complete eradication of smallpox. There remains a need to develop new and improved immunogenic compositions and uses thereof.SUMMARYIn an aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) one or more expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; and (d) a second postcircularization element; wherein the first post-circularization element and the second postcircularization element together form a circularization junction.In another aspect, the disclosure provides circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a polyribonucleotide cargo encoding an immunogen; (c) one or more expression augmenting element; and (d) a second postcircularization element; wherein the first post-circularization element and the second postcircularization element together form a circularization junction.In some embodiments, the one or more expression augmenting element comprises a fusion of a translation enhancer and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the one or more expression augmenting element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group comprising a BYDV like-element (BTE), a translation enhancer element (TED), a PMV / PEMV-like translation enhancer (PTE), an l-shaped structure (ISS), a Y- shaped structure (YSS), a t-shaped structure (TSS), dumbbell shaped structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, hepatitis B virus posttranscriptional regulatory element, human genomic fragments, a histone mRNA sequence, a cyclin D mRNA sequence, or an elF4g aptamer sequence. In some embodiments, the translation enhancer binds to elF4g.In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a translation enhancer. In some embodiments, the circular polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a translation enhancer after the circular polyribonucleotide is administered to a subject. In some embodiments, the circular polyribonucleotide comprises a polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without a translation enhancer.In some embodiments, the one or more expression augmenting element comprises a fusion of a stability element and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the expression augmenting element comprises a stability element. In some embodiments, the stability element is an untranslated region (UTR). In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR. In some embodiments, the UTR is from a gene encoding a translocation associated membrane protein 1 (TRAM1 ), a transmembrane p24 trafficking protein 2 (TMED2), a vesicle associated membrane protein 3 (VAMP3), a CXXC repeat containing interactor of PDZ3 domain (CRIP), an adaptor related protein complex 2 subunit alpha 2 (AP2A2), a proteasome 26S subunit, a non-ATPase 5 (PSMD5), glutathione peroxidase 4 (GPX4), or a protein kinase AMP-activated non-catalytic subunit beta 1 (PRKAB1 ). In some embodiments, the UTR is a UTR from a human beta actin, DDB2, TP53I3, FcIgG, LSP1 , AES, DRB4, or a mitochondrially encoded 12S rRNA.. In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a stability element. In some embodiments, the circular polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a stability element after the circular polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression in comparison to a polyribonucleotide without a stability element.In some embodiments, the circular polyribonucleotide further comprises one or more spacer elements comprising a polyA region. In some embodiments, the spacer element has a length of between 50 to 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides. In some embodiments, the spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500,350 to 500, 400 to 500, 450 to 500, 100 to 300, 100 to 200, 110 to 300, and 110 to 200) ribonucleotides. In some embodiments, the spacer element has a length of between 110 to 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 120 to 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 110 to 300, 115 to 300, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, 110 to 200, and 280 to 300) ribonucleotides. In some embodiments, the spacer has a length of between 10 and 200 (e.g., between 10 and 175, 10 and 150, 10 and 125, 10 and 100, 10 and 75, 10 and 50, 10 and 25, 25 and 200, 50 and 200, 75 and 200, 100 and 200, 150 and 200, 175 and 200, and 25 and 100) ribonucleotides. In some embodiments, the spacer element has a length of about 120 ribonucleotides. In some embodiments, the spacer element has a length of about 50 ribonucleotides.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression augmenting element; and (e) a second post-circularization element; wherein the first postcircularization element and the second post-circularization element together form a circularization junction. In some embodiments, the first expression augmenting element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression augmenting element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression augmenting element comprises a translation enhancer. In some embodiments, the second expression augmenting element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, thetranslation enhancer is selected from the group comprising a BTE, a TED, a PTE, an ISS, a YSS, a TSS, dumbbell shaped structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, hepatitis B virus posttranscriptional regulatory element, human genomic fragments, a histone mRNA sequence, a cyclin D mRNA sequence, or an elF4g aptamer sequence. In some embodiments, the translation enhancer binds to elF4g. In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a translation enhancer. In some embodiments, the circular polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a translation enhancer after the circular polyribonucleotide is administered to a subject. In some embodiments, the circular polyribonucleotide comprises a polynucleotide cargo encoding an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without a translation enhancer.In some embodiments, the first expression augmenting element comprises a fusion of a stability element and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression augmenting element comprises a stability element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression augmenting element comprises a stability element. In some embodiments, the stability element is a UTR. In some embodiments, the UTR is from a gene encoding a TRAM1 , a TMED2, a VAMP3, a CRIP, an AP2A2, a proteasome 26S subunit, a PSMD5, a GPX4, or a PRKAB1 . In some embodiments, the UTR is a UTR from a human beta actin, DDB2, TP53I3, FcIgG, LSP1 , AES, DRB4, or a mitochondrially encoded 12S rRNA. In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR. In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a stability element. In some embodiments, the circular polyribonucleotide may be detected for at least 2-fold longer incomparison to a polyribonucleotide without a stability element after the circular polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression in comparison to a polyribonucleotide without a stability element.In some embodiments, the circular polyribonucleotide further comprises one or more spacer elements comprising a polyA region. In some embodiments, the spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 120 to 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 100 to 300 (e.g., 100 to 280, 100 to 260,100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) an expression augmenting element; and (e) a second post-circularization element and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) an expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a spacer element; and (e) a second post-circularization element and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression augmenting element; and (e) a second post-circularization element and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element having a length of atleast 100 ribonucleotides; and (e) a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In some embodiments, the first spacer element has a length of between 50 to 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides. In some embodiments, the first spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the second spacer element has a length of between 50 to 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides. In some embodiments, the second spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise 110 to 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise 120 to 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 150 to 500 (e.g., 150 to 450, 150 to 400, 150 to 350, 150 and 300, 150 and 250, 150 and 200, 200 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 200 to 500 (e.g., 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 500, 300 to 500, 350 to 500, 400 to 500, or 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 100 to 200 (e.g., 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 100 to 110, 110 to 200, 120 to 200, 130 to 200, 140 to 200, 150 to 200, 160 to 200, 170 to 200, 180 to 200, and 90 to 200) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 180, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300, and 290 to 300) ribonucleotides.In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 (e.g., 0 and 10, 0 and 20, 0 and 30, 0, and 40, 0 and 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30 or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the first spacer element and the second spacer element are the same number of ribonucleotides in length.In some embodiments, the first spacer or the second spacer element consists of: (i) a polyA region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; (ii) a polyAC region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or cytosine residues; (iii) a polyAU region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iii) a polyAG region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without the first spacer element or the second spacer element. In some embodiments, the circular polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without the first spacer element or the second spacer element after the circular polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without the first spacer element or the second spacer element.In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an expression sequence. In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence. In some embodiments, theexpression sequence further comprises a 3’ untranslated region or a 5’ untranslated region. In some embodiments, the expression sequence encodes an immunogen.In some embodiments, the polyribonucleotide comprises between 500 and 20,000 (e.g., between 500 to 15,000, 500 to 10,000, 500 to 5,000, 500 to 1 ,000, 1 ,000 to 20,000, 5,000 to 20,000, 10,000 to 20,000, and 15,000 to 20,000) ribonucleotides. In some embodiments, the polyribonucleotide comprises between 2,000 and 20,000 (e.g., 2,000 to 5,000, 2,000 to 7,500, 2,000 to 10,000, 2,000 to 12,500, 2,000 to 15,000, 2,000 to 17,500, 5,000 to 20,000, 7,500 to 20,000, 10,000 to 20,000, 12,500 to 20,000, 15,000 to 20,000, and 17,500 to 20,000) ribonucleotides.In some embodiments, the circularization junction comprises a splice junction. In some embodiments, the first post-circularization element comprises a first exon fragment and the second post-circularization element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are joined by the splice junction. In some embodiments, the circularization junction comprises an oligonucleotide splint that is hybridized to the first postcircularization element and to the second post-circularization element. In some embodiments, the oligonucleotide splint is a DNA splint or an RNA splint. In some embodiments, the first postcircularization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint and the second post-circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.In an aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) one or more expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; and (d) a second postcircularization element; wherein the first post-circularization element and the second postcircularization element together form a circularization junction.In an aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a polyribonucleotide cargo encoding an immunogen; (c) one or more expression augmenting element; and (d) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In some embodiments, the one or more expression augmenting element comprises a fusion of a translation enhancer and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the one or more expression augmenting element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group comprising a BTE, a TED, a PTE, an ISS, a YSS, a TSS, dumbbell shaped structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, hepatitis B virus posttranscriptional regulatory element, human genomic fragments, a histone mRNA sequence, a cyclin D mRNA sequence, or an elF4g aptamer sequence. In someembodiments, the translation enhancer binds to elF4g. In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a translation enhancer. In some embodiments, the linear polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a translation enhancer after the linear polyribonucleotide is administered to a subject. In some embodiments, the linear polyribonucleotide is polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without a translation enhancer.In some embodiments, the one or more expression augmenting element comprises a fusion of a stability element and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the expression augmenting element comprises a stability element. In some embodiments, the stability element is a UTR. In some embodiments, the UTR is from a gene encoding TRAM1 , a TMED2, a VAMP3, a CRIP, an AP2A2, a proteasome 26S subunit, a PSMD5, a GPX4, or a PRKAB1 . In some embodiments, the UTR is a UTR from a human beta actin, DDB2, TP53I3, FcIgG, LSP1 , AES, DRB4, or a mitochondrially encoded 12S rRNA. In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR.In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a stability element. In some embodiments, the linear polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a stability element after the linear polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression in comparison to a polyribonucleotide without a stability element.In some embodiments, the linear polyribonucleotide further comprises one or more spacer elements comprising a polyA region. In some embodiments, the spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100to 150, 110 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 110 to 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 120 to 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 110 to 300, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression augmenting element; and (e) a second post-circularization element; wherein the first postcircularization element and the second post-circularization element together form a circularization junction. In some embodiments, the first expression augmenting element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression augmenting element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression augmenting element comprises a translation enhancer. In some embodiments, the second expression augmenting element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group comprising a BTE, a TED, a PTE, an ISS, a YSS, a TSS, dumbbell shaped structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, hepatitis B virus posttranscriptional regulatory element, human genomic fragments, a histone mRNA sequence, a cyclin D mRNA sequence, or an elF4g aptamer sequence. In some embodiments, the translation enhancer binds to elF4g.In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a translation enhancer. In some embodiments, the linear polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a translation enhancer after the linear polyribonucleotide is administered to a subject. In some embodiments, the linear polyribonucleotide is polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without a translation enhancer.In some embodiments, the first expression augmenting element comprises a fusion of a stability element and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the first expression augmenting element comprises a stability element. In some embodiments, the second expression augmenting element comprises a fusion of a stability element and a spacer element. In some embodiments, the spacer element comprises from 5 to 200 ribonucleotides in length (e.g., from 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the second expression augmenting element comprises a stability element. In some embodiments, the stability element is a UTR. In some embodiments, the UTR is from a gene encoding a TRAM1 , a TMED2, a VAMP3, a CRIP, an AP2A2, a proteasome 26S subunit, a PSMD5, a GPX4, or a PRKAB1 . In some embodiments, the UTR is a UTR from a human beta actin, DDB2, TP53I3, FcIgG, LSP1 , AES, DRB4, or a mitochondrially encoded 12S rRNA. In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR.In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without a stability element. In some embodiments, the linear polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without a stability element after the linear polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression in comparison to a polyribonucleotide without a stability element.In some embodiments, the linear polyribonucleotide further comprises one or more spacer elements comprising a polyA region. In some embodiments, the spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 120 to 500(e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the spacer element has a length of between 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) an expression augmenting element and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) an expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a spacer element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first expression augmenting element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression augmenting element; and (e) a second post-circularization element, and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first spacer element having a length of at least 100 ribonucleotides; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element and (e) a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a first spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element having a length of at least 100 ribonucleotides and (e) a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.In some embodiments, the first spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element has a length of between 100 and 300 (e.g., 100 to 250, 100 to 200, 100 to 150, 110 to 300, 120 to 300, 150 to 300, 200 to 300, and 250 to 300). In some embodiments, the second spacer element has a length of between 100 to 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise 110 to 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise 120 to 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 150 to 500 (e.g., 150 to 450, 150 to 400, 150 to 350, 150 and 300, 150 and 250, 150 and 200, 200 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 200 to 500 (e.g., 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 500, 300 to 500, 350 to 500, 400 to 500, or 450 to 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300,160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 100 to 200 (e.g., 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to140, 100 to 130, 100 to 120, 100 to 110, 110 to 200, 120 to 200, 130 to 200, 140 to 200, 150 to 200,160 to 200, 170 to 200, 180 to 200, and 90 to 200) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each have a length of 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 180, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300, and 290 to 300) ribonucleotides. In some embodiments, the difference between the length of the first spacer elementand the length of the second spacer element is 0 to 100 (e.g., 0 and 10, 0 and 20, 0 and 30, 0, and 40, 0 and 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30 or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the first spacer element and the second spacer element are the same number of ribonucleotides in length.In some embodiments, the first spacer or the second spacer element consists of: (i) a polyA region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; (ii) a polyAC region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or cytosine residues; (iii) a polyAU region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iv) a polyAG region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.In some embodiments, the polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without the first spacer element or the second spacer element. In some embodiments, the polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without the first spacer element or the second spacer element after the polyribonucleotide is administered to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to the polyribonucleotide without the first spacer element or the second spacer element.In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an expression sequence. In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence. In some embodiments, the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region. In some embodiments, the expression sequence encodes an immunogen.In some embodiments, the polyribonucleotide comprises between 500 and 20,000 (e.g., between 500 to 15,000, 500 to 10,000, 500 to 5,000, 500 to 1 ,000, 1 ,000 to 20,000, 5,000 to 20,000, 10,000 to 20,000, and 15,000 to 20,000) ribonucleotides. In some embodiments, the polyribonucleotide comprises between 2,000 and 20,000 (e.g., 2,000 to 5,000, 2,000 to 7,500, 2,000 to 10,000, 2,000 to 12,500, 2,000 to 15,000, 2,000 to 17,500, 5,000 to 20,000, 7,500 to 20,000, 10,000 to 20,000, 12,500 to 20,000, 15,000 to 20,000, and 17,500 to 20,000) ribonucleotides.In some embodiments, the circularization junction comprises a splice junction. In some embodiments, the first post-circularization element comprises a first exon fragment and the second post-circularization element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are joined by the splice junction. In some embodiments, thecircularization junction comprises an oligonucleotide splint that is hybridized to the first postcircularization element and to the second post-circularization element. In some embodiments, the oligonucleotide splint is a DNA splint or an RNA splint. In some embodiments, the first postcircularization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint and the second post-circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint. In some embodiments, the first circularization element comprises a first catalytic intron fragment, a first splice site dinucleotide, and a first exon fragment; and the second circularization element comprises a second catalytic intron fragment, a second splice site dinucleotide, and a second exon fragment. In some embodiments, the first catalytic intron fragment and the second catalytic intron fragment, together, are capable of selfsplicing thereby covalently joining the first exon region and the second exon region to produce a circular polyribonucleotide. In some embodiments, the first catalytic intron fragment and the second catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene or a Tetrahymena pre-rRNA. In some embodiments, the first circularization element comprises a region that is capable of hybridizing to a first region of an oligonucleotide splint and the second circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint. In another aspect the disclosure provides a DNA vector comprising an RNA polymerase promoter operably linked to a sequence that encodes the any one of the linear polyribonucleotides described herein.In another aspect the disclosure provides a circular polyribonucleotide produced from any one of the linear polyribonucleotides or from the DNA vector described herein. In another aspect the disclosure provides a pharmaceutical composition comprising any one of the linear polyribonucleotides, circular polyribonucleotides, or the DNA vector described herein and a pharmaceutically acceptable excipient.In another aspect the disclosure provides a method of expressing an immunogen in a cell or a subject, the method comprising providing to the cell or the subject any one of the linear polyribonucleotides, the circular polyribonucleotides, the DNA vector, or the pharmaceutical composition described herein.In another aspect the disclosure provides a method of producing a circular polyribonucleotide from any one of the linear polyribonucleotides described herein, the method comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.DefinitionsTo facilitate the understanding of this disclosure, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the disclosure. Terms such as "a", "an," and "the" are not intended to refer to only a singular entity but include the general class of which a specific example may be used for illustration. The term "or" is used to mean "and / or" unless explicitly indicated to refer to alternatives only or the alternative are mutually exclusive, although the disclosure supports a definition that refers to onlyalternatives and "and / or.” The terminology herein is used to describe specific embodiments, but their usage is not to be taken as limiting, except as outlined in the claims.As used herein, the term “about” refers to a value that is within ± 10% of a recited value.As used herein, the term “adaptive immune response” means either a humoral or cell- mediated immune response. For purposes of the present disclosure, a “humoral immune response” refers to an immune response mediated by antibody molecules, while a “cellular immune response” is one mediated by T-lymphocytes and / or other white blood cells.As used herein, the term “adjuvant” refers to a composition (e.g., a compound, polypeptide, nucleic acid, or lipid) that increases an immune response, for example, increases a specific immune response against an immunogen. Increasing an immune response includes intensification or broadening the specificity of either or both antibody and cellular immune responses.As used herein, any values provided in a range of values include both the upper and lower bounds, and any values contained within the upper and lower bounds.As used herein, the term “between” refers to all values that are greater than or equal to the initial value and less than or equal to the endpoint, such that the range of values between two values includes the endpoints of the range. For example, between 1 and 5 refers to all values >1 and < 5 such that the endpoints of 1 and 5 are included in the contemplated range.As used herein, the term “carrier” is a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., a circular polyribonucleotide) into a cell by a covalent modification of the circular polyribonucleotide, via a partially or completely encapsulating agent, or a combination thereof. Non-limiting examples of carriers include carbohydrate carriers (e.g., an anhydride-modified phytoglycogen or glycogen-type material), nanoparticles (e.g., a nanoparticle that encapsulates or is covalently linked binds to the circular polyribonucleotide), liposomes, fusosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., a protein covalently linked to the circular polyribonucleotide), or cationic carriers (e.g., a cationic lipopolymer or transfection reagent).As used herein, the terms “circRNA,” “circular polyribonucleotide,” “circular RNA,” and “circular polyribonucleotide molecule” are used interchangeably and mean a polyribonucleotide molecule that has a structure having no free ends (i.e. , no free 3’ and / or 5’ ends), for example a polyribonucleotide molecule that forms a circular or end-less structure through covalent (e.g., covalently closed) or non-covalent bonds. The circular polyribonucleotide may be e.g., a covalently closed polyribonucleotide.As used herein, the term “circularization efficiency” is a measurement of resultant circular polyribonucleotide versus its non-circular starting material.As used herein, the terms “disease,” “disorder,” and “condition” each refer to a state of sub- optimal health, for example, a state that is or would typically be diagnosed or treated by a medical professional.As used herein, the term “epitope” refers to a portion or the whole of an immunogen that is recognized, targeted, or bound by an antibody or T cell receptor. An epitope can be a linear epitope, for example, a contiguous sequence of nucleic acids or amino acids. An epitope can be aconformational epitope, for example, an epitope that contains amino acids that form an epitope in the folded conformation of the protein. A conformational epitope can contain non-contiguous amino acids from a primary amino acid sequence. As another example, a conformational epitope includes nucleic acids that form an epitope in the folded conformation of an immunogenic sequence based on its secondary structure or tertiary structure.As used herein, the term “expression augmenting element” refers to a component of a polyribonucleotide construct which increases the expression of an immunogen cargo encoded by the polyribonucleotide in comparison to a polyribonucleotide construct lacking the expression element. For example, in embodiments, the expression augmenting element is a translation enhancer or a stability element. In embodiments, the expression augmenting element increases expression of the immunogen cargo by increasing the length of time circRNA persists before it is degraded, or it increases the concentration of the immunogen cargo that is expressed over a fixed time period.As used herein, the term “expression sequence” is a nucleic acid sequence that encodes a product, e.g., an immunogen. An exemplary expression sequence that codes for an immunogen may include a plurality of nucleotide triads, each of which can code for an amino acid and is termed as a “codon.”As used herein, the term “fragment,” with respect to an immunogen or a nucleic acid sequence, refers to a continuous, less than a whole portion of a sequence of the immunogen or the nucleic acid. A fragment of an immunogen for instance, refers to continuous, less than a whole fraction (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the entire length) of the sequence such as a sequence disclosed herein. It is understood that all the present disclosure contemplates fragments of all polypeptides disclosed herein.As used herein, the term “fusion” refers a single, contiguous molecule containing two or more different elements. For example, the fusion elements described herein may include a translation enhancer (e.g., joined or connected) fused to a stability element, a translation enhancer fused (e.g., joined or connected) to a spacer element, or a stability element fused (e.g., joined or connected) to a spacer element. Fusion elements may have functional properties derived from each of the original elements. In some embodiments, a translation enhancer is connected at its 5’ end to a spacer element. In some embodiments, a translation enhancer is connected at its 3’ end to a spacer element. In some embodiments, a stability element is connected at its 5’ end to a spacer element. In some embodiments, a stability element is connected at its 3’ end to a spacer element. In some embodiments, a translation enhancer is connected at its 5’ end to a stability element. In some embodiments, a translation enhancer is connected at its 3’ end to a translation stability.As used herein, the term “GC content” refers to the percentage of guanine (G) and cytosine (C) in a nucleic acid sequence. The formula for calculation of the GC content is (G+C) I (A+G+C+U) x 100% (for RNA) or (G+C) I (A+G+C+T) x 100% (for DNA). Likewise, the term “uridine content” refers to the percentage of uridine (U) in a nucleic acid sequence. The formula for calculation of the uridine content is U / (A+G+C+U) x 100%. Likewise, the term “thymidine content” refers to the percentage of thymidine (T) in a nucleic acid sequence. The formula for calculation of the thymidine content is T / (A+G+C+T) x 100%.By “heterologous” is meant to occur in a context other than in the naturally occurring (native) context. A “heterologous” polynucleotide sequence indicates that the polynucleotide sequence is being used in a way other than what is found in that sequence’s native genome. For example, a “heterologous promoter” is used to drive transcription of a sequence that is not one that is natively transcribed by that promoter; thus, a “heterologous promoter” sequence is often included in an expression construct by means of recombinant nucleic acid techniques. The term “heterologous” is also used to refer to a given sequence that is placed in a non-naturally occurring relationship to another sequence; for example, a heterologous coding or non-coding nucleotide sequence is commonly inserted into a genome by genomic transformation techniques, resulting in a genetically modified or recombinant genome.As used herein, the term “impurity” is an undesired substance present in a composition, e.g., a pharmaceutical composition as described herein. In some embodiments, an impurity is a process- related impurity. In some embodiments, an impurity is a product-related substance other than the desired product in the final composition, e.g., other than the active drug ingredient, e.g., circular polyribonucleotide, as described herein. As used herein, the term “process-related impurity” is a substance used, present, or generated in the manufacturing of a composition, preparation, or product that is undesired in the final composition, preparation, or product other than the linear polyribonucleotides described herein. In some embodiments, the process-related impurity is an enzyme used in the synthesis or circularization of polyribonucleotides. As used herein, the term “product-related substance” is a substance or byproduct produced during the synthesis of a composition, preparation, or product, or any intermediate thereof. In some embodiments, the product- related substance is deoxyribonucleotide fragments. In some embodiments, the product-related substance is deoxyribonucleotide monomers. In some embodiments, the product-related substance is one or more of: derivatives or fragments of polyribonucleotides described herein, e.g., fragments of 10, 9, 8, 7, 6, 5, or 4 ribonucleic acids, monoribonucleic acids, diribonucleic acids, or triribonucleic acids.As used herein, the term “innate immune system stimulator” refers to a substance that induces an innate immunological response, in part, by inducing expression of one or more genes involved in innate immunity, including, but not limited to, a type I interferon (e.g., IFNa, INFp, and / or IFNy), a pro-inflammatory cytokine (e.g., IL-1 , IL-12, IL-18, TNF-a, and / or GM-CSF), retinoic-acid inducible gene-l (RIG-I, also known as DDX58), melanoma-differentiation-associated gene 5 (MDA5, also known as IFIH1 ), 2’-5’ oligoadenylate synthase 1 (OAS 1 ), OAS-like protein (OASL), and / or protein kinase R (PKR). An innate immune system stimulator function as an adjuvant, (e.g., when administered in combination with or formulated with a ribonucleotide that encodes an immunogen). An innate immune system stimulator may be a separate molecule entity (e.g., not encoded by or incorporated as a sequence in a polyribonucleotide), for example, STING (e.g., caSTING), TLR3, TLR4, TLR9, TLR7, TLR8, TLR7, RIG-I / DDX58, and MDA-5 / IFIH1 or a constitutively active mutant thereof. An innate immune system stimulator may be encoded by (e.g., expressed from) a polyribonucleotide. A polyribonucleotide may alternately or further include a ribonucleotide sequencethat acts as an innate immune system stimulator (e.g., GU-rich motif, an AU-rich motif, a structured region including dsRNA, or an aptamer).As used herein, the term “immunogen” refers to any molecule or molecular structure that includes one or more epitopes recognized, targeted, or bound by an antibody or a T cell receptor. In particular, an immunogen induces an immune response in a subject (e.g., is immunogenic as defined herein). An immunogen is capable of inducing an immune response in a subject, wherein the immune response refers to a series of molecular, cellular, and organismal events that are induced when an immunogen is encountered by the immune system. The immune response may be humoral and / or cellular immune response. These may include the production of antibodies and the expansion of B- and T-cells. To determine whether an immune response has occurred and to follow its course, the immunized subject can be monitored for the appearance of immune reactants directed at the specific immunogen. Immune responses to most immunogens induce the production of both specific antibodies and specific effector T cells. In some embodiments, the immunogen is foreign to a host. In some embodiments, the immunogen is not foreign to a host. An immunogen may include all or a portion of a polypeptide, a polysaccharide, a polynucleotide, or a lipid. An immunogen may also be a mixed polypeptide, polysaccharide, polynucleotide, and / or lipid. For example, an immunogen may be a polypeptide that has been translationally modified. A “polypeptide immunogen” refers to an immunogen that includes a polypeptide. A polypeptide immunogen may also include one or more post-translational modifications, and / or may form a complex with one or more additional molecules, and / or may adopt a tertiary or quaternary structure, each of which may determine or affect the immunogenicity of the polypeptide.As used herein, the term “immunogenic” refers to a potential to induce a response to a substance in a particular immune response assay above a pre-determined threshold. The assay can be, e.g., expression of certain inflammatory markers, production of antibodies, or an assay for immunogenicity as described herein. In some embodiments, an immune response may be induced when an immune system of an organism or a certain type of immune cells are exposed to an immunogen.An immunogenic response may be assessed may evaluating the antibodies in the plasma or serum of a subject using a total antibody assay, a confirmatory test, titration and isotyping of the antibodies, and neutralizing antibody assessment. A total antibody assay measures all the antibodies generated as part of the immune response in the serum or plasma of a subject that has been administered the immunogen. The most commonly used test to detect antibodies is an ELISA (enzyme-linked immunosorbent assay), which detects antibodies in the tested serum that bind to the antibody of interest, including IgM, IgD, IgG, IgA, and IgE. An immunogenic response can be further assessed by a confirmatory assay. Following a total antibody assessment, a confirmatory assay may be used to confirm the results of the total antibody assay. A competition assay may be used to confirm that antibody is specifically binding to target and that the positive finding in the screening assay is not a result of non-specific interactions of the test serum or detection reagent with other materials in the assay.An immunogenic response can be assessed by isotyping and titration. An isotyping assay may be used to assess only the relevant antibody isotypes. For example, the expected isotypes may be IgM and IgG which may be specifically detected and quantified by isotyping and titration, and then compared to the total antibodies present.An immunogenic response can be assessed by a neutralizing antibody assay (nAb). A neutralizing antibody assay (nAb) may be used to determine if the antibodies produced in response to the immunogen neutralized the immunogen thereby inhibiting the immunogen from having an effect on the target and leading to abnormal pharmacokinetic behaviors. An nAb assay is often a cell-based assay where the target cells are incubated with the antibody. A variety of cell based nAb assays may be used including but not limited to Cell Proliferation, Viability, Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC), Complement-Dependent Cytotoxicity (CDC), Cytopathic Effect Inhibition (CPE), Apoptosis, Ligand Stimulated Cell Signaling, Enzyme Activity, Reporter Gene Assays, Protein Secretion, Metabolic Activity, Stress and Mitochondrial Function. Detection readouts include Absorbance, Fluorescence, Luminescence, Chemiluminescence, or Flow Cytometry. A ligandbinding assay may also be used to measure the binding affinity of an immunogen and an antibody in vitro to evaluate neutralization efficacy.Furthermore, induction of a cellular immune response may be assessed by measuring T cell activation in a subject using cellular markers on T cells obtained from the subject. A blood sample, lymph node biopsy, or tissue sample can be collected from a subject and then T cells from this sample can be evaluated for one or more (e.g., 2, 3, 4 or more) activation markers: CD25, CD71 , CD26, CD27, CD28, CD30, CD154, CD40L, CD134, CD69, CD62L or CD44. T cell activation can also be assessed using the same methods in an in vivo animal model. This assay can also be performed by adding an immunogen to T cells in vitro (e.g., T cells obtained from a subject, animal model, repository, or commercial source) and measuring the aforementioned markers to evaluate T cell activation. Similar approaches can be used to assess the effect of and on activation of other immune cells, such as eosinophils (markers: CD35, CD11 b, CD66, CD69 and CD81 ), dendritic cells (makers: IL-8, MHC class II, CD40, CD80, CD83, and CD86), basophils (CD63, CD13, CD4, and CD203c), and neutrophils (CD11 b, CD35, CD66b and CD63). These markers can be assessed using flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for measurement of cellular markers. Comparing results from before and after administration of an immunogen can be used to determine its effect.As used herein, the term “inducing an immune response” refers to initiating, amplifying, or sustaining an immune response by a subject. Inducing an immune response may refer to an adaptive immune response or an innate immune response. The induction of an immune response may be measured as discussed above.As used herein, the terms “linear RNA,” “linear polyribonucleotide,” and “linear polyribonucleotide molecule” are used interchangeably and mean a monoribonucleotide molecule or polyribonucleotide molecule having a 5’ and 3’ end. One or both of the 5’ and 3’ ends may be free ends or joined to another moiety. In some embodiments, the linear RNA has a 5’ end or 3’ end that is modified or protected from degradation (e.g., by a 5’ end protectant or a 3’ end protectant). In someembodiments, the linear RNA has non-covalently linked 5’ or 3’ ends. Linear RNA includes RNA that has not undergone circularization (e.g., is pre-circularized) and can be used as a starting material for circularization.As used herein, the term “linear counterpart” is a polyribonucleotide molecule (and its fragments) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage therebetween sequence similarity) as a circular polyribonucleotide and having two free ends (i.e., the uncircularized version (and its fragments) of the circularized polyribonucleotide). In some embodiments, the linear counterpart (e.g., a pre-circularized version) is a polyribonucleotide molecule (and its fragments) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage therebetween sequence similarity) and same or similar nucleic acid modifications as a circular polyribonucleotide and having two free ends (i.e., the uncircularized version (and its fragments) of the circularized polyribonucleotide). In some embodiments, the linear counterpart is a polyribonucleotide molecule (and its fragments) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage therebetween sequence similarity) and different or no nucleic acid modifications as a circular polyribonucleotide and having two free ends (i.e., the uncircularized version (and its fragments) of the circularized polyribonucleotide). In some embodiments, a fragment of the polyribonucleotide molecule that is the linear counterpart is any portion of linear counterpart polyribonucleotide molecule that is shorter than the linear counterpart polyribonucleotide molecule. In some embodiments, the linear counterpart further comprises a 5’ cap. In some embodiments, the linear counterpart further comprises a poly adenosine tail. In some embodiments, the linear counterpart further comprises a 3’ UTR. In some embodiments, the linear counterpart further comprises a 5’ UTR.As used herein, the term “modified ribonucleotide” is a nucleotide with at least one modification to the sugar, the nucleobase, or the internucleoside linkage.The term “pharmaceutical composition” is intended to also disclose that the circular polyribonucleotide included within a pharmaceutical composition can be used for the treatment of the human or animal body (e.g., veterinary use) by therapy. It is thus meant to be equivalent to “a circular polyribonucleotide for use in therapy”.The terms “polyA based spacer element” or “polyA spacer element” refer to a spacer element comprising an untranslated, contiguous region of nucleic acid molecules of at least 4 nucleotides in length and consisting of one or more individual adenine (A) residues in combination with one or more (A), thymine (T), cytosine (C), guanine (G), or uracil (U) residues. For example, in some embodiments, the polyA based spacer element is a polyA region, which may be sequence of adenine residues. In other embodiments, the polyA based spacer element is a polyAT region, which is a combination of adenine and thymine residues. In other embodiments, the polyA based spacer element is a poly AU region, which may be a combination of adenine and uracil residues. In some embodiments, the polyA based spacer element is a polyAG region, which is a combination of adenine and guanine residues. A polyA based spacer element comprises between 50% to 100% (e.g., between 50% to 90%, 50% to 80%, 50% to 70%, 50% to 60%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 70% to 90%, or 60% to 80%) adenine residues.The term “polynucleotide” as used herein means a molecule including one or more nucleic acid subunits, or nucleotides, and can be used interchangeably with “nucleic acid” or “oligonucleotide.” A polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphate (PO3) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or deoxyribose), and one or more phosphate groups. Ribonucleotides are nucleotides in which the sugar is ribose. Polyribonucleotides or ribonucleic acids, or RNA, can refer to macromolecules that include multiple ribonucleotides that are polymerized via phosphodiester bonds. Deoxyribonucleotides are nucleotides in which the sugar is deoxyribose. In some examples, a polynucleotide is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or derivatives or variants thereof. In some cases, a polynucleotide is a short interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a short hairpin RNA (shRNA), small nuclear RNA (snRNA), messenger RNA (mRNA), precursor mRNA (pre-mRNA), antisense RNA (asRNA), to name a few, and encompasses both the nucleotide sequence and any structural embodiments thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some cases, a polynucleotide molecule is circular. A polynucleotide can have various lengths. A nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3, kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. A polynucleotide can be isolated from a cell or a tissue. As embodied herein, the polynucleotide sequences may include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.“Polydeoxyribonucleotides,” “deoxyribonucleic acids,” and “DNA” mean macromolecules that include multiple deoxyribonucleotides that are polymerized via phosphodiester bonds. A nucleotide can be a nucleoside monophosphate or a nucleoside polyphosphate. A nucleotide means a deoxyribonucleoside polyphosphate, such as, e.g., a deoxyribonucleoside triphosphate (dNTP), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP) and deoxythymidine triphosphate (dTTP) dNTPs, which include detectable tags, such as luminescent tags or markers (e.g., fluorophores). A nucleotide can include any subunit that can be incorporated into a growing nucleic acid strand. Such subunit can be an A, C, G, T, or U, or any other subunit that is specific to one or more complementary A, C, G, T or U, or complementary to a purine (i.e. , A or G, or variant thereof) or a pyrimidine (i.e., C, T or U, or variant thereof).Polynucleotides, e.g., polyribonucleotides or polydeoxyribonucleotides, may include one or more nucleotide variants, including nonstandard nucleotide(s), non-natural nucleotide(s), nucleotide analog(s) and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to diaminopurine, 5-fl uorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6 -isopentenyladenine, uracil-5- oxyacetic acid, wybutoxosine, pseudo uracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, 3-(3-amino-3-carboxypropyl)uridine 2,6- diaminopurine and the like. In some cases, nucleotides may include modifications in their phosphate moieties, including modifications to a triphosphate moiety. Non-limiting examples of such modifications include phosphate chains of greater length (e.g., a phosphate chain having, 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications with thiol moieties (e.g., alpha-thiotriphosphate and beta-thiotriphosphates). Nucleic acid molecules may also be modified at the base moiety (e.g., at one or more atoms that typically are available to form a hydrogen bond with a complementary nucleotide and / or at one or more atoms that are not typically capable of forming a hydrogen bond with a complementary nucleotide), sugar moiety or phosphate backbone. Nucleic acid molecules may also contain amine -modified groups, such as amino ally 1-dUTP (aa-dUTP) and aminohexhylacrylamide- dCTP (aha-dCTP) to allow covalent attachment of amine reactive moieties, such as N-hydroxy succinimide esters (NHS). Alternatives to standard DNA base pairs or RNA base pairs in the oligonucleotides of the present disclosure can provide higher density in bits per cubic mm, higher safety (resistant to accidental or purposeful synthesis of natural toxins), easier discrimination in photoprogrammed polymerases, or lower secondary structure. Such alternative base pairs compatible with natural and mutant polymerases for de novo and / or amplification synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. NAT. CHEM. BIOL. 2012 Jul ;8(7) :612-4, which is herein incorporated by reference for all purposes.As used herein, “polypeptide” means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single molecule or a multi-molecular complex such as a dimer, trimer, or tetramer. They can also comprise single chain or multichain polypeptides such as antibodies or insulin and can be associated or linked. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.As used herein, the term “polyribonucleotide cargo” herein includes any sequence including at least one polyribonucleotide. In embodiments, the polyribonucleotide cargo includes one or multiple expression sequences, wherein each expression sequence encodes an immunogen. In embodiments, the polyribonucleotide cargo includes one or multiple noncoding sequences, such as a polyribonucleotide having regulatory or catalytic functions. In embodiments, the polyribonucleotide cargo includes a combination of expression and noncoding sequences. In embodiments, the polyribonucleotide cargo includes one or more polyribonucleotide sequence described herein, such asone or multiple regulatory elements, internal ribosomal entry site (IRES) elements, or spacer elements.As used herein, the term “prevent” means to reduce the likelihood of developing a disease, disorder, or condition, or alternatively, to reduce the severity or frequency of symptoms in a subsequently developed disease or disorder. The polyribonucleotides described herein can be administered to a subject who is at increased risk of developing a disease or disorder relative to a member of the general population in order to prevent the development of, or lessen the severity of, the disease or condition. The polyribonucleotides described herein can be administered as a prophylactic (e.g., before development of any symptom or manifestation of a disease or disorder).As used herein, the terms “purify,” “purifying,” and “purification” refer to one or more steps or processes of removing impurities (e.g., a process-related impurity (e.g., an enzyme), a process- related substance (e.g., a deoxyribonucleotide fragment, a deoxyribonucleotide monomer)) or byproducts (e.g., linear RNA) from a sample containing a mixture circular RNA and linear RNA, among other substances, to produce a composition containing an enriched population of circular RNA with a reduced level of an impurity (e.g., a process-related impurity (e.g., an enzyme), a process-related substance (e.g., deoxyribonucleotide fragment, deoxyribonucleotide monomer)) or by-product (e.g., linear RNA) as compared to the original mixture or in which the linear RNA or substances have been reduced by 40% or more by mass (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% or more) relative to a starting mixture.As used herein, the terms “pure” and “purity” refer to the extent to which an analyte (e.g., circular RNA) has been isolated and is free of other components. In the context of nucleic acids (e.g., polyribonucleotides), purity of an isolated nucleic acid (e.g., circular RNA) can be expressed with regard to the population of nucleic acids that is free of any contaminants, impurities, or by-products (e.g., linear RNA and other substances). For example, purity of a population of circular RNA indicates how much of the population is circular RNA by total mass of the isolated material, which may be determined using, e.g., pure circular RNA as a reference. A level of purity found in the disclosure can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, greater than 95%, or greater than 99% (w / w). In some embodiments, the level of contaminants or impurities or by-products is no more than about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w). Purity can be determined by detecting a level of a specific analyte (e.g., circular RNA) or a specific impurity or by-product (e.g., linear RNA) using gel electrophoresis, spectrophotometry (e.g., NanoDrop by ThermoFisher Scientific), or other technique suitable for measuring purity of a population of nucleic acids and calculating a percentage of the analyte (w / w) relative to the total nucleic acid content (e.g., as determined by an assay known in the art).As used herein, the phrase “substantially free of one or more impurities or by-products” refers to a property of a sample, such as a sample containing an enriched population of circular RNA, that is free of one or more impurities or by-products (e.g., one or more impurities or by-products disclosed herein) or contains a minimal amount of the one or more impurities or by-products. A minimal amount of the one or more impurities or by-products may be no more than 20% (w / w) (e.g., no more than 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%(w / w), or less). In another example, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount that is less than 15% (w / w) (e.g., no more than 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In another example, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount that is less than 10% (w / w) (e.g., no more than 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In another example, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount that is less than 5% (w / w) (e.g., no more than 4%, 3%, 2%, 1% (w / w) or less). In yet another example, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount that is less than 1% (no more than 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% (w / w), or less).As used herein, the term “regulatory element” is a moiety, such as a nucleic acid sequence, that modifies expression of an expression sequence within the circular polyribonucleotide.As used herein, the term “replication element” is a sequence and / or motif useful for replication or that initiates transcription of the circular polyribonucleotide.As used herein, the term “RNA equivalent” refers to an RNA sequence that is the RNA equivalent of a DNA sequence. An RNA equivalent of a DNA sequence therefore refers to a DNA sequence in which each of the thymidine (T) residues is replaced by a uridine (U) residue. The disclosure specifically contemplates that any of these DNA sequences may be converted to the corresponding RNA sequence and included in an RNA molecule described herein.As used herein, the term “sequence identity” is determined by alignment of two peptide or two nucleotide sequences using a global or local alignment algorithm. Sequences may then be referred to as "substantially identical” or “essentially similar” when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizes the number of gaps. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) 18 (proteins) and gap extension penalty = 3 (nucleotides) 12 (proteins). For nucleotides the default scoring matrix used is a nwsgapdna.cmp scoring matrix and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121 -3752 USA, or EmbossWin version 2.10.0 (using the program “needle”). Alternatively, or additionally, percent identity may be determined by searching against databases, using algorithms such as FASTA, BLAST, etc. Sequence identity refers to the sequence identity over the entire length of the sequence.A “signal sequence” refers to a polypeptide sequence, e.g., between 10 and 45 amino acids in length, that is present at the N-terminus of a polypeptide sequence of a nascent protein which targets the polypeptide sequence to the secretory pathway.As used herein, the term “spacer element” refers to any contiguous nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. Spacer elements may be present in between any of the nucleic acid elements described herein. Spacer element may also be present within a nucleic acid element described herein.As used herein, the term “stability element” refers to a polyribonucleotide element which increases the stability of the polyribonucleotide in comparison to a polyribonucleotide lacking the stability element. The stability element may increase stability of the polyribonucleotide such that the polyribonucleotide degrades more slowly.As used herein, the term "subject" refers to an organism, such as an animal, plant, or microbe. In embodiments, the subject is a vertebrate animal (e.g., mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal such as a non-human primate (e.g., monkeys, apes), ungulate (e.g., cattle, buffalo, bison, sheep, goat, pig, camel, llama, alpaca, deer, horses, donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse), or lagomorph (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the avian taxa Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate such as an arthropod (e.g., insects, arachnids, crustaceans), a nematode, an annelid, a helminth, or a mollusc. In embodiments, the subject is an invertebrate agricultural pest or an invertebrate that is parasitic on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm plant (which can be a dicot or a monocot) or a gymnosperm plant (e.g., a conifer, a cycad, a gnetophyte, a Ginkgo), a fern, horsetail, clubmoss, or a bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is a plant of agricultural or horticultural importance, such as row crop plants, fruit-producing plants and trees, vegetables, trees, and ornamental plants including ornamental flowers, shrubs, trees, groundcovers, and turf grasses.As used herein, the term “translation enhancer” refers to a polyribonucleotide element, which allows for translation of mRNA via recruitment of a ribosome, translation initiation factor directly or through interacting with RNA-binding protein. The polyribonucleotides including a translation enhancer may, for example, demonstrate increased stability and / or increased expression of a polyribonucleotide cargo encoding an immunogen in comparison to a polyribonucleotide lacking the translation enhancer. As used herein, the term “termination element” is a moiety, such as a nucleic acid sequence, that terminates translation of the expression sequence in the circular polyribonucleotide.As used herein, the term “total ribonucleotide molecules” means the total amount of any ribonucleotide molecules, including linear polyribonucleotide molecules, circular polyribonucleotidemolecules, monomeric ribonucleotides, other polyribonucleotide molecules, fragments thereof, and modified variations thereof, as measured by total mass of the ribonucleotide molecules.As used herein, the term “translation efficiency” is a rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as amount of protein or peptide produced per given amount of transcript that codes for the protein or peptide, e.g., in a given period of time, e.g., in a given translation system, e.g., an in vitro translation system like rabbit reticulocyte lysate, or an in vivo translation system like a eukaryotic cell or a prokaryotic cell.As used herein, the term “translation initiation sequence” is a nucleic acid sequence that initiates translation of an expression sequence in the circular polyribonucleotide.As used herein, the terms “treat,” or “treating,” refers to a treatment of a disease or disorder (e.g., an infectious disease, a cancer, a toxicity, or an allergic reaction) in a subject. The effect of treatment can include reversing, alleviating, reducing severity of, curing, inhibiting the progression of, reducing the likelihood of recurrence of the disease or one or more symptoms or manifestations of the disease or disorder, stabilizing (i.e. , not worsening) the state of the disease or disorder, and / or preventing the spread of the disease or disorder as compared to the state and / or the condition of the disease or disorder in the absence of the treatment.As used herein, a “variant” refers to a polypeptide which includes at least one alteration, e.g., a substitution, insertion, deletion, and / or fusion, at one or more residue positions, as compared to the parent or wild-type polypeptide. A variant may include between 1 and 10, 10 and 20, 20 and 50, 50 and 100, or more alterations.BRIEF DESCRIPTION OF THE DRAWINGSFIGS. 1A-1F are schematic diagrams of exemplary linear and circular polyribonucleotide constructs having spacer element(s) and / or expression augmenting element(s).FIG. 2 is a table showing the circularization efficiency (%circRNA) of single spacer designs or dual spacer design constructs having a spacer element(s) between 50 and 300 nucleotides in length, wherein the construct encodes a Glue polypeptide or human erythropoietin.FIG. 3A is a table of translation enhancers, including motifs and sequences.FIG. 3B is a table showing the circularization efficiency (%circRNA) of single design and dual design constructs having a spacer element and / or a translation enhancer and encoding a Glue polypeptide.FIG. 4A is a bar graph showing expression of Glue in HeLa cells transfected with circular RNAs having a spacer element and encoding a Glue polypeptide, 24 and 48 hours after transfection.FIG. 4B is a graph showing expression of EPO in HeLa cells transfected with circular RNAs having a spacer element and encoding a human erythropoietin, 24 and 48 hours after transfection.FIG. 5 is a bar graph showing expression of Glue in HeLa cells transfected with circular RNAs having a single spacer design or a dual spacer design and encoding a Glue polypeptide, 24 hours after transfection.FIG. 6A is a bar graph showing expression of Glue in HeLa cells transfected with circular RNAs having a dual spacer design and encoding a Glue polypeptide, 4, 24, and 48 hours after transfection.FIG. 6B is a bar graph showing expression of EPO in HeLa cells transfected with circular RNAs having a dual spacer design and encoding a human erythropoietin, 4, 24, and 48 hours after transfection.FIG. 7A is a bar graph showing expression of Glue in A549 cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding a Glue polypeptide.FIG. 7B is a bar graph showing expression of EPO in A549 cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding human erythropoietin, 24 hours after transfection.FIG. 8 is a bar graph showing the expression of EPO in HEK cells transfected with a circular polyribonucleotide having a translation enhancer and encoding a human erythropoietin, at Day 1 and Day 2 after transfection.FIG. 9 is a bar graph showing the expression of EPO in HeLa cells transfected with a circular polyribonucleotide having a translation enhancer and encoding a human erythropoietin, at Day 1 and Day 2 after transfection.FIG. 10 is a bar graph showing in vivo expression of EPO encoded by a circular polyribonucleotide including a translation enhancer.FIG. 11 is a graph showing the expression of EPO in A549 cells transfected with circular polyribonucleotides having spacer elements and / or translation enhancers and encoding a human erythropoietin with a CVB3 IRES, 24 hours after transfection.FIG. 12 is a graph showing the expression of EPO in A549 cells transfected with circular polyribonucleotides having spacer elements and / or translation enhancers and encoding a human erythropoietin with an EMCV IRES, 24 hours after transfection.FIG. 13 is a graph showing the expression of EPO in A549 cells transfected with circular polyribonucleotides having multiple spacer elements and multiple translation enhancers and encoding a human erythropoietin and a SARS-CoV-2 RBD polypeptide, 24 hours after transfection of the cells.FIGS. 14A and 14B are graphs showing the time course of expression of EGFPd2 in A549 cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding a EGFPd2 polypeptide. FIG. 14A shows the expression of EGFPd2 over time. FIG. 14B shows the area under the curve from 0 to 24 hours.FIGS. 15A-15C are bar graphs showing expression of EPO in A549 cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding a human erythropoietin, 24 hours after transfection of the cells.FIGS. 16A and 16B are bar graphs showing expression of EPO in A549 cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding a human erythropoietin, 24 hours after transfection.FIGS. 17A-17C are bar graphs showing HiBiT expression in HEK cells transfected with circular RNAs having a spacer element and a translation enhancer and encoding a Factor 9-Albumin- HiBiT polypeptide, 24 hours after transfection.FIGS. 18A and 18B are bar graphs showing the expression of Glue in HeLa cells transfected with different concentrations of circular RNA having a spacer element and a minimized or full length elF4g aptamer translation enhancer and encoding a Glue polypeptide, 48 hours after transfection.FIG. 19 is a bar graph showing CFTR expression in HEK293T cells which were transfected with one of twelve (12) different circular RNAs encoding CFTR.FIG. 20 is a bar graph showing SARS-CoV-2 Spike expression detected on the cell surface of HEK293T cells which were transfected with one of thirteen (13) different circular RNAs encoding SARS-CoV-2 Spike protein.FIG. 21 is a bar graph showing VZV gE expression detected on the cell surface of HEK293T cells which were transfected with one of four different circular RNAs encoding VZV gE.FIG. 22 is a graph showing the relative amount of circular polyribonucleotide present over time for circular polyribonucleotides having a 5’ spacer element and a 3’ RNA stability element and encoding a EGFPd2 polypeptide with a modified CVB3 IRES.FIG. 23A-FIG. 23C are a series of bar graphs showing the concentration of polypeptide Factor 9-HiBiT encoded by circular polyribonucleotides having a 5’ spacer element and a 3’ translation enhancer and encoding a Factor 9-HiBiT, 24 hours post-transfection.FIG. 24A and FIG. 24B are graphs showing the time course of expression data for EGFPd2 encoded by circular polyribonucleotides having spacer elements and / or translation enhancers and encoding EGFPd2 with a modified CVB3 IRES, where FIG. 24A shows EGFPd2 expression over time and FIG. 24B shows the area under the curve from 0 to 24 hours.FIG. 25A and FIG. 25B are graphs showing the time course of expression data for EGFPd2 encoded by a circular polyribonucleotide having a 5’ translation enhancer and a 3’ spacer element and encoding EGFPd2 with a modified CVB3 IRES, where FIG. 25A shows EGFPd2 expression over time and FIG. 25B shows the area under the curve from 0 to 24 hours.FIG. 26A and FIG. 26B are bar graphs showing the concentration of polypeptide B-HiBiT encoded by a circular polyribonucleotide having a 5’ spacer element and a 3’ translation enhancer and encoding polypeptide B-HiBiT with a EV69 IRES (FIG. 26A) or a modified CVB3 IRES (FIG. 26B), 24 hours post-transfectionFIG. 27 is a bar graph showing the concentration of polypeptide B-HiBiT encoded by circular polyribonucleotides having multiple translation enhancers or multiple spacer elements.FIG. 28 shows the expression of polypeptide G encoded by circular polyribonucleotides having spacer elements and / or translation enhancers and encoding polypeptide G with a modified CVB3 IRES, 24 hours post-transfection.FIG. 29A and FIG. 29B are bar graphs showing the area under the curve for GFPd2 (FIG. 29A) and concentration of polypeptide B-HiBiT (FIG. 29B) wherein the polypeptide is encoded by a circular polyribonucleotide having a single spacer design or a dual spacer design.FIG. 30A and FIG. 30B are bar graphs showing the area under the curve for GFPd2 encoded by circular polyribonucleotides having a single spacer design or a dual spacer design.FIG. 31 A and FIG. 31 B are bar graphs showing the area under the curve for polypeptide B- HiBiT encoded by circular polyribonucleotides having a single spacer design or a dual spacer design.FIG. 32A-FIG. 32D are bar graphs showing the area under the curve for GFPd2 encoded by circular polyribonucleotides having a spacer element(s) and / or a translation enhancer(s), wherein the translation enhancer is FcIgG (FIG. 32A), TP53I3 (FIG. 32B), LSP1 (FIG. 32C), or Histone4E (FIG. 32D).FIG. 33A-FIG. 33D are bar graphs showing the concentration of polypeptide B-HiBiT encoded by circular polyribonucleotides having a spacer element(s) and / or a translation enhancer(s), wherein the translation enhancer is FcIgG (FIG. 33A), TP53I3 (FIG. 33B), LSP1 (FIG. 33C), or Histone4E (FIG. 33D).FIG. 34A-FIG. 34D are bar graphs showing the area under the curve for GFPd2 encoded by circular polyribonucleotides having a translation enhancer, wherein the translation enhancer is TBR16 (FIG. 34A), 12S (FIG. 34B), TRAM1 - (FIG. 34C), and GPX4 (FIG. 34D).FIG. 35A-FIG. 35D are bar graphs showing the concentration of polypeptide B-HiBiT encoded by circular polyribonucleotides having a translation enhancer, wherein the translation enhancer is TBR16 (FIG. 35A), 12S (FIG. 35B), TRAM1 - (FIG. 35C), and GPX4 (FIG. 35D).DETAILED DESCRIPTIONThe present disclosure features compositions including polyribonucleotides having one or more expression augmenting elements or spacer elements. The polyribonucleotides described herein are particularly useful in increasing the stability and / or increasing the expression of a polynucleotide cargo (e.g., encoding an immunogen) encoded by the polyribonucleotide.The disclosure provides polyribonucleotides including a first post-circularization element; a first expression augmenting element having a length of at least 100 ribonucleotides; a polyribonucleotide cargo encoding an immunogen; a second expression augmenting element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. The disclosure also provides polyribonucleotides having a first post-circularization element; a first spacer element having a length of at least 100 ribonucleotides; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. The disclosure also provides polyribonucleotides having a first post-circularization element; a first spacer element; a polyribonucleotide cargo encoding an immunogen; a second spacer element having a length of at least 100 ribonucleotides; and a second post-circularization element; and wherein the first postcircularization element and the second post-circularization element together form a circularization junction.The polyribonucleotide constructs described herein may show increased stability, potentially increasing the length of time the polyribonucleotide may persist before degradation. Additionally, thepolyribonucleotide constructs described herein may show increased expression of a polynucleotide cargo encoded by the polyribonucleotide. Each of the DNA sequences described herein include the RNA equivalent sequence, as would be understood by one skilled in the art. Likewise, all RNA sequences described herein include the DNA equivalent sequence, as would be understood by one skilled in the art. The molecules, methods of producing, and uses thereof are described in more detail below.Circular Polyribonucleotides ElementsThe circular polyribonucleotide may include from 5’ to 3’ a first post-circularization element; one or more expression augmenting element; a polyribonucleotide cargo encoding an immunogen; and a second post-circularization element. In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first post-circularization element; a polyribonucleotide cargo; one or more expression augmenting element; and a second post-circularization element.In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first postcircularization element; a first expression augmenting element; a polyribonucleotide cargo; a second expression augmenting element; and a second post-circularization element.In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first postcircularization element; a spacer element; a polyribonucleotide cargo; an expression augmenting element and a second post-circularization element. In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first post-circularization element; a polyribonucleotide cargo encoding an immunogen; one or more expression augmenting element; and a second postcircularization element. In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first post-circularization element; a first expression augmenting element; a polyribonucleotide cargo encoding an immunogen; a second expression augmenting element; and a second postcircularization element. In some embodiments, the circular polyribonucleotide includes from 5’ to 3’ a first post-circularization element; a first spacer element having a length of at least 100 ribonucleotides; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second postcircularization element.The circular polyribonucleotides as disclosed herein comprise a first post-circularization element; (b) a first spacer element having at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides). The circular polyribonucleotide disclosed herein also includes a polyribonucleotide cargo encoding an immunogen and a second spacer element. In some embodiments, the second spacer element has a length of at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides) ribonucleotides. For example, the second spacer element may have a length of between 120 and 500 (e.g., between 120 and 400, 120 and 300, 120 and 200, 120 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 400 and 500, or 350 and 500) ribonucleotides. In some embodiments, the second spacer element has a length of between 100 and 300 (e.g., between 100 and 280, 100 and 260, 100 and 240, 100 and 220, 100 and 200, 100 and 180, 100 and 160, 100 and 140, 100 and 120, 120 and 300, 140 and 300, 160 and 300, 180 and 300, 200 and 300, 220 and 300, 240 and 300, 260and 300, or 280 and 300) ribonucleotides. In some embodiments, the second spacer element has a length of between 200 and 500 (e.g., between 200 and 450, 200 and 400, 200 and 350, 200 and 300, 200 and 250, 250 and 500, 300 and 500, 350 and 500, 400 and 500, 450 and 500, 300 and 500, or 300 and 400) ribonucleotides.Expression Augmenting ElementsThe polyribonucleotides described herein may include one or more expression augmenting elements. In some embodiments, the circular or linear polyribonucleotides include between 1 and 5 expression augmenting elements (e.g., 1 , 2, 3, 4, or 5 expression augmenting elements). For example, the circular or linear polyribonucleotides may include a first expression augmenting element and a second expression augmenting element. The one or more expression augmenting elements may include a translation enhancer, a stability element, a translation enhancer fused (e.g., joined, connected) to a spacer element, or a stability element fused (e.g., joined, connected) to a spacer element. In some embodiments, circular or linear polyribonucleotides includes a translation enhancer and a stability element.The polyribonucleotides described herein may include the combinations of elements as described in Table 1 in 5’ to 3’ order. One or more spacer elements may be included between any one the elements described in Table 1 .Table 1. Exemplary Constructst The spacer element may be fused to the 5’ end or the 3’ end of the Translation Enhancer or Stability ElementTranslation EnhancersThe polyribonucleotides described herein may include a first expression augmenting element or a second expression augmenting element. The first expression augmenting element may include a translation enhancer. The second augmenting element may include translation enhancer. In some embodiments, a circular or linear polyribonucleotide described herein includes one or more translation enhancers. In some embodiments, a translation enhancer may be fused (e.g., joined, connected) to a spacer element. Translation enhancers may be present in between any of the nucleic acid elements described herein. Translation enhancers may also be present within a nucleic acid element described herein. In some embodiments, a translation enhancer is a spacer element. In some embodiments, a translation enhancer is a stability element.In some embodiments, the translation enhancer is from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer comprises nucleic acid sequence comprising a fragment from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%< 99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer is from a gene encoding a BYDV like-element (BTE), a translation enhancer element (TED), a PMV / PEMV-like translation enhancer (PTE), an l-shaped structure (ISS), a Y-shaped structure (YSS), a t-shaped structure (TSS), dumbbell shaped structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, hepatitis B virus posttranscriptional regulatory element, human genomic fragments, a histone mRNA sequence, a cyclin D mRNA sequence, or an elF4g aptamer sequence. In some embodiments, the translation enhancer element is from a plant virus. In some embodiments, the translation enhancer comprises nucleic acid sequence comprising a fragment from a plant virus. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%< 99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a plant virus. In some embodiments, the plant virus is a Barley yellow dwarf virus (BYDV) like-element (BTE) translation enhancer. Non-limiting examples of plant viruses with BTEs include BYDV, TNVD, OLV1 , LWSV, SCNMV, CRSV, TBTV, GRV, OMMV, BBSV, RSDaV, and OPMV. BTEs bind to elF4g with high affinity. In particular embodiments, a circular or linear polyribonucleotide comprises a BTE sequence described in TABLE 2. In some embodiments, the BTE comprises a sequence having at least about80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 2, SEQ ID NOs: 1 -22.In some embodiments, the translation enhancer element is from a plant virus containing a TED. Non-limiting examples of plant viruses with TEDs include STNV, PLPV, PCRPV, ELV, RrLDV, PelRSV, and CbMV. TEDs bind to elF4F with high affinity. In particular embodiments, a circular or linear polyribonucleotide comprises a TED sequence described in TABLE 3. In some embodiments, the TED comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 3, SEQ ID NOs: 23-29.In some embodiments, the translation enhancer element is from a plant virus containing a Panicum mosaic virus / Pea enation mosaic virus (PMV / PEMV)-like translation enhancer (PTE) translation enhancer. Non-limiting examples of plant viruses with PTEs SCV, PFBV, CarMV, HnRSV, PSNV, HCRSV, GaMV, CMMV, TPAV, JINRV, PEMV2, PMV, MCMV, BGLV, AdMV, and CLSV. PTEs bind to elF4E with high affinity. In particular embodiments, a circular or linear polyribonucleotide comprises a PTE sequence described in TABLE 4. In some embodiments, the PTE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 4, SEQ ID NOs: 30-46.In some embodiments, the translation enhancer element is from a plant virus containing an ISS translation enhancer. Non-limiting examples of plant viruses with ISSs include MNeSV, MNSV264, CBV, MWLMV, JCSMV, and GoMVA. ISSs bind to elF4E bound to elF4G. In particular embodiments, a circular or linear polyribonucleotide comprises a TSS sequence described in TABLE5. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 5, SEQ ID NOs: 47-53In some embodiments, the translation enhancer element is from a plant virus containing a YSS translation enhancer. Non-limiting examples of plant viruses with YSSs include TBSV, CIRV, CymRSV, CNV, AMCV, PNSV, GALV, PLCV, PeLV, and LNV. YSSs bind to elF4F. In particular embodiments, a circular or linear polyribonucleotide comprises a YSS sequence described in TABLE6. In some embodiments, the YSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 6, SEQ ID NOs: 54-63.In some embodiments, the translation enhancer element is from a plant virus containing a TSS translation enhancer. Non-limiting examples of plant viruses with TSSs include TYMV, RCNM, TCV, and CCFV. TSSs bind to the 60s ribosomal subunit. In particular embodiments, a circular or linear polyribonucleotide comprises a TSS sequence described in TABLE 7. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 7, SEQ ID NOs: 64-67.In some embodiments, the translation enhancer element is from a plant virus containing a dumbbell-shaped translation enhancer. A non-limiting example of a plant virus with a dumbbellshaped translation enhancer includes CABYV-X. In particular embodiments, a circular or linear polyribonucleotide comprises a dumbbell-shaped translation enhancer sequence described in TABLE 8 SEQ ID NO: 68. In some embodiments, the dumbbell-shaped enhancer comprises a sequencehaving at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 8, SEQ ID NO: 68.In some embodiments, the translation enhancer element is from a gene from a mammal. In some embodiments, the translation enhancer comprises nucleic acid sequence comprising a fragment from a mammalian gene. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%< 99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a mammalian gene. The gene from a mammal may be, but is not limited to, histone or cyclin D mRNA sequences that binds to elF4E. In some embodiments, the translation enhancer element is from a synthetic sequence, including but not limited to, an elF4G aptamer that binds to elF4G. In some embodiments, the translation enhancer element is from a viral sequence. Non-limiting examples of translation enhancers from viral sequences are HCV and DENV. In particular embodiments, a circular or linear polyribonucleotide comprises a mammalian, synthetic, or viral translation enhancer sequence described in TABLE 8. In some embodiments, the mammalian, synthetic, or viral translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 8, SEQ ID NOs: 68-159, and 321 -335.In particular embodiments, a circular or linear polyribonucleotide comprises a translation enhancer element described in TABLE 2-8. In some embodiments, the translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from TABLE 2-8.In certain embodiments, the translation enhancer includes a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity) sequence identity with the nucleic acid sequence of any one of SEQ ID NOs: 1 -159, 264-267, or 278-335. In some embodiments, the translation enhancer includes a nucleic acid sequence having at least 90% (e.g., at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity) identity with the nucleic acid sequence of any one of SEQ ID NOs: 1 -159, 264-267, or 278-335. In some embodiments, the translation enhancer includes a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity) identity with the nucleic acid sequence of any one of SEQ ID NOs: 1 -159, 264-267, or 278-335. In some embodiments, the translation enhancer includes a nucleic acid sequence having a nucleic acid sequence of any one of SEQ ID NOs: 1 -159, 264-267, 278-335.In some embodiments, the translation enhancer element may be TBR16, 12S, TRAM1 , or GPX4.The translation enhancer element may be a 5’ UTR or a 3’ UTR. In some embodiments, the 5’ UTR or 3’ UTR is a human translation enhancer. In some embodiments, the 5’ UTR or 3’ UTR comprises any one of the 5’ UTRs or 3’ UTRs described in Table 9, or a portion thereof.The translation enhancer element may have between 20 and 750 ribonucleotides (e.g., between 20 and 700, 20 and 650, 20 and 600, 20 and 550, 20 and 500, 20 and 450, 20 and 400, 20 and 350, 20 and 300, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 50, 50 and 100, 50 and 750, 100 and 750, 150 and 750, 200 and 750, 250 and 750, 300 and 750, 350 and 750, 400 and750, 450 and 750, 500 and 750, 550 and 750, 600 and 750, 650 and 750, and 700 and 750 ribonucleotides). For example, translation enhancer may have a length of between 100 and 500 ribonucleotides (e.g., between 100 and 450, 100 and 400, 100 and 350, 100 and 300, 100 and 250, 100 and 200, 100 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500 ribonucleotides).Table 2. BTE sequencesTable 3. TED sequencesTable 4. PTE sequencesTable 5. ISS sequencesTable 6. YSS sequencesTable 7. TSS sequencesTable 8. Additional translation enhancer elementsThe expression augmenting element may include a translation enhancer fused to a spacer element.The spacer element may be conjugated to the 5’ end of the translation enhancer. In some embodiments, the spacer element may be conjugated to the 3’ end of the translation enhancer.Stability ElementsThe polyribonucleotides described herein may include a first expression augmenting element wherein the first expression augmenting element may include a stability element. The second expression augmenting element may include a stability element. The second spacer element may include an expression augmenting element. One or more of the expression augmenting elements may be a stability element. In some embodiments, the stability element is a translation enhancer. In some embodiments, a stability element is a spacer element. The stability element may be a 5’ UTR or a 3’ UTR. In some embodiments, the 5’ UTR or 3’UTR is a human UTR. In some embodiments, the 5’ UTR or 3’ UTR comprises any one of the 5’ UTRs or 3’ UTRs described in Table 9 below, or a portion thereof. The 5’ UTR or 3’ UTR may be froma gene encoding a TRAM1 , a TMED2, a VAMP3, CRIP, an AP2A2, a PSMD5, a GPX4, or a PRKAB1 . The 5’ UTR or 3’ UTR may be a 5’ UTR or 3’ UTR from a human beta actin, DDB2, TP53I3, FcIgG, LSP1 , AES, DRB4, or a mitochondrially encoded 12S rRNA.The stability element may include between 50 and 2000 ribonucleotides (e.g., between 50 and 1500, 50 and 1000, 50 and 500, 50 and 100, 100 and 2000, 500 and 2000, 1000 and 2000, or 1500 and 2000). The stability element may include between 20 and 750 ribonucleotides (e.g., between 20 and 700, 20 and 650, 20 and 600, 20 and 550, 20 and 500, 20 and 450, 20 and 400, 20 and 350, 20 and 300, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 50, 50 and 100, 50 and 750, 100 and 750, 150 and 750, 200 and 750, 250 and 750, 300 and 750, 350 and 750, 400 and 750, 450 and 750, 500 and 750, 550 and 750, 600 and 750, 650 and 750, and 700 and 750 nucleotides). For example, the stability element may have a length of between 100 and 500 ribonucleotides (e.g., between 100 and 450, 100 and 400, 100 and 350, 100 and 300, 100 and 250, 100 and 200, 100 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500 ribonucleotides).The expression augmenting element may include a stability element fused to a spacer element. The spacer element may be conjugated to the 5’ end of the stability element. In some embodiments, the spacer element not encoding an expression augmenting element may be conjugated to the 3’ end of the stability element.The stability element may be any known stability element. In some embodiments, the stability element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 9. In some embodiments, the stability element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 9. In some embodiments, the stability element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 9. In some embodiments, the stability element has a nucleic acid sequence of any one of the sequences described in TABLE 9.Table 9. Stability Element SequencesUntranslated regionsIn some embodiments, a circular or linear polyribonucleotide includes untranslated regions (UTRs). In some embodiments, the stability element may include a UTR. In some embodiments, the translation enhancer may include a UTR. In some embodiments, the UTR is a 3’ UTR. In some embodiments, the UTR is a 5’ UTR. UTRs of a genomic region including a gene may be transcribed but not translated. In some embodiments, a UTR may be included upstream of the translation initiation sequence of an expression sequence described herein. In some embodiments, a UTR may be included downstream of an expression sequence described herein. In some instances, one UTR for the first expression sequence is the same as or continuous with or overlapping with another UTR for a second expression sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, e.g., ZKSCAN1 .Exemplary untranslated regions are described in paragraphs

[0197] -

[0201] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety. In some embodiments, a circular polyribonucleotide includes a poly-A sequence. Exemplary poly-A sequences are described in paragraphs

[0202] -

[0205] of International Patent Publication No WO2019 / 118919, which is hereby incorporated by reference in its entirety. In some embodiments, a circular polyribonucleotide lacks a poly-A sequence.In some embodiments, a circular or linear polyribonucleotide includes a UTR with one or more stretches of Adenosines and Uridines embedded within. These AU rich signatures may increase turnover rates of the expression product.Introduction, removal, or modification of UTR AU rich elements (AREs) may be useful to modulate the stability, or immunogenicity (e.g., the level of one or more markers of an immune or inflammatory response) of the circular or linear polyribonucleotide. When engineering specific circular polyribonucleotides, one or more copies of an ARE may be introduced to the circular polyribonucleotide and the copies of an ARE may modulate translation and / or production of an expression product. Likewise, AREs may be identified and removed or engineered into the circular polyribonucleotide to modulate the intracellular stability and thus affect translation and production of the resultant protein.It should be understood that any UTR from any gene may be incorporated into the respective flanking regions of the circular polyribonucleotide.In some embodiments, a circular polyribonucleotide lacks a 5’-UTR and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a 3’-UTR and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a poly-A sequence and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a termination element and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks an internal ribosomal entry site and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a cap and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a 5’- UTR, a 3’-UTR, and an IRES, and is competent for protein expression from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide includes one or more of the following sequences: a sequence that encodes one or more miRNAs, a sequence that encodes one or more replication proteins, a sequence that encodes an exogenous gene, a sequence that encodes an immunogen, a regulatory element (e.g., translation modulator, e.g., translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids that targets endogenous genes (e.g., siRNA, IncRNAs, shRNA), and a sequence that encodes an immunogen.In some embodiments, a circular or linear polyribonucleotide lacks a 5’-UTR. In some embodiments, the circular polyribonucleotide lacks a 3’-UTR. In some embodiments, the circular polyribonucleotide lacks a poly-A sequence. In some embodiments, the circular or linear polyribonucleotide lacks a termination element. In some embodiments, the circular or linear polyribonucleotide lacks an internal ribosomal entry site. In some embodiments, the circular or linear polyribonucleotide lacks degradation susceptibility by exonucleases. In some embodiments, the fact that the circular polyribonucleotide lacks degradation susceptibility can mean that the circular polyribonucleotide is not degraded by an exonuclease, or only degraded in the presence of anexonuclease to a limited extent, e.g., that is comparable to or similar to in the absence of exonuclease. In some embodiments, the circular polyribonucleotide is not degraded by exonucleases. In some embodiments, the circular polyribonucleotide has reduced degradation when exposed to exonuclease. In some embodiments, the circular polyribonucleotide lacks binding to a cap-binding protein. In some embodiments, the circular polyribonucleotide lacks a 5’ cap.Spacer ElementsIn some embodiments, the polyribonucleotide includes one or more spacer elements. For example, either the first expression augmenting element or the second expression augmenting element may include a spacer element fused to a translation enhancer or a spacer element fused to a stability element. In some embodiments, the spacer may be fused to the 5’ end of the translation enhancer or stability element. In some embodiments, the spacer may be fused to the 3’ end of the translation enhancer or stability element. In some embodiments, a spacer element is a translation enhancer. Not all spacers are translation enhancers. In some embodiments, a spacer element is a stability element. Not all spacers are stability elements. A spacer element refers to any contiguous nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. Spacer elements may be present in between any of the nucleic acid elements described herein. Spacer element may also be present within a nucleic acid element described herein. The circular polyribonucleotide may include a first post-circularization element; a first spacer element having a length of at least 100 ribonucleotides; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. The circular polyribonucleotide may include a first post-circularization element; a first spacer element; a polyribonucleotide cargo encoding an immunogen; a second spacer element having a length of at least 100 ribonucleotides; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.In some embodiments, the spacer element has a length of at least 100 ribonucleotides. The spacer element may have a length of between 100 to 500 (e.g., between 100 and 400, 100 and 300, 100 and 200, 200 and 500, 300 and 500, 400 and 500, 200 and 400, or 200 and 300) ribonucleotides. For example, the spacer element not including an expression augmenting element may have a length of between 120 and 500 (e.g., between 120 and 400, 120 and 300, 120 and 200, 120 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 400 and 500, or 350 and 500) ribonucleotides. In some embodiments, the spacer element includes between 110 and 500 (e.g., between 110 and 400, 110 and 300, 110 and 200, 110 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 400 and 500, or 350 and 500) ribonucleotides. In some embodiments, the spacer element includes between 100 and 300 (e.g., between 100 and 280, 100 and 260, 100 and 240, 100 and 220, 100 and 200, 100 and 180, 100 and 160, 100 and 140, 100 and 120, 110 and 300, 120 and 300, 140 and 300, 160 and 300, 180 and 300, 200 and 300, 220 and 300, 240 and 300, 260 and 300, or 280 and 300) ribonucleotides. In some embodiments, the spacer element has a length of between 200 and 500(e.g., between 200 and 450, 200 and 400, 200 and 350, 200 and 300, 200 and 250, 250 and 500, 300 and 500, 350 and 500, 400 and 500, 450 and 500, 300 and 500, or 300 and 400) ribonucleotides. In some embodiments, the spacer element has at least 50 ribonucleotides. For example, the spacer element may have between 50 and 500 ribonucleotides (e.g., 50 and 100, 50 and 150, 50 and 200, 50 and 250, 50 and 300, 50 and 350, 50 and 400, 50 and 450, 100 and 500, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500).In some embodiments, the spacer element has a length of about 50 (e.g., 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, or 55) ribonucleotides. In some embodiments, the spacer element has a length of about 80 (e.g., 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, or 88) ribonucleotides. In some embodiments, the spacer element has a length of about 100 (e.g., 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, or 110) ribonucleotides. In some embodiments, the spacer element has a length of about 120 (e.g., 108, 109, 110, 111 , 112, 113, 114,115, 116, 117, 118, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , or 132) ribonucleotides. In some embodiments, the spacer element has a length of about 150 (e.g., 135, 136, 137, 138, 139, 140, 141 , 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, 156,157, 158, 159, 160, 161 , 162, 163, 164, or 165) ribonucleotides. In some embodiments, the spacer element has a length of about 200 (e.g., 180, 181 , 182, 183, 184, 185, 186, 187, 188, 189, 190, 191 , 192, 193, 194, 195, 196, 197, 198, 199, 200, 201 , 202, 203, 204, 205, 206, 207, 208, 209, 210, 211 , 212, 213, 214, 215, 216, 217, 218, 219, or 220) ribonucleotides.In some embodiments, the polyribonucleotide includes a first spacer element and a second spacer element, wherein the first and second spacer are the same length. In some embodiments, the first spacer element and the second spacer element are about the same length.In some embodiments, the polyribonucleotide includes a first spacer element and a second spacer element, wherein the first spacer element and the second spacer elements are different lengths. In some embodiments, the difference between the length of the first spacer element and the length of the second region is 0 to 100 (e.g. , 0 to 95, 0 to 90, 0 to 85, 0 to 80, 0 to 75, 0 to 70, 0 to 65, 0 to 60, 0 to 55, 0 to 50, 0 to 45, 0 to 40, 0 to 35, 0 to 30, 0 to 25, 0 to 20, 0 to 15, 0 to 10, 0 to 5, 5 to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 100, 75 to 100, 80 to 100, 85 to 100, 90 to 100, or 95 to 100,) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18 ,19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides. In some embodiments, the length of the first spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, or 55) ribonucleotides, and the length of the second spacer is about 120 (e.g., 108, 109, 110, 111 , 112, 113, 114, 115, 116, 117, 118, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , or 132) ribonucleotides. In some embodiments, the length of the first spacer is about 120 (e.g., 108, 109, 110, 111 , 112, 113, 114, 115,116, 117, 118, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , or 132) ribonucleotides, and the length of the second spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, or 55) ribonucleotides.In some embodiments, a spacer element may be a polyA based spacer, or a polyA based spacer element. In some embodiments, a first spacer is a polyA based spacer, or a polyA based spacer element. In some embodiments a second spacer is a polyA based spacer, or a polyA based spacer element. In some embodiments, the first spacer and the second spacer may be a polyA based spacer, or a polyA based spacer element. A polyA based spacer, or a polyA based spacer element is equivalent to a polyA region (e.g., a polyAC region, polyAU region, polyAG region, or polyAT region), as described herein.The first spacer element may consist of a polyA region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine residues. The first spacer element may consist of a polyAC region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or cytosine residues. The adenosine and cytosine residues may be present in any ratio to one another. In some embodiments, the first spacer element may consist of a polyAU region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or uridine residues. In some embodiments, the first spacer element may consist of a polyAG region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. The adenosine and guanosine residues may be present in any ratio to one another. In some embodiments, the first spacer element may consist of a polyAT region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or thymidine residues. The adenosine and thymidine residues may be present in any ration to one another. In some embodiments, the first spacer element includes a polyAT region, wherein the polyAT region includes between 100 ribonucleotides and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides).The second spacer element may consist of a polyA region comprising 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine residues. The second spacer element may consist of a polyAC region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or cytosine residues. In some embodiments, the second spacer element may consist of a polyAU region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or uridine residues. The adenosine and uridine residues may be present in any ratio to one another. In some embodiments, the second spacer element may consist of a polyAG region comprising between 80% to 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. The adenosine and guanosine residues may be present in any ratio to one another. In some embodiments, the first spacer element may consist of a polyAT region comprising between 80% to 100% (e.g., 80%, 81%,82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or thymidine residues. In some embodiments, the second spacer element includes a polyAT region, wherein the polyAT region includes between 100 ribonucleotides and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides). The adenosine and thymidine residues may be present in any ratio to one another.In some embodiments, the spacer element sequences can be a poly A region (e.g., polyA, polyAT, polyAU, polyAC, ro polyAG) or a random sequence. In some embodiments, the spacer element may be referred to based on a combination of nucleotide content and length. For example, an AU120 spacer element may consist of a polyAU region comprising between 80% to 100% adenosine or uridine residues and 120 nucleotides in length.In some embodiments, the spacer element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in TABLE 10. In some embodiments, the spacer element has a nucleic acid sequence of any one of the sequences described in TABLE 10.Table 10. Spacer Element SequencesExemplary spacer element sequences are described in paragraphs

[0293] -

[0302] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.Internal Ribosome Entry SitesIn some embodiments, a circular or linear polyribonucleotide described herein includes one or more internal ribosome entry site (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression sequences (e.g., each IRES is operably linked to one or more expression sequences, where each expression sequence optionally encodes an immunogen. Inembodiments, the IRES is located between a heterologous promoter and the 5’ end of a coding sequence.A suitable IRES element to include in a polyribonucleotide includes an RNA sequence capable of engaging a eukaryotic ribosome. In some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.In some embodiments, the IRES element is from the DNA of an organism including, but not limited to, a virus, a mammal, and a Drosophila. Such viral DNA may be from, but is not limited to, picomavirus complementary DNA (cDNA), with encephalomyocarditis virus (EMCV) cDNA and poliovirus cDNA. In one embodiment, an IRES element is from an Antennapedia gene from Drosophila melanogaster.In some embodiments, the IRES sequence is an IRES sequence of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, simian Virus 40, Solenopsis Invicta virus 1 , Rhopalosiphum padi virus, Reticuloendotheliosis virus, human poliovirus 1 , Plautia stall intestine virus, Kashmir bee virus, Human rhinovirus 2 (HRV-2), Homalodisca coagulata virus-1 , Human Immunodeficiency Virus type 1 , Homalodisca coagulata virus-1 , Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, foot and mouth disease virus, Human enterovirus 71 , Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus (EMCV), Drosophila C Virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1 , Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus (AEV), Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1 , Human AML1 / RUNX1 , Drosophila antennapedia, Human AQP4, Human AT1 R, Human BAG-I, Human BCL2, Human BiP, Human c-IAPI , Human c-myc, Human elF4G, Mouse NDST4L, Human LEF1 , Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-I, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Salivirus, Cosavirus, Parechovirus, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1 , Human c-src, Human FGF-I, Simian picomavirus, Turnip crinkle virus, Aichivirus, Crohivirus, Echovirus 11 , an aptamer to elF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2). In yet another embodiment, the IRES is an IRES sequence of Coxsackievirus B3 (CVB3). In a further embodiment, the IRES is an IRES sequence of Encephalomyocarditis virus. In a further embodiment, the IRES is an IRES sequence of Theiler's encephalomyelitis virus.In some embodiments, the IRES sequence has a modified sequence in comparison to the wild-type IRES sequence. In some embodiments, when the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence is modified such that it is a cytosine residue. For example, the IRES sequence may be a CVB3 IRES sequence wherein the terminal adenosine residue is modified to cytosine residue. In some embodiments, the modified CVB3 IRES may have the nucleic acid sequence of:UUAAAACAGCCUGUGGGUUGAUCCCACCCACAGGCCCAUUGGGCGCUAGCACUCUGG UAUCACGGUACCUUUGUGCGCCUGUUUUAUACCCCCUCCCCCAACUGUAACUUAGAA GUAACACACACCGAUCAACAGUCAGCGUGGCACACCAGCCACGUUUUGAUCAAGCACU UCUGUUACCCCGGACUGAGUAUCAAUAGACUGCUCACGCGGUUGAAGGAGAAAGCGU UCGUUAUCCGGCCAACUACUUCGAAAAACCUAGUAACACCGUGGAAGUUGCAGAGUG UUUCGCUCAGCACUACCCCAGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCACG GGCGACCGUGGCGGUGGCUGCGUUGGCGGCCUGCCCAUGGGGAAACCCAUGGGACG CUCUAAUACAGACAUGGUGCGAAGAGUCUAUUGAGCUAGUUGGUAGUCCUCCGGCCC CUGAAUGCGGCUAAUCCUAACUGCGGAGCACACACCCUCAAGCCAGAGGGCAGUGUG UCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCCGUGUUUCAUUUU AUUCCUAUACUGGCUGCUUAUGGUGACAAUUGAGAGAUCGUUACCAUAUAGCUAUUG GAUUGGCCAUCCGGUGACUAAUAGAGCUAUUAUAUAUCCCUUUGUUGGGUUUAUACC ACUUAGCUUGAAAGAGGUUAAAACAUUACAAUUCAUUGUUAAGUUGAAUACAGCAAC(SEQ ID NO: 184)In some embodiments, the IRES sequence is an Enterovirus 71 (EV17) IRES. In some embodiments, the terminal guanosine residue of the EV17 IRES sequence is modified to a cytosine residue. In some embodiments, the modified EV71 IRES may have the nucleic acid sequence of:UUAAAACAGCUGUGGGUUGUCACCCACCCACAGGGUCCACUGGGCGCUAGUACACUG GUAUCUCGGUACCUUUGUACGCCUGUUUUAUACCCCCUCCCUGAUUUGCAACUUAGA AGCAACGCAAACCAGAUCAAUAGUAGGUGUGACAUACCAGUCGCAUCUUGAUCAAGCA CUUCUGUAUCCCCGGACCGAGUAUCAAUAGACUGUGCACACGGUUGAAGGAGAAAAC GUCCGUUACCCGGCUAACUACUUCGAGAAGCCUAGUAACGCCAUUGAAGUUGCAGAG UGUUUCGCUCAGCACUCCCCCCGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCA CGGGCGACCGUGGCGGUGGCUGCGUUGGCGGCCUGCCUAUGGGGUAACCCAUAGGA CGCUCUAAUACGGACAUGGCGUGAAGAGUCUAUUGAGCUAGUUAGUAGUCCUCCGGC CCCUGAAUGCGGCUAAUCCUAACUGCGGAGCACAUACCCUUAAUCCAAAGGGCAGUG UGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCCGUGUUUCUU UUUAUUCUUGUAUUGGCUGCUUAUGGUGACAAUUAAAGAAUUGUUACCAUAUAGCUA UUGGAUUGGCCAUCCAGUGUCAAACAGAGCUAUUGUAUAUCUCUUUGUUGGAUUCAC ACCUCUCACUCUUGAAACGUUACACACCCUCAAUUACAUUAUACUGCUGAACACGAAGCGGCCACC (SEQ ID NO: 185)In some embodiments, the IRES sequence is a synthetic IRES. A “synthetic IRES” is an IRES that is modified relative to a wildtype IRES in order to modulate its structure and / or activity. For example, in some embodiments, an IRES that is modified to incorporate an aptamer sequence is a synthetic IRES. In some embodiments, the polyribonucleotide includes at least one IRES flanking at least one (e.g., 2, 3, 4, 5 or more) expression sequence. In some embodiments, the IRES flanks both sides of at least one (e.g., 2, 3, 4, 5 or more) expression sequence. In some embodiments, the polyribonucleotide includes one or more IRES sequences on one or both sides of each expression sequence, leading to separation of the resulting peptide(s) and or polypeptide(s). For example, apolyribonucleotide described herein may include a first IRES operably linked to a first expression sequence and a second IRES operably linked to a second expression sequence.In some embodiments, a polyribonucleotide described herein includes an IRES (e.g., an IRES operably linked to a coding region). For example, the polyribonucleotide may include any IRES as described in Chen et al. Nature Biotechnology 41 :262-272, 2023, Chen et al. Mol. Cell 81 (20):4300- 4318, 2021 ; Jopling et al. Oncogene 20:2664-2670, 2001 ; Baranick et al. PNAS 105(12):4733-4738, 2008; Lang et al. Molecular Biology of the Cell 13(5) :1792-1801 , 2002; Dorokhov et al. PNAS 99(8):5301 -5306, 2002; Wang et al. Nucleic Acids Research 33(7):2248-2258, 2005; Petz et al. Nucleic Acids Research 35(8):2473-2482, 2007, Chen et al. SCIENCE 268:415-417, 1995; Fan et al. NATURE COMMUNICATION 13(1 ):3751 -3765, 2022, International Publication No. WO2021 / 263124, and International Publication No. WO2022 / 271965 each of which is hereby incorporated by reference in their entirety.Signal SequencesIn some embodiments, immunogens expressed from a circular or linear polyribonucleotide disclosed herein include a secreted immunogen, for example, an immunogen that naturally includes a signal sequence, or one that does not usually encode a signal sequence but is modified to contain one. In some embodiments, the immunogen(s) includes a secretion signal. For example, the secretion signal may be the naturally encoded secretion signal for a secreted immunogen. In another example, the secretion signal may be a modified secretion signal for a secreted immunogen. In other embodiments, the immunogen(s) do not include a secretion signal.In some embodiments, a polyribonucleotide encodes multiple copies of the same immunogen (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more). In some embodiments, at least one copy of the polypeptide (e.g., immunogen) includes a signal sequence and at least one copy of the polypeptide does not include a signal sequence. In some embodiments, a circular polyribonucleotide encodes plurality of polypeptides (e.g., immunogens),, where at least one of the plurality of polypeptides includes a signal sequence and at least one copy of the plurality of polypeptides does not include a signal sequence.In some embodiments, the signal sequence is a wild-type signal sequence that is present on the N-terminus of the corresponding wild-type polypeptide (e.g., immunogen),, e.g., when expressed endogenously. In some embodiments, the signal sequence is heterologous to the polypeptide (e.g., immunogen),, e.g., is not present when the wild-type polypeptide is expressed endogenously. A polyribonucleotide sequence encoding a polypeptide may be modified to remove the nucleotide sequence encoding a wild-type signal sequence and / or add a sequence encoding a heterologous signal sequence.The circular polyribonucleotide may further include one or more adjuvants, each with or without a signal sequence. In some embodiments, the circular polyribonucleotide includes an adjuvant with or without a signal sequence. In some embodiments, the circular polyribonucleotide encodes at least one adjuvant and at least one polypeptide. In some embodiments, the at least one encoded adjuvant includes a signal sequence and the at least one encoded polypeptide does notinclude a signal sequence. In some embodiments, the at least one encoded adjuvant includes a signal sequence and the at least one encoded polypeptide includes a signal sequence. In some embodiments, the at least one encoded adjuvant does not include a signal sequence and the at least one encoded polypeptide includes a signal sequence. In some embodiments, neither the encoded adjuvant nor the encoded polypeptide includes a signal sequence.In some embodiments, the signal sequence is a wild-type signal sequence that is present on the N-terminus of the corresponding wild-type adjuvant, e.g., when expressed endogenously. In some embodiments, the signal sequence is heterologous to the adjuvant, e.g., is not present when the wild-type adjuvant is expressed endogenously. A polyribonucleotide sequence encoding an adjuvant may be modified to remove the nucleotide sequence encoding a wild-type signal sequence and / or add a sequence encoding a heterologous signal sequence.A polypeptide (e.g., immunogen or an adjuvant encoded by a polyribonucleotide) encoded by an expression sequence may include a signal sequence that directs the polypeptide to the secretory pathway. In some embodiments, the signal sequence may direct the polypeptide or adjuvant to reside in certain organelles (e.g., the endoplasmic reticulum, Golgi apparatus, or endosomes). In some embodiments, the signal sequence directs the polypeptide or adjuvant to be secreted from the cell. For secreted proteins, the signal sequence may be cleaved after secretion, resulting in a mature protein. In other embodiments, the signal sequence may become embedded in the membrane of the cell or certain organelles, creating a transmembrane segment that anchors the protein to the membrane of the cell, endoplasmic reticulum, or Golgi apparatus. In certain embodiments, the signal sequence of a transmembrane protein is a short sequence at the N-terminal of the polypeptide. In other embodiments, the first transmembrane domain acts as the first signal sequence, which targets the protein to the membrane.In some embodiments, the secretion signal is human interleukin-2 (IL-2) secretion signal. In some embodiments, the IL-2 secretion signal has an amino acid sequence of at least 90% sequence identity to MYRMQLLSCIALSLALVTNS (SEQ ID NO: 186). In some embodiments, the IL2 secretion signal has an amino acid sequence of at least 95% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence of at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence of 100% sequence identity to SEQ ID NO: 186.In some embodiments, the secretion signal is Gaussia luciferase secretion signal. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence of at least 90% sequence identity of MGVKVLFALICIAVAEAK (SEQ ID NO: 187). In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence of at least 95% sequence identity of SEQ ID NO: 187. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence of at least 99% sequence identity of SEQ ID NO: 187. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence of 100% sequence identity of SEQ ID NO: 187.In some embodiments, the secretion signal is an EPO (e.g., a human EPO) secretion signal. In some embodiments, the EPO secretion signal has an amino acid sequence of at least 90% sequence identity of MGVHECPAWLWLLLSLLSLPLGLPVLGA (SEQ ID NO: 188). In someembodiments, the EPO secretion signal has an amino acid sequence of at least 95% sequence identity of SEQ ID NO: 188. In some embodiments, the 88. In some embodiments, the EPO secretion signal has an amino acid sequence of 100% sequence identity of SEQ ID NO: 188.In some embodiments, the secretion signal is a wildtype SARS-CoV-2 secretion signal. In some embodiments, the wildtype SARS-CoV-2 secretion signal has an amino acid sequence of at least 90% sequence identity of MFVFLVLLPLVSS (SEQ ID NO: 189). In some embodiments, the wildtype SARS-CoV-2 secretion signal has an amino acid sequence of at least 95% sequence identity of SEQ ID NO: 189. In some embodiments, the wildtype SARS-CoV-2 secretion signal has an amino acid sequence of at least 99% sequence identity of SEQ ID NO: 189. In some embodiments, the wildtype SARS-CoV-2 secretion signal has an amino acid sequence of 100% sequence identity of SEQ ID NO: 189.In some embodiments, an adjuvant encoded by a polyribonucleotide includes a secretion signal. In some embodiments, a polypeptide encoded by a polyribonucleotide includes either a secretion signal sequence, a transmembrane insertion signal sequence, or does not include a signal sequence.Regulatory ElementsIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo encoding an immunogen of the polyribonucleotide) includes one or more regulatory elements. In some embodiments, the polyribonucleotide includes a regulatory element, e.g., a sequence that modifies expression of an expression sequence within the polyribonucleotide.A regulatory element may include a sequence that is located adjacent to an expression sequence that encodes an expression product. A regulatory element may be operably linked to the adjacent sequence. A regulatory element may increase an amount of product expressed as compared to an amount of the expressed product when no regulatory element is present. A regulatory element may be used to increase the expression of one or more polypeptide(s) and / or adjuvant(s) encoded by a polyribonucleotide. Likewise, a regulatory element may be used to decrease the expression of one or more polypeptide(s) encoded by a polyribonucleotide. In some embodiments, a regulatory element is used to increase expression of polypeptide and another regulatory element is used to decrease expression of another polypeptide on the same polyribonucleotide. In addition, one regulatory element can increase an amount of product expressed for multiple expression sequences attached in tandem. Hence, one regulatory element can enhance the expression of one or more expression sequences. Multiple regulatory elements can also be used, for example, to differentially regulate expression of different expression sequences.In some embodiments, the regulatory element is a translation modulator. A translation modulator can modulate translation of the expression sequence in the polyribonucleotide. A translation modulator can be a translation enhancer or suppressor. In some embodiments, the polyribonucleotide includes at least one translation modulator adjacent to at least one expression sequence. In some embodiments, the polyribonucleotide includes a translation modulator adjacent to each expression sequence. In some embodiments, the translation modulator is present on one orboth sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and or polypeptide(s).In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.In some embodiments, a regulatory element as provided herein includes a selective translation sequence. As used herein, the term “selective translation sequence” refers to a nucleic acid sequence that selectively initiates or activates translation of an expression sequence in the polyribonucleotide, for instance, certain riboswitch aptazymes. A regulatory element can also include a selective degradation sequence. As used herein, the term “selective degradation sequence” refers to a nucleic acid sequence that initiates degradation of the polyribonucleotide, or an expression product of the polyribonucleotide. In some embodiments, the regulatory element is a translation modulator. A translation modulator can modulate translation of the expression sequence in the polyribonucleotide. A translation modulator can be a translation enhancer or suppressor. In some embodiments, a translation initiation sequence can function as a regulatory element.In some embodiments, a polyribonucleotide produces stoichiometric ratios of expression products. Rolling circle translation continuously produces expression products at substantially equivalent ratios. In some embodiments, the polyribonucleotide has a stoichiometric translation efficiency, such that expression products are produced at substantially equivalent ratios. In some embodiments, the polyribonucleotide has a stoichiometric translation efficiency of multiple expression products, e.g., products from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, or more expression sequences. In some embodiments, the polyribonucleotide produces substantially different ratios of expression products. For example, the translation efficiency of multiple expression products may have a ratio of 1 :10,000; 1 :7000, 1 :5000, 1 :1000, 1 :700, 1 :500, 1 :100, 1 :50, 1 :10, 1 :5, 1 :4, 1 :3 or 1 :2. In some embodiments, the ratio of multiple expression products may be modified using a regulatory element.Further examples of regulatory elements are described in paragraphs

[0154] -

[0161] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.Cleavage DomainsA circular or linear polyribonucleotide of the disclosure can include a cleavage domain (e.g., a stagger element or a cleavage sequence).As used herein, the term “stagger element” is a moiety, such as a nucleotide sequence, that induces ribosomal pausing during translation. In some embodiments, the stagger element is a nonconserved sequence of amino-acids with a strong alpha-helical propensity followed by the consensus sequence -D(V / l)ExNPGP (SEQ ID NO: 190), where x= any amino acid. In some embodiments, the stagger element may include a chemical moiety, such as glycerol, a non-nucleic acid linking moiety, a chemical modification, a modified nucleic acid, or any combination thereof.In some embodiments, a circular or linear polyribonucleotide includes at least one stagger element adjacent to an expression sequence. In some embodiments, the circular or linear polyribonucleotide includes a stagger element adjacent to each expression sequence. In someembodiments, the stagger element is present on one or both sides of each expression sequence, leading to separation of the expression products. In some embodiments, the stagger element is a portion of the one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide includes one or more expression sequences, and each of the one or more expression sequences is separated from a succeeding expression sequence by a stagger element on the circular or linear polyribonucleotide. In some embodiments, the stagger element prevents generation of a single polypeptide (a) from two rounds of translation of a single expression sequence or (b) from one or more rounds of translation of two or more expression sequences. In some embodiments, the stagger element is a sequence separate from the one or more expression sequences. In some embodiments, the stagger element includes a portion of an expression sequence of the one or more expression sequences.Examples of stagger elements are described in paragraphs

[0172] -

[0175] of International Patent Publication No. WO2019 / 1 18919, which is hereby incorporated by reference in its entirety.To avoid production of a continuous expression product while maintaining rolling circle translation, a stagger element may be included to induce ribosomal pausing during translation. In some embodiments, the stagger element is at 3’ end of at least one of the one or more expression sequences. The stagger element can be configured to stall a ribosome during rolling circle translation of the circular or linear polyribonucleotide. The stagger element may include, but is not limited to a 2A-like, or CHYSEL (SEQ ID NO: 191 ) (cis-acting hydrolase element) sequence. In some embodiments, the stagger element encodes a sequence with a C-terminal consensus sequence that is X1X2X3EX5NPGP, where Xi is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid (SEQ ID NO: 192). Some non-limiting examples of stagger elements includes GDVESNPGP (SEQ ID NO: 193), GDIEENPGP (SEQ ID NO: 194), VEPNPGP (SEQ ID NO: 195), IETNPGP (SEQ ID NO: 196), GDIESNPGP (SEQ ID NO: 197), GDVELNPGP (SEQ ID NO: 198), GDIETNPGP (SEQ ID NO: 199), GDVENPGP (SEQ ID NO: 200), GDVEENPGP (SEQ ID NO: 201 ), GDVEQNPGP (SEQ ID NO: 202), IESNPGP (SEQ ID NO: 203), GDIELNPGP (SEQ ID NO: 204), HDIETNPGP (SEQ ID NO: 205), HDVETNPGP (SEQ ID NO: 206), HDVEMNPGP (SEQ ID NO: 207), GDMESNPGP (SEQ ID NO: 208), GDVETNPGP (SEQ ID NO: 209), GDIEQNPGP (SEQ ID NO: 210), and DSEFNPGP (SEQ ID NO: 21 1 ).In some embodiments, a stagger element described herein cleaves an expression product, such as between G and P of the consensus sequence described herein. As one non-limiting example, the circular or linear polyribonucleotide includes at least one stagger element to cleave the expression product. In some embodiments, the circular or linear polyribonucleotide includes a stagger element adjacent to at least one expression sequence. In some embodiments, the circular or linear polyribonucleotide includes a stagger element after each expression sequence. In some embodiments, the circular or linear polyribonucleotide includes a stagger element that is present on one or both sides of each expression sequence, leading to translation of individual peptide(s) and or polypeptide(s) from each expression sequence.In some embodiments, a stagger element includes one or more modified nucleotides or unnatural nucleotides that induce ribosomal pausing during translation. Unnatural nucleotides mayinclude peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Examples such as these are distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Exemplary modifications can include any modification to the sugar, the nucleobase, the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage I to the phosphodiester backbone), and any combination thereof that can induce ribosomal pausing during translation. Some of the exemplary modifications provided herein are described elsewhere herein.In some embodiments, a stagger element is present in a circular or linear polyribonucleotide in other forms. For example, in some exemplary circular or linear polyribonucleotides, a stagger element includes a termination element of a first expression sequence in the circular or linear polyribonucleotide, and a nucleotide spacer sequence that separates the termination element from a first translation initiation sequence of an expression succeeding the first expression sequence. In some examples, the first stagger element of the first expression sequence is upstream of (5’ to) a first translation initiation sequence of the expression succeeding the first expression sequence in the circular or linear polyribonucleotide. In some cases, the first expression sequence and the expression sequence succeeding the first expression sequence are two separate expression sequences in the circular or linear polyribonucleotide. The distance between the first stagger element and the first translation initiation sequence can enable continuous translation of the first expression sequence and its succeeding expression sequence. In some embodiments, the first stagger element includes a termination element and separates an expression product of the first expression sequence from an expression product of its succeeding expression sequences, thereby creating discrete expression products. In some cases, the circular or linear polyribonucleotide including the first stagger element upstream of the first translation initiation sequence of the succeeding sequence in the circular or linear polyribonucleotide is continuously translated, while a corresponding circular or linear polyribonucleotide including a stagger element of a second expression sequence that is upstream of a second translation initiation sequence of an expression sequence succeeding the second expression sequence is not continuously translated. In some cases, there is only one expression sequence in the circular or linear polyribonucleotide, and the first expression sequence and its succeeding expression sequence are the same expression sequence. In some exemplary circular or linear polyribonucleotides, a stagger element includes a first termination element of a first expression sequence in the circular or linear polyribonucleotide, and a nucleotide spacer sequence that separates the termination element from a downstream translation initiation sequence. In some such examples, the first stagger element is upstream of (5’ to) a first translation initiation sequence of the first expression sequence in the circular or linear polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence enables continuous translation of the first expression sequence and any succeeding expression sequences. In some embodiments, the first stagger element separates one round expression product of the first expression sequence from the next round expression product of the first expression sequences, thereby creating discrete expression products. In some cases, the circular or linear polyribonucleotide including the first stagger element upstream of the first translation initiation sequence of the firstexpression sequence in the circular or linear polyribonucleotide is continuously translated, while a corresponding circular or linear polyribonucleotide including a stagger element upstream of a second translation initiation sequence of a second expression sequence in the corresponding circular or linear polyribonucleotide is not continuously translated. In some cases, the distance between the second stagger element and the second translation initiation sequence is at least 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or 10x greater in the corresponding circular or linear polyribonucleotide than a distance between the first stagger element and the first translation initiation in the circular or linear polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation is at least 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, or greater. In some embodiments, the distance between the second stagger element and the second translation initiation is at least 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, or greater than the distance between the first stagger element and the first translation initiation. In some embodiments, the circular or linear polyribonucleotide includes more than one expression sequence.In some embodiments, the plurality of expression sequences encoded by a circular ribonucleotide may be separated by an IRES between each expression sequence. For example, a circular polyribonucleotide may include a first IRES operable linked to a first expression sequence and a second IRES operably linked to a second expression sequence. The IRES may be the same IRES between all expression sequences. The IRES may be different between expression sequences.In some embodiments, the plurality of expression sequences may be separated by a 2A selfcleaving peptide. For example, a circular polyribonucleotide may encode an IRES operably linked to an open reading frame encoding a first expression sequence, a 2A, and a second expression sequences. In some embodiments, the 2A may have a sequence of GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 212).In some embodiments, the plurality of expression sequences may be separated by a protease cleavage site (e.g., a furin cleavage site). For example, a circular polyribonucleotide may encode an IRES operably linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., a furin cleavage site), and a second expression sequence. In some embodiments, the furin cleavage site may have a sequence of GRLRR (SEQ ID NO: 213).In some embodiments, the plurality of expression sequence may be separated by a 2A selfcleaving peptide and a protease cleavage site (e.g., a furin cleavage site). For example, a circular polyribonucleotide may encode an IRES operably linked to an open reading frame encoding a first expression sequence, a 2A, a protease cleavage site (e.g., a furin cleavage site), and a second expression sequence. A circular polyribonucleotide may also encode an IRES operably linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., a furin cleavage site), a 2A, and a second expression sequence. A tandem 2A and furin cleavage site may be referred to as a furin-2A (which includes furin-2A or 2A-furin, arranged in either orientation).Furthermore, the plurality of expression sequences and / or adjuvants encoded by the circular ribonucleotide may be separated by both IRES and 2A sequences. For example, an IRES may bebetween one expression sequence and a second expression sequence while a 2A peptide may be between the second expression sequence and the third expression sequence. The selection of a particular IRES or 2A self-cleaving peptide may be used to control the expression level of expression sequence under control of the IRES or 2A sequence. For example, depending on the IRES and or 2A peptide selected, expression on the polypeptide may be higher or lower.In some embodiments, a circular or linear polyribonucleotide includes at least one cleavage sequence. In some embodiments, the cleavage sequence is adjacent to an expression sequence. In some embodiments, the cleavage sequence is between two expression sequences. In some embodiments, cleavage sequence is included in an expression sequence. In some embodiments, the circular or linear polyribonucleotide includes between 2 and 10 cleavage sequences. In some embodiments, the circular or linear polyribonucleotide includes between 2 and 5 cleavage sequences. In some embodiments, the multiple cleavage sequences are between multiple expression sequences; for example, a circular or linear polyribonucleotide may include three expression sequences two cleavage sequences such that there is a cleavage sequence in between each expression sequence. In some embodiments, the circular or linear polyribonucleotide includes a cleavage sequence, such as in an immolating circRNA or cleavable circRNA or self-cleaving circRNA. In some embodiments, the circular or linear polyribonucleotide includes two or more cleavage sequences, leading to separation of the circular or linear polyribonucleotide into multiple products, e.g., miRNAs, linear RNAs, smaller circular or linear polyribonucleotide, etc.In some embodiments, a cleavage sequence includes a ribozyme RNA sequence. A ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyzes a chemical reaction. Many natural ribozymes catalyze either the hydrolysis of one of their own phosphodiester bonds, or the hydrolysis of bonds in other RNA, but they have also been found to catalyze the aminotransferase activity of the ribosome. Catalytic RNA can be “evolved” by in vitro methods. Similar to riboswitch activity discussed above, ribozymes and their reaction products can regulate gene expression. In some embodiments, a catalytic RNA or ribozyme can be placed within a larger non-coding RNA such that the ribozyme is present at many copies within the cell for the purposes of chemical transformation of a molecule from a bulk volume. In some embodiments, aptamers and ribozymes can both be encoded in the same non-coding RNA.In some embodiments, the cleavage sequence encodes a cleavable polypeptide linker. For example, a polyribonucleotide may encode two or more expression sequences are encoded by a single open-reading frame (ORF). For example, two or more expression sequences may be encoded by a single open-reading frame, the expression of which is controlled by an IRES. In some embodiments, the ORF further encodes a polypeptide linker, e.g., such that the expression product of the ORF encodes two or more expression sequences each separated by a sequence encoding a polypeptide linker (e.g., a linker of 5-200, 5 to 100, 5 to 50, 5 to 20, 50 to 100, or 50 to 200 amino acids). The polypeptide linker may include a cleavage site, for example, a cleavage site recognized and cleaved by a protease (e.g., an endogenous protease in a subject following administration of the polyribonucleotide to that subject). In such embodiments, a single expression product including the amino acid sequence of two or more expression sequences is cleaved upon expression, such that thetwo or more expression sequences are separated following expression. Exemplary protease cleavage sites are known to those of skill in the art, for example, amino acid sequences that act as protease cleavage sites recognized by a metalloproteinase (e.g., a matrix metalloproteinase (MMP), such as any one or more of MMPs 1 -28), a disintegrin and metalloproteinase (ADAM, such as any one or more of ADAMs 2, 7-12, 15, 17-23, 28-30 and 33), a serine protease, urokinase-type plasminogen activator, matriptase, a cysteine protease, an aspartic protease, or a cathepsin protease. In some embodiments, the protease is MMP9 or MMP2. In some embodiments, the protease is matriptase.In some embodiments, a circular or linear polyribonucleotide described herein is an immolating circular or linear polyribonucleotide, a cleavable circular or linear polyribonucleotide, or a self-cleaving circular or linear polyribonucleotide. A circular or linear polyribonucleotide can deliver cellular components including, for example, RNA, IncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA. In some embodiments, a circular or linear polyribonucleotide includes miRNA separated by (i) self-cleavable elements; (ii) cleavage recruitment sites; (iii) degradable linkers; (iv) chemical linkers; and / or (v) spacer element sequences. In some embodiments, circRNA includes siRNA separated by (i) self-cleavable elements; (ii) cleavage recruitment sites (e.g., ADAR); (iii) degradable linkers (e.g., glycerol); (iv) chemical linkers; and / or (v) spacer element sequences. Nonlimiting examples of self-cleavable elements include hammerhead, splicing element, hairpin, hepatitis delta virus (HDV), Varkud Satellite (VS), and glmS ribozymes.In some embodiments, the circular polyribonucleotide includes at least one stagger element adjacent to an expression sequence. In some embodiments, the circular polyribonucleotide includes a stagger element adjacent to each expression sequence. In some embodiments, the stagger element is present on one or both sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and / or polypeptide(s). In some embodiments, the stagger element is a portion of the one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and each of the one or more expression sequences is separated from a succeeding expression sequence by a stagger element on the circular polyribonucleotide. In some embodiments, the stagger element prevents generation of a single polypeptide (a) from two rounds of translation of a single expression sequence or (b) from one or more rounds of translation of two or more expression sequences. In some embodiments, the stagger element is a sequence separate from the one or more expression sequences. In some embodiments, the stagger element comprises a portion of an expression sequence of the one or more expression sequences.Translation Initiation SequencesIn some embodiments, a circular or linear polyribonucleotide encodes an expression sequence and includes a translation initiation sequence, e.g., a start codon. In some embodiments, the polyribonucleotide includes a translation initiation sequence operably linked to an expression sequence. In some embodiments, the translation initiation sequence includes a Kozak or Shine- Dalgarno sequence. In some embodiments, the translation initiation sequence includes a Kozak sequence. In some embodiments, the circular or linear polyribonucleotide includes the translationinitiation sequence, e.g., Kozak sequence, adjacent to an expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, the translation initiation sequence, e.g., Kozak sequence, is present on one or both sides of each expression sequence, leading to separation of the expression products. In some embodiments, the circular or linear polyribonucleotide includes at least one translation initiation sequence adjacent to an expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the circular or linear polyribonucleotide. In some embodiments, the translation initiation sequence is within a single stranded region of the circular or linear polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs

[0163] -

[0165] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.The circular or linear polyribonucleotide may include more than one start codon such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may initiate on the first start codon or may initiate downstream of the first start codon.In some embodiments, a circular or linear polyribonucleotide may initiate at a codon which is not the first start codon, e.g., AUG. Translation of the circular or linear polyribonucleotide may initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. In some embodiments, translation begins at an alternative translation initiation sequence under selective conditions, e.g., stress induced conditions. As a non-limiting example, the translation of the polyribonucleotide may begin at alternative translation initiation sequence, such as ACG. As another non-limiting example, the polyribonucleotide translation may begin at alternative translation initiation sequence, CTG / CUG. As another non-limiting example, the polyribonucleotide translation may begin at alternative translation initiation sequence, GTG / GUG. As another non-limiting example, the polyribonucleotide may begin translation at a repeat-associated non-AUG (RAN) sequence, such as an alternative translation initiation sequence that includes short stretches of repetitive RNA e.g., CGG, GGGGCC, CAG, CTG.In some embodiments, translation is initiated by eukaryotic initiation factor 4A (elF4A) treatment with Rocaglates (translation is repressed by blocking 43S scanning, leading to premature, upstream translation initiation and reduced protein expression from transcripts bearing the RocA- elF4A target sequence, see for example, nature.com / articles / nature17978).Termination ElementsIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo encoding an immunogen of the polyribonucleotide) includes least one termination element. In some embodiments, the polyribonucleotide includes a termination element operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.In some embodiments, the polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product.In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the circular polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product, e.g., peptides or polypeptides, due to lack of ribosome stalling or fall-off. In such an embodiment, rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, a termination element of an expression sequence can be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide includes a termination element. However, rolling circle translation or expression of a succeeding (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide is performed. In such instances, the expression product may fall off the ribosome when the ribosome encounters the termination element, e.g., a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, e.g., at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.In some embodiments, the circular polyribonucleotide includes a termination element at the end of one or more expression sequences. In some embodiments, one or more expression sequences includes two or more termination elements in succession. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome completely disengages with the circular polyribonucleotide. In some such embodiments, production of a succeeding (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide may require the ribosome to reengage with the circular polyribonucleotide prior to initiation of translation. Generally, termination elements include an in-frame nucleotide triplet that signals termination of translation, e.g., UAA, UGA, UAG. In some embodiments, one or more termination elements in the circular polyribonucleotide are frame-shifted termination elements, such as but not limited to, off-frame or -1 and + 1 shifted reading frames (e.g., hidden stop) that may terminate translation. Frame-shifted termination elements include nucleotide triples, TAA, TAG, and TGA that appear in the second and third reading frames of an expression sequence. Frame-shifted termination elements may be important in preventing misreads of mRNA, which is often detrimental to the cell. In some embodiments, the termination element is a stop codon.Further examples of termination elements are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.Polyribonucleotide CargoIn some embodiments, the circular polyribonucleotide encodes a polyribonucleotide cargo. A polyribonucleotide cargo described herein includes any sequence including at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo includes an expression sequence, a non-coding sequence, or an expression sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo includes an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo includes an IRES operably linked to an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo includes an expression sequence that encodes a polypeptide that has a biological effect on a subject.A polyribonucleotide cargo may, for example, include at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1 ,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments, the polyribonucleotides cargo includes from 1 -20,000 nucleotides, 1 -10,000 nucleotides, 1 -5,000 nucleotides, 100-20,000 nucleotide, 100-10,000 nucleotides, 100-5,000 nucleotides, 500-20,000 nucleotides, 500-10,000 nucleotides, 500-5,000 nucleotides, 1 ,000-20,000 nucleotides, 1 ,000-10,000 nucleotides, or 1 ,000-5,000 nucleotides.In embodiments, the polyribonucleotide cargo includes one or multiple expression (or coding) sequences, wherein each expression (or coding) sequence encodes a polypeptide. In embodiments, the polyribonucleotide cargo includes one or multiple noncoding sequences. In embodiments, the polyribonucleotide cargo consists entirely of non-coding sequence(s). In embodiments, the polyribonucleotide cargo includes a combination of expression (or coding) and noncoding sequences.In some embodiments, the GC content of a nucleic acid sequence encoding a polypeptide is at least 51% (e.g., at least 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%). In some embodiments, the GC content of a nucleic acid sequence encoding a polypeptide is at most 52%, 53%, 54%, 55%, 56%, 57%, 58% or 59%, or 60%. In some embodiments, the GC content of a nucleic acid sequence encoding a polypeptide is 51% to 60%, 52% to 60%, 53% to 60%, 54% to 60%, 55% to 60%, 52% to 58%, 53% to 58%.In some embodiments, the uridine content (for RNA) or the thymidine content (for DNA) of a nucleic acid sequence encoding polypeptide is more than 10% (e.g., more than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content (for RNA) or the thymidine content (for DNA) of a nucleic acid sequence encoding a polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content (for RNA) or the thymidine content (for DNA) of anucleic acid sequence encoding a polypeptide is 20% to 28%, 21 % to 26%, 10% to 24%, 15% to 24%, 20% to 24%, 21 % to 24%, 22% to 24%, 23% to 24%, 10% to 23%, 15% to 23%, 20% to 23%, 21 % to 23%, or 22% to 23%.The GC content of an expression sequence encoding the polypeptide refers to the GO content of the expression sequence that exclusively encodes the polypeptide with no other coding regions that encode peptides other than the polypeptide. Likewise, the uridine content or thymidine of an expression sequence encoding the polypeptide refers to the uridine content of the expression sequence that exclusively encodes the polypeptide with no other coding regions that encode peptides other than the polypeptide. In some embodiments, the calculation of the GC content or the uridine (or thymidine) content of the expression sequence encoding the polypeptide only takes into account the continuous nucleic acid sequence that starts in a 5’ to 3’ direction from the first nucleoside of the start codon of the open reading frame that encodes the polypeptide to the last nucleoside of the stop codon of the same open reading frame. In other embodiments, the calculation of the GC content or the uridine (or thymidine) content of the expression sequence encoding the polypeptide only takes into account the continuous nucleic acid sequence that starts in a 5’ to 3’ direction from the first nucleoside of the codon that encodes the N-terminal end amino acid residue of the polypeptide to the last nucleoside of the codon that encodes the C-terminal end amino acid residue of the polypeptide.In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of more than 20%. In some embodiments, the uridine content of a nucleic acid sequence encoding polypeptide is more than 10% (e.g., more than 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content of a nucleic acid sequence encoding polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21 %, or 20%). In some embodiments, the uridine content of a nucleic acid sequence encoding polypeptide is 20% to 28%, 21 % to 26%, 10% to 24%, 15% to 24%, 20% to 24%, 21 % to 24%, 22% to 24%, 23% to 24%, 10% to 23%, 15% to 23%, 20% to 23%, 21 % to 23%, or 22% to 23%. In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of 20% to 28%.In some embodiments, polyribonucleotides made as described herein are used as effectors in therapy or agriculture. For example, a circular polyribonucleotide made by the methods described herein (e.g., the cell-free methods described herein) may be administered to a subject (e.g., in a pharmaceutical, or agricultural composition). In another example, a circular polyribonucleotide made by the methods described herein (e.g., the cell-free methods described herein) may be delivered to a cell.In some embodiments, the polyribonucleotide includes any feature, or any combination of features as disclosed in International Patent Publication No. WO2019 / 1 18919, which is hereby incorporated by reference in its entirety.Polypeptide Expression SequencesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the circular polyribonucleotide) includes one or more expression (or coding) sequences,wherein each expression sequence encodes a polypeptide. In some embodiments, the circular polyribonucleotide includes two, three, four, five, six, seven, eight, nine, ten or more expression (or coding) sequences.Each encoded polypeptide may be linear or branched. In various embodiments, the polypeptide has a length from about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1 ,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, the polypeptide has a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1 ,500 amino acids, less than about 1 ,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less may be useful.Polypeptides included herein may include naturally occurring polypeptides or non-naturally occurring polypeptides. In some embodiments, the polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, the polypeptide may be a functionally active variant of any of the polypeptides described herein with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, e.g., over a specified region or over the entire sequence, to a sequence of a polypeptide described herein or a naturally occurring polypeptide. In some instances, the polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or greater) identity to a protein of interest.Some examples of a polypeptide include, but are not limited to, a fluorescent tag or marker, an antigen, a therapeutic polypeptide, or a polypeptide for agricultural applications.A therapeutic polypeptide may be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., oxidoreductase, metabolic enzyme, mitochondrial enzyme, oxygenase, dehydrogenase, ATP - independent enzyme, lysosomal enzyme, desaturase), a cytokine, an antigen binding polypeptide (e.g., antigen binding antibody or antibody-like fragments, such as single chain antibodies, nanobodies or other Ig heavy chain or light chain containing polypeptides), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenetic protein, an interferon, an interleukin, and a thrombolytic.A polypeptide for agricultural applications may be a bacteriocin, a lysin, an antimicrobial polypeptide, an antifungal polypeptide, a nodule C-rich peptide, a bacteriocyte regulatory peptide, a peptide toxin, a pesticidal polypeptide (e.g., insecticidal polypeptide or nematocidal polypeptide), anantigen binding polypeptide (e.g., antigen binding antibody or antibody-like fragments, such as single chain antibodies, nanobodies or other Ig heavy chain or light chain containing polypeptides), an enzyme (e.g., nuclease, amylase, cellulase, peptidase, lipase, chitinase), a peptide pheromone, and a transcription factor.In some embodiments, the circular polyribonucleotide expresses a non-human protein.In some embodiments, the circular polyribonucleotide expresses an antibody, e.g., an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the circular polyribonucleotide can be of any isotype, such as IgA, IgD, Ig E, IgG, IgM. In some embodiments, the circular polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, a Fc fragment, a CDR (complementary determining region), a Fv fragment, or a Fab fragment, a further portion thereof. In some embodiments, the circular polyribonucleotide expresses one or more portions of an antibody. For instance, the circular polyribonucleotide can include more than one expression (or coding) sequence, each of which expresses a portion of an antibody, and the sum of which can constitute the antibody. In some cases, the circular polyribonucleotide includes one expression sequence coding for the heavy chain of an antibody, and another expression sequence coding for the light chain of the antibody. In some cases, when the circular polyribonucleotide is expressed in a cell or a cell-free environment, the light chain and heavy chain can be subject to appropriate modification, folding, or other post-translation modification to form a functional antibody.In embodiments, polypeptides include multiple polypeptides, e.g., multiple copies of one polypeptide sequence, or multiple different polypeptide sequences. In embodiments, multiple polypeptides are connected by linker amino acids or spacer amino acids.In embodiments, the polynucleotide cargo includes a sequence encoding a signal peptide. Many signal peptide sequences have been described, for example, the Tat (Twin-arginine translocation) signal sequence is typically an N-terminal peptide sequence containing a consensus SRRxFLK “twin-arginine” motif, which serves to translocate a folded protein containing such a Tat signal peptide across a lipid bilayer. See also, e.g., the Signal Peptide Database publicly available at www[dot]signalpeptide[dot]de. Signal peptides are also useful for directing a protein to specific organelles; see, e.g., the experimentally determined and computationally predicted signal peptides disclosed in the Spdb signal peptide database, publicly available at proline, bic.nus.edu.sg / spdb.In embodiments, the polynucleotide cargo includes sequence encoding a cell-penetrating peptide (CPP). Hundreds of CPP sequences have been described; see, e.g., the database of cellpenetrating peptides, CPPsite, publicly available at crdd[dot]osdd[dot]net / raghava / cppsite / . An example of a commonly used CPP sequence is a poly-arginine sequence, e.g., octoarginine or nonoarginine, which can be fused to the C-terminus of the CGI peptide.In embodiments, the polynucleotide cargo includes sequence encoding a self-assembling peptide; see, e.g., Miki et al. (2021 ) Nature Communications, 21 :3412, DOI: 10.1038 / s41467-021 - 23794-6.In some embodiments, the expression (or coding) sequence includes a poly-A sequence (e.g., at the 3’ end of an expression sequence). In some embodiments, the length of a poly-A sequence is greater than 10 nucleotides in length. In one embodiment, the poly-A sequence is greaterthan 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1 ,000, 1 ,100, 1 ,200, 1 ,300, 1 ,400, 1 ,500, 1 ,600, 1 ,700, 1 ,800, 1 ,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed according to the descriptions of the poly-A sequence in

[0202] -

[0204] of International Patent Publication No. WO2019 / 118919A1 , which is incorporated herein by reference in its entirety. In some embodiments, the expression sequence lacks a poly-A sequence (e.g., at the 3’ end of an expression sequence).In some embodiments, a circular polyribonucleotide includes a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide lacking a polyA or having modified polyA improves one or more functional characteristics, e.g., immunogenicity (e.g., the level of one or more marker of an immune or inflammatory response), half-life, and / or expression efficiency.Therapeutic polypeptidesIn some embodiments, the circular polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the circular polyribonucleotide) includes at least one expression sequence encoding a therapeutic polypeptide. A therapeutic polypeptide is a polypeptide that when administered to or expressed in a subject provides some therapeutic benefit. Administration to a subject or expression in a subject of a therapeutic polypeptide may be used to treat or prevent a disease, disorder, or condition or a symptom thereof. In some embodiments, the circular polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more therapeutic polypeptides.In some embodiments, the circular polyribonucleotide includes an expression sequence encoding a therapeutic protein. The protein may treat the disease in the subject in need thereof. In some embodiments, the therapeutic protein can compensate for a mutated, under-expressed, or absent protein in the subject in need thereof. In some embodiments, the therapeutic protein can target, interact with, or bind to a cell, tissue, or virus in the subject in need thereof.A therapeutic polypeptide can be a polypeptide that can be secreted from a cell, or localized to the cytoplasm, nucleus, or membrane compartment of a cell.A therapeutic polypeptide may be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., oxidoreductase, metabolic enzyme, mitochondrial enzyme, oxygenase, dehydrogenase, ATP - independent enzyme, lysosomal enzyme, desaturase), a cytokine, a transcription factor, an antigen binding polypeptide (e.g., antigen binding antibody or antibody-like fragments, such as single chain antibodies, nanobodies or other Ig heavy chain or light chain containing polypeptides), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenetic protein, an interferon, an interleukin, a thrombolytic, an antigen (e.g., a tumor, viral, or bacterial antigen), a nuclease (e.g., an endonuclease such as a Cas protein, e.g., Cas9), a membrane protein (e.g., a chimeric antigen receptor (CAR), a transmembrane receptor, a G-protein-coupled receptor (GPCR), a receptor tyrosine kinase (RTK), an antigen receptor, an ion channel, or a membrane transporter), a secreted protein, agene editing protein (e.g., a CRISPR-Cas, TALEN, or zinc finger), or a gene writing protein (see, e.g., International Patent Publication No. W02020 / 047124, incorporated in its entirety herein by reference).In some embodiments, the therapeutic polypeptide is an antibody, e.g., a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the circular polyribonucleotide can be of any isotype, such as IgA, IgD, IgE, IgG, IgM. In some embodiments, the circular polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, a Fc fragment, a CDR (complementary determining region), a Fv fragment, or a Fab fragment, a further portion thereof. In some embodiments, the circular polyribonucleotide expresses one or more portions of an antibody. For instance, the circular polyribonucleotide can include more than one expression sequence, each of which expresses a portion of an antibody, and the sum of which can constitute the antibody. In some cases, the circular polyribonucleotide includes one expression sequence coding for the heavy chain of an antibody, and another expression sequence coding for the light chain of the antibody. When the circular polyribonucleotide is expressed in a cell, the light chain and heavy chain can be subject to appropriate modification, folding, or other post-translation modification to form a functional antibody.In some embodiments, circular polyribonucleotides made as described herein are used as effectors in therapy or agriculture. For example, a circular polyribonucleotide made by the methods described herein (e.g., the cell-free methods described herein) may be administered to a subject (e.g., in a pharmaceutical or agricultural composition). In embodiments, the subject is a vertebrate animal (e.g., mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the method subject is a non-human mammal. In embodiments, the subject is a nonhuman mammal such as a non-human primate (e.g., monkeys, apes), ungulate (e.g., cattle, buffalo, sheep, goat, pig, camel, llama, alpaca, deer, horses, donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse), or lagomorph (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the avian taxa Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate such as an arthropod (e.g., insects, arachnids, crustaceans), a nematode, an annelid, a helminth, or a mollusc. In embodiments, the subject is an invertebrate agricultural pest or an invertebrate that is parasitic on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm plant (which can be a dicot or a monocot) or a gymnosperm plant (e.g., a conifer, a cycad, a gnetophyte, a Ginkgo), a fern, horsetail, clubmoss, or a bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is a plant of agricultural or horticultural importance, such as row crop plants, fruit-producing plants and trees, vegetables, trees, and ornamental plants including ornamental flowers, shrubs, trees, groundcovers, and turf grasses.Secreted polypeptide effectorsIn some embodiments, the circular polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the circular polyribonucleotide) includes at least one coding sequence encoding a secreted polypeptide effector. Exemplary secreted polypeptide effectors or proteins thatmay be expressed include, e.g., cytokines and cytokine receptors, polypeptide hormones and receptors, growth factors, clotting factors, therapeutic replacement enzymes and therapeutic non- enzymatic effectors, regeneration, repair, and fibrosis factors, transformation factors, and proteins that stimulate cellular regeneration, non-limiting examples of which are described herein, e.g., in the tables below.Cytokines and cytokine receptorsIn some embodiments, an effector described herein comprises a cytokine of Table 2, or a functional variant or fragment thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 11 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding cytokine receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher or lower than the Kd of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, the effector comprises a fusion protein comprising a first region (e.g., a cytokine polypeptide of Table 11 or a functional variant or fragment thereof) and a second, heterologous region. In some embodiments, the first region is a first cytokine polypeptide of Table 11 . In some embodiments, the second region is a second cytokine polypeptide of Table 11 , wherein the first and second cytokine polypeptides form a cytokine heterodimer with each other in a wild-type cell. In some embodiments, the polypeptide of Table 11 or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence.In some embodiments, an effector described herein comprises an antibody or fragment thereof that binds a cytokine of Table 11 . In some embodiments, the antibody molecule comprises a signal sequence.Table 11. Exemplary cytokines and cytokine receptors1Sequence available on the NCBI database on the world wide web internet site ncbi.nlm.nih.gov / gene; Maglott D, et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii: gku1055.2Sequence available on the Uniprot database on the world wide web internet site uniprot.org / uniprot; UniProt: the universal protein knowledgebase in 2021 .Nucleic Acids Res. 49:D1 (2021 ).Polypeptide hormones and receptorsIn some embodiments, an effector described herein comprises a hormone of Table 12, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 12 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 12 or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence.In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a hormone of Table 12. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a hormone receptor of Table 12. In some embodiments, the antibody molecule comprises a signal sequence.Table 12. Exemplary polypeptide hormones and receptors1Sequence available on the NCBI database on the world wide web internet site “ncbi.nlm.nih.gov / gene” (Maglott D, et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii: gku1055).2Sequence available on the Uniprot database on the world wide web internet site “uniprot.org / uniprot / ”; UniProt: the universal protein knowledgebase in 2021 .Nucleic Acids Res. 49:D1 (2021 ). Growth FactorsIn some embodiments, an effector described herein comprises a growth factor of Table 13, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 13 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 13 or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence.In some embodiments, an effector described herein comprises an antibody or fragment thereof that binds a growth factor of Table 13. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a growth factor receptor of Table 13. In some embodiments, the antibody molecule comprises a signal sequence.Table 13. Exemplary growth factors1Sequence available on the NCBI database on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the Uniprot database on the world wide web internet site uniprot.org / uniport.Clotting factorsIn some embodiments, an effector described herein comprises a polypeptide of Table 14, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 14 by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate no less than 10%, 20%, 30%, 40%, or 50% lower or higher than the wild-type protein. In some embodiments, the polypeptide of Table 14 or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence.Table 14. Clotting-associated factors1Sequence available on the NCBI database on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the Uniprot database on the world wide web internet site “uniprot.org / uniprot.Therapeutic replacement enzymesIn some embodiments, an effector described herein comprises an enzyme of Table 15, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 15 by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate no less or no more than 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein.Table 15. Exemplary enzymatic effectors for enzyme deficiency1Sequence available on the NCBI database on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the Uniprot database on the world wide web internet site uniprot.org / uniprot. Other non-enzymatic effectorsIn some embodiments, a therapeutic polypeptide described herein comprises a polypeptide of Table 16, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 16 by reference to its UniProt ID. Table 16. Exemplary non-enzymatic effectors and corresponding indications1Sequence available on the NCBI database on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the Uniprot database on the world wide web internet site uniprot.org / uniprot. Regeneration, Repair and Fibrosis FactorsTherapeutic polypeptides described herein also include growth factors, e.g., as disclosed in Table 17, or functional variants thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 17 by reference to its NCBI protein accession number. Also included are antibodies or fragments thereof against such growth factors, or miRNAs that promote regeneration and repair.Table 17. Exemplary Regeneration, Repair, and Fibrosis Factors1Sequence available on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the world wide web internet site ncbi.nlm.nih.gov / protein.Transformation factorsTherapeutic polypeptides described herein also include transformation factors, e.g., protein factors that transform fibroblasts into differentiated cell e.g., factors disclosed in Table 18 or functional variants thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 18 by reference to its UniProt ID.Table 18: Polypeptides indicated for organ repair by transforming fibroblasts1Sequence available on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the world wide web internet site ncbi.nlm.nih.gov / protein.Proteins that stimulate cellular regenerationTherapeutic polypeptides described herein also include proteins that stimulate cellular regeneration e.g., proteins disclosed in Table 19 or functional variants thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 19 by reference to its UniProt ID.Table 19. Exemplary proteins that stimulate cellular regeneration1Sequence available on the world wide web internet site ncbi.nlm.nih.gov / gene.2Sequence available on the world wide web internet site ncbi.nlm.nih.gov / protein. Cystic fibrosis transmembrane conductance regulator (CFTR)In some embodiments, an effector described herein comprises CFTR gene of Table 20, or a functional variant or fragment thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to a protein sequence disclosed in Table 20.In some embodiments, the circular polyribonucleotide comprises one or more expression sequences (coding sequences) and is configured for persistent expression in a cell of a subject in vivo. In some embodiments, the circular polyribonucleotide is configured such that expression of the one or more expression sequences in the cell at a later time point is equal to or higher than an earlier time point. In such embodiments, the expression of the one or more expression sequences may be either maintained at a relatively stable level or may increase over time. The expression of the expression sequences may be relatively stable for an extended period of time. For instance, in some cases, the expression of the one or more expression sequences in the cell over a time period of at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23 or more days does not decrease by 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%. In some cases, in some cases, the expression of the one or more expression sequences in the cell is maintained at a level that does not vary by more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% for at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23 or more days.Plant-modifying polypeptidesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the polyribonucleotide) includes at least one expression sequence encoding a plantmodifying polypeptide. A plant-modifying polypeptide refers to a polypeptide that can alter the genetic properties (e.g., increase gene expression, decrease gene expression, or otherwise alter the nucleotide sequence of DNA or RNA), epigenetic properties, or physiological or biochemical properties of a plant in a manner that results in a change in the plant’s physiology or phenotype, e.g. ,an increase or decrease in the plant’s fitness. In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more different plant-modifying polypeptides, or multiple copies of one or more plant-modifying polypeptides. A plant-modifying polypeptide may change the physiology or phenotype of, or increase or decrease the fitness of, a variety of plants, or can be one that affects such change(s) in one or more specific plants (e.g., a specific species or genera of plants).Examples of polypeptides that can be used herein can include an enzyme (e.g., a metabolic recombinase, a helicase, an integrase, a RNAse, a DNAse, or a ubiquitination protein), a poreforming protein, a signaling ligand, a cell penetrating peptide, a transcription factor, a receptor, an antibody, a nanobody, a gene editing protein (e.g., CRISPR-Cas endonuclease, TALEN, or zinc finger), riboprotein, a protein aptamer, or a chaperone.Agricultural polypeptidesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the polyribonucleotide) includes at least one expression sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide that is suitable for an agricultural use. In embodiments, an agricultural polypeptide is applied to a plant or seed (e.g., by foliar spray, dusting, injection, or seed coating) or to the plant’s environment (e.g., by soil drench or granular soil application), resulting in an alteration of the plant’s physiology, phenotype, or fitness. Embodiments of an agricultural polypeptide include polypeptides that alter a level, activity, or metabolism of one or more microorganisms resident in or on a plant or non-human animal host, the alteration resulting in an increase in the host’s fitness. In some embodiments the agricultural polypeptide is a plant polypeptide. In some embodiments, the agricultural polypeptide is an insect polypeptide. In some embodiments, the agricultural polypeptide has a biological effect when contacted with a non-human vertebrate animal, invertebrate animal, microbial, or plant cell.In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.Embodiments of polypeptides useful in agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, nodule C-rich peptides, and bacteriocyte regulatory peptides. Such polypeptides can be used to alter the level, activity, or metabolism of target microorganisms for increasing the fitness of insects, such as honeybees and silkworms. Embodiments of agriculturally useful polypeptides include peptide toxins, such as those naturally produced by entomopathogenic bacteria (e.g., Bacillus thuringiensis, Photorhabdus luminescens,Serratia entomophila, or Xenorhabdus nematophila), as is known in the art. Embodiments of agriculturally useful polypeptides include polypeptides (including small peptides such as cyclodipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, e.g., antimicrobial polypeptides or antifungal polypeptides for controlling diseases in plants, or pesticidal polypeptides (e.g., insecticidal polypeptides or nematicidal polypeptides) for controlling invertebrate pests such as insects or nematodes. Embodiments of agriculturally useful polypeptides include antibodies, nanobodies, and fragments thereof, e.g., antibody or nanobody fragments that retain at least some (e.g., at least 10%) of the specific binding activity of the intact antibody or nanobody. Embodiments of agriculturally useful polypeptides include transcription factors, e.g., plant transcription factors; see., e.g., the “AtTFDB” database listing the transcription factor families identified in the model plant Arabidopsis thaliana), publicly available at agris-knowledgebase.org / AtTFDB / . Embodiments of agriculturally useful polypeptides include nucleases, for example, exonucleases or endonucleases (e.g., Cas nucleases such as Cas9 or Cas12a). Embodiments of agriculturally useful polypeptides further include cell-penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones (for example, yeast mating pheromones, invertebrate reproductive and larval signaling pheromones, see, e.g., Altstein (2004) Peptides, 25:1373-1376).Termination ElementsIn some embodiments, the polyribonucleotide described herein includes at least one termination element. In some embodiments, the polyribonucleotide includes a termination element operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.In some embodiments, the polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product.In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the circular polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product, e.g., peptides or polypeptides, due to lack of ribosome stalling or fall-off. In such an embodiment, rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, a termination element of an expression sequence can be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide includes a termination element. However, rolling circle translation or expression of a succeeding (e.g., second, third, fourth, fifth, etc.)expression sequence in the circular polyribonucleotide is performed. In such instances, the expression product may fall off the ribosome when the ribosome encounters the termination element, e.g., a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, e.g., at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.In some embodiments, the circular polyribonucleotide includes a termination element at the end of one or more expression sequences. In some embodiments, one or more expression sequences includes two or more termination elements in succession. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome completely disengages with the circular polyribonucleotide. In some such embodiments, production of a succeeding (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide may require the ribosome to reengage with the circular polyribonucleotide prior to initiation of translation. Generally, termination elements include an in-frame nucleotide triplet that signals termination of translation (e.g., UAA, UGA, UAG). In some embodiments, one or more termination elements in the circular. polyribonucleotide are frame-shifted termination elements, such as but not limited to, off-frame or -1 and + 1 shifted reading frames (e.g., hidden stop) that may terminate translation. Frame-shifted termination elements include nucleotide triples, TAA, TAG, and TGA that appear in the second and third reading frames of an expression sequence. Frame-shifted termination elements may be important in preventing misreads of mRNA, which is often detrimental to the cell. In some embodiments, the termination element is a stop codon.In some embodiments, an expression sequence includes a poly-A sequence (e.g., at the 3’ end of an expression sequence, for example 3’ to a termination element). In some embodiments, the length of a poly-A sequence is greater than 10 nucleotides in length. In one embodiment, the poly-A sequence is greater than 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1 ,000, 1 ,100, 1 ,200, 1 ,300, 1 ,400, 1 ,500, 1 ,600, 1 ,700, 1 ,800, 1 ,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed according to the descriptions of the poly-A sequence in

[0202] -

[0204] of International Patent Publication No. WO2019 / 118919A1 , which is incorporated herein by reference in its entirety. In some embodiments, the expression sequence lacks a poly-A sequence (e.g., at the 3’ end of an expression sequence).In some embodiments, a circular polyribonucleotide includes a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide lacking a polyA or having modified polyA improves one or more functional characteristics, e.g., immunogenicity (e.g., the level of one or more marker of an immune or inflammatory response), half-life, and / or expression efficiency.Further examples of termination elements are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO2019 / 118919, which is hereby incorporated by reference in its entirety.ModificationsA polyribonucleotide may include one or more substitutions, insertions and / or additions, deletions, and covalent modifications with respect to reference sequences, in particular, the parent polyribonucleotide, are included within the scope of this disclosure.In some embodiments, a polyribonucleotide includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid includes messenger RNA (mRNA). In some embodiments, the polyribonucleotide includes at least one nucleoside selected from the group such as those described in

[0311] of International Patent Publication No. WO2019 / 118919A1 , which is incorporated herein by reference in its entirety.A polyribonucleotide may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage I to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof). Additional modifications are described herein.In some embodiments, a polyribonucleotide includes at least one N(6)methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the m6A modification can reduce immunogenicity (e.g., reduce the level of one or more marker of an immune or inflammatory response) of the polyribonucleotide.In some embodiments, a modification may include a chemical or cellular induced modification. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan in “RNA modifications and structures cooperate to guide RNA-protein interactions" from Nat Reviews Mol Cell Biol, 2017, 18:202-210.In some embodiments, chemical modifications to the ribonucleotides of a polyribonucleotide may enhance immune evasion. The polyribonucleotide may be synthesized and / or modified by methods well established in the art, such as those described in Current Protocols in Nucleic Acid Chemistry, Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5' end modifications (phosphorylation (mono-, di- and tri-), conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), base modifications (e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expandedrepertoire of partners), removal of bases (abasic nucleotides), or conjugated bases. The modified ribonucleotide bases may also include 5-methylcytidine and pseudouridine. In some embodiments, base modifications may modulate expression, immune response, stability, subcellular localization, to name a few functional effects, of the polyribonucleotide. In some embodiments, the modification includes a bi-orthogonal nucleotide, e.g., an unnatural base. See for example, Kimoto et al, Chem Commun (Camb), 2017, 53:12309, DOI: 10.1039 / c7cc06661 a, which is hereby incorporated by reference.In some embodiments, sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar one or more ribonucleotides of the polyribonucleotide may, as well as backbone modifications, include modification or replacement of the phosphodiester linkages. Specific examples of polyribonucleotide include, but are not limited to, polyribonucleotide including modified backbones or no natural internucleoside linkages such as internucleoside modifications, including modification or replacement of the phosphodiester linkages. Polyribonucleotides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, the polyribonucleotide will include ribonucleotides with a phosphorus atom in its internucleoside backbone.Modified polyribonucleotide backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In some embodiments, the polyribonucleotide may be negatively or positively charged.The modified nucleotides, which may be incorporated into the polyribonucleotide, can be modified at the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases "phosphate" and "phosphodiester" are used interchangeably. Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylenephosphonates).The a-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. Phosphorothioate linked to the polyribonucleotide is expected to reduce the innate immune response through weaker binding / activation of cellular innate immune molecules.In specific embodiments, a modified nucleoside includes an alpha-thio-nucleoside (e.g., 5'-0- (l-thiophosphate)-adenosine, 5'-0-(l-thiophosphate)-cytidine (a- thio-cytidine), 5'-0-(l-thiophosphate)- guanosine, 5'-0-(l-thiophosphate)-uridine, or 5'-0-(1 -thiophosphate)-pseudouridine).Other internucleoside linkages that may be employed according to the present disclosure, including internucleoside linkages which do not contain a phosphorous atom, are described herein.In some embodiments, a polyribonucleotide may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into polyribonucleotide, such as bifunctional modification. Cytotoxic nucleoside may include, but are not limited to, adenosine arabinoside, 5- azacytidine, 4'-thio- aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, l-(2-C-cyano-2-deoxy-beta-D-arabino- pentofuranosyl)-cytosine, decitabine, 5- fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5- fluoro-l-(tetrahydrofuran-2- yl)pyrimidine-2,4(IH,3H)-dione), troxacitabine, tezacitabine, 2'- deoxy-2'- methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-l-beta-D- arabinofuranosylcytosine, N4-octadecyl- 1 -beta-D- arabinofuranosylcytosine, N4- palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5'-elaidic acid ester).A polyribonucleotide may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purine or pyrimidine, or any one or more or all of A, G, U, C, I, pU) may or may not be uniformly modified in the polyribonucleotide, or in a given predetermined sequence region thereof. In some embodiments, the polyribonucleotide includes a pseudouridine. In some embodiments, the polyribonucleotide includes an inosine, which may aid in the immune system characterizing the polyribonucleotide as endogenous versus viral RNAs. The incorporation of inosine may also mediate improved RNA stability / reduced degradation. See for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.In some embodiments, all nucleotides in a polyribonucleotide (or in a given sequence region thereof) are modified. In some embodiments, the modification may include an m6A, which may augment expression; an inosine, which may attenuate an immune response; pseudouridine, which may increase RNA stability, or translational readthrough (stagger element), an m5C, which may increase stability; and a 2,2,7-trimethylguanosine, which aids subcellular translocation (e.g., nuclear localization).Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in a polyribonucleotide. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) may be located at anyposition(s) of the polyribonucleotide, such that the function of the polyribonucleotide is not substantially decreased. A modification may also be a non-coding region modification. The polyribonucleotide may include from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e. any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%>, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1 % to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%).Production methodsThe disclosure provides methods for producing circular polyribonucleotides, including, e.g., recombinant technology or chemical synthesis. For example, a DNA molecule used to produce an RNA circle can include a DNA sequence of a naturally occurring nucleic acid sequence, a modified version thereof, or a DNA sequence encoding a synthetic polypeptide not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant techniques, such as site- directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof.The circular polyribonucleotides may be prepared according to any available technique, including, but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, a linear primary construct or linear polyribonucleotide for circularization may be cyclized or concatenated to create a circRNA described herein. In some embodiments, the linear polyribonucleotide for circularization may be cyclized in vitro prior to formulation and / or delivery. In some embodiments, the circular polyribonucleotide may be in a mixture with linear polyribonucleotides. In some embodiments, the linear polyribonucleotides have the same nucleic acid sequence as the circular polyribonucleotides.The mechanism of cyclization or concatenation may occur through methods such as, e.g., chemical, enzymatic, splint ligation, or ribozyme-catalyzed methods. The newly formed 5’-3’ linkage may be an intramolecular linkage or an intermolecular linkage. For example, a splint ligase, such as a SplintR® ligase, can be used for splint ligation. According to this method, a single stranded polynucleotide (splint), such as a single-stranded DNA or RNA, can be designed to hybridize with both termini of a linear polyribonucleotide, so that the two termini can be juxtaposed uponhybridization with the single-stranded splint. Splint ligase can thus catalyze the ligation of the juxtaposed two termini of the linear polyribonucleotide, generating a circRNA. In some embodiments, a DNA or RNA ligase may be used in the synthesis of the circular polynucleotides. As a non-limiting example, the ligase may be a circ ligase or circular ligase.In some embodiments, either the 5' or 3' end of the linear polyribonucleotide can encode a ligase ribozyme sequence such that during in vitro transcription, the resultant linear polyribonucleotide for circularization includes an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide for circularization to the 3' end of the linear polyribonucleotide for circularization. The ligase ribozyme may be derived from the Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or may be selected by SELEX (systematic evolution of ligands by exponential enrichment).In another example, a linear polyribonucleotide may be cyclized or concatenated by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with regions or features near the 5' terminus or near the 3' terminus of the linear polyribonucleotide for circularization in order to cyclize or concatenate the linear polyribonucleotide for circularization. In another aspect, the at least one non-nucleic acid moiety may be located in or linked to or near the 5' terminus or the 3' terminus of the linear polyribonucleotide for circularization. The non-nucleic acid moieties may be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety may be a linkage such as a hydrophobic linkage, ionic linkage, a biodegradable linkage, or a cleavable linkage. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein.In some embodiments, a linear polyribonucleotide for circularization may include a 5' triphosphate of the nucleic acid converted into a 5' monophosphate, e.g., by contacting the 5' triphosphate with RNA 5' pyrophosphohydrolase (RppH) or an ATP diphosphohydrolase (apyrase). In some embodiments, the 5’ end of at least a portion of the linear polyribonucleotides includes a monophosphate moiety. In some embodiments, a population of polyribonucleotides including circular and linear polyribonucleotides is contacted with RppH prior to digesting at least a portion of the linear polyribonucleotides with a 5’ exonuclease and / or a 3’ exonuclease. Alternately, converting the 5' triphosphate of the linear polyribonucleotide for circularization into a 5' monophosphate may occur by a two-step reaction including: (a) contacting the 5' nucleotide of the linear polyribonucleotide for circularization with a phosphatase (e.g., Antarctic Phosphatase, Shrimp Alkaline Phosphatase, or Calf Intestinal Phosphatase) to remove all three phosphates; and (b) contacting the 5' nucleotide after step (a) with a kinase (e.g., Polynucleotide Kinase) that adds a single phosphate. In another aspect, linear polyribonucleotides for circularization may be cyclized or concatenated by self-splicing. In some embodiments, the linear polyribonucleotide may include a sequence that mediates self-ligation. In some embodiments, the linear polyribonucleotides may include loop E sequence (e.g., in PSTVd) to self-ligate. In some embodiments, the linear polyribonucleotide may include a HDV sequence, e.g., HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGAC UGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 234) (Beeharry et al 2004) orGGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUC GCCGCCCGAGCC (SEQ ID NO: 235), to self-ligate. In another embodiment, the linear polyribonucleotides may include a self-circularizing intron, e.g., a 5' and 3’ slice junction, or a selfcircularizing catalytic intron such as a Group I, Group II, or Group III Introns. Nonlimiting examples of group I intron self- splicing sequences may include self-splicing permuted intron-exon sequences derived from T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena, cyanobacterium Anabaena pre-tRNA-Leu gene, or a Tetrahymena pre-rRNA.In some embodiments, the polyribonucleotide includes catalytic intron fragments, such as a 3' half of Group I catalytic intron fragment and a 5' half of Group I catalytic intron fragment. The first and second annealing regions may be positioned within the catalytic intron fragments. Group I catalytic introns are self-splicing ribozymes that catalyze their own excision from mRNA, tRNA, and rRNA precursors via two-metal ion phorphoryl transfer mechanism. Importantly, the RNA itself self-catalyzes the intron removal without the requirement of an exogenous enzyme, such as a ligase.In some embodiments, the 3' half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene, or a Tetrahymena pre-rRNA.In some embodiments, the 3' half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a Cyanobacterium Anabaena pre-tRNA-Leu gene, and the 3’ exon fragment includes the first annealing region and the 5’ exon fragment includes the second annealing region. The first annealing region may include, e.g., from 5 to 50, e.g., from 10 to 15 (e.g., 10, 11 , 12,13, 14, or 15) ribonucleotides and the second annealing region may include, e.g., from 5 to 50, e.g., from 10 to 15 (e.g., 10, 11 , 12, 13, 14, or 15) ribonucleotides.In some embodiments, the 3' half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a Tetrahymena pre-rRNA, and the 3' half of Group I catalytic intron fragment includes the first annealing region and the 5’ exon fragment includes the second annealing region. In some embodiments, the 3' exon includes the first annealing region and the 5’ half of Group I catalytic intron fragment includes the second annealing region. The first annealing region may include, e.g., from 6 to 50, e.g., from 10 to 16 (e.g., 10, 11 , 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may include, e.g., from 6 to 50, e.g., from 10 to 16 (e.g., 10, 11 , 12, 13,14, 15, or 16) ribonucleotides.In some embodiments, the 3' half of Group I catalytic intron fragment and the 5’ half of Group I catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene, a Tetrahymena pre-rRNA, or a T4 phage td gene.In some embodiments, the 3' half of Group I catalytic intron fragment and the 5’ Group I catalytic intron fragment are from a T4 phage td gene. The 3' exon fragment may include the first annealing region and the 5’ half of Group I catalytic intron fragment may include the second annealing region. The first annealing region may include, e.g., from 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region may include, e.g., from 2 to 16, e.g., 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16) ribonucleotides.In some embodiments, the 3' half of Group I catalytic intron fragment is the 5’ terminus of the linear polynucleotide.In some embodiments, the 5' half of Group I catalytic intron fragment is the 3’ terminus of the linear polyribonucleotide.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCA AGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAG AATG-3’ (SEQ ID NO: 236).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATC TAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3’ (SEQ ID NO: 237).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 236 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 237.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- CTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATA AGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCT GGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG-3’ (SEQ ID NO: 238).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAAC CAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTT CAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGG ACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGAT-3’ (SEQ ID NO: 239).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 238 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 239.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- GGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAG ACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATT CCGGGGTAAGATTAACGACCTTATCTGAACATAATG-3’ (SEQ ID NO: 240).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTA GACAATCCCGTGCTAAATTGTAGGACT-3’ (SEQ ID NO: 241 ).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 240 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 241.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAAACAACTAACAGCTTTAGAAGGTGCAGAGACTAGACGGGAGCTACCCTAACGGATTCAGCCG AGGGTAAAGGGATAGTCCAATTCTCAACATCGCGATTGTTGATGGCAGCGAAAGTTGCAGAGAG AATGAAAATCCGCTGACTGTAAAGGTCGTGAGGGTTCGAGTCCCTCCGCCCCCA-3’ (SEQ ID NO: 242).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTGGCAGCTC TCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCCTGAGCCAAGCTAAAGC- 3’ (SEQ ID NO: 243).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 242 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 243.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TTAAACTCAAAATTTAAAATCCCAAATTCAAAATTCCGGGAAGGTGCAGAGACTCGACGGGAGCT ACCCTAACGTAAAGCCGAGGGTAAAGGGAGAGTCCAATTCTCAAAGCCTGAAGTTGCTGAAGCA ACAAGGCAGTAGTGAAAGCTGCGAGAGAATGAAAATCCGTTGACTGTAAAAAGTCGTGGGGGTT CAAGTCCCCCCACCCCC-3’ (SEQ ID NO: 244).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTTAAGTGGAAGCTCTC AAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCAGAAAATTTAG ACTTGAGATTTGATTTTGGAG-3’ (SEQ ID NO: 245).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 244 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 245.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- GGCTTTCAATTTGAAATCAGAAATTCAAAATTCAGGGAAGGTGCAGAGACTCGACGGGAGCTACC CTAACGTAAAGGCGAGGGTAAAGGGAGAGTCCAATTCTTAAAGCCTGAAGTTGTGCAAGCAACA AGGCAACAGTGAAAGCTGTGGAAGAATGAAAATCCGTTGACCTTAAACGGTCGTGGGGGTTCAA GTCCCCCCACCCCC-3’ (SEQ ID NO: 246).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTCAAGTGGAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCGGAAATTTTAG AATCAAGATTTTATTTT-3’ (SEQ ID NO: 247).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 246 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 247.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGG GACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCG AAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3’ (SEQ ID NO: 248).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGG GACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCG AAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3’ (SEQ ID NO: 249).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 248 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 249.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ACAACAGATAACTTACTAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCT AACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTG CGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3’ (SEQ ID NO: 250).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTC AGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAG TTAGTAAGTT-3’ (SEQ ID NO: 251 ).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 250 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 251.In some embodiments, the 3’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AACAACAGATAACTTACTAGTTACTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAAC GTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGG GAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3’ (SEQ ID NO: 252).In some embodiments, the 5’ half of Group I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’-AGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTC AGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAG TT-3’ (SEQ ID NO: 253).In some embodiments, the 3’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 252 and the 5’ half of Group I catalytic intron fragment has the sequence of SEQ ID NO: 253.In some embodiments, the Group I catalytic intron fragment is from the T4 phage nrdB gene or nrdD gene. In some embodiments, the 3' half of Group I catalytic intron fragment of includes a sequence having at least 80% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAA TCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAGAACGG GTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 254).In some embodiments, the 3' half of Group I catalytic intron fragment of (A) includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAA TCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAGAACGG GTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 254).In some embodiments, the 5' half of Group I catalytic intron fragment from the T4 phage nrdB gene. In some embodiments, the 3' half of Group I catalytic intron fragment is from the T4 phage nrdB gene and the 5' half of Group I catalytic intron fragment is from the T4 phage nrdB gene.In some embodiments, the 5' half of Group I catalytic intron includes a sequence having at least 80% sequence identity to 5’- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGA AAACTAGCAGCCAAGGTTTTGCTT-3’ (SEQ ID NO: 255).In some embodiments, the 5' half of Group I catalytic intron includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGA AAACTAGCAGCCAAGGTTTTGCTT-3’ (SEQ ID NO: 255).In some embodiments, the 3' half of Group I catalytic intron fragment is from the T4 phage nrdD gene.In some embodiments, the 3' half of Group I catalytic intron fragment includes a sequence having at least 80% sequence identity to 5’- CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCG AAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTA TCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGT AGAGAAGTAGCGAACTCTACTGAACACATTG-3’ (SEQ ID NO: 256).In some embodiments, the 3' half of Group I catalytic intron fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCG AAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGT AGAGAAGTAGCGAACTCTACTGAACACATTG-3’ (SEQ ID NO: 256).In some embodiments, the 5' half of Group I catalytic intron fragment is from the T4 phage nrdD gene. In some embodiments, the 3' half of Group I catalytic intron fragment is from the T4 phage nrdD gene and the 5' half of Group I catalytic intron fragment is from the T4 phage nrdD gene.In some embodiments, the 5' half of Group I catalytic intron includes a sequence having at least 80% sequence identity to 5’- TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTG CTAAATCAG-3’ (SEQ ID NO: 257).In some embodiments, the 5' half of Group I catalytic intron includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTG CTAAATCAG-3’ (SEQ ID NO: 257).In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’-GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG- 3’ (SEQ ID NO: 258).In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 258).In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’- GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 259).In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3’ (SEQ ID NO: 259).In some embodiments, the 5’ exon fragment includes a sequence having at least 80% sequence identity to 5’-TTTTTATGTATCTTTTGCGT-3’ (SEQ ID NO: 260).In some embodiments, the 5’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’-TTTTTATGTATCTTTTGCGT-3’ (SEQ ID NO: 260).In some embodiments, the 3’ exon fragment Includes a sequence having at least 80% sequence identity to 5’- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 261 ).In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 261 ).In some embodiments, the 3’ exon fragment includes a sequence having at least 80% sequence identity to 5’- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 262).In some embodiments, the 3’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3’ (SEQ ID NO: 262).In some embodiments, the 5’ exon fragment includes a sequence having at least 80% sequence identity to 5’- TGCATTCCAAGCTTATGAGT -3’ (SEQ ID NO: 263).In some embodiments, the 5’ exon fragment includes a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TGCATTCCAAGCTTATGAGT -3’ (SEQ ID NO: 263).In another aspect, a linear polyribonucleotide for circularization may be cyclized or concatenated by a non-nucleic acid moiety that causes an attraction between atoms, molecular surfaces at, near, or linked to the 5' and 3' ends of the linear polyribonucleotide for circularization. In one embodiment, one or more linear polyribonucleotides is cyclized or concatenated by intermolecular forces or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, Van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipolar bonds, conjugation, hyperconjugation and antibonding.In some embodiments, a linear polyribonucleotide for circularization may include a ribozyme RNA sequence near the 5' terminus and near the 3' terminus. The ribozyme RNA sequence may covalently link to a peptide when the sequence is exposed to the remainder of the ribozyme. In one aspect, the peptides covalently linked to the ribozyme RNA sequence near the 5’ terminus and the 3 ‘terminus may associate with each other causing a linear polyribonucleotide to cyclize or concatenate. In another example, the peptides covalently linked to the ribozyme RNA near the 5' terminus and the 3' terminus may cause the linear primary construct or linear mRNA to cyclize or concatenate after being subjected to ligation using various methods known in the art such as, but not limited to, protein ligation. Non-limiting examples of ribozymes for use in the linear primary constructs or linear polyribonucleotides of the present invention or a non-exhaustive listing of methods to incorporate or covalently link peptides are described in US patent application No. US20030082768, the contents of which is here in incorporated by reference in its entirety.In another aspect, chemical methods of circularization may be used to generate the circular polyribonucleotide. Such methods may include but are not limited to click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal- imine crosslinking, base modification, and any combination thereof. In some chemical methods, the 5'-end and the 3'-end of a linear polyribonucleotide for circularization includes chemically reactive groups that, when close together, may form a new covalent linkage between the 5'-end and the 3'-end of the molecule. The 5'-end may contain an NHS-ester reactive group and the 3'-end may contain a 3'-amino-terminated nucleotide such that in an organic solvent the 3'-amino-terminated nucleotide on the 3'-end of a linear RNA molecule will undergo a nucleophilic attack on the 5'-NHS-ester moiety forming a new 5'73'-amide bond.In another aspect, the circular polyribonucleotide may be produced using a deoxyribonucleotide template transcribed in a cell-free system (e.g., by in vitro transcription) to a produce a linear RNA. The linear polyribonucleotide produces a splicing-compatible polyribonucleotide, which may be self-spliced to produce a circular polyribonucleotide.In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide (e.g., in a cell-free system) by providing a linear polyribonucleotide; and selfsplicing linear polyribonucleotide under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide; thereby producing a circular polyribonucleotide.In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing a deoxyribonucleotide encoding the linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide; optionally purifying the splicing-compatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide.In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing a deoxyribonucleotide encoding a linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide, wherein the transcribing occurs in a solution under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5’ split-intron and a 3’ split-intron (e.g., a selfsplicing construct for producing a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5’ annealing region and a 3’ annealing region.Suitable conditions for in vitro transcriptions and or self-splicing may include any conditions (e.g., a solution or a buffer, such as an aqueous buffer or solution) that mimic physiological conditions in one or more respects. In some embodiments, suitable conditions include between 0.1 -100mM Mg2+ ions or a salt thereof (e.g., 1 -1 OOmM, 1 -50mM, 1 -20mM, 5- 50mM, 5-20 mM, or 5-15mM). In some embodiments, suitable conditions include between 1 -1 OOOmM K+ ions or a salt thereof such as KCI (e.g., 1 -1 OOOmM, 1 -500mM, 1 -200mM, 50- 500mM, 100-500mM, or 100-300mM). In some embodiments, suitable conditions include between 1 -1 OOOmM Cl- ions or a salt thereof such as KCI (e.g., 1 -1 OOOmM, 1 -500mM, 1 -200mM, 50- 500mM, 100-500mM, or 100-300mM). In some embodiments, suitable conditions include between 0.1 -1 OOmM Mn2+ ions or a salt thereof such as MnCI2 (e.g., 0.1 -100mM, 0.1 -50mM, 0.1 -20mM, 0.1 -10mM, 0.1 -5mM, 0.1 -2mM, 0.5- 50mM, 0.5-20 mM, 0.5-15mM, 0.5-5mM, 0.5-2mM, or 0.1 -1 OmM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1 -1000 pM, 1 -500 pM, 1 -200pM, 50- 500pM, 100-500pM, 100-300pM, 0.1 - 100mM, 0.1 -50mM, 0.1 -20mM, 0.1 -10mM, 0.1 -5mM, 0.1 -2mM, 0.5- 50mM, 0.5-20 mM, 0.5-15mM, 0.5-5mM, 0.5-2mM, or 0.1 -1 OmM). In some embodiments, suitable conditions include between 0.1 mM and 10OmM ribonucleoside triphosphate (NTP) (e.g., 0.1 -100 mM, 0.1 -50mM, 0.1 -1 OmM, 1 - 10OmM, 1 -50mM, or 1 -1 OmM). In some embodiments, suitable conditions include a pH of 4 to 10 (e.g., pH of 5 to 9, pH of 6 to 9, or pH of 6.5 to 8.5). In some embodiments, suitable conditions include a temperature of 4°C to 50°C (e.g., 10°C to 40°C, 15 °C to 40°C, 20°C to 40°C, or 30°C to 40°C),In some embodiments the linear polyribonucleotide is produced from a deoxyribonucleic acid, e.g., a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA. In some embodiments, the linear polyribonucleotide is transcribed from the deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription).In another aspect, the circular polyribonucleotide may be produced in a cell, e.g., a prokaryotic cell or a eukaryotic cell. In some embodiments, an exogenous polyribonucleotide is provided to a cell (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding for the transcription of a linear polyribonucleotide described here). The linear polyribonucleotides may be transcribed in the cell from an exogenous DNA molecule provided to the cell. The linear polyribonucleotide may be transcribed in the cell from an exogenous recombinant DNA molecule transiently provided to the cell. In some embodiments, the exogenous DNA molecule does not integrate into the cell’s genome. In some embodiments, the linear polyribonucleotide is transcribed in the cell from a recombinant DNA molecule that is incorporated into the cell’s genome.In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell including the polyribonucleotides described herein is a bacterial cell or an archaeal cell. For example, the prokaryotic cell including the polyribonucleotides described herein may be E coli, halophilic archaea (e.g., Haloferax volcaniii), Sphingomonas, cyanobacteria (e.g., Synechococcus elongatus, Spirulina (Arthrospira) spp., and Synechocystis spp.), Streptomyces, actinomycetes (e.g., Nonomuraea, Kitasatospora, or Thermobifida), Bacillus spp. (e.g., Bacillus subtilis, Bacillus anthracis, Bacillus cereus), betaproteobacteria (e.g., Burkholderia), alphaproteobacterial (e.g., Agrobacterium), Pseudomonas (e.g., Pseudomonas putida), and enterobacteria. The prokaryotic cells may be grown in a culture medium. The prokaryotic cells may be contained in a bioreactor.In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic is a unicellular fungal cell such as a yeast cell (e.g., Saccharomyces cerevisiae and other Saccharomyces spp., Brettanomyces spp., Schizosaccharomyces spp., Torulaspora spp, and Pichia spp.). In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. A unicellular animal cell may be a cell isolated from a multicellular animal and grown in culture, or the daughter cells thereof. In some embodiments, the unicellular animal cell is dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. A unicellular plant cell may be a cell isolated from a multicellular plant and grown in culture, or the daughter cells thereof. In some embodiments, the unicellular plant cell is dedifferentiated. In some embodiments, the unicellular plant cell is from a plant callus. In embodiments, the unicellular cell is a plant cell protoplast. In some embodiments, the unicellular eukaryotic cell is a unicellular eukaryotic algal cell, such as a unicellular green alga, a diatom, an euglenid, or a dinoflagellate. Non-limiting examples of unicellular eukaryotic algae of interest include Du naliella salina, Chlorella vulgaris, Chlorel la zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris spp., Protosiphon botryoides, Botryococcus braunii, Cryptococcus spp., Chlamydomonas reinhardtii and other Chlamydomonas spp. In some embodiments, the unicellular eukaryotic cell is a protist cell. In some embodiments, the unicellular eukaryotic cell is a protozoan cell.In some embodiments, the eukaryotic cell is a cell of a multicellular eukaryote. For example, the multicellular eukaryote may be selected from the group consisting of a vertebrate animal, an invertebrate animal, a multicellular fungus, a multicellular alga, and a multicellular plant. In some embodiments, the eukaryotic organism is a human. In some embodiments, the eukaryotic organism is a non-human vertebrate animal. In some embodiments, the eukaryotic organism is an invertebrate animal. In some embodiments, the eukaryotic organism is a multicellular fungus. In some embodiments, the eukaryotic organism is a multicellular plant. In embodiments, the eukaryotic cell is a cell of a human or a cell of a non-human mammal such as a non-human primate (e.g., monkeys, apes), ungulate (e.g., bovids including cattle, buffalo, bison, sheep, goat, and musk ox; pig; camelids including camel, llama, and alpaca; deer, antelope; and equids including horse and donkey), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse, guinea pig, hamster, squirrel), or lagomorph (e.g., rabbit, hare). In embodiments, the eukaryotic cell is a cell of a bird, such as a member of the avian taxa Galliformes (e.g., chickens, turkeys, pheasants, quail), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the eukaryotic cell is a cell of an arthropod (e.g., insects, arachnids, crustaceans), a nematode, an annelid, a helminth, or a mollusc. In embodiments, the eukaryotic cell is a cell of a multicellular plant, such as an angiosperm plant (which can be a dicot or a monocot) or a gymnosperm plant (e.g., a conifer, a cycad, a gnetophyte, a Ginkgo), a fern, horsetail, clubmoss, or a bryophyte. In embodiments, the eukaryotic cell is a cell of a eukaryotic multicellular alga.The eukaryotic cells may be grown in a culture medium. The eukaryotic cells may be contained in a bioreactor.In some embodiments, any method of producing a circular polyribonucleotide described herein may be performed in a bioreactor. A bioreactor refers to any vessel in which a chemical or biological process is carried out which involves organisms or biochemically active substances derived from such organisms. Bioreactors may be compatible with the cell-free methods for production of circular RNA described herein. A vessel for a bioreactor may include a culture flask, a dish, or a bag that may be single use (disposable), autoclavable, or sterilizable. A bioreactor may be made of glass, or it may be polymer-based, or it may be made of other materials.Examples of bioreactors include, without limitation, stirred tank (e.g., well mixed) bioreactors and tubular (e.g., plug flow) bioreactors, airlift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibromixers, fluidized bed reactors, and membrane bioreactors. The mode of operating the bioreactor may be a batch or continuous processes. A bioreactor is continuous when the reagent and product streams are continuously being fed and withdrawn from the system. A batch bioreactor may have a continuous recirculating flow, but no continuous feeding of reagents or product harvest. Some methods of the present disclosure are directed to large-scale production of circular polyribonucleotides. For large-scale production methods, the method may be performed in a volume of 1 liter (L) to 50 L, or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L, or more). In some embodiments, the method may be performed in a volume of 5 L to 10 L, 5 L to 15 L, 5 L to 20 L, 5 L to 25 L, 5 L to 30 L, 5 L to 35 L, 5 L to 40 L, 5 L to 45 L, 10 L to 15 L, 10 L to 20 L, 10 L to 25 L, 20 L to 30 L, 10 L to 35 L, 10 L to 40 L, 10 L to 45 L, 10 L to 50 L, 15 L to 20 L, 15 L to 25 L, 15 L to 30 L,15 L to 35 L, 15 L to 40 L, 15 L to 45 L, or 15 to 50 L. In some embodiments, a bioreactor may produce at least 1g of circular RNA. In some embodiments, a bioreactor may produce 1 -200g of circular RNA (e.g., 1 -10g, 1 -20g, 1 -50g, 10-50g, 10-100g, 50-100g, or 50-200g of circular RNA). In some embodiments, the amount produced is measured per liter (e.g., 1 -200g per liter), per batch or reaction (e.g., 1 -200g per batch or reaction), or per unit time (e.g., 1 -200g per hour or per day). In some embodiments, more than one bioreactor may be utilized in series to increase the production capacity (e.g., one, two, three, four, five, six, seven, eight, or nine bioreactors may be used in series).In some embodiments, circularization efficiency is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, circularization efficiency is at least about 40%. In some embodiments, circularization efficiency is between about 10% and about 100%; for example, circularization efficiency is about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, circularization efficiency is between about 20% and about 80%. In some embodiments, circularization efficiency is between about 30% and about 60%. In some embodiments, circularization efficiency is about 40%.Additional methods of making the circular polyribonucleotides described herein are described in, for example, Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); Muller and Appel, from RNA Biol, 2017, 14(8):1018-1027; and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012). Other methods of making circular polyribonucleotides are described, for example, in International Publication No. WO2022 / 247943, US Patent No. US11000547, International Publication No. 2018 / 191722, International Publication No. WO2019 / 236673, International Publication No. W02020 / 023595, International Publication No. W02022 / 204460, International Publication No. WO2022 / 204464, International Publication No. WO2022 / 204466, and International Publication No. 2022 / 261490.Additional methods of synthesizing circular polyribonucleotides are also described elsewhere (see, e.g., US Patent No. US6210931 , US Patent No. US5773244, US Patent No. US5766903, US Patent No. US5712128, US Patent No. US5426180, US Publication No. US20100137407, International Publication No. WO1992001813, International Publication No. WO2010084371 , and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); the contents of each of which are herein incorporated by reference in their entirety).Methods of purificationOne or more purification steps may be included in the methods described herein. For example, in some embodiments, the linear polyribonucleotide is substantively enriched or pure (e.g., purified) prior to self-splicing the linear polyribonucleotide. In other embodiments, the linearpolyribonucleotide is not purified prior to self-splicing the linear polyribonucleotide. In some embodiments, the resulting circular RNA is purified.Purification may include separating or enriching the desired reaction product from one or more undesired components, such as any unreacted stating material, byproducts, enzymes, or other reaction components. For example, purification of linear polyribonucleotide following transcription in a cell-free system (e.g., in vitro transcription) may include separation or enrichment from the DNA template prior to self-splicing the linear polyribonucleotide. Purification of the circular RNA product following splicing may be used to separate or enrich the circular polyribonucleotide from its corresponding linear polyribonucleotide. Methods of purification of polyribonucleotides are known to those of skill in the art and include enzymatic purification or by chromatography.In some embodiments, the methods of purification result in a circular polyribonucleotide that has less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polyribonucleotides.In some embodiments, the reference criterion for the amount of linear polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is the presence of no more than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 1 pg / ml, 10 pg / ml, 50 pg / ml, 100 pg / ml, 200 g / ml, 300 pg / ml, 400 pg / ml, 500 pg / ml, 600 pg / ml, 700 pg / ml, 800 pg / ml, 900 pg / ml, 1 mg / ml, 1 .5 mg / ml, or 2 mg / ml of linear polyribonucleotide molecules.In some embodiments, the reference criterion for the amount of circular polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91 % (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 99.1% (w / w), 99.2% (w / w), 99.3% (w / w), 99.4% (w / w), 99.5% (w / w), 99.6% (w / w), 99.7% (w / w), 99.8% (w / w), 99.9% (w / w), or 100% (w / w) molecules of the total ribonucleotide molecules in the preparation.In some embodiments, the reference criterion for the amount of linear polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) linear polyribonucleotide molecules of the total ribonucleotide molecules in the preparation.In some embodiments, the reference criterion for the amount of nicked polyribonucleotide molecules present in a preparation (e.g., pharmaceutical preparation) is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) nicked polyribonucleotide molecules of the total ribonucleotide molecules in the preparation.In some embodiments, the reference criterion for the amount of combined nicked and linear polyribonucleotide molecules present in a preparation is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) combined nicked and linear polyribonucleotide molecules of the total ribonucleotide molecules in the preparation. In some embodiments, a preparation (e.g., pharmaceutical preparation) is an intermediate preparation of a final circular polyribonucleotide drug product. In some embodiments, apreparation (e.g., pharmaceutical preparation) is a drug substance or active pharmaceutical ingredient (API). In some embodiments, a preparation (e.g., pharmaceutical preparation) is a drug product for administration to a subject.In some embodiments, a preparation (e.g., pharmaceutical preparation) of circular polyribonucleotides is (before, during or after the reduction of linear polyribonucleotide) further processed to substantially remove DNA, protein contamination (e.g., cell protein such as a host cell protein or protein process impurities), endotoxin, mononucleotide molecules, and / or a process-related impurity.Linear Polyribonucleotide ElementsThe linear polyribonucleotide comprises the elements as described below as described herein.Linear polyribonucleotides described herein are a polyribonucleotide molecule having a 5’ and 3’ end. In some embodiments, the linear RNA has a free 5’ end or 3’ end. In some embodiments, the linear RNA has a 5’ end or 3’ end that is modified or protected from degradation. In some embodiments, the linear RNA has non-covalently linked 5’ or 3’ ends. In some embodiments, the linear RNA is an mRNA.In some embodiments, the linear polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1 ,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.The linear polyribonucleotides of the disclosure may include any element or combination of elements described herein, e.g., any element or combination of elements described above with respect to circular polyribonucleotides. A linear polyribonucleotide may include any one or more IRES, signal sequence, regulatory element, cleavage domain, translation initiation sequence, untranslated region, termination element, or modification as described herein (e.g., with respect to circular polyribonucleotide described above). A linear polyribonucleotide may include such elements in any number or configuration described herein (e.g., with respect to circular polyribonucleotide described above).Methods of UseA polyribonucleotide described herein may be administered to a subject (e.g., in a pharmaceutical composition). For example, a circular or linear polyribonucleotide described herein may be administered to a subject (e.g., in a pharmaceutical composition). In some embodiments, acircular or linear polyribonucleotide described herein is administered to a subject in an immunogenic composition.Immunogenic compositions of the disclosure may include a diluent or a carrier, adjuvant, or any combination thereof. Immunogenic compositions of the disclosure may also include one or more immunoregulatory agents, e.g., one or more adjuvants. The adjuvants may include a TH1 adjuvant and / or a TH2 adjuvant, further discussed below. In some embodiments, the immunogenic composition includes a diluent free of any carrier and is used for naked delivery of the circular polyribonucleotide to a subject. In some embodiments, the immunogenic composition includes a diluent free of any carrier and is used for naked delivery of the linear polyribonucleotide to a subject.Immunogenic compositions of the disclosure are used to raise an immune response in a subject. The immune response is preferably protective and preferably involves an antibody response (usually including IgG) and / or a cell-mediated immune response. For example, a subject is immunized with an immunogenic composition including a circular polyribonucleotide of the disclosure to induce an immune response. In another example, a subject is immunized with an immunogenic composition including a linear polyribonucleotide including an immunogen to stimulate production of antibodies that bind to the immunogen. By raising an immune response in the subject by these uses and methods, the subject can be protected against various diseases and / or infections e.g. against bacterial and / or viral diseases as discussed above. In certain embodiments, the immunogenic compositions are vaccine compositions. Vaccines according to the disclosure may either be prophylactic (i.e. to prevent infection) or therapeutic (i.e. to treat infection) but will typically be prophylactic. In some embodiments, the subject is a mammal. In some embodiments, the subject is an animal, preferably a mammal, e.g., a human. In one embodiment, the subject is a human. In other embodiments the subject is a non-human mammal, e.g., selected from a cow (e.g., dairy and beef cattle), a sheep, a goat, a pig, a horse, a dog, or a cat. In other embodiments the subject is a bird, e.g., a hen or rooster, turkey, parrot. In some embodiments, the animal is not a mouse or a rabbit or a cow. In a particular embodiment, where the immunogenic composition is for prophylactic use, the human is a child (e.g. a toddler or infant) or a teenager. In another embodiment, where the immunogenic composition is for therapeutic use, the human is a teenager or an adult. An immunogenic composition intended for children may also be administered to adults e.g. to assess safety, dosage, immunogenicity, etc.Immunogenic composition prepared according to the disclosure may be used to treat both children and adults. A human subject may be less than 1 year old, less than 5 years old, 1 -5 years old, 5-15 years old, 15-55 years old, or at least 55 years old. In a particular embodiment, a human subject for receiving the immunogenic compositions are the elderly (e.g., >50 years old, >60 years old, and >65 years), the young (e.g., <5 years old), hospitalized patients, healthcare workers, armed service and military personnel, pregnant women, the chronically ill, or immunodeficient patients. The immunogenic compositions are not suitable solely for these groups, however, and may be used more generally in a population.In some embodiments, the subject is further immunized with an adjuvant. In some embodiments the subject is further immunized with a vaccine.Methods of DosingA polyribonucleotide (e.g., a circular polyribonucleotide, a linear polyribonucleotide) described herein (e.g., in a pharmaceutical or agricultural composition) may be administered in a single dose or in multiple doses to a cell, tissue, or subject.A method of administering multiple doses of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition) comprises providing two or more compositions, over a period of time, to a cell, tissue or subject (e.g., a mammal). According to certain embodiments, multiple doses of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition) may be administered to a subject over a defined time course. The methods according to this aspect of the invention comprise sequentially administering to a subject multiple doses of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition). As used herein, “sequentially administering” means that each dose of composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition) is administered to the subject at a different point in time, e.g., on different days separated by a predetermined interval (e.g., hours, days, weeks or months). In some embodiments, the present invention provides methods which comprise sequentially administering to the subject a single initial dose of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition), followed by one or more secondary doses of the composition, and optionally followed by one or more tertiary doses of the composition.The terms “initial dose,” “secondary doses,” and “tertiary doses,” refer to the temporal sequence of administration of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition). Thus, the “initial dose” is the dose which is administered at the beginning of the treatment regimen (also referred to as the “baseline dose”); the “secondary doses” are the doses which are administered after the initial dose; and the “tertiary doses” are the doses which are administered after the secondary doses. The initial, secondary, and tertiary doses may all contain the same amount of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition), and in certain embodiments, may differ from one another in terms of frequency of administration. In certain embodiments, the amount of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition) contained in the initial, secondary and / or tertiary doses varies from one another (e.g., adjusted up or down as appropriate) during the course of treatment. In certain embodiments, one or more (e.g., 2, 3, 4, or 5) doses are administered at the beginning of the treatment regimen as “loading doses” followed by subsequent doses that are administered on a less frequent basis (e.g., “maintenance doses”).In certain embodiments, each secondary and / or tertiary dose is administered after the immediately preceding dose. The phrase “the immediately preceding dose,” as used herein, means, in a sequence of multiple administrations, the dose of the composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition) which is administered to a subject prior to the administration of the very next dose in the sequence with no intervening doses. In certain embodiments, each secondary and / or tertiary dose is administered every day, every 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after the immediately preceding dose. In certain embodiments, each secondary and / or tertiary dose is administered every 0.5 weeks, 1 week, 2 weeks, 3 weeks, or 4 weeks after the immediately preceding dose.The methods according to this aspect of the invention may comprise administering to a subject any number of secondary and / or tertiary doses of a composition of a polyribonucleotide described herein (e.g., a circular polyribonucleotide, a linear polyribonucleotide) (e.g., in a pharmaceutical or agricultural composition). For example, in certain embodiments, only a single secondary dose is administered to the subject. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) secondary doses are administered to the subject. Likewise, in certain embodiments, only a single tertiary dose is administered to the subject. In other embodiments, ...

Claims

CLAIMS1 . A circular polyribonucleotide comprising, in the following order from 5’ to 3’:(a) a first post-circularization element;(b) a first spacer element having a length of at least 100 ribonucleotides;(c) a polyribonucleotide cargo encoding an immunogen;(d) a second spacer element; and(e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

2. A circular polyribonucleotide comprising, in the following order from 5’ to 3’:(a) a first post-circularization element;(b) a first spacer element;(c) a polyribonucleotide cargo encoding an immunogen;(d) a second spacer element having a length of at least 100 ribonucleotides; and(e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

3. The circular polyribonucleotide of claim 1 or 2, wherein the first spacer element has a length of between 100 to 500 ribonucleotides.

4. The circular polyribonucleotide of claim 3, wherein the second spacer element has a length of between 100 to 500 ribonucleotides.

5. The circular polyribonucleotide of claim 4, wherein the first spacer element and the second spacer element each comprise 110 to 500 ribonucleotides.

6. The circular polyribonucleotide of claim 5, wherein the first spacer element and the second spacer element each comprise 120 to 500 ribonucleotides.

7. The circular polyribonucleotide of claim 6, wherein the first spacer element and the second spacer element each have a length of 150 to 500 ribonucleotides.

8. The circular polyribonucleotide of claim 7, wherein the first spacer element and the second spacer element each have a length of 200 to 500 ribonucleotides.

9. The circular polyribonucleotide of claim 4, wherein the first spacer element and the second spacer element each have a length of 100 to 300 ribonucleotides.

10. The circular polyribonucleotide of claim 9, wherein the first spacer element and the second spacer element each have a length of 100 to 200 ribonucleotides.11 . The circular polyribonucleotide of claim 9, wherein the first spacer element and the second spacer element each have a length of 110 to 300 ribonucleotides.

12. The circular polyribonucleotide of claim 11 , wherein the first spacer element and the second spacer element each have a length of 120 to 300 ribonucleotides.

13. The circular polyribonucleotide of claim 12, wherein the first spacer element and the second spacer element each have a length of 150 to 300 ribonucleotides.

14. The circular polyribonucleotide of any one of claims 1 -13, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 500 nucleotides.

15. The circular polyribonucleotide of any one of claims 14, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 nucleotides.

16. The circular polyribonucleotide of claim 15, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 nucleotides.

17. The circular polyribonucleotide of any one of claims 1 -16, wherein the first spacer or the second spacer element consists of:(i) a polyA region comprising 80% to 100% adenosine residues;(ii) a polyAC region comprising between 80% to 100% adenosine or cytosine residues;(iii) a polyAU region comprising between 80% to 100% adenosine or uridine residues; or(iii) a polyAG region comprising between 80% to 100% adenosine or guanosine residues.

18. The circular polyribonucleotide of any one of claims 1 -17, wherein the circular polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without the first spacer element or the second spacer element.

19. The circular polyribonucleotide of any one of claims 1 -18, wherein the circular polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without the first spacer element or the second spacer element after the circular polyribonucleotide is administered to a subject.

20. The circular polyribonucleotide of any one of claims 1 -19, wherein the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without the first spacer element or the second spacer element.21 . The circular polyribonucleotide any one of claims 1 -20, wherein the polyribonucleotide cargo encoding an immunogen comprises an expression sequence.

22. The circular polyribonucleotide of claim 21 , wherein the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence.

23. The circular polyribonucleotide of claim 21 or 22, wherein the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region.

24. The circular polyribonucleotide of any one of claims 21 -23, wherein the expression sequence encodes an immunogen.

25. The circular polyribonucleotide of any one of claims 1 -24, wherein the polyribonucleotide comprises between 500 and 20,000 ribonucleotides.

26. The circular polyribonucleotide of claim 25, wherein the polyribonucleotide comprises between 2,000 and 20,000 ribonucleotides.

27. The circular polyribonucleotide of any one of claims 1 -26, wherein the circularization junction comprises a splice junction.

28. The circular polyribonucleotide of claim 27, wherein the first post-circularization element comprises a first exon fragment and the second post-circularization element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are joined by the splice junction.

29. The circular polyribonucleotide of any one of claims 1 -28, wherein the circularization junction comprises an oligonucleotide splint that is hybridized to the first post-circularization element and to the second post-circularization element.

30. The circular polyribonucleotide of claim 29, wherein the oligonucleotide splint is a DNA splint or an RNA splint.31 . The circular polyribonucleotide of claim 29 or 30, wherein the first post-circularization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint and thesecond post-circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

32. A linear polyribonucleotide comprising, in the following order from 5’ to 3’:(a) a first post-circularization element;(b) a first spacer element having a length of at least 100 ribonucleotides;(c) a polyribonucleotide cargo encoding an immunogen;(d) a second spacer element; and(e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

33. A linear polyribonucleotide comprising, in the following order from 5’ to 3’:(a) a first post-circularization element;(b) a first spacer element;(c) a polyribonucleotide cargo encoding an immunogen;(d) a second spacer element having a length of at least 100 ribonucleotides; and(e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

34. The linear polyribonucleotide of claim 32 or 33, wherein the first spacer element has a length of between 100 to 500 ribonucleotides.

35. The linear polyribonucleotide of claim 34, wherein the second spacer element has a length of between 100 and 500.

36. The linear polyribonucleotide of claim 35, wherein the first spacer element and the second spacer element each comprise 110 to 500 ribonucleotides.

37. The linear polyribonucleotide of claim 36, wherein the first spacer element and the second spacer element each comprise 120 to 500 ribonucleotides.

38. The linear polyribonucleotide of claim 37, wherein the first spacer element and the second spacer element each have a length of 150 to 500 ribonucleotides.

39. The linear polyribonucleotide of claim 38, wherein the first spacer element and the second spacer element each have a length of 200 to 500 ribonucleotides.

40. The linear polyribonucleotide of claim 35, wherein the first spacer element and the second spacer element each have a length of 100 to 300 ribonucleotides.41 . The linear polyribonucleotide of claim 40, wherein the first spacer element and the second spacer element each have a length of 100 to 200 ribonucleotides.

42. The linear polyribonucleotide of claim 40, wherein the first spacer element and the second spacer element each have a length of 110 to 300 ribonucleotides.

43. The linear polyribonucleotide of claim 42, wherein the first spacer element and the second spacer element each have a length of 120 to 300 ribonucleotides.

44. The linear polyribonucleotide of claim 43, wherein the first spacer element and the second spacer element each have a length of 150 to 300 ribonucleotides.

45. The linear polyribonucleotide of any one of claims 32-44, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 500 nucleotides.

46. The linear polyribonucleotide of claim 45, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 nucleotides.

47. The linear polyribonucleotide of claim 46, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 nucleotides.

48. The linear polyribonucleotide of any one of claims 32-47, wherein the first spacer or the second spacer element consists of:(i) a polyA region comprising 80% to 100% adenosine residues;(ii) a polyAC region comprising between 80% to 100% adenosine or cytosine residues;(iii) a polyAU region comprising between 80% to 100% adenosine or uridine residues; or(iv) a polyAG region comprising between 80% to 100% adenosine or guanosine residues.

49. The linear polyribonucleotide of any one of claims 32-48, wherein the polyribonucleotide exhibits at least 2-fold greater stability in comparison to a polyribonucleotide without the first spacer element or the second spacer element.

50. The linear polyribonucleotide of any one of claims 32-49, wherein the polyribonucleotide may be detected for at least 2-fold longer in comparison to a polyribonucleotide without the first spacer element or the second spacer element after the polyribonucleotide is administered to a subject.51 . The linear polyribonucleotide of any one of claims 32-50, wherein the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression in comparison to a polyribonucleotide without the first spacer element or the second spacer element.

52. The linear polyribonucleotide any one of claims 32-51 , wherein the polyribonucleotide cargo encoding an immunogen comprises an expression sequence.

53. The linear polyribonucleotide of claim 52, wherein the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence.

54. The linear polyribonucleotide of claim 52 or 53, wherein the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region.

55. The linear polyribonucleotide of any one of claims 52-54, wherein the expression sequence encodes an immunogen.

56. The linear polyribonucleotide of any one of claims 32-55, wherein the polyribonucleotide comprises between 500 and 20,000 ribonucleotides.

57. The linear polyribonucleotide of claim 56, wherein the polyribonucleotide comprises between 2,000 and 20,000 ribonucleotides.

58. The linear polyribonucleotide of any one of claims 21 -57, wherein the circularization junction comprises a splice junction.

59. The linear polyribonucleotide of claim 58, wherein the first post-circularization element comprises a first exon fragment and the second post-circularization element comprises a second exon fragment, and wherein the first exon fragment and the second exon fragment are joined by the splice junction.

60. The linear polyribonucleotide of any one of claims 32-59, wherein the circularization junction comprises an oligonucleotide splint that is hybridized to the first post-circularization element and to the second post-circularization element.61 . The linear polyribonucleotide of claim 60, wherein the oligonucleotide splint is a DNA splint or an RNA splint.

62. The linear polyribonucleotide of claim 60 or 61 , wherein the first post-circularization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint and the second post-circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

63. The linear polyribonucleotide of any one of claims 32-62, wherein: the first circularization element comprises a first catalytic intron fragment, a first splice site dinucleotide, and a first exon fragment; and the second circularization element comprises a second catalytic intron fragment, a second splice site dinucleotide, and a second exon fragment.

64. The linear polyribonucleotide of claim 63, wherein the first catalytic intron fragment and the second catalytic intron fragment, together, are capable of self-splicing thereby covalently joining the first exon region and the second exon region to produce a circular polyribonucleotide.

65. The linear polyribonucleotide of claim 63 or 64, wherein the first catalytic intron fragment and the second catalytic intron fragment are from a cyanobacterium Anabaena pre-tRNA-Leu gene or a Tetrahymena pre-rRNA.

66. The linear polyribonucleotide of any one of claims 32-65, wherein the first circularization element comprises a region that is capable of hybridizing to a first region of an oligonucleotide splint and the second circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

67. A DNA vector comprising an RNA polymerase promoter operably linked to a sequence that encodes the linear polyribonucleotide of any one of claims 32-66.

68. A circular polyribonucleotide produced from the linear polyribonucleotide of any one of claims 32- 66 or from the DNA vector of claim 67.

69. A pharmaceutical composition comprising the linear polyribonucleotide, the circular polyribonucleotide, or the DNA vector of any one of claims 1 -66 and a pharmaceutically acceptable excipient.

70. A method of expressing an immunogen in a cell or a subject, the method comprising providing to the cell or the subject the linear polyribonucleotide, the circular polyribonucleotide, the DNA vector, or the pharmaceutical composition of one of claims 1 -69.71 . A method of producing a circular polyribonucleotide from the linear polyribonucleotide of any one of claims 1 -66, the method comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.