Pah-modulating systems and methods

EP4680737A2Pending Publication Date: 2026-01-21FLAGSHIP PIONEERING INNOVATIONS VI LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024771754
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-17
Filing Date
2024-03-14
Publication Date
2026-01-21

AI Technical Summary

Technical Problem

Current methods for treating phenylketonuria (PKU) are inadequate, as they either rely on small edits that are inefficient for longer sequences or require multiple steps, and existing therapies like dietary supplements and enzyme substitution therapies have limited effectiveness in reducing phenylalanine levels and addressing genetic mutations in the PAH gene.

Method used

A gene modifying system comprising a nucleic acid encoding a gene modifying polypeptide with a reverse transcriptase domain and Cas9 nickase, combined with a template RNA that includes a gRNA spacer, scaffold, heterologous object sequence, and primer binding site, is used to target and correct mutations in the PAH gene, allowing for the insertion, deletion, or substitution of sequences to restore PAH enzyme function.

Benefits of technology

This approach enables precise modification of the PAH gene, potentially leading to significant reductions in phenylalanine levels and improved treatment outcomes for PKU patients by correcting pathogenic mutations and restoring enzyme function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000115_0001
    Figure IMGF000115_0001
  • Figure IMGF000115_0002
    Figure IMGF000115_0002
  • Figure IMGF000115_0003
    Figure IMGF000115_0003
Patent Text Reader

Abstract

The disclosure provides, e.g., compositions, systems, and methods for targeting, editing, modifying, or manipulating a host cell's genome at one or more locations in a DNA sequence in a cell, tissue, or subject. Gene modifying systems for treating phenylketonuria (PKU) are described.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PAH-MODULATING SYSTEMS AND METHODS

[0002] SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format compliant with WIPO Standard ST.26 and is hereby incorporated by reference in its entirety. Said XML copy, created on March 12, 2024, is named V2065-7048WO_SL.xml and is 8,922,351 bytes in size.

[0004] CROSS REFERENCE TO RELATED APPLICATIONS

[0005] This application claims the benefit of U.S. Provisional Application No. 63 / 490,442, filed March 15, 2023, U.S. Provisional Application No. 63 / 491,490, filed March 21, 2023, and U.S. Provisional Application No. 63 / 600,472, filed November 17, 2023. Tire contents of the aforementioned applications are hereby incorporated by reference in their entirety.

[0006] BACKGROUND

[0007] Integration of a nucleic acid of interest into a genome occurs at low frequency and with little site specificity, in the absence of a specialized protein to promote the insertion event. Some existing approaches, like CRISPR / Cas9, are more suited for small edits that rely on host repair pathways, and are less effective at integrating longer sequences. Other existing approaches, like Cre / loxP, require a first step of inserting a loxP site into the genome and then a second step of inserting a sequence of interest into the loxP site. There is a need in the art for improved compositions (e.g., proteins and nucleic acids) and methods for inserting, altering, or deleting sequences of interest in a genome.

[0008] PKU is an inherited disorder involving an autosomal recessive inborn error of metabolism caused by a deficiency in the hepatic enzyme PAH. PAH catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine metabolism. Tire reaction is dependent on tetrahydrobiopterin (BH4), as a cofactor, molecular oxygen, and iron. Loss-of-function mutations in one, or both, copies of the PAH gene lead to a non-functional, or less efficient enzyme. This ultimately results in phenotypically severe forms of PKU where phenylalanine in the blood can accumulate to toxic concentrations, with impaired levels of plasma tyrosine. Additionally, the deficiency prevents normal synthesis of downstream products, including dopamine, norepinephrine, and melanin.

[0009] The PAH genomic sequence and its flanking regions span about 171 kb, containing 13 exons. Study of pathogenic allelic variants have identified more than 500 different disease-causing mutations in the PAH gene (Mitchell, et al. Genet Med. 2011; 13:697-707). Of these mutations, approximately 62% have been characterized as missense, 13% deletions, 11% splice, 6% silent, 5% nonsense, 2% insertion, and < 1% deletion or duplication of exons. The identification of several PAH mutations have been described for their effects on enzymatic activity using enzyme kinetics and crystallographic studies. Mutations affecting the catalytic binding mode, including Y138F, S23A, and Y377F, were observed with reduced propensity for tetramer formation (Flydal, etal. PNAS. 2019; 116(23): 11229-34). Other residues that interact with BH4 in the precatalytic confomration (amino acids 245-255. 286, 322, and 325) also interact with BH4 in the catalytic conformation, and. in addition, these sites are actually associated with severe destabilization of PAH.

[0010] Naturally occurring N-terminal PAH mutations have been determined to be distributed in a nonrandom pattern, clustering within residues 46-48 (GAL motif) and 65-69 (IESRP motif (SEQ ID NO: 37634)), both motifs highly conserved in pyruvate dehydrogenase (PDH) (Gjetting, et al. Am. / J. Hum. Genet. 2001; 68: 1353-60). Structure -function studies demonstrated that mutations in these regions drastically reduced phenylalanine binding. Most missense mutations identified in PKU to date result in phenotypic outcomes associated with misfolding of the PAH enzyme, increased protein turnover, and loss of enzymatic function. Residues in exons 7-9 and in interdomain regions within the subunit appear to play an important structural role and constitute hotspots for destabilization. Additionally, using recombinant fonns of hPAH, mutations in BH4 responsive domains, including R408W and Y414C showed residual activity, but had perturbed allostery suggesting altered protein conformation (Gersting, et al. Hum. Genet. 2008; 83:5-17). Mutation analyses and structure-function analyses have identified a robust genotype- phenotype mapping for PAH’s role in PKU; however, outside of lifetime symptom management strategies, there has not been a successful cure.

[0011] Dietary therapy of phenylalanine (Phe) remains to be the mainstay treatment for PKU since its introduction in 1953. In tire 1970s, tetrahydrobiopterin (BH4) and neurotransmitter precursor (L- dopa / carbidopa and 5 -hydroxytryptophan) combination therapy showed promise in modulating PKU. Since its institution as a therapy, synthetics such as sapropterin have been formulated for as small molecule isomers of BFL. Although, this form of therapy is generally only useful in patients with mild subsets of PAH-deficient PKU. It is thought that the therapy responsiveness is associated with mutations in the PAH gene resulting in some residual enzyme activity. At high blood concentrations, Phe in the blood will compete with other large neutral amino acids (LNAAs) for transport across the blood-brain barrier. LNAA supplementation has been shown to reduce cerebral Phe concentrations despite the observed increase in plasma Phe levels. Likewise, dietary supplementation with glycomacropeptides (GMP) has been observed to significantly reduce ureagenesis, improved protein retention, and Phe utilization. Although, these strategies do little to address tire increased blood levels of Phe or the genotypic drivers.

[0012] Modem non-dictary approaches include the development of PAH-bascd fusion proteins and enzyme substitution therapies. Enzyme substitution therapies can include administration of phenylalanine ammonia-lyase (PAL) to a patient. PAL is an enzyme which catalyzes the conversion of Phe to transcinnamic acid and insignificant amounts of ammonia. Early studies using PAL administered in enteric- coated gelatin capsules to PKU patients, showed reductions in Phe levels; however, repeated dosing in vivo resulted in mounting of immune responses. Although, these approaches are not practical from a clinical perspective as several intravenous injections would be required due to the limited half-life of circulating enzymes. Gene therapy has shown some promise, for example using viral vectors, in rescuing PAH functionality. However, the efficacy of this strategy is hampered by the very low gene transfer rate and transient transgene expression. Accordingly, there is a need for new and more effective treatments for targeting PAH in PKU.

[0013] SUMMARY OF THE INVENTION

[0014] This disclosure relates to novel compositions, systems, and methods for altering a genome at one or more locations in a host cell, tissue, or subject, in vivo or in vitro. The disclosure provides gene modifying systems that are capable of modulating (e.g., inserting, altering, or deleting sequences of interest) phenylalanine hydroxylase (PAH) activity and methods of treating phenylketonuria (PKU) by administering one or more such systems to alter a genomic sequence, such as to correct mutations, within the PAH gene on the human chromosome 12q23.2 involved as a genetic driver in PKU.

[0015] In one aspect, the disclosure relates to a system for modifying DNA to correct a human PAH gene mutation causing PKU comprising (a) a nucleic acid encoding a gene modifying polypeptide capable of target primed reverse transcription, the polypeptide comprising (i) a reverse transcriptase domain and (ii) a Cas9 nickase that binds DNA and has endonuclease activity, and (b) a template RNA comprising (i) a gRNA spacer that is complementary to a first portion of the human PAH gene, (ii) a gRNA scaffold that binds the polypeptide, (iii) a heterologous object sequence comprising a mutation region to correct the mutation, and (iv) a primer binding site (PBS) sequence comprising at least 3. 4, 5, 6, 7. or 8 bases of 100% homology to a target DNA strand at the 3' end of the template RNA. In some embodiments, the PAH gene may comprise a R408W mutation. The template RNA sequence may comprise a sequence described herein, e.g., in Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3.

[0016] Tire gRNA spacer may comprise at least 15 bases of 100% homology to the target DNA at the 5 ' end of the template RNA. Hie template RNA may fiirther comprise a PBS sequence comprising at least 5 bases of at least 80% homology to the target DNA strand. The template RNA may comprise one or more chemical modifications.

[0017] The domains of the gene modifying polypeptide may be joined by a peptide linker. The polypeptide may comprise one or more peptide linkers. The gene modifying polypeptide may further comprise a nuclear localization signal. The polypeptide may comprise more than one nuclear localization signal, e.g., multiple adjacent nuclear localization signals or one or more nuclear localization signals in different regions of the polypeptide, e.g., one or more nuclear localization signals in the N-terminus of the polypeptide and one or more nuclear localization signals in the C-terminus of the polypeptide. The nucleic acid encoding the gene modifying polypeptide may encode one or more intein domains.

[0018] Introduction of the system into a target cell may result in insertion of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30. 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 500, or 1000 base pairs of exogenous DNA. Introduction of the system into a target cell may result in deletion, wherein the deletion is less than 2, 3, 4, 5, 10, 50, or 100 base pairs of genomic DNA upstream or downstream of the insertion. Introduction of the system into a target cell may result in substitution, e.g., substitution of 1, 2, or 3 nucleotides, e.g., consecutive nucleotides.

[0019] Tire heterologous object sequence may be at least 5, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, or 700 base pairs.

[0020] In one aspect, the disclosure relates to a pharmaceutical composition comprising the system described above and a pharmaceutically acceptable excipient or carrier, wherein the pharmaceutically acceptable excipient or carrier is selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle. In one aspect, the disclosure relates to a pharmaceutical composition comprising the system described above and multiple pharmaceutically acceptable excipients or carriers, wherein the pharmaceutically acceptable excipients or carriers are selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle, e.g., where the system described above is delivered by two distinct excipients or carriers, e g., two lipid nanoparticles, two viral vectors, or one lipid nanoparticle and one viral vector. The viral vector may be an adeno-associated virus (AAV).

[0021] In one aspect, the disclosure relates to a host cell (e.g., a mammalian cell, e.g., a human cell) comprising the system described above.

[0022] In one aspect, the disclosure relates to a method of correcting a mutation in the human PAH gene in a cell, tissue or subject, the method comprising administering the system described above to the cell, tissue or subject, wherein optionally the correction of the mutant PAH gene comprises an amino acid substitution of W408R (reversing the pathogenic substitution which is R408W). The system may be introduced in vivo, in vitro, ex vivo, or in situ. The nucleic acid of (a) may be integrated into the genome of the host cell. In some embodiments, the nucleic acid of (a) is not integrated into the genome of the host cell. In some embodiments, the heterologous object sequence is inserted at only one target site in the host cell genome. The heterologous object sequence may be inserted at two or more target sites in the host cell genome, e.g., at the same corresponding site in two homologous chromosomes or at two different sites on the same or different chromosomes. The heterologous object sequence may encode a mammalian polypeptide, or a fragment or a variant thereof. The components of the system may be delivered on 1, 2, 3, 4, or more distinct nucleic acid molecules. The system may be introduced into a host cell by electroporation or by using at least one vehicle selected from a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle.

[0023] Features of the compositions or methods can include one or more of the following enumerated embodiments.

[0024] Enumerated Embodiments

[0025] 1. A gene modifying system comprising:

[0026] (a) a template RNA (tgRNA) comprising, from 5’ to 3’:

[0027] (1) a gRNA spacer;

[0028] (2) a gRNA scaffold;

[0029] (3) a heterologous object sequence; and

[0030] (4) a primer binding site (PBS) sequence; wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and

[0031] (b) a gene modifying polypeptide, or a nucleic acid encoding the gene modifying polypeptide, the gene modifying polypeptide comprising:

[0032] (1) a Cas domain;

[0033] (2) a linker; and

[0034] (3) a reverse transcriptase (RT) domain; wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modify ing polypeptide of SEQ ID NO: 28, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0035] 2. A gene modifying system comprising:

[0036] (a) a template RNA (tgRNA) comprising, from 5’ to 3’:

[0037] (1) a gRNA spacer having a sequence of a gRNA spacer of a template RNA of Table 1A, El, E1A. E3, E3A. E5. E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2. or 3 sequence alterations (e.g., substitutions) relative thereto:

[0038] (2) a gRNA scaffold having a sequence of a gRNA scaffold of the template RNA of Table 1A, El , El A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, El 3, E13A, or X3, or a sequence with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sequence alterations relative thereto; (3) a heterologous object sequence having a sequence of a heterologous object sequence of the template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and

[0039] (4) a primer binding site (PBS) sequence having a sequence of a PBS sequence of the template RNA of Table 1A. El. E1A. E3. E3A. E5. E5A. E7. E7A, E9. E9A, E13, E13A. or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and

[0040] (b) a gene modifying polypeptide, or a nucleic acid encoding the gene modifying polypeptide, the gene modifying polypeptide comprising:

[0041] (1) a Cas domain;

[0042] (2) a linker; and

[0043] (3) a reverse transcriptase (RT) domain; wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0044] 3. The system of embodiment 1 or 2, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 95% identity thereto.

[0045] 4. The system of embodiment 1 or 2, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 97%. 98%. or 99% identity thereto.

[0046] 5. Tire system of embodiment 1 or 2, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3.

[0047] 6. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 2, or a sequence having at least 95%. 97%. 98%. or 99% identity thereto.

[0048] 7. Tire system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 2. 8. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37638, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0049] 9. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37638.

[0050] 10. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37654, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0051] 11. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37654.

[0052] 12. Tire system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37653, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0053] 13. The system of any of the preceding embodiments, wherein the template RNA comprises a nucleotide sequence of SEQ ID NO: 37653.

[0054] 14. The system of any one of embodiments 1-13, wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28. or a sequence having at least 95% identity thereto.

[0055] 15. The system of any one of embodiments 1-13, wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 99% identity thereto.

[0056] 16. The system of any one of embodiments 1-13, wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28.

[0057] 17. The system of any one of embodiments 1-16, which comprises the nucleic acid encoding the gene modifying polypeptide, and wherein the nucleic acid encoding the gene modifying polypeptide has a sequence according to SEQ ID NO: 106, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0058] 18. The system of any one of embodiments 1-16, which comprises the nucleic acid encoding the gene modifying polypeptide, and wherein the nucleic acid encoding the gene modifying polypeptide has a sequence according to SEQ ID NO: 106.

[0059] 19. The system of any one of embodiments 1-18, further comprising a second nick RNA (ngRNA) that directs a second nick to the second strand of the human PAH gene.

[0060] 20. The system of embodiment 19, wherein the ngRNA comprises a sequence of an ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10. E10A, El 4, or EMA. or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0061] 21. The system of embodiment 19, wherein the ngRNA comprises, from 5’ to 3’:

[0062] (1) a gRNA spacer having the sequence of a gRNA spacer of a ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA, or a sequence with no more than 1, 2, or 3 sequence alterations (e.g., substitutions) relative thereto; and

[0063] (2) a gRNA scaffold having a sequence of a gRNA scaffold of the ngRNA of Table 2 A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA or a sequence with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sequence alterations relative thereto.

[0064] 22. The system of embodiment 19 or 20, wherein the ngRNA has a ’PAM-in orientation” with the template RNA of the gene modifying system.

[0065] 23. The system of any one of embodiments 19-22, wherein the ngRNA has a sequence according to SEQ ID NO: 23, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0066] 24. The system of any one of embodiments 19-22, wherein the ngRNA has a sequence according to SEQ ID NO: 23.

[0067] 25. The system of any one of embodiments 19-22, wherein the ngRNA has a sequence according to SEQ ID NO: 84, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto. 26. The system of any one of embodiments 19-22, wherein the ngRNA has a sequence according to SEQ ID NO: 84.

[0068] 27. Tire system of any one of embodiments 1-26, wherein tire nucleic acid encoding the gene modifying polypeptide comprises RNA, e g., mRNA.

[0069] 28. The system of any one of embodiments 1-27, wherein the nucleic acid encoding the gene modifying polypeptide comprises one or more chemically modified nucleotides.

[0070] 29. A nucleic acid molecule encoding a gene modifying polypeptide, wherein the nucleic acid comprises, e.g., from 5' to 3’:

[0071] (a) a 5’ UTR of SEQ ID NO: 41-44. or a sequence having at least 90%. 95%. 96%. 97%. 98%, or 99% identity thereto:

[0072] (b) a region encoding aN-terminal NLS of SEQ ID NO: 36, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0073] (c) a region encoding a Cas domain of SEQ ID NO: 52, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0074] (d) a region encoding a linker of SEQ ID NO: 54. or a sequence having at least 90%. 95%, 96%, 97%, 98%, or 99% identity thereto;

[0075] (e) a region encoding a reverse transcriptase (RT) domain of SEQ ID NO: 56, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0076] (f) a region encoding a C-tenninal NLS of SEQ ID NO: 38, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0077] (g) a 3’ UTR of SEQ ID NO: 45-48. or a sequence having at least 90%. 95%. 96%. 97%. 98%. or 99% identity thereto:

[0078] (h) optionally, an expression element of SEQ ID NOs: 40, 101, or 102, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and

[0079] (i) a poly(A) tail of SEQ ID NO: 49-51, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0080] 30. The nucleic acid molecule of embodiment 29, which has a sequence according to SEQ ID NO: 106, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0081] 31. The nucleic acid molecule of embodiment 29 which has a sequence according to SEQ ID NO: 106. 32. A nucleic acid molecule encoding a gene modifying polypeptide, wherein the nucleic acid comprises, e.g., from 5’ to 3’:

[0082] (a) a 5’ UTR of SEQ ID NO: 41-44, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0083] (b) a region encoding a N-terminal NLS of SEQ ID NO: 37, or a sequence having at least 90%. 95%, 96%, 97%, 98%, or 99%identity thereto;

[0084] (c) a region encoding a Cas domain of SEQ ID NO: 53, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0085] (d) a region encoding a linker of SEQ ID NO: 55, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0086] (e) a region encoding a reverse transcriptase (RT) domain of SEQ ID NO: 57, or a sequence having at least 90%, 95%, 96%, 97%. 98%. or 99% identity thereto;

[0087] (f) a region encoding a C-terminal NLS of SEQ ID NO: 39, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0088] (g) a 3’ UTR of SEQ ID NO: 45-48, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;

[0089] (h) optionally, an expression element of SEQ ID NOs: 40. 101, or 102, or a sequence having at least 90%, 95%, 96%, 97%. 98%. or 99% identity thereto; and

[0090] (i) a poly(A) tail of SEQ ID NO: 49-51, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0091] 33. The nucleic acid molecule of any one of embodiments 29-32, wherein the Cas domain comprises a Cas domain that binds to the target DNA molecule and is heterologous to the RT domain.

[0092] 34. The nucleic acid molecule of any one of embodiments 29-33, wherein the nucleic acid molecule is an mRNA.

[0093] 35. The nucleic acid molecule of any one of embodiments 29-34, wherein the nucleic acid molecule comprises one or more chemically modified nucleotides.

[0094] 36. A template RNA comprising:

[0095] (1) a gRNA spacer;

[0096] (2) a gRNA scaffold;

[0097] (3) a heterologous object sequence: and (4) a primer binding site (PBS) sequence: and wherein the template RNA comprises a nucleotide sequence of a template RNA of SEQ ID NO: 15, 17, 92, or 94, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0098] 37. The nucleic acid molecule of embodiment 36, wherein the template RNA comprises one or more chemically modified nucleotides.

[0099] 38. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37638, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0100] 39. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37638.

[0101] 40. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37653, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

[0102] 41. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37653.

[0103] 42. A gene modifying system comprising:

[0104] (a) a template RNA (tgRNA) comprising, from 5’ to 3’:

[0105] (1) a gRNA spacer;

[0106] (2) a gRNA scaffold;

[0107] (3) a heterologous object sequence: and

[0108] (4) a primer binding site (PBS) sequence; wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1 A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and

[0109] (b) a nucleic acid (e g., mRNA) encoding a gene modifying polypeptide comprising:

[0110] (1) a Cas domain:

[0111] (2) a linker: and

[0112] (3) a reverse transcriptase (RT) domain; wherein the nucleotide encoding the gene modifying polypeptide comprises the nucleic acid of any one of embodiments 29-35. 43. A gene modifying system comprising:

[0113] (a) a template RNA (tgRNA) comprising, from 5’ to 3’:

[0114] (1) a gRNA spacer;

[0115] (2) a gRNA scaffold;

[0116] (3) a heterologous object sequence: and

[0117] (4) a primer binding site (PBS) sequence; wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and

[0118] (b) a nucleic acid (e.g., mRNA) encoding a gene modifying polypeptide comprising:

[0119] (1) a Cas domain;

[0120] (2) a linker; and

[0121] (3) a reverse transcriptase (RT) domain; wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or E15, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0122] 44. A gene modifying system comprising:

[0123] (a) a template RNA (tgRNA) comprising, from 5’ to 3’:

[0124] (1) a gRNA spacer having a sequence of a gRNA spacer of a template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations (e.g., substitutions) relative thereto;

[0125] (2) a gRNA scaffold having a sequence of a gRNA scaffold of the template RNA of Table 1A. El. E1A. E3. E3A. E5. E5A. E7. E7A. E9. E9A. E13, E13A. or X3, or a sequence with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sequence alterations relative thereto;

[0126] (3) a heterologous object sequence having a sequence of a heterologous object sequence of the template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A. E7. E7A, E9. E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and

[0127] (4) a primer binding site (PBS) sequence having a sequence of a PBS sequence of tire template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and (b) a nucleic acid (e.g., mRNA) encoding a gene modifying polypeptide comprising:

[0128] (1) a Cas domain;

[0129] (2) a linker; and

[0130] (3) a reverse transcriptase (RT) domain; wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or El 5, or a sequence having at least 70%. 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0131] 45. The system of any one of embodiments 42-44, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, El 3. E13A, or X3, or a sequence having at least 95% identity thereto.

[0132] 46. The system of any one of embodiments 42-44, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 97%, 98%, or 99% identity thereto.

[0133] 47. The system of any one of embodiments 42-44. wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A. El. E1A. E3. E3A, E5. E5A, E7, E7A, E9, E9A, E13, E13A, or X3.

[0134] 48. The system of any one of embodiments 42-47, wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or El 5. or a sequence having at least 95% identity thereto.

[0135] 49. The system of any one of embodiments 42-47, wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or El 5, or a sequence having at least 99% identify thereto.

[0136] 50. The system of any one of embodiments 42-47. wherein the nucleotide encoding the gene modify ing polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or E15.

[0137] 51. The system of any one of embodiments 42-50, further comprising a second nick RNA (ngRNA) that directs a second nick to the second strand of the human PAEI gene. 52. The system of embodiment 51, wherein the ngRNA comprises a sequence of an ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, El 4, or EMA, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0138] 53. The system of embodiment 51, wherein the ngRNA comprises, from 5’ to 3’:

[0139] (1) a gRNA spacer having the sequence of a gRNA spacer of a ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA, or a sequence with no more than 1, 2, or 3 sequence alterations (e.g., substitutions) relative thereto; and

[0140] (2) a gRNA scaffold having a sequence of a gRNA scaffold of the ngRNA of Table 2 A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA or a sequence with no more than 1, 2, 3, 4. 5, 6, 7, 8. 9, or 10 sequence alterations relative thereto.

[0141] 54. The system of embodiment 51 or 52, wherein the ngRNA has a ‘ PAM-in orientation” with the template RNA of the gene modifying system.

[0142] 55. Tire system of any one of embodiments 42-54, wherein the nucleic acid encoding the gene modifying polypeptide comprises RNA, e.g., mRNA.

[0143] 56. The system of any one of embodiments 42-55, wherein the nucleic acid encoding the gene modifying polypeptide comprises one or more chemically modified nucleotides.

[0144] 57. The nucleic acid molecule of any one of embodiments 29-35 or the template RNA of any one of embodiments 36-41. wherein the nucleic acid molecule is formulated in a lipid nanoparticle (LNP).

[0145] 58. The system of any one of embodiments 1-28 or 42-56, wherein the tgRNA, nucleic acid molecule encoding the gene modifying polypeptide, and / or the ngRNA are formulated in an LNP.

[0146] 59. A pharmaceutical composition, comprising tire system of any one of embodiments 1-28, or 42-56, or one or more nucleic acids encoding the same, and a pharmaceutically acceptable excipient or carrier.

[0147] 60. The pharmaceutical composition of embodiment 59, wherein the pharmaceutically acceptable excipient or carrier is selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticlc (LNP). 61. The pharmaceutical composition of embodiment 60, wherein the viral vector is an adeno-associated virus.

[0148] 62. A host cell (e.g., a mammalian cell, e.g., a human cell) comprising the nucleic acid molecule, gene modifying system, or template RNA of any one of the preceding embodiments.

[0149] 63. A method of making the nucleic acid molecule or template RNA of any one of the preceding embodiments, the method comprising synthesizing the nucleic acid molecule or template RNA in vitro (e.g., by in vitro transcription or solid-state synthesis) or by introducing a DNA encoding the template RNA into a host cell under conditions that allow for production of tire template RNA.

[0150] 64. A method for modifying a target site in the human PAH gene in a cell, the method comprising contacting the cell with the gene modifying system of any one of embodiments 1-28, or 42-56, or DNA encoding the same, or the pharmaceutical composition of any one of embodiments 59-61, thereby modifying tire target site in the human PAH gene in a cell.

[0151] 65. A method for treating a subject having a disease or condition associated with a mutation in the human PAH gene, the method comprising administering to the subject the gene modifying system of any one of embodiments 1-28, 42-56, or 58, or DNA encoding the same, or the pharmaceutical composition of any one of embodiments 59-61, thereby treating the subject having a disease or condition associated with a mutation in the human PAH gene.

[0152] 66. The method of embodiment 65, wherein the disease or condition is phenylketonuria (PKU) or hyperphenylalaninemia (e.g., mild or severe hyperphenylalaninemia).

[0153] 67. The method of embodiment 65 or 66, wherein the subject has a R408W mutation.

[0154] 68. A method for treating a subject having PKU the method comprising administering to the subject the gene modifying system of any one of embodiments 1-28, 42-56. or 58, or DNA encoding the same, or the pharmaceutical composition of any one of embodiments 59-61, thereby treating the subject having PKU.

[0155] 69. The gene modifying system or method of any one of the preceding embodiments, wherein introduction of the system into a target cell results in a correction of a pathogenic mutation in the PAH gene. 70. The gene modifying system or method of any one of the preceding embodiments, wherein the pathogenic mutation is a R408W mutation, and wherein the correction comprises an amino acid substitution of W408R.

[0156] 71. The gene modify ing system or method of any one of the preceding embodiments, wherein introduction of tire system into a target cell results in a mutation that causes the restoration of the function of the PAH gene.

[0157] 72. Tire gene modifying system or method of any one of the preceding embodiments, wherein correction of tire mutation occurs in at least 10% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, or more) of target nucleic acids.

[0158] 73. The gene modifying system or method of any one of the preceding embodiments, wherein correction of the mutation occurs in at least 10% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, or more) of target cells.

[0159] 74. The gene modify ing system or method of any one of the preceding embodiments, wherein the gene modifying system comprises a second strand-targeting gRNA. and wherein correction of the mutation in a population of target cells is increased relative to a population of target cells treated with a gene modifying system comprising a template RNA without a second strand-targeting gRNA.

[0160] 75. The method of any one of the preceding embodiments, wherein the cell is a mammalian cell, such as a human cell.

[0161] 76. The method of any one of the preceding embodiments, wherein the subject is a human.

[0162] 77. The method of any one of the preceding embodiments, wherein the contacting occurs ex vivo, e.g., wherein the cell’s or subject’s DNA is modified ex vivo.

[0163] 78. The method of any one of the preceding embodiments, wherein the contacting occurs in vivo, e.g.. wherein the cell’s or subject’s DNA is modified in vivo.

[0164] 79. The method of any one of the preceding embodiments, wherein contacting the cell or the subject with the system comprises contacting the cell or a cell within the subject with a nucleic acid (e.g., DNA or RNA) encoding the gene modifying polypeptide under conditions that allow for production of the gene modifying polypeptide.

[0165] 80. Tire template RNA or system of any of the preceding embodiments, wherein the heterologous object sequence comprises a region of at least 5 contiguous nucleotides comprising 2’-fluoro modifications on alternating nucleotides.

[0166] 81. Tire template RNA or system of embodiment 80, wherein tire heterologous object sequence comprises 2 ’-fluoro modifications on alternating nucleotides starting from position +4 of the heterologous object sequence.

[0167] 82. The template RNA or system of embodiment 81, wherein the heterologous object sequence comprises 2’-fluoro modifications on alternating nucleotides from position +4 through position +8, +10, +12, +14, +16, or +18 of the heterologous object sequence.

[0168] 83. The template RNA or system of embodiment 80, wherein the heterologous object sequence comprises 2’-fluoro modifications on alternating nucleotides in a region having a length of 2-5, 5-10, 10- 15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, or 80-81 nucleotides.

[0169] 84. The template RNA or system of embodiment 80, wherein the heterologous object sequence comprises 2’-fluoro modifications on alternating nucleotides in a region having a length of 80-90. 90-100. 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000- 1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, 4000-4500, or 4500-5000 nucleotides.

[0170] 85. The template RNA or system of embodiment 80, wherein the heterologous object sequence comprises 2 ’-fluoro modifications on alternating nucleotides starting from position +5 of the heterologous object sequence.

[0171] 86. Tire template RNA or system of embodiment 81, wherein the heterologous object sequence comprises 2’-fluoro modifications on alternating nucleotides from position +5 through position +9, +11, +13. +15, or +17 of the heterologous object sequence. 87. The template RNA or system of any of embodiments 80-86, which comprises a 2’-fluoro modified nucleotide at the 5’ end of the heterologous object sequence (e.g., at position +10 or +11 of the heterologous object sequence).

[0172] 88. The template RNA or system of embodiment 80, which comprises 2’-fluoro modified nucleotides at positions +4, +6, +8, and / or +10 of the heterologous object sequence.

[0173] 89. The template RNA or system of embodiment 80, which comprises 2’-fluoro modified nucleotides at positions +5, +7, +9, and / or +11 of the heterologous object sequence.

[0174] 90. The template RNA or system of embodiment 80, wherein the second nucleotide from the 5' end of the heterologous object sequence comprises a 2’-fluoro modification (e.g., position +9 or +10 of the heterologous object sequence).

[0175] 91. The template RNA or system of embodiment 80, which comprises 2’-fluoro modified nucleotides at positions +5, +7, and / or +9 of the heterologous object sequence.

[0176] 92. The template RNA or system of embodiment 80, which comprises 2’-fluoro modified nucleotides at positions +4, +6, +8, and / or +10 of the heterologous object sequence.

[0177] BRIEF DESCRIPTION OF THE DRAWINGS

[0178] FIG. 1 is a graph showing Phe levels in plasma from mice treated with exemplary gene modifying systems.

[0179] FIG. 2A is a graph showing % rewriting level for each of the tested template RNAs with their Spacer-corresponding second nick.

[0180] FIG. 2B is a graph showing %INDEL activity for each of the tested template RNAs with their Spacer-corresponding second nick.

[0181] FIG. 3A is a graph showing rewriting activity in primary mouse hepatocytes dosed with the indicated LNPs containing the indicated dosages of template RNA, second nick guide, and RNAIVT338 gene modifying polypeptide encoding mRNA as measured by Amp-SEQ.

[0182] FIG. 3B is a graph showing %INDEL activity in primary mouse hepatocytes dosed with the indicated LNPs containing the indicated dosages of template RNA, second nick guide, and RNAIVT338 gene modifying polypeptide encoding mRNA. FIG. 4A is a graph showing rewriting activity in primary mouse hepatocytes nucleofected with the indicated dosages of template RNA, second nick guide, and RNAIVT338 gene modifying polypeptide as measured by Amp-SEQ.

[0183] FIG. 4B is a graph showing %INDEL activity in primary mouse hepatocytes nucleofected with the indicated dosages of template RNA, second nick guide, and RNAIVT338 gene modifying polypeptide.

[0184] FIG. 5 is a graph of Phe levels in plasma obtained from mice treated with the gene modifying systems containing the indicated template RNA and second nick guide.

[0185] FIG. 6A is a graph showing % rewriting levels obtained from treating with the gene modifying systems containing the indicated template RNA and second nick guide.

[0186] FIG. 6B is a graph showing % INDEL activity obtained from treating hPAH mice with the gene modifying systems containing the indicated template RNA and second nick guide.

[0187] FIG. 7A is a graph showing % rewriting level for each of the tested template RNAs with no second nick guide (left) and with second nick guide (right) in mouse liver.

[0188] FIG. 7B is a graph showing %INDEL activity for each of the tested template RNAs with no second nick guide (left) and with second nick guide (right) in mouse liver.

[0189] FIG. 8A is a graph showing % rewriting level obtained using gene modifying systems containing RNACS4134 and RNACS1810 with the various mRNAs encoding gene modifying polypeptides.

[0190] FIG. 8B is a graph showing %INDEL activity obtained using gene modifying systems containing various mRNAs encoding gene modifying polypeptides.

[0191] FIG. 9A is a pair of graphs show ing % rewriting level for gene modifying systems containing RNACS4134 template RNA with either RNACS1809 or RNACS1810 second nick guide, and various mRNAs encoding gene modifying polypeptides.

[0192] FIG 9B is a pair of graphs show ing %INDEL activity for gene modifying systems containing RNACS4134 template RNA with either RNACS1809 or RNACS1810 second nick guide, and various mRNAs encoding gene modifying polypeptides.

[0193] FIG. 10A is a pair of graphs showing Phe levels in plasma obtained from treated mice when treated with the gene modifying systems comprising RNACS4134 template RNA with either RNACS1809 or RNACS1810 second nick guide, and various mRNAs encoding gene modifying polypeptides at the indicated dosages.

[0194] FIG. 10B is a pair of graphs show ing Phe levels in brain obtained from mice treated with the gene modifying systems comprising RNACS4134 template RNA with either RNACS1809 or RNACS1810 second nick guide, and various mRNAs encoding gene modifying polypeptides at tire indicated dosages. FIG. 11 depicts a gene modifying system as described herein. The left hand diagram shows the gene modifying polypeptide, which comprises a Cas nickase domain (e.g., spCas9 N863A) and a reverse transcriptase domain (RT domain) which are linked by a linker. The right hand diagram shows the template RNA which comprises, from 5’ to 3’, a gRNA spacer, a gRNA scaffold, a heterologous object sequence, and a primer binding site sequence (PBS sequence). The heterologous object sequence can comprise a mutation region that comprises one or more sequence differences relative to the target site. The heterologous object sequence can also comprise a pre-edit homology region and a post-edit homology region, which flank the mutation region. Without wishing to be bound by theory , it is thought that the gRNA spacer of the template RNA binds to the second strand of a target site in the genome, and the gRNA scaffold of the template RNA binds to the gene modifying polypeptide, e.g ., localizing the gene modifying polypeptide to the target site in the genome. It is thought that the Cas domain of the gene modifying polypeptide nicks the target site (e.g., the first strand of the target site), e.g., allowing the PBS sequence to bind to a sequence adjacent to the site to be altered on the first strand of the target site. It is thought that the RT domain of the gene modifying polypeptide uses the first strand of the target site that is bound to the complementary sequence comprising tire PBS sequence of the template RNA as a primer and the heterologous object sequence of the template RNA as a template to, e.g., polymerize a sequence complementary to the heterologous object sequence. Without wishing to be bound by theory, it is thought that reverse transcription can then proceed through the pre-edit homology region, then through the mutation region, and then through the post-edit homology region, thereby producing a DNA strand comprising a mutation specified by the heterologous object sequence.

[0195] FIG. 12 is a series of diagrams showing the heterologous object sequences and PBS (priming) sequences of a series of variants of a template RNA. each comprising 2'-fluoro modifications as indicated in the table on the top in gray boxes. Two of the variants included alternating patterns of 2'-fluoro modifications, in which every other nucleotide in a subsequence of the heterologous object sequence comprises a 2’-fluoro modification. These variants further comprised, in 5’ to 3’ order, a 2’-fluoro modified nucleotide, three 2’-0Me modified nucleotides, and three nucleotides each comprising a 2’- OMe and a phosphorothioate modification, at the 3’ end of the priming region. These template RNA variants were tested for their capacity to introduce alterations the target nucleic acid sequence, with the resultant rewriting efficiency and percentage of insertions or deletions (indels) for each variant shown in the graphs on the bottom left and bottom right, respectively. This figure discloses SEQ ID NOS 37647- 37649, respectively, in order of appearance.

[0196] FIG. 13 is a series of diagrams showing the heterologous object sequences and PBS (priming) sequences of a scries of variants of a template RNA, each comprising 2’-fluoro modifications as indicated in the table on the top in gray boxes. Two of the variants included alternating patterns of 2'-fluoro modifications, in which every other nucleotide in a subsequence of the heterologous object sequence comprises a 2’-fluoro modification. These variants further comprised, in 5’ to 3’ order, a 2’-fluoro modified nucleotide, three 2’-0Me modified nucleotides, and three nucleotides each comprising a 2’- OMe and / or a phosphorothioate modification, at the 3’ end of tire priming region. These template RNA variants were tested for their capacity to introduce alterations the target nucleic acid sequence, with the resultant rewriting efficiency and percentage of indels for each variant shown in the graphs on the bottom left and bottom right, respectively. This figure discloses SEQ ID NOS 37647-37649, respectively, in order of appearance.

[0197] FIG. 14 is a series of diagrams showing the heterologous object sequence and PBS (priming) sequence of a variant of a template RNA, each comprising 2 ’-fluoro modifications as indicated in the table on the top in gray boxes. The RNACS6874 variant included an alternating pattern of 2’-fluoro modifications, in which every other nucleotide in a subsequence of the heterologous object sequence comprises a 2’-fluoro modification. This variant further comprised, in 5’ to 3’ order, a 2’-fluoro modified nucleotide, three 2’-0Me modified nucleotides, and three nucleotides each comprising a 2’-0Me and a phosphorothioate modification, at the 3’ end of the priming region. These template RNA variants were tested fortheir capacity to introduce alterations the target nucleic acid sequence, with tire resultant rewriting efficiency and percentage of indels for each variant shown in the graphs on the bottom left and bottom right, respectively. This figure discloses SEQ ID NOS 37647-37648, respectively, in order of appearance.

[0198] FIG. 15 is a series of diagrams showing the heterologous object sequences and PBS (priming) sequences of a series of variants of a template RNA, each comprising 2’-fluoro modifications as indicated in the table on the top in gray boxes. Two of the variants included alternating patterns of 2 ’-fluoro modifications, in which every other nucleotide in a subsequence of the heterologous object sequence comprises a 2’-fluoro modification. These variants further comprised, in 5’ to 3’ order, a 2’-fluoro modified nucleotide, a 2’-0Me modified nucleotide, and three nucleotides each comprising a 2’-0Me and / or a phosphorothioate modification, at the 3’ end of the priming region. These template RNA variants were tested for their capacity to introduce alterations the target nucleic acid sequence, with the resultant rewriting efficiency and percentage of indels for each variant shown in the graphs on the bottom left and bottom right, respectively. This figure discloses SEQ ID NOS 37650-37652, respectively, in order of appearance.

[0199] FIG. 16 is a series of diagrams showing the heterologous object sequences and PBS (priming) sequences of a series of variants of a template RNA, each comprising 2 ’-fluoro modifications as indicated in the tabic on the top in gray boxes. Two of the variants included alternating patterns of 2 ’-fluoro modifications, in which every other nucleotide in a subsequence of the heterologous object sequence comprises a 2’-fluoro modification. These variants further comprised, in 5’ to 3’ order, a 2’-fluoro modified nucleotide, a 2’-0Me modified nucleotide, and three nucleotides each comprising a 2’-0Me and / or a phosphorothioate modification, at the 3’ end of the priming region. These template RNA variants were tested for their capacity to introduce alterations the target nucleic acid sequence, with the resultant rewriting efficiency and percentage of indels for each variant shown in the graphs on the bottom left and bottom right, respectively. This figure discloses SEQ ID NOS 37650-37652, respectively, in order of appearance.

[0200] FIGs. 17A-17B are a pair of graphs showing % rewriting level (17A) or % INDELs (17B) for gene modifying systems containing RNACS6874 template RNA with various mRNAs encoding gene modifying polypeptides, where the mRNAs contain different versions of WPRE or lack WPRE.

[0201] DETAILED DESCRIPTION

[0202] Definitions

[0203] The term “alternating nucleotides.” as used herein with respect to chemical modifications, refers to a pattern of nucleotides wherein all of the odd nucleotides of that region have the same chemical modification and ail the even nucleotides do not have that chemical modification, or the opposite: all of the even nucleotides of that region have the same chemical modification and all die odd nucleotides do not have that chemical modification. For instance, in a region that is five nucleotides in length and has alternating nucleotides, the first, th ird, and fifth positions of a region may all comprise 2’F chemical modifications, and the second and fourth positions of a region may comprise unmodified nucleotides or a chemical modification other than 2’F. Hie second and fourth positions may be the same or different. Furthermore, of the nucleotides that ail comprise the same chemical modification, one or more may comprise a second chemical modification As a non-limiting example, in the region described above having 2’F chemical modifications at the first, third, and fifth positions, if only one of the nucleotides at those positions further comprises a backbone modification, the region still comprises alternating nucleotides with respect to the 2 F chemical modification. Hie alternating nucleotides may be found in a region of a larger nucleic acid, wherein the larger nucleic acid comprises one or more other, non- alternating, regions.

[0204] The term “expression cassette,” as used herein, refers to a nucleic acid construct comprising nucleic acid elements sufficient tor tlie expression of the nucleic acid molecule of the instant invention.

[0205] A “gRNA spacer”, as used herein, refers to a portion of a nucleic acid that has complementarity to a target nucleic acid and can, together with a gRNA scaffold, target a Cas protein to the target nucleic acid. A '‘gRNA scaffold”, as used herein, refers to a portion of a nucleic acid that can bind a Cas protein and can, together with a gRNA spacer, target the Cas protein to the target nucleic acid. In some embodiments, the gRNA scaffold comprises a crRNA sequence, tetraloop, and tracrRNA sequence.

[0206] A “gene modifying polypeptide”, as used herein, refers to a polypeptide comprising a retroviral reverse transcriptase, or a polypeptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%. or 99% amino acid sequence identity to a retroviral reverse transcriptase, which is capable of integrating a nucleic acid sequence (e.g., a sequence provided on a template nucleic acid) into a target DNA molecule (e.g., in a mammalian host cell, such as a genomic DNA molecule in the host cell). In some embodiments, the gene modifying polypeptide is capable of integrating the sequence substantially without relying on host machinery. In some embodiments, the gene modifying polypeptide integrates a sequence into a random position in a genome, and in some embodiments, the gene modifying polypeptide integrates a sequence into a specific target site. In some embodiments, a gene modifying polypeptide includes one or more domains that, collectively, facilitate 1) binding the template nucleic acid, 2) binding the target DNA molecule, and 3) facilitate integration of the at least a portion of the template nucleic acid into the target DNA. Gene modifying polypeptides include both naturally occurring polypeptides as well as engineered variants of the foregoing, e.g., having one or more amino acid substitutions to the naturally occurring sequence. Gene modifying polypeptides also include heterologous constructs, e.g., where one or more of the domains recited above are heterologous to each other, whether through a heterologous fusion (or other conjugate) of otherwise wild-type domains, as well as fusions of modified domains, e.g., by way of replacement or fusion of a heterologous sub-domain or other substituted domain. Exemplary gene modifying polypeptides, and systems comprising them and methods of using them, that can be used in the methods provided herein are described, e.g., in PCT / US2021 / 020948. which is incorporated herein by reference with respect to gene modifying polypeptides that comprise a retroviral reverse transcriptase domain. In some embodiments, a gene modifying polypeptide integrates a sequence into a gene. In some embodiments, a gene modifying polypeptide integrates a sequence into a sequence outside of a gene. A “gene modifying system,” as used herein, refers to a system comprising a gene modifying polypeptide and a template nucleic acid.

[0207] Tire tenn “domain” as used herein refers to a structure of a biomolecule that contributes to a specified function of the biomolecule. A domain may comprise a contiguous region (e.g., a contiguous sequence) or distinct, non-contiguous regions (e.g., non-contiguous sequences) of a biomolecule. Examples of protein domains include, but are not limited to, an endonuclease domain, a DNA binding domain, a reverse transcription domain; an example of a domain of a nucleic acid is a regulatory domain, such as a transcription factor binding domain. In some embodiments, a domain (e.g., a Cas domain) can comprise two or more smaller domains (e.g., a DNA binding domain and an endonuclease domain). As used herein, the term “exogenous”, when used with reference to a biomolecule (such as a nucleic acid sequence or polypeptide) means that the biomolecule was introduced into a host genome, cell or organism by the hand of man. For example, a nucleic acid that is as added into an existing genome, cell, tissue or subject using recombinant DNA techniques or other methods is exogenous to the existing nucleic acid sequence, cell, tissue or subject.

[0208] As used herein, “first strand” and “second strand”, as used to describe the individual DNA strands of target DNA, distinguish the two DNA strands based upon which strand the reverse transcriptase domain initiates polymerization, e.g., based upon where target primed synthesis initiates. The first strand refers to the strand of the target DNA upon which the reverse transcriptase domain initiates polymerization, e.g.. where target primed synthesis initiates. Tire second strand refers to the other strand of the target DNA. First and second strand designations do not describe the target site DNA strands in other respects: for example, in some embodiments the first and second strands are nicked by a polypeptide described herein, but the designations ‘first’ and ‘second’ strand have no bearing on the order in which such nicks occur.

[0209] Tire term “heterologous,” as used herein to describe a first element in reference to a second element means that tire first element and second element do not exist in nature disposed as described. For example, a heterologous polypeptide, nucleic acid molecule, construct or sequence refers to (a) a polypeptide, nucleic acid molecule or portion of a polypeptide or nucleic acid molecule sequence that is not native to a cell in which it is expressed, (b) a polypeptide or nucleic acid molecule or portion of a polypeptide or nucleic acid molecule that has been altered or mutated relative to its native state, or (c) a polypeptide or nucleic acid molecule with an altered expression as compared to the native expression levels under similar conditions. For example, a heterologous regulatory sequence (e g., promoter, enhancer) may be used to regulate expression of a gene or a nucleic acid molecule in a way that is different than the gene or a nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA binding domain of a polypeptide or nucleic acid encoding a DNA binding domain of a polypeptide) may be disposed relative to other domains or may be a different sequence or from a different source, relative to other domains or portions of a polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule may exist in a native host cell genome, but may have an altered expression level or have a different sequence or both. In other embodiments, heterologous nucleic acid molecules may not be endogenous to a host cell or host genome but instead may have been introduced into a host cell by transformation (e.g., transfection, electroporation), wherein the added molecule may integrate into the host genome or can exist as extra-chromosomal genetic material either transiently (e.g., mRNA) or semi- stably for more than one generation (e.g., episomal viral vector, plasmid or other self-replicating vector). As used herein, '‘insertion’’ of a sequence into a target site refers to the net addition of DNA sequence at the target site, e.g., where there are new nucleotides in the heterologous object sequence with no cognate positions in the unedited target site. In some embodiments, a nucleotide alignment of the PBS sequence and heterologous object sequence to the target nucleic acid sequence would result in an alignment gap in tire target nucleic acid sequence.

[0210] As used herein, a “deletion” generated by a heterologous object sequence in a target site refers to the net deletion of DNA sequence at the target site, e.g., where there are nucleotides in the unedited target site with no cognate positions in the heterologous object sequence. In some embodiments, a nucleotide alignment of the PBS sequence and heterologous object sequence to the target nucleic acid sequence would result in an alignment gap in the molecule comprising the PBS sequence and heterologous object sequence.

[0211] The term “inverted terminal repeats” or “ITRs” as used herein refers to AAV viral cis-elements named so because of their symmetry. These elements promote efficient multiplication of an AAV genome. It is hypothesized that the minimal elements for ITR function are a Rep-binding site (RBS; 5 - GCGCGCTCGCTCGCTC-3' for AAV2; SEQ ID NO: 4601) and a terminal resolution site (TRS; 5 - AGTTGG-3' for AAV2) plus a variable palindromic sequence allowing for hairpin formation. According to the present invention, an ITR comprises at least these three elements (RBS, TRS, and sequences allowing the formation of an hairpin). In addition, in the present invention, the term “ITR” refers to ITRs of known natural AAV serotypes (e.g. ITR of a serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 AAV), to chimeric ITRs formed by the fusion of ITR elements derived from different serotypes, and to functional variants thereof. “Functional variant” refers to a sequence presenting a sequence identity of at least 80%, 85%, 90%, preferably of at least 95% with a known ITR and allowing multiplication of the sequence that includes said ITR in the presence of Rep proteins.

[0212] The term “mutation region,” as used herein, refers to a region in a template RNA having one or more sequence difference relative to the corresponding sequence in a target nucleic acid. The sequence difference may comprise, for example, a substitution, insertion, frameshift, or deletion.

[0213] Tire term “mutated” when applied to nucleic acid sequences means that nucleotides in a nucleic acid sequence are inserted, deleted, or changed compared to a reference (e.g., native) nucleic acid sequence. A single alteration may be made at a locus (a point mutation), or multiple nucleotides may be inserted, deleted, or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence. A nucleic acid sequence may be mutated by any method known in the art.

[0214] “Nucleic acid molecule” refers to both RNA and DNA molecules including, without limitation, complementary DNA (“cDNA”), genomic DNA (“gDNA”). and messenger RNA (“mRNA”). and also includes synthetic nucleic acid molecules, such as those that are chemically synthesized or recombinantly produced, such as RNA templates, as described herein. The nucleic acid molecule can be double-stranded or single-stranded, circular, or linear. If single-stranded, the nucleic acid molecule can be the sense strand or tire antisense strand. Unless otherwise indicated, and as an example for all sequences described herein under the general format “SEQ ID NO:,” or “nucleic acid comprising SEQ ID NO: 1” refers to a nucleic acid, at least a portion which has either (i) the sequence of SEQ ID NO: 1, or (ii) a sequence complimentary to SEQ ID NO: 1. Tire choice between the two is dictated by the context in which SEQ ID NO: 1 is used. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target. Nucleic acid sequences of the present disclosure may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more naturally occurring nucleotides with an analog, inter-nucleotide modifications such as uncharged linkages (for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example, phosphorothioates, phosphorodithioates, etc.), pendant moieties, (for example, polypeptides), intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and modified linkages (for example, alpha anomeric nucleic acids, etc.). Also included are chemically modified bases (see, for example. Table 13), backbones (see, for example. Table 14), and modified caps (see, for example, Table 15). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of a molecule, e.g., peptide nucleic acids (PNAs). Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as modifications found in “locked” nucleic acids (LNAs). In various embodiments, the nucleic acids are in operative association with additional genetic elements, such as tissue-specific expression-control sequence(s) (e g., tissue-specific promoters and tissue-specific microRNA recognition sequences), as well as additional elements, such as inverted repeats (e.g., inverted terminal repeats, such as elements from or derived from viruses, e.g., AAV ITRs) and tandem repeats, inverted repeats / direct repeats, homology regions (segments with various degrees of homology to a target DNA). untranslated regions (UTRs) (5', 3', or both 5' and 3' UTRs), and various combinations of the foregoing. The nucleic acid elements of the systems provided by the invention can be provided in a variety of topologies, including single-stranded, double-stranded, circular, linear, linear with open ends, linear with closed ends, and particular versions of these, such as doggybone DNA (dbDNA), closcd-cndcd DNA (ccDNA). As used herein, a ‘'gene expression unit” is a nucleic acid sequence comprising at least one regulatory nucleic acid sequence operably linked to at least one effector sequence. A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if the promoter or enhancer affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be contiguous or non- contiguous. Where necessary to join two protein-coding regions, operably linked sequences may be in the same reading frame.

[0215] Tire terms “host genome” or “host cell”, as used herein, refer to a cell and / or its genome into which protein and / or genetic material has been introduced. It should be understood that such temis are intended to refer not only to the particular subject cell and / or genome, but to the progeny of such a cell and / or the genome of the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein. A host genome or host cell may be an isolated cell or cell line grown in culture, or genomic material isolated from such a cell or cell line, or may be a host cell or host genome which composing living tissue or an organism. In some instances, a host cell may be an animal cell or a plant cell, e.g., as described herein. In certain instances, a host cell may be a mammalian cell, a human cell, avian cell, reptilian cell, bovine cell, horse cell, pig cell, goat cell, sheep cell, chicken cell, or turkey cell. In certain instances, a host cell may be a com cell, soy cell, wheat cell, or rice cell.

[0216] As used herein, “operative association” describes a functional relationship between two nucleic acid sequences, such as a 1) promoter and 2) a heterologous object sequence, and means, in such example, the promoter and heterologous object sequence (e.g., a gene of interest) are oriented such that, under suitable conditions, the promoter drives expression of the heterologous object sequence. For instance, a template nucleic acid carrying a promoter and a heterologous object sequence may be single- stranded, e.g., either the (+) or (-) orientation. An “operative association” between the promoter and the heterologous object sequence in this template means that, regardless of whether the template nucleic acid will be transcribed in a particular state, when it is in the suitable state (e.g., is in the (+) orientation, in the presence of required catalytic factors, and NTPs, etc.), it is accurately transcribed. Operative association applies analogously to other pairs of nucleic acids, including other tissue-specific expression control sequences (such as enhancers, repressors and microRNA recognition sequences), IR / DR, ITRs, UTRs, or homology regions and heterologous object sequences or sequences encoding a retroviral RT domain.

[0217] Tire term “primer binding site sequence” or “PBS sequence,” as used herein, refers to a portion of a template RNA capable of binding to a region comprised in a target nucleic acid sequence. In some instances, a PBS sequence is a nucleic acid sequence comprising at least 3, 4, 5, 6, 7, or 8 bases with 100% identity to the region comprised in the target nucleic acid sequence. In some embodiments the primer region comprises at least 5, 6, 7, 8 bases with 100% identity to the region comprised in the target nucleic acid sequence. Without wishing to be bound by theory, in some embodiments when a template RNA comprises a PBS sequence and a heterologous object sequence, the PBS sequence binds to a region comprised in a target nucleic acid sequence, allowing a reverse transcriptase domain to use that region as a primer for reverse transcription, and to use the heterologous object sequence as a template for reverse transcription.

[0218] As used herein, a “stem-loop sequence” refers to a nucleic acid sequence (e.g., RNA sequence) with sufficient self-complementarity to form a stem-loop, e.g., having a stem comprising at least two (e.g., 3, 4, 5. 6, 7, 8, 9. or 10) base pairs, and a loop with at least three (e.g., four) base pairs. The stem may comprise mismatches or bulges.

[0219] As used herein, a “tissue-specific expression-control sequence” means nucleic acid elements that increase or decrease the level of a transcript comprising tire heterologous object sequence in a target tissue in a tissue-specific manner, e.g., preferentially in on-target tissue(s), relative to off-target tissue(s). In some embodiments, a tissue-specific expression-control sequence preferentially drives or represses transcription, activity, or the half-life of a transcript comprising the heterologous object sequence in the target tissue in a tissue-specific manner, e.g., preferentially in an on-target tissue(s). relative to an off- target tissue(s). Exemplary tissue-specific expression-control sequences include tissue-specific promoters, repressors, enhancers, or combinations thereof, as well as tissue-specific microRNA recognition sequences. Tissue specificity refers to on-target (tissue(s) where expression or activity of the template nucleic acid is desired or tolerable) and off-target (tissue(s) where expression or activity of the template nucleic acid is not desired or is not tolerable). For example, a tissue-specific promoter drives expression preferentially in on-target tissues, relative to off-target tissues. In contrast, a microRNA that binds the tissue-specific microRNA recognition sequences is preferentially expressed in off-target tissues, relative to on-target tissues, thereby reducing expression of a template nucleic acid in off-target tissues. Accordingly, a promoter and a microRNA recognition sequence that are specific for tire same tissue, such as the target tissue, have contrasting functions (promote and repress, respectively, with concordant expression levels, i.e., high levels of the microRNA in off-target tissues and low levels in on-target tissues, while promoters drive high expression in on-target tissues and low expression in off-target tissues) with regard to the transcription, activity, or half-life of an associated sequence in that tissue.

[0220] Unless specified otherwise, the following numbering system will be adhered to for describing the position of nucleotides having chemical modifications in the PBS and / or heterologous object sequence of a template RNA. The positions of nucleotides in the heterologous object sequence are numbered +1, +2, +3, and so on, starting from the 3’-most end of the heterologous object sequence. The positions of nucleotides in the PBS sequence are numbered -1, -2, -3, and so on, starting from the 5’-most end of the PBS sequence. Tirus, positions +1 and -1 are directly adjacent to each other.

[0221] Introduction

[0222] This disclosure relates to methods for treating phenylketonuria (PKU) and compositions for targeting, editing, modifying or manipulating a DNA sequence (e.g., inserting a heterologous object sequence into a target site of a mammalian genome) at one or more locations in a DNA sequence in a cell, tissue or subject, e.g., in vivo or in vitro. Hie heterologous object DNA sequence may include, e.g., a substitution.

[0223] More specifically, the disclosure provides methods for treating PKU using reverse transcriptase- based systems for altering a genomic DNA sequence of interest, e.g., by inserting, deleting, or substituting one or more nucleotides into / from the sequence of interest.

[0224] Tire disclosure provides, in part, methods for treating PKU using a gene modifying system comprising a gene modifying polypeptide component and a template nucleic acid (e.g., template RNA) component. In some embodiments, a gene modifying system can be used to introduce an alteration into a target site in a genome. In some embodiments, the gene modifying polypeptide component comprises a writing domain (e.g., a reverse transcriptase domain), a DNA-binding domain, and an endonuclease domain (e.g., nickase domain). In some embodiments, the template nucleic acid (e.g., template RNA) comprises a sequence (e.g., a gRNA spacer) that binds a target site in the genome (e.g., that binds to a second strand of the target site), a sequence (e.g., a gRNA scaffold) that binds the gene modifying polypeptide component, a heterologous object sequence, and a PBS sequence. Without wishing to be bound by theory, it is thought that the template nucleic acid (e.g., template RNA) binds to the second strand of a target site in the genome, and binds to the gene modifying polypeptide component (e.g., localizing the polypeptide component to tire target site in the genome). It is thought that the endonuclease (e.g., nickase) of the gene modifying polypeptide component cuts the target site (e.g., the first strand of the target site), e.g., allowing the PBS sequence to bind to a sequence adjacent to the site to be altered on the first strand of the target site. It is thought that the writing domain (e.g., reverse transcriptase domain) of the polypeptide component uses the first strand of the target site that is bound to the complementary sequence comprising the PBS sequence of the template nucleic acid as a primer and the heterologous object sequence of the template nucleic acid as a template to, e.g., polymerize a sequence complementary to the heterologous object sequence. Without wishing to be bound by theory, it is thought that selection of an appropriate heterologous object sequence can result in substitution, deletion, and / or insertion of one or more nucleotides at the target site. Gene modifying systems

[0225] In some embodiments, a gene modifying system described herein comprises: (A) a gene modifying polypeptide or a nucleic acid encoding the gene modifying polypeptide, wherein the gene modifying polypeptide comprises (i) a reverse transcriptase domain, and an endonuclease domain that contains DNA binding functionality; and (B) a template RNA. A gene modifying polypeptide, in some embodiments, acts as a substantially autonomous protein machine capable of integrating a template nucleic acid sequence into a target DNA molecule (e.g., in a mammalian host cell, such as a genomic DNA molecule in the host cell), substantially without relying on host machinery’. For example, the gene modifying protein may comprise a DNA-binding domain, a reverse transcriptase domain, and an endonuclease domain. In some embodiments, tire DNA-binding function may involve an RNA component that directs the protein to a DNA sequence, e.g., a gRNA spacer. In other embodiments, the gene modifying polypeptide may comprise a reverse transcriptase domain and an endonuclease domain. The RNA template element of a gene modifying system is typically heterologous to the gene modifying polypeptide element and provides an object sequence to be inserted (reverse transcribed) into the host genome. In some embodiments, the gene modifying polypeptide is capable of target primed reverse transcription. In some embodiments, the gene modifying polypeptide is capable of second-strand synthesis.

[0226] A functional gene modifying polypeptide can be made up of unrelated DNA binding, reverse transcription, and endonuclease domains. This modular structure allows combining of functional domains, e.g., dCas9 (DNA binding), AVIRE reverse transcriptase (reverse transcription), FokI (endonuclease). In some embodiments, multiple functional domains may arise from a single protein, e.g., Cas9 or Cas9 nickase (DNA binding, endonuclease).

[0227] In some embodiments, a gene modifying polypeptide includes one or more domains that, collectively, facilitate 1) binding the template nucleic acid, 2) binding the target DNA molecule, and 3) facilitate integration of the at least a portion of the template nucleic acid into the target DNA. In some embodiments, the gene modifying polypeptide is an engineered polypeptide that comprises one or more amino acid substitutions to a corresponding naturally occurring sequence. In some embodiments, the gene modifying polypeptide comprises two or more domains that are heterologous relative to each other, e.g., through a heterologous fusion (or other conjugate) of otherwise wild-type domains, or well as fusions of modified domains, e.g.. by way of replacement or fusion of a heterologous sub-domain or other substituted domain. For instance, in some embodiments, one or more of: the RT domain is heterologous to the DBD; the DBD is heterologous to the endonuclease domain; or the RT domain is heterologous to the endonuclease domain. In some embodiments, a template RNA molecule for use in the system comprises, from 5 ' to 3 '

[0228] (1) a gRNA spacer; (2) a gRNA scaffold; (3) heterologous object sequence (4) a primer binding site (PBS) sequence. In some embodiments:

[0229] (1) Is a gRNA spacer of -18-22 nt, e.g.. is 20 nt

[0230] (2) Is a gRNA scaffold comprising one or more hairpin loops, e.g., 1, 2, of 3 loops for associating the template with a Cas domain, e.g., a nickase Cas9 domain. In some embodiments, the gRNA scaffold comprises the sequence, from 5' to 3', GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 21).

[0231] (3) In some embodiments, the heterologous object sequence is, e.g., 7-74. e.g., 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, or 70-80 nt or, 80-90 nt in length.

[0232] (4) In some embodiments, the PBS sequence that binds the target priming sequence after nicking occurs is e.g., 3-20 nt, e.g., 7-15 nt, e.g., 12-14 nt. In some embodiments, the PBS sequence has 40-60% GC content.

[0233] In some embodiments, a second gRNA associated with the system may help drive complete integration. In some embodiments, the second gRNA may target a location that is 0-200 nt away from the first-strand nick, e.g., 0-50, 50-100, 100-200 nt away from the first-strand nick. In some embodiments, the second gRNA can only bind its target sequence after the edit is made, e.g., the gRNA binds a sequence present in the heterologous object sequence, but not in the initial target sequence.

[0234] In some embodiments, a gene modifying system described herein is used to make an edit in HEK293, K562, U2OS, or EleLa cells. In some embodiment, a gene modifying system is used to make an edit in primary cells, e.g., human primary cells.

[0235] In some embodiments, a gene modifying polypeptide as described herein comprises a reverse transcriptase or RT domain (e.g., as described herein) that comprises an AVIRE RT sequence or variant thereof. In some embodiments, an endonuclease domain (e.g., as described herein) comprises a Cas9 domain (e.g., SpCas9, e.g., comprising an N863A mutation (e.g., in spCas9)).

[0236] In some embodiments, the heterologous object sequence (e.g., of a system as described herein) is about 1-50, 50-100, 100-200, 200-300, 300-400, 400-500. 500-600, 600-700, 700-800, 800-900, 900- 1000, or more, nucleotides in length.

[0237] In some embodiments, the RT and endonuclease domains are joined by a flexible linker, e.g., comprising the amino acid sequence AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 54). In some embodiments, the endonuclease domain is N-terminal relative to the RT domain. In some embodiments, the endonuclease domain is C-terminal relative to the RT domain.

[0238] In some embodiments, the system incorporates a heterologous object sequence into a target site by TPRT, e.g., as described herein.

[0239] In some embodiments, a gene modifying system is capable of producing an insertion into the target site of at least 45, 50, 55, 60, 65, 70, 75. 80. 85. 90, 95, or 100 nucleotides (and optionally no more than 500, 400, 300, 200, or 100 nucleotides). In some embodiments, a gene modifying system is capable of producing an insertion into the target site of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally no more than 500, 400, 300, 200, or 100 nucleotides). In some embodiments, a gene modifying system is capable of producing an insertion into the target site of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2. 2.5, 3, 3.5, 4, 4.5, 5,

[0240] 5.5, 6. 6.5. 7, 7.5, 8, 8.5. 9, 9.5 or 10 kilobases (and optionally no more than 1, 5, 10, or 20 kilobases). In some embodiments, a gene modifying system is capable of producing a deletion of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally no more than 500, 400, 300, or 200 nucleotides). In some embodiments, a gene modifying system is capable of producing a deletion of at least 81, 85, 90, 95, 100, 110, 120. 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally no more than 500, 400, 300, or 200 nucleotides). In some embodiments, a gene modifying system is capable of producing a deletion of at least 1, 2. 3. 4, 5, 6. 7. 8, 9, 10, 15, 20, 25, 30. 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally no more than 500, 400, 300, or 200 nucleotides). In some embodiments, a gene modifying system is capable of producing a deletion of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,

[0241] 1.5, 2, 2.5. 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9. 9.5 or 10 kilobases (and optionally no more than 1. 5, 10, or 20 kilobases). In some embodiments, a gene modifying system is capable of producing a substitution into the target site of at least 1, 2, 3. 4, 5, 6, 7. 8, 9, 10, 15, 20. 25. 30. 35. 40, 45, 50, 60, 70, 80, 90, or 100 or more nucleotides. In some embodiments, a gene modifying system is capable of producing a substitution in the target site of 1-2, 2-3, 3-4, 4-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides.

[0242] In some embodiments, the substitution is a transition mutation. In some embodiments, tire substitution is a transversion mutation. In some embodiments, the substitution converts an adenine to a thymine, an adenine to a guanine, an adenine to a cytosine, a guanine to a thymine, a guanine to a cytosine, a guanine to an adenine, a thymine to a cytosine, a thymine to an adenine, a thymine to a guanine, a cytosine to an adenine, a cytosine to a guanine, or a cytosine to a thymine.

[0243] In some embodiments, an insertion, deletion, substitution, or combination thereof, increases or decreases expression (e.g. transcription or translation) of a gene. In some embodiments, an insertion, deletion, substitution, or combination thereof, increases or decreases expression (e.g. transcription or translation) of a gene by altering, adding, or deleting sequences in a promoter or enhancer, e.g. sequences that bind transcription factors. In some embodiments, an insertion, deletion, substitution, or combination thereof alters translation of a gene (e.g. alters an amino acid sequence), inserts or deletes a start or stop codon, alters or fixes the translation frame of a gene. In some embodiments, an insertion, deletion, substitution, or combination thereof alters splicing of a gene, e.g. by inserting, deleting, or altering a splice acceptor or donor site. In some embodiments, an insertion, deletion, substitution, or combination thereof alters transcript or protein half-life. In some embodiments, an insertion, deletion, substitution, or combination thereof alters protein localization in the cell (e.g. from the cytoplasm to a mitochondria, from the cytoplasm into the extracellular space (e g. adds a secretion tag)). In some embodiments, an insertion, deletion, substitution, or combination thereof alters (e.g. improves) protein folding (e.g. to prevent accumulation of misfolded proteins). In some embodiments, an insertion, deletion, substitution, or combination thereof, alters, increases, decreases the activity of a gene, e.g. a protein encoded by the gene.

[0244] Exemplary gene modifying polypeptides, and systems comprising them and methods of using them are described, e.g., in PCT / US2021 / 020948, which is incorporated herein by reference with respect to retroviral RT domains, including the amino acid and nucleic acid sequences therein.

[0245] Exemplary gene modifying polypeptides and retroviral RT domain sequences are also described, e.g.. in International Application No. PCT / US21 / 20948 filed March 4. 2021, e.g.. at Table 30. Table 31. and Table 44 therein: the entire application is incorporated by reference herein with respect to retroviral RTs, e.g., in said sequences and tables. Accordingly, a gene modifying polypeptide described herein may comprise an amino acid sequence according to any of the Tables mentioned in this paragraph, or a domain thereof (e.g., a retroviral RT domain), or a functional fragment or variant of any of the foregoing, or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0246] In some embodiments, a polypeptide for use in any of the systems described herein can be a molecular reconstruction or ancestral reconstruction based upon the aligned polypeptide sequence of multiple homologous proteins. In some embodiments, a reverse transcriptase domain for use in any of the systems described herein can be a molecular reconstruction or an ancestral reconstruction, or can be modified at particular residues, based upon alignments of reverse transcriptase domains from the same or different sources. A skilled artisan can, based on the Accession numbers provided herein, align polypeptides or nucleic acid sequences, e.g.. by using routine sequence analysis tools as Basic Local Alignment Search Tool (BLAST) or CD-Search for conserved domain analysis. Molecular reconstructions can be created based upon sequence consensus, e.g. using approaches described in Ivies et al., Cell 1997, 501 - 510 ; Wagstaff ct al., Molecular Biology and Evolution 2013, 88-99. Polypeptide components of sene modifying systems

[0247] In some embodiments, the gene modifying polypeptide possesses the functions of DNA target site binding, template nucleic acid (e.g., RNA) binding, DNA target site cleavage, and template nucleic acid (e.g., RNA) writing, e g., reverse transcription. In some embodiments, each functions is contained within a distinct domain. In some embodiments, a function may be attributed to two or more domains (e g., two or more domains, together, exhibit tire functionality). In some embodiments, two or more domains may have the same or similar function (e.g., two or more domains each independently have DNA-binding functionality, e.g., for two different DNA sequences). In other embodiments, one or more domains may be capable of enabling one or more functions, e.g., a Cas9 domain enabling both DNA binding and target site cleavage. In some embodiments, the domains are all located within a single polypeptide. In some embodiments, a first domain is in one polypeptide and a second domain is in a second polypeptide. For example, in some embodiments, the sequences may be split between a first polypeptide and a second polypeptide, e.g., wherein the first polypeptide comprises a reverse transcriptase (RT) domain and wherein the second polypeptide comprises a DNA-binding domain and an endonuclease domain, e.g., a nickase domain. As a further example, in some embodiments, the first polypeptide and the second polypeptide each comprise a DNA binding domain (e.g., a first DNA binding domain and a second DNA binding domain). In some embodiments, the first and second polypeptide may be brought together post- translationally via a split-intein to form a single gene modifying polypeptide.

[0248] In some aspects, a gene modifying polypeptide described herein comprises (e.g., a system described herein comprises a gene modifying polypeptide that comprises): 1) a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); 2) a reverse transcriptase (RT) domain, wherein the RT domain is C-temiinal of the Cas domain; and a linker disposed between the RT domain and the Cas domain.

[0249] In some embodiments, the gene modifying polypeptide comprises a GG amino acid sequence between the Cas domain and the linker, an AG amino acid sequence between the RT domain and the second NLS, and / or a GG amino acid sequence between the linker and the RT domain.

[0250] Writing domain (RT Domain)

[0251] In certain aspects of the present invention, the writing domain of the gene modifying system possesses reverse transcriptase activity and is also referred to as a reverse transcriptase domain (a RT domain). In some embodiments, the RT domain comprises an RT catalytic portion and RNA-binding region (e.g., a region that binds the template RNA).

[0252] In some embodiments, a nucleic acid encoding the reverse transcriptase is altered from its natural sequence to have altered codon usage, e.g. improved for human cells. In some embodiments the reverse transcriptase domain is a heterologous reverse transcriptase from a retrovirus. In some embodiments, the RT domain comprising a gene modifying polypeptide has been mutated from its original amino acid sequence, e.g., has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 substitutions. In some embodiments, the RT domain is derived from the RT of a retrovirus, e.g., Avian reticuloendotheliosis virus (AVIRE) (e.g., UniProtKB accession: P03360) RT.

[0253] In some embodiments, the retroviral reverse transcriptase (RT) domain exhibits enhanced stringency of target-primed reverse transcription (TPRT) initiation, e.g., relative to an endogenous RT domain. In some embodiments, the RT domain initiates TPRT when the 3 nt in the target site immediately upstream of the first strand nick, e.g., tire genomic DNA priming tire RNA template, have at least 66% or 100% complementarity to the 3 nt of homology in the RNA template. In some embodiments, the RT domain initiates TPRT when there are less than 5 nt mismatched (e.g., less than 1, 2. 3, 4, or 5 nt mismatched) between the template RNA homology and the target DNA priming reverse transcription. In some embodiments, the RT domain is modified such that the stringency for mismatches in priming the TPRT reaction is increased, e.g., wherein the RT domain does not tolerate any mismatches or tolerates fewer mismatches in the priming region relative to a wild-type (e.g., unmodified) RT domain.

[0254] Naturally heterodimeric RT domains may, in some embodiments, also be functional as homodimers. In some embodiments, dimeric RT domains are expressed as fusion proteins, e.g.. as homodimeric fusion proteins or heterodimeric fusion proteins. In some embodiments, the RT function of the system is fulfilled by multiple RT domains. In further embodiments, the multiple RT domains are fused or separate, e.g., may be on the same polypeptide or on different polypeptides.

[0255] In some embodiments, a gene modifying system described herein comprises an integrase domain, e.g., wherein the integrase domain may be part of the RT domain. In some embodiments, an RT domain (e.g., as described herein) comprises an integrase domain. In some embodiments, an RT domain (e.g.. as described herein) lacks an integrase domain, or comprises an integrase domain that has been inactivated by mutation or deleted. In some embodiment, a gene modifying system described herein comprises an RNase H domain, e.g., wherein the RNase H domain may be part of the RT domain. In some embodiments, the RNase H domain is not part of the RT domain and is covalently linked via a flexible linker. In some embodiments, an RT domain (e g., as described herein) comprises an RNase H domain, e.g., an endogenous RNAse H domain or a heterologous RNase H domain. In some embodiments, an RT domain (e.g., as described herein) lacks an RNase H domain. In some embodiments, an RT domain (e.g.. as described herein) comprises an RNase H domain that has been added, deleted, mutated, or swapped for a heterologous RNase H domain. In some embodiments, the polypeptide comprises an inactivated endogenous RNase H domain. In some embodiments, an endogenous RNase H domain from one of the other domains of the polypeptide is genetically removed such that it is not included in the polypeptide, e.g., the endogenous RNase H domain is partially or completely truncated from the comprising domain. In some embodiments, mutation of an RNase H domain yields a polypeptide exhibiting lower RNase activity, e.g., as determined by the methods described in Kotewicz et al. Nucleic Acids Res 16(l):265-277 (1988) (incorporated herein by reference in its entirety), e.g., lower by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to an otherwise similar domain without the mutation. In some embodiments. RNase H activity is abolished.

[0256] In some embodiments, an RT domain is mutated to increase fidelity compared to an otherwise similar domain without the mutation. For instance, in some embodiments, a YADD (SEQ ID NO: 37635) or YMDD motif (SEQ ID NO: 37636) in an RT domain (e.g., in a reverse transcriptase) is replaced with YVDD (SEQ ID NO: 37637). In embodiments, replacement of the YADD (SEQ ID NO: 37635) or YMDD (SEQ ID NO: 37636) or YVDD (SEQ ID NO: 37637) results in higher fidelity in retroviral reverse transcriptase activity (e.g.. as described in Jamburuthugoda and Eickbush J Mol Biol 2011; incorporated herein by reference in its entirety).

[0257] In some embodiments, a RT domain for use in a gene modifying system described herein comprises a RT domain from AVIRE. In some embodiments, the RT domain comprises one or more mutations as listed in Table 2 below compared to a wild-type or canonical RT domain (e.g., from AVIRE). In some embodiments, an RT domain comprises one, two. three, four, five, or six of the mutations listed in the corresponding row of Table 2 below.

[0258] Table 2. Exemplary RT domain mutations (relative to corresponding wild-type sequences)

[0259] In some embodiments, a gene modifying polypeptide described herein comprises an RT domain having an amino acid sequence according to Table 6, or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, a gene modifying polypeptide described herein comprises an RT domain encoded by a nucleic acid sequence according to Table 6, or a sequence having at least 70%. 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid described herein encodes an RT domain having an amino acid sequence according to Table 6, or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. Table 6: Exemplary reverse transcriptase domains from retroviruses

[0260] In some embodiments, reverse transcriptase domains are modified, for example by site-specific mutation. In some embodiments, reverse transcriptase domains are engineered to have improved properties. In some embodiments, the reverse transcriptase domain may be engineered to have lower error rates, e.g., as described in WO2001068895, incorporated herein by reference. In some embodiments, the reverse transcriptase domain may be engineered to be more thermostable. In some embodiments, tire reverse transcriptase domain may be engineered to be more processive. In some embodiments, the reverse transcriptase domain may be engineered to have tolerance to inhibitors. In some embodiments, the reverse transcriptase domain may be engineered to be faster. In some embodiments, the reverse transcriptase domain may be engineered to better tolerate modified nucleotides in the RNA template. In some embodiments, the reverse transcriptase domain may be engineered to insert modified DNA nucleotides. In some embodiments, the reverse transcriptase domain is engineered to bind a template RNA.

[0261] In some embodiments, a retroviral reverse transcriptase domain may comprise one or more mutations from a wild-type sequence that may improve features of the RT, e.g., thermostability, processivity. and / or template binding.

[0262] In some embodiments, a writing domain (e.g., RT domain) comprises an RNA-binding domain, e.g., that specifically binds to an RNA sequence. In some embodiments, a template RNA comprises an RNA sequence that is specifically bound by the RNA-binding domain of the writing domain. In some embodiments, the reverse transcription domain only recognizes and reverse transcribes a specific template, e.g., a template RNA of the system. In some embodiments, the template comprises a sequence or structure that enables recognition and reverse transcription by a reverse transcription domain. In some embodiments, the template comprises a sequence or structure that enables association with an RNA-binding domain of a polypeptide component of a genome engineering system described herein. In some embodiments, the genome engineering system reverse preferably transcribes a template comprising an association sequence over a template lacking an association sequence.

[0263] The writing domain may also comprise DNA-dependent DNA polymerase activity, e.g., comprise enzymatic activity capable of writing DNA into the genome from a template DNA sequence. In some embodiments, DNA-dependent DNA polymerization is employed to complete second-strand synthesis of a target site edit. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a DNA polymerase domain in the polypeptide. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a reverse transcriptase domain that is also capable of DNA-dependent DNA polymerization, e.g., second-strand synthesis. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a second polypeptide of the system. In some embodiments, the DNA- dependent DNA polymerase activity is provided by an endogenous host cell polymerase that is optionally recruited to the target site by a component of the genome engineering system.

[0264] In some embodiments, the reverse transcriptase domain has a lower probability of premature termination rate (Poff) in vitro relative to a reference reverse transcriptase domain. In some embodiments, the reference reverse transcriptase domain is a viral reverse transcriptase domain, e.g., the RT domain from AVIRE.

[0265] In some embodiments, the reverse transcriptase domain has a lower probability of premature tennination rate (Poff) in vitro of less than about 5 x 10’3 / nt, 5 x 10'4 / nt, or 5 x 10’6 / nt, e.g., as measured on a 1094 nt RNA. In embodiments, the in vitro premature termination rate is determined as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845 (incorporated by reference herein its entirety).

[0266] In some embodiments, the reverse transcriptase domain is able to complete at least about 30% or 50% of integrations in cells. The percent of complete integrations can be measured by dividing the number of substantially full-length integration events (e g., genomic sites that comprise at least 98% of the expected integrated sequence) by the number of total (including substantially full-length and partial) integration events in a population of cells. In embodiments, the integrations in cells is determined (e.g., across the integration site) using long-read amplicon sequencing, e.g., as described in Karst et al. (2020) bioRxiv doi.org / 10. 1101 / 645903 (incorporated by reference herein in its entirety). In embodiments, quantifying integrations in cells comprises counting the fraction of integrations that contain at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the DNA sequence corresponding to the template RNA (e.g., a template RNA having a length of at least 0.05, 0.1, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 3, 4, or 5 kb, e.g., a length between 0.5-0.6, 0.6-0.7, 0.7-0.8, 0.8-0.9, 1.0- 1.2, 1.2-1.4, 1.4-1.6. 1.6-1.8, 1.8-2.0, 2-3, 3-4. or 4-5 kb).

[0267] In some embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro. In embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro at a rate between 0.1 - 50 nt / sec (e.g., between 0.1-1, 1-10, or 10-50 nt / sec). In embodiments, polymerization of dNTPs by the reverse transcriptase domain is measured by a single -molecule assay, e.g., as described in Schwartz and Quake (2009) PNAS 106(48) :20294-20299 (incorporated by reference in its entirety).

[0268] In some embodiments, the reverse transcriptase domain has an in vitro error rate (e.g., misincorporation of nucleotides) of between 1 x 10‘3- 1 x 10‘4or 1 x 10'4- 1 x 10'5substitutions / nt , e.g.. as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2): 147-153 (incorporated herein by reference in its entirety). In some embodiments, the reverse transcriptase domain has an error rate (e.g., misincorporation of nucleotides) in cells (e.g., HEK293T cells) of between 1 x 10'3- l x 10’4or 1 x 10'4- 1 x 10'5substitutions / nt, e g., by long-read amplicon sequencing, e.g., as described in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated by reference herein in its entirety).

[0269] In some embodiments, the reverse transcriptase domain is capable of performing reverse transcription of a target RNA in vitro. In some embodiments, the reverse transcriptase requires a primer of at least 3 nucleotides to initiate reverse transcription of a template. In some embodiments, reverse transcription of the target RNA is determined by detection of cDNA from the target RNA (e.g., when provided with a ssDNA primer, e.g.. which anneals to the target with at least 3, 4, 5, 6, 7, 8, 9. or 10 nt at the 3' end), e.g.. as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845 (incorporated herein by reference in its entirety).

[0270] In some embodiments, the reverse transcriptase domain performs reverse transcription at least 5 or 10 times more efficiently (e.g., by cDNA production), e.g., when converting its RNA template to cDNA, for example, as compared to an RNA template lacking the protein binding motif (e.g., a 3' UTR). In embodiments, efficiency of reverse transcription is measured as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2): 147-153 (incorporated by reference herein in its entirety).

[0271] In some embodiments, the reverse transcriptase domain specifically binds a specific RNA template with higher frequency (e g., about 5 or 10-fold higher frequency) than any endogenous cellular RNA, e.g., when expressed in cells (e.g., HEK293T cells). In embodiments, frequency of specific binding between the reverse transcriptase domain and the template RNA arc measured by CLIP-scq, e.g., as described in Lin and Miles (2019) Nucleic Acids Res 47(11 ) :5490-5501 (incorporated herein by reference in its entirety).

[0272] Template nucleic acid binding domain

[0273] The gene modifying polypeptide typically contains regions capable of associating with the template nucleic acid (e.g., template RNA). In some embodiments, the template nucleic acid binding domain is an RNA binding domain. In some embodiments, the RNA binding domain is a modular domain that can associate with RNA molecules containing specific signatures, e.g., structural motifs. In other embodiments, the template nucleic acid binding domain (e.g., RNA binding domain) is contained within tire reverse transcription domain, e.g., the reverse transcriptase-derived component has a known signature for RNA preference.

[0274] In other embodiments, the template nucleic acid binding domain (e.g., RNA binding domain) is contained within the target DNA binding domain. For example, in some embodiments, the DNA binding domain is a CRISPR-associated protein that recognizes the structure of a template nucleic acid (e.g., template RNA) comprising a gRNA. In some embodiments, a gene modifying polypeptide comprises a DNA-binding domain comprising a CRISPR-associated protein that associates with a gRNA scaffold that allows the DNA-binding domain to bind a target genomic DNA sequence. In some embodiments, the gRNA scaffold and gRNA spacer is comprised within the template nucleic acid (e.g., template RNA). thus the DNA-binding domain is also the template nucleic acid binding domain. In some embodiments, the polypeptide possesses RNA binding function in multiple domains, e.g., can bind a gRNA structure in a CRISPR-associated DNA binding domain and an additional sequence, or structure in a reverse transcriptase domain.

[0275] In some embodiments, the RNA binding domain is capable of binding to a template RNA with greater affinity than a reference RNA binding domain. In some embodiments, the reference RNA binding domain is an RNA binding domain from Cas9 of S. pyogenes. In some embodiments, the RNA binding domain is capable of binding to atemplate RNA with an affinity between 100 pM - 10 nM (e.g., between 100 pM-1 nM or 1 nM - 10 nM). In some embodiments, the affinify of a RNA binding domain for its template RNA is measured in vitro, e.g., by thermophoresis, e.g., as described in Asmari et al. Methods 146: 107-119 (2018) (incorporated by reference herein in its entirety). In some embodiments, the affinity of a RNA binding domain for its template RNA is measured in cells (e.g.. by FRET or CLIP-Seq).

[0276] In some embodiments, the RNA binding domain is associated with the template RNA in vitro at a frequency at least about 5-fold or 10-fold higher than with a scrambled RNA. In some embodiments, the frequency of association between the RNA binding domain and the template RNA or scrambled RNA is measured by CLIP-seq, e.g., as described in Lin and Miles (2019) Nucleic Acids Res 47(11): 5490-5501 (incorporated by reference herein in its entirety). In some embodiments, the RNA binding domain is associated with the template RNA in cells (e.g., in HEK293T cells) at a frequency at least about 5-fold or 10-fold higher than with a scrambled RNA. In some embodiments, the frequency of association between the RNA binding domain and the template RNA or scrambled RNA is measured by CLIP-seq, e.g., as described in Lin and Miles (2019), supra.

[0277] Endonuclease domains and DNA binding domains

[0278] In some embodiments, a gene modifying polypeptide possesses the function of DNA target site cleavage via an endonuclease domain. In some embodiments, a gene modifying polypeptide comprises a DNA binding domain, e g., for binding to a target nucleic acid. In some embodiments, a domain (e.g., a Cas domain) of the gene modifying polypeptide comprises two or more smaller domains, e.g.. a DNA binding domain and an endonuclease domain. It is understood that when a DNA binding domain (e.g., a Cas domain) is said to bind to a target nucleic acid sequence, in some embodiments, the binding is mediated by a gRNA.

[0279] In some embodiments, a domain has two functions. For example, in some embodiments, tire endonuclease domain is also a DNA-binding domain. In some embodiments, the endonuclease domain is also a template nucleic acid (e.g., template RNA) binding domain. For example, in some embodiments, a polypeptide comprises a CRISPR -associated endonuclease domain that binds a template RNA comprising a gRNA, binds a target DNA sequence (e.g., with complementarity to a portion of tire gRNA), and cuts the target DNA sequence. In some embodiments, an endonuclease domain or endonuclease / DNA-binding domain from a heterologous source can be used or can be modified (e.g., by insertion, deletion, or substitution of one or more residues) in a gene modifying system described herein.

[0280] In some embodiments, a nucleic acid encoding the endonuclease domain or endonuclease / DNA binding domain is altered from its natural sequence to have altered codon usage, e.g. improved for human cells. In some embodiments, the endonuclease element is a heterologous endonuclease element, such as a Cas endonuclease (e.g., Cas9).

[0281] In certain aspects, the DNA-binding domain of a gene modifying polypeptide described herein is selected, designed, or constructed for binding to a desired host DNA target sequence. In certain embodiments, the DNA-binding domain of the polypeptide is a heterologous DNA-binding element. In some embodiments the heterologous DNA binding element is a sequence-guided DNA binding element, such as Cas9, Cpfl, or other CRISPR-related protein that has been altered to have no endonuclease activity. In some embodiments the heterologous DNA binding element retains endonuclease activity. In some embodiments, the heterologous DNA binding element retains partial endonuclease activity to cleave ssDNA, e.g., possesses nickase activity. In some embodiments, DNA-binding domains are modified, for example by site-specific mutation, increasing or decreasing DNA-binding elements (for example, number, and / or specificity of zinc fingers), etc., to alter DNA-binding specificity and affinity. In some embodiments a nucleic acid sequence encoding the DNA binding domain is altered from its natural sequence to have altered codon usage, e g. improved for human cells. In embodiments, the DNA binding domain comprises one or more modifications relative to a wild-type DNA binding domain, e.g.. a modification via directed evolution, e.g., phage-assisted continuous evolution (PACE).

[0282] In some embodiments, a gene modifying polypeptide comprises a modification to a DNA-binding domain, e.g., relative to the wild-type polypeptide. In some embodiments, the DNA-binding domain comprises an addition, deletion, replacement, or modification to the amino acid sequence of the original DNA-binding domain. In some embodiments, the DNA-binding domain is modified to include a heterologous functional domain that binds specifically to a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the functional domain replaces at least a portion (e.g., the entirety of) the prior DNA-binding domain of the polypeptide. In some embodiments, the Cas domain comprises a Cas9 or a mutant or variant thereof (e.g., as described herein). In embodiments, the Cas domain is associated with a guide RNA (gRNA), e.g.. as described herein. In embodiments, the Cas domain is directed to a target nucleic acid (e.g., DNA) sequence of interest by the gRNA. In embodiments, the Cas domain is encoded in the same nucleic acid (e.g., RNA) molecule as the gRNA. In embodiments, the Cas domain is encoded in a different nucleic acid (e.g., RNA) molecule from the gRNA.

[0283] In some embodiments, the DNA binding domain is capable of binding to a target sequence (e.g., a dsDNA target sequence) with greater affinity than a reference DNA binding domain. In some embodiments, the reference DNA binding domain is a DNA binding domain from Cas9 of S. pyogenes. In some embodiments, the DNA binding domain is capable of binding to a target sequence (e.g., a dsDNA target sequence) with an affinity between 100 pM - 10 nM (e.g., between 100 pM-1 nM or 1 nM - 10 nM).

[0284] In some embodiments, the affinity7of a DNA binding domain for its target sequence (e.g., dsDNA target sequence) is measured in vitro, e.g., by thermophoresis, e.g., as described in Asmari et al. Methods 146: 107-119 (2018) (incorporated by reference herein in its entirety).

[0285] In embodiments, the DNA binding domain is capable of binding to its target sequence (e.g.. dsDNA target sequence), e.g, with an affinity between 100 pM - 10 nM (e.g.. between 100 pM-1 nM or 1 nM - 10 nM) in the presence of a molar excess of scrambled sequence competitor dsDNA, e g ., of about 100-fold molar excess.

[0286] In some embodiments, the DNA binding domain is found associated with its target sequence (e.g., dsDNA target sequence) more frequently than any other sequence in the genome of a target cell. e.g., human target cell, e.g., as measured by ChlP-seq (e.g., in HEK293T cells), e.g., as described in He and Pu (2010) Curr. Protoc Mol Biol Chapter 21 (incorporated herein by reference in its entirety). In some embodiments, the DNA binding domain is found associated with its target sequence (e.g., dsDNA target sequence) at least about 5-fold or 10-fold, more frequently than any other sequence in the genome of a target cell, e.g., as measured by ChlP-seq (e.g., in HEK293T cells), e.g., as described in He and Pu (2010), supra.

[0287] In some embodiments, the endonuclease domain has nickase activity and cleaves one strand of a target DNA. In some embodiments, nickase activity reduces the formation of double-stranded breaks at the target site. In some embodiments, the endonuclease domain creates a staggered nick structure in the first and second strands of a target DNA. In some embodiments, a staggered nick structure generates free 3‘ overhangs at the target site. In some embodiments, free 3’ overhangs at the target site improve editing efficiency, e.g., by enhancing access and annealing of a 3’ homology region of a template nucleic acid. In some embodiments, a staggered nick structure reduces the formation of double -stranded breaks at the target site.

[0288] In some embodiments, the endonuclease domain cleaves both strands of a target DNA, e.g., results in blunt-end cleavage of a target with no ssDNA overhangs on either side of the cut-site. The amino acid sequence of an endonuclease domain of a gene modifying system described herein may be at least about 50%. at least about 60%. at least about 70%. at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to the amino acid sequence of an endonuclease domain described herein.

[0289] In certain embodiments, the heterologous endonuclease is derived from a CRISPR-associated protein, e.g.. Cas9. In certain embodiments, the heterologous endonuclease is engineered to have only ssDNA cleavage activity, e.g.. only nickase activity, e.g., be a Cas9 nickase, e.g., SpCas9 with D10A. H840A. or N863A mutations. In still other embodiments, homologous endonuclease domains are modified, for example by site-specific mutation, to alter DNA endonuclease activity. In still other embodiments, endonuclease domains are modified to reduce DNA-sequence specificity, e.g., by truncation to remove domains that confer DNA-sequence specificity or mutation to inactivate regions conferring DNA-sequence specificity.

[0290] In some embodiments, the endonuclease domain has nickase activity and does not fonn double- stranded breaks. In some embodiments, the endonuclease domain forms single-stranded breaks at a higher frequency than double-stranded breaks, e.g., at least 90%, 95%, 96%, 97%, 98%, or 99% of the breaks are single-stranded breaks, or less than 10%, 5%, 4%, 3%, 2%, or 1% of the breaks are double- stranded breaks. In some embodiments, tire endonuclease forms substantially no double -stranded breaks. In some embodiments, the endonuclease does not form detectable levels of double-stranded breaks. In some embodiments, the endonuclease domain has nickase activity that nicks the target site DNA of the first strand; e.g., in some embodiments, the endonuclease domain cuts the genomic DNA of the target site near to the site of alteration on the strand that will be extended by the writing domain. In some embodiments, the endonuclease domain has nickase activity that nicks the target site DNA of the first strand and does not nick the target site DNA of the second strand. For example, when a polypeptide comprises a CRISPR-associated endonuclease domain having nickase activity, in some embodiments, said CRISPR-associated endonuclease domain nicks the target site DNA strand containing the PAM site (e.g., and does not nick the target site DNA strand that does not contain the PAM site). As a further example, when a polypeptide comprises a CRISPR-associated endonuclease domain having nickase activity, in some embodiments, said CRISPR-associated endonuclease domain nicks the target site DNA strand not containing the PAM site (e.g., and does not nick the target site DNA strand that contains the PAM site).

[0291] In some other embodiments, the endonuclease domain has nickase activity that nicks the target site DNA of the first strand and the second strand. Without wishing to be bound by theory, after a writing domain (e.g., RT domain) of a polypeptide described herein polymerizes (e.g., reverse transcribes) from the heterologous object sequence of a template nucleic acid (e.g ., template RNA), the cellular DNA repair machinery must repair the nick on the first DNA strand. The target site DNA now contains two different sequences for the first DNA strand: one corresponding to the original genomic DNA (e.g., having a free 5' end) and a second corresponding to that polymerized from the heterologous object sequence (e.g., having a free 3' end). It is thought that the two different sequences equilibrate with one another, first one hybridizing the second strand, then the other, and which sequence the cellular DNA repair apparatus incorporates into its repaired target site may be a stochastic process. Without wishing to be bound by theory, it is thought that introducing an additional nick to the second-strand may bias the cellular DNA repair machinery to adopt the heterologous object sequence -based sequence more frequently than the original genomic sequence (Anzalone et al. Nature 576: 149-157 (2019)). In some embodiments, the additional nick is positioned at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides 5' or 3' of the target site modification (e.g., the insertion, deletion, or substitution) or to the nick on the first strand.

[0292] Alternatively or additionally, without wishing to be bound by theory, it is thought that an additional nick to the second strand may promote second-strand synthesis. In some embodiments, where the gene modifying system has inserted or substituted a portion of the first strand, synthesis of a new sequence corresponding to the insertion / substitution in the second strand is necessary.

[0293] In some embodiments, the polypeptide comprises a single domain having endonuclease activity (e.g., a single endonuclease domain) and said domain nicks both tire first strand and the second strand. For example, in such an embodiment the endonuclease domain may be a CRISPR-associated endonuclease domain, and the template nucleic acid (e.g., template RNA) comprises a gRNA spacerthat directs nicking of the first strand and an additional gRNA spacer that directs nicking of the second strand. In some embodiments, the polypeptide comprises a plurality of domains having endonuclease activity, and a first endonuclease domain nicks the first strand and a second endonuclease domain nicks the second strand (optionally, the first endonuclease domain does not (e.g., cannot) nick the second strand and the second endonuclease domain does not (e.g., cannot) nick the first strand).

[0294] In some embodiments, the endonuclease domain is capable of nicking a first strand and a second strand. In some embodiments, the first and second strand nicks occur at the same position in the target site but on opposite strands. In some embodiments, the second strand nick occurs in a staggered location, e.g., upstream or downstream, from the first nick. In some embodiments, the endonuclease domain generates a target site deletion if the second strand nick is upstream of the first strand nick. In some embodiments, the endonuclease domain generates a target site duplication if the second strand nick is downstream of the first strand nick. In some embodiments, the endonuclease domain generates no duplication and / or deletion if the first and second strand nicks occur in the same position of the target site. In some embodiments, the endonuclease domain has altered activity depending on protein conformation or RNA-binding status, e.g.. which promotes the nicking of the first or second strand (e.g., as described in Christensen et al. PNAS 2006; incorporated by reference herein in its entirety).

[0295] In some embodiments, a gene modifying polypeptide comprises a modification to an endonuclease domain, e.g., relative to a wild-type Cas protein. In some embodiments, the endonuclease domain comprises an addition, deletion, replacement, or modification to the amino acid sequence of the wild-type Cas protein. In some embodiments, the endonuclease domain is modified to include a heterologous fimctional domain that binds specifically to and / or induces endonuclease cleavage of a target nucleic acid (e.g.. DNA) sequence of interest.

[0296] In some embodiments, the endonuclease domain is associated with the target dsDNA in vitro at a frequency at least about 5-fold or 10-fold higher than with a scrambled dsDNA. In some embodiments, the endonuclease domain is associated with the target dsDNA in vitro at a frequency at least about 5 -fold or 10-fold higher than with a scrambled dsDNA, e.g., in a cell (e.g., a HEK293T cell). In some embodiments, the frequency of association between the endonuclease domain and the target DNA or scrambled DNA is measured by ChlP-seq. e.g., as described in He and Pu (2010) Curr. ProtocMol Biol Chapter 21 (incorporated by reference herein in its entirety).

[0297] In some embodiments, the endonuclease domain can catalyze the formation of a nick at a target sequence, e.g., to an increase of at least about 5-fold or 10-fold relative to a non-target sequence (e.g., relative to any other genomic sequence in the genome of the target cell). In some embodiments, the level of nick formation is determined using NickSeq, e.g., as described in Elacqua et al. (2019) bioRxiv doi.org / 10.1101 / 867937 (incorporated herein by reference in its entirety).

[0298] In some embodiments, the endonuclease domain is capable of nicking DNA in vitro. In embodiments, the nick results in an exposed base. In embodiments, the exposed base can be detected using a nuclease sensitivity assay, e.g., as described in Chaudhry and Weinfeld (1995) Nucleic Acids Res 23(19):3805-3809 (incorporated by reference herein in its entirety). In embodiments, the level of exposed bases (e.g., detected by the nuclease sensitivity assay) is increased by at least 10%, 50%, or more relative to a reference endonuclease domain. In some embodiments, the reference endonuclease domain is an endonuclease domain from Cas9 of S. pyogenes.

[0299] In some embodiments, the endonuclease domain is capable of nicking DNA in a cell. In embodiments, the endonuclease domain is capable of nicking DNA in aHEK293T cell. In embodiments, an unrepaired nick that undergoes replication in the absence of Rad51 results in increased NHEJ rates at the site of the nick, which can be detected, e.g., by using a Rad51 inhibition assay, e.g., as described in Bothmer et al. (2017) Nat Commun 8: 13905 (incorporated by reference herein in its entirety). In embodiments, NHEJ rates are increased above 0-5%. In embodiments, NHEJ rates are increased to 20- 70% (e.g., between 30%-60% or 40-50%), e.g., upon Rad51 inhibition.

[0300] In some embodiments, the endonuclease domain releases the target after cleavage. In some embodiments, release of the target is indicated indirectly by assessing for multiple turnovers by the enzyme, e.g., as described in Yourik at al. RNA 25(1): 35-44 (2019) (incorporated herein by reference in its entirety) and shown in FIG. 2. In some embodiments, the kexpof an endonuclease domain is 1 x 10'3- I x 10'5 min-1 as measured by such methods.

[0301] In some embodiments, the endonuclease domain has a catalytic efficiency (kcJKN) greater than about 1 x 108s’1M’1in vitro. In embodiments, the endonuclease domain has a catalytic efficiency greater than about 1 x 105, 1 x 10b, 1 x 107, or 1 x 108. s'1M1in vitro. In embodiments, catalytic efficiency is determined as described in Chen et al. (2018) Science 360(6387):436-439 (incorporated herein by reference in its entirety). In some embodiments, the endonuclease domain has a catalytic efficiency (Ccat / Am) greater than about 1 x 108s'1M1in cells. In embodiments, tire endonuclease domain has a catalytic efficiency greater than about 1 x 105, 1 x 106. 1 x 107, or 1 x 108s'1M-1in cells.

[0302] Gene modifying polypeptides comprising Cas domains

[0303] In some embodiments, a gene modifying polypeptide described herein comprises a Cas domain. In some embodiments, the Cas domain can direct the gene modifying polypeptide to a target site specified by a gRNA spacer, thereby modifying a target nucleic acid sequence in "‘cis.” In some embodiments, a gene modifying polypeptide is fused to a Cas domain. In some embodiments, a gene modifying polypeptide comprises a CRISPR / Cas domain (also referred to herein as a CRISPR-associated protein). In some embodiments, a CRISPR / Cas domain comprises a protein involved in the clustered regulatory interspaced short palindromic repeat (CRISPR) system, e.g., a Cas protein, and optionally binds a guide RNA, e.g., single guide RNA (sgRNA).

[0304] CRISPR systems are adaptive defense systems originally discovered in bacteria and archaea. CRISPR systems use RNA-guided nucleases termed CRISPR-associated or “Cas” endonucleases (e.g., Cas9 or Cpfl) to cleave foreign DNA. For example, in a typical CRISPR-Cas system, an endonuclease is directed to a target nucleotide sequence (e. g., a site in the genome that is to be sequence -edited) by sequence-specific, non-coding “guide RNAs” that target single- or double-stranded DNA sequences. Three classes (I-III) of CRISPR systems have been identified. The class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”). The crRNA contains a “spacer” sequence, atypically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence (“protospacer”). In the wild-type system, and in some engineered systems, crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure that is cleaved by RNase III, resulting in a crRNA / tracrRNA hybrid molecule. A crRNA / tracrRNA hybrid then directs the Cas endonuclease to recognize and cleave a target DNA sequence. A target DNA sequence is generally adjacent to a “protospacer adjacent motif’ (“PAM”) that is specific for a given Cas endonuclease and required for cleavage activity at a target site matching the spacer of the crRNA. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements, e.g., as listed for exemplary Cas enzymes in Table 7; examples of PAM sequences include 5 -NGG (Streptococcus pyogenes), 5 -NNAGAA (Streptococcus thermophilus CRISPR1), 5 -NGGNG (Streptococcus thermophilus CRISPR3), and 5 -NNNGATT (Neisseria meningiditis). Some endonucleases, e.g., Cas9 endonucleases, are associated with G-rich PAM sites, e.g., 5'-NGG), and perform blunt-end cleaving of the target DNA at a location 3 nucleotides upstream from (5' from) the PAM site. Another class II CRISPR system includes the type V endonuclease Cpfl, which is smaller than Cas9; examples include AsCpfl (from Acidaminococcus sp.) and LbCpfl (from Lachnospiraceae sp.). Cpfl -associated CRISPR arrays are processed into mature crRNAs without the requirement of a tracrRNA; in other words, a Cpfl system, in some embodiments, comprises only Cpfl nuclease and a crRNA to cleave a target DNA sequence. Cpfl endonucleases, are typically associated with T-rich PAM sites, e. g., 5'-TTN. Cpfl can also recognize a 5'-CTA PAM motif. Cpfl typically cleaves a target DNA by introducing an offset or staggered double-strand break with a 4- or 5-nucleotide 5 ' overhang, for example, cleaving a target DNA with a 5 -nucleotide offset or staggered cut located 18 nucleotides downstream from (3 ' from) from a PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complimentary strand: the 5 -nucleotide overhang that results from such offset cleavage allows more precise genome editing by DNA insertion by homologous recombination than by insertion at blunt-end cleaved DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759 - 771.

[0305] A variety of CRISPR associated (Cas) genes or proteins can be used in the technologies provided by the present disclosure and the choice of Cas protein will depend upon the particular conditions of the method. Specific examples of Cas proteins include class II systems including Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cpfl, C2C1, or C2C3. In some embodiments, a Cas protein, e.g., a Cas9 protein, may be from any of a variety of prokaryotic species. In some embodiments a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer-adjacent motif (PAM) sequence. In some embodiments, a DNA-binding domain or endonuclease domain includes a sequence targeting polypeptide, such as a Cas protein, e.g., Cas9. In certain embodiments a Cas protein, e.g., a Cas9 protein, may be obtained from a bacteria or archaea or synthesized using known methods. In certain embodiments, a Cas protein may be from a gram-positive bacteria or a gram-negative bacteria. In certain embodiments, a Cas protein may be from a Streptococcus (e.g., a S. pyogenes).

[0306] In some embodiments, a gene modifying polypeptide may comprise a Cas domain as listed in Table 7 or 8, or a functional fragment thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto.

[0307] Table 7. CRISPR / Cas Proteins, Species, and Mutations

[0308] Table 8 Sequences of Exemplary CRISPR / Cas Protein

[0309] 318082055.1

[0310]

[0311] 318082055.1

[0312]

[0313] In some embodiments, a Cas protein requires a protospacer adjacent motif (PAM) to be present in or adjacent to a target DNA sequence for the Cas protein to bind and / or function. In some embodiments, the PAM is or comprises, from 5' to 3', NGG, YG, NNGRRT, NNNRRT, NGA, TYCV, TATV, NTTN, or NNNGATT, where N stands for any nucleotide, Y stands for C or T, R stands for A or G, and V stands for A or C or G. In some embodiments, a Cas protein is a protein listed in Table 7 or 8. In some embodiments, a Cas protein comprises one or more mutations altering its PAM. Exemplary advances in the engineering of Cas enzymes to recognize altered PAM sequences are reviewed in Collias et al Nature Communications 12:555 (2021), incorporated herein by reference in its entirety.

[0314] In some embodiments, the Cas protein is catalytically active and cuts one or both strands of the target DNA site. In some embodiments, cutting the target DNA site is followed by formation of an alteration, e.g., an insertion or deletion, e.g., by the cellular repair machinery.

[0315] In some embodiments, the Cas protein is modified to deactivate or partially deactivate tire nuclease, e.g., nuclease-deficient Cas9. Whereas wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by a gRNA, a number of CRISPR endonucleases having modified functionalities are available, for example: a “nickase’’ version of Cas9 that has been partially deactivated generates only a single-strand break; a catalytically inactive Cas9 (“dCas9”) does not cut target DNA. In some embodiments, dCas9 binding to a DNA sequence may interfere with transcription at that site by steric hindrance. In some embodiments. dCas9 binding to an anchor sequence may interfere with (e.g., decrease or prevent) genomic complex (e g., ASMC) formation and / or maintenance. In some embodiments, a DNA-binding domain comprises a catalytically inactive Cas9, e.g., dCas9. Many catalytically inactive Cas9 proteins are known in the art. In some embodiments, dCas9 comprises mutations in each endonuclease domain of the Cas protein, e.g., N863A mutations. In some embodiments, a catalytically inactive or partially inactive CRISPR / Cas domain comprises a Cas protein comprising one or more mutations, e.g., one or more of the mutations listed in Table 7. In some embodiments, a Cas protein described on a given row of Table 7 comprises one, two, three, or all of the mutations listed in the same row of Table 7. In some embodiments, a Cas protein, e.g., not described in Table 7, comprises one, two, three, or all of the mutations listed in a row of Table 7 or a corresponding mutation at a corresponding site in that Cas protein.

[0316] In some embodiments, a catalytically inactive Cas9 protein, e g., dCas9, or partially deactivated Cas9 protein comprises a N863 mutation (e.g., a N863A mutation) or an analogous substitution to the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises a DIO mutation (e.g., D10A), a D839 mutation (e.g., D839A), a H840 mutation (e.g., H840A), and a N863 mutation (e.g., N863A) or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a DNA-binding domain or endonuclease domain may comprise a Cas molecule comprising or linked (e.g., covalently) to a gRNA (e.g., a template nucleic acid, e.g., template RNA, comprising a gRNA).

[0317] In some embodiments, an endonuclease domain or DNA binding domain comprises a Streptococcus pyogenes Cas9 (SpCas9) or a functional fragment or variant thereof. In some embodiments, the endonuclease domain or DNA binding domain comprises a modified SpCas9. In embodiments, the modified SpCas9 comprises a modification that alters protospacer-adjacent motif (PAM) specificity. In embodiments, the PAM has specificity for the nucleic acid sequence 5'-NGT-3'. In some embodiments, the endonuclease domain or DNA binding domain comprises a Cas domain, e.g., a Cas9 domain. In embodiments, the endonuclease domain or DNA binding domain comprises a nuclease -active Cas domain, a Cas nickase (nCas) domain, or a nuclease-inactive Cas (dCas) domain. In embodiments, the endonuclease domain or DNA binding domain comprises a nuclease-active Cas9 domain, a Cas9 nickase (nCas9) domain, or a nuclease-inactive Cas9 (dCas9) domain.

[0318] In some embodiments, the endonuclease domain or DNA binding domain comprises a Cas9 sequence, e.g., as described in Chylinski, Rhun, and Charpentier (2013) RNA Biology 10:5, 726-737; incorporated herein by reference. In some embodiments, the endonuclease domain or DNA binding domain comprises the HNH nuclease subdomain and / or the RuvCl subdomain of a Cas, e.g., Cas9, e.g., as described herein, or a variant thereof. In some embodiments, the endonuclease domain or DNA binding domain comprises a Cas polypeptide (e.g., enzyme), or a functional fragment thereof. In embodiments, the Cas9 comprises one or more substitutions and / or one or more mutations.

[0319] Additional Components of Exemplary Gene Modifying Polypeptides

[0320] In addition to the writing / RT domain and endonuclease and DNA binding domains, the exemplary gene modifying polypeptides for use in the gene modifying systems may comprise additional components as described herein.

[0321] Linkers

[0322] In some embodiments, a gene modifying polypeptide may comprise a linker, e.g.. a peptide linker, e.g., a linker as described in Table 10. In some embodiments, a gene modifying polypeptide comprises, in an N-terminal to C-terminal direction, a Cas domain (e.g., a Cas domain of Table 8), a linker of Table 10 (or a sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identify thereto), and an RT domain (e.g., an RT domain of Table 6). In some embodiments, a gene modifying polypeptide comprises a flexible linker between the endonuclease and the RT domain, e.g., a linker comprising the ammo acid sequence AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 54), or a sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, an RT domain of a gene modifying polypeptide may be located C-terminal to the endonuclease domain. In some embodiments, an RT domain of a gene modifying polypeptide may be located N-terminal to the endonuclease domain.

[0323] Table 10 Exemplary linker sequences

[0324] In some embodiments, a gene modifying polypeptide comprises: (i) a linker comprising a linker sequence as listed in a row of Table Tl, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (ii) an RT domain comprising an RT domain sequence as listed in the same row of Table TL or an amino acid sequence having at least 70%, 75%. 80%. 85%. 90%. 95%. or 99% identity thereto.

[0325] Table Tl. Selection of exemplary gene modifying polypeptides

[0326] 318082055.1

[0327] In some embodiments, a gene modifying polypeptide comprises: (i) a Cas domain comprising a Cas sequence as listed in a row of Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; (ii) a linker comprising a linker sequence as listed in the same row of Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (iii) an RT domain comprising an RT domain sequence as listed in the same row of Table T2, or an amino acid sequence having at least 70%,

[0328] 5 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0329] Table T2. Selection of exemplary gene modifying polypeptides

[0330] 318082055.1

[0331]

[0332] 318082055.1

[0333] Localization sequences

[0334] In certain embodiments, a gene modifying system RNA further comprises an intracellular localization sequence, e.g., a nuclear localization sequence (NLS). In some embodiments, a gene modifying polypeptide or a nucleic acid (e.g., RNA) encoding a gene modifying polypeptide comprises an NLS. Tire nuclear localization sequence may be an RNA sequence that promotes the import of the RNA into the nucleus. In certain embodiments the nuclear localization signal is located on the template RNA. In certain embodiments, the gene modifying polypeptide is encoded on a first RNA, and the template RNA is a second, separate, RNA, and the nuclear localization signal is located on the template RNA and not on an RNA encoding the gene modifying polypeptide. While not wishing to be bound by theory, in some embodiments, the RNA encoding the gene modifying polypeptide is targeted primarily to the cytoplasm to promote its translation, while the template RNA is targeted primarily to the nucleus to promote insertion into the genome. In some embodiments the nuclear localization signal is at the 3' end, 5' end, or in an internal region of the template RNA. In some embodiments the nuclear localization signal is 3' of the heterologous sequence (e.g., is directly 3' of the heterologous sequence) or is 5' of the heterologous sequence (e.g., is directly 5' of the heterologous sequence). In some embodiments the nuclear localization signal is placed outside of the 5' UTR or outside of the 3' UTR of the template RNA. In some embodiments the nuclear localization signal is placed between the 5' UTR and the 3' UTR, wherein optionally the nuclear localization signal is not transcribed with the transgene (e.g.. the nuclear localization signal is an anti-sense orientation or is downstream of a transcriptional termination signal or polyadenylation signal). In some embodiments the nuclear localization sequence is situated inside of an intron. In some embodiments a plurality of the same or different nuclear localization signals are in the RNA, e.g., in the template RNA. In some embodiments the nuclear localization signal is less than 5. 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 bp in length. Various RNA nuclear localization sequences can be used. For example, Lubelsky and Ulitsky. Nature 555 (107- 111), 2018 describe RNA sequences which drive RNA localization into the nucleus. In some embodiments, the nuclear localization signal is a SINE-derived nuclear RNA localization (SIRLOIN) signal. In some embodiments the nuclear localization signal binds a nuclear-enriched protein. In some embodiments the nuclear localization signal binds the HNRNPK protein. In some embodiments the nuclear localization signal is rich in pyrimidines, e.g., is a C / T rich, C / U rich, C rich, T rich, or U rich region. In some embodiments the nuclear localization signal is derived from a long non-coding RNA. In some embodiments the nuclear localization signal is derived from MALAT1 long non-coding RNA or is the 600 nucleotide M region of MALAT1 (described in Miyagawa et al., RNA 18, (738-751), 2012). In some embodiments the nuclear localization signal is derived from BORG long non-coding RNA or is a AGCCC motif (described in Zhang et al., Molecular and Cellular Biology 34, 2318-2329 (2014). In some embodiments the nuclear localization sequence is described in Shukla et aL, The EMBO Journal e98452 (2018). In some embodiments the nuclear localization signal is derived from a retrovirus.

[0335] In some embodiments, a polypeptide described herein comprises one or more (e.g., 2, 3, 4, 5) nuclear targeting sequences, for example a nuclear localization sequence (NLS). In some embodiments, the NLS is a bipartite NLS. In some embodiments, an NLS facilitates the import of a protein comprising an NLS into the cell nucleus. In some embodiments, the NLS is fused to the N-terminus of a gene modifying polypeptide as described herein. In some embodiments, the NLS is fused to the C-terminus of the gene modifying polypeptide. In some embodiments, the NLS is fused to the N-terminus or the C- terminus of a Cas domain. In some embodiments, a linker sequence is disposed between the NLS and the neighboring domain of the gene modifying polypeptide.

[0336] In some embodiments, an NLS comprises an amino acid sequence as disclosed in Table 11. An NLS may be utilized with one or more copies in a polypeptide in one or more locations in a polypeptide, e.g., 1, 2, 3, or more copies of an NLS in an N-terminal domain, between peptide domains, in a C- terminal domain, or in a combination of locations, in order to improve subcellular localization to the nucleus. Multiple unique sequences may be used within a single polypeptide. Sequences may be naturally monopartite or bipartite, e g., having one or two stretches of basic amino acids, or may be used as chimeric bipartite sequences. Sequence references correspond to UniProt accession numbers, except where indicated as SeqNLS for sequences mined using a subcellular localization prediction algorithm (Lin et al BMC Bioinformat 13: 157 (2012), incorporated herein by reference in its entirety).

[0337] Table 11 Exemplary nuclear localization signals for use in gene modifying systems

[0338] In some embodiments, a gene modifying polypeptide disclosed herein comprises an N-tenninal NLS comprises the amino acid sequence of PAAKRVKLDGG (SEQ ID NO: 36). or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto). In some embodiments, a gene modifying polypeptide disclosed herein comprises a C- terminal NLS comprising the amino acid sequence of KRTADGSEFEKRTADGSEFESPKKKAKVE (SEQ ID NO: 38), or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto).

[0339] Additional exemplary NLS sequences are also described in PCT / EP2000 / 011690, the contents of which are incorporated herein by reference for their disclosure of exemplary nuclear localization sequences.

[0340] In some embodiments, the gene modifying polypeptide comprises, in N-terminal to C-terminal order, one or more (e.g., 1, 2, 3, 4, 5, or all 6) of an N-terminal methionine residue, a first nuclear localization signal (NLS), a DNA binding domain, a linker, an RT domain, and / or a second NLS. In some embodiments, a gene modifying polypeptide comprises, in N-terminal to C-terminal order, a first NLS, a DNA binding domain, a linker, an RT domain, and a second NLS.

[0341] In some embodiments, a gene modifying polypeptide comprises: (i) an N-terminal NLS comprising an NLS sequence of PAAKRVKLDGG (SEQ ID NO: 36), or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identify thereto); (ii) a Cas domain comprising a Cas sequence of SEQ ID NO: 52, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; (iii) a linker comprising a linker sequence of AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 54), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%. or 99% identity thereto; (iv) an RT domain comprising an RT domain sequence of SEQ ID NO: 56, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (v) a C-terminal NLS of KRTADGSEFEKRTADGSEFESPKKKAKVE (SEQ ID NO: 38), or a functional fragment thereof (e.g., an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto). In some embodiments, the gene modifying polypeptide comprises the amino acid sequence of, SEQ ID NO 28 (e.g., as shown in Table T3 below), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0342] Table T3. Exemplary gene modifying polypeptide

[0343] In some embodiments, the gene modifying polypeptide further comprises an N-terminal methionine residue.

[0344] In some embodiments, the gene modifying polypeptide further comprises (e.g., C-terminal to the second NLS) a T2A sequence and / or a puromycin sequence. In some embodiments, a nucleic acid encoding a gene modifying polypeptide (e.g., as described herein) encodes a T2A sequence, e.g., wherein the T2A sequence is situated between a region encoding tire gene modifying polypeptide and a second region, wherein the second region optionally encodes a selectable marker, e.g., puromycin.

[0345] In certain embodiments, the gene modifying polypeptide further comprises a spacer sequence between the first NLS and the DNA binding domain. In certain embodiments, the spacer sequence between the first NLS and the DNA binding domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the first NLS and the DNA binding domain comprises the amino acid sequence GG. In certain embodiments, the gene modifying polypeptide further comprises a spacer sequence between the DNA binding domain and the linker. In certain embodiments, the spacer sequence between the DNA binding domain and the linker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the DNA binding domain and the linker comprises the amino acid sequence GG.

[0346] In certain embodiments, the gene modifying polypeptide further comprises a spacer sequence between the linker and tire RT domain. In certain embodiments, the spacer sequence between the linker and the RT domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the linker and the RT domain comprises the amino acid sequence GG.

[0347] In certain embodiments, the gene modifying polypeptide further comprises a spacer sequence between the RT domain and the second NLS. In certain embodiments, the spacer sequence between the RT domain and the second NLS comprises 1, 2. 3, 4, 5, 6. 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the RT domain and the second NLS comprises the amino acid sequence AG.

[0348] In certain embodiments, the gene modifying polypeptide further comprises a spacer sequence between the second NLS and the T2A sequence and / or puromycin sequence. In certain embodiments, the spacer sequence between the second NLS and the T2A sequence and / or puromycin sequence comprises 1, 2, 3. 4, 5, 6, 7. 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the second NLS and the T2A sequence and / or puromycin sequence comprises the amino acid sequence GSG.

[0349] Additional domains

[0350] The gene modifying polypeptide can bind a target DNA sequence and template nucleic acid (e.g., template RNA), nick tire target site, and write (e.g., reverse transcribe) the template into DNA, resulting in a modification of the target site. In some embodiments, additional domains may be added to the polypeptide to enhance the efficiency of the process. In some embodiments, the gene modifying polypeptide may contain an additional DNA ligation domain to join reverse transcribed DNA to tire DNA of the target site. In some embodiments, the polypeptide may comprise a heterologous RNA-binding domain. In some embodiments, the polypeptide may comprise a domain having 5' to 3' exonuclease activity (e g., wherein the 5' to 3' exonuclease activity increases repair of the alteration of the target site, e.g.. in favor of alteration over the original genomic sequence). In some embodiments, the polypeptide may comprise a domain having 3' to 5' exonuclease activity, e g., proof-reading activity. In some embodiments, the writing domain, e.g., RT domain, has 3' to 5' exonuclease activity, e.g., proof-reading activity. Nucleic Acids encoding sene modifying polypeptides

[0351] Provided herein are nucleic acids encoding gene modifying polypeptides for use in the gene modifying systems disclosed herein.

[0352] In some embodiments, a nucleic acid encoding the gene modifying polypeptide is altered from its canonical sequence to have altered codon usage, e.g. improved for human cells. In certain embodiments, the nucleic acid molecule encoding the gene modifying polypeptide comprises one or more silent mutations in the coding region (e.g., in the sequence encoding the RT domain) relative to a nucleic acid molecule as described herein.

[0353] In some embodiments the nucleic acid (e.g., RNA) encoding the gene modifying polypeptide comprises a posttranscriptional regulatory element that enhances nuclear export. In some embodiments, the posttranscriptional regulatory element is that of Hepatitis B Virus (HPRE) or Woodchuck Hepatitis Virus (WPRE). Nucleic acid sequences of exemplary WPRE regulatory elements are shown in Table Nl, below. In some embodiments, a WPRE regulatory' element included in a nucleic acid encoding the gene modifying polypeptide comprises one or more mutations relative to a wild-type WPRE regulatory element, e.g., mutations recited in Zanta-Boussif, M. A. et al. Gene Ther. 16, 605-619 (2009).

[0354] In some embodiments, a nucleic acid encoding a gene modifying polypeptide is flanked by untranslated regions (UTRs) that modify’ protein expression levels. Various 5' and 3' UTRs can affect protein expression. For example, in some embodiments, the coding sequence may be preceded by a 5' UTR that modifies RNA stability or protein translation. In some embodiments, the sequence may be followed by a 3' UTR that modifies RNA stability7or translation. In some embodiments, the sequence may be preceded by a 5 ' UTR and followed by a 3 ' UTR that modify RNA stability or translation. In some embodiments, a 5' and / or 3' UTR may be selected to enhance protein expression. In some embodiments, a 5' and / or 3' UTR may be selected to modify protein expression such that overproduction inhibition is minimized. In some embodiments, UTRs are around a coding sequence, e.g.. outside the coding sequence and in other embodiments proximal to the coding sequence.

[0355] In some embodiments, a system described herein comprises a DNA encoding a transcript, wherein the DNA comprises the corresponding 5' UTR and 3' UTR sequences, with T substituting for U in the above-listed sequence). In some embodiments, a DNA vector used to produce an RNA component of the system further comprises a promoter upstream of the 5 ' UTR for initiating in vitro transcription, e.g, a T7, T3, or SP6 promoter. Tire 5' UTR above begins with GGG. which is a suitable start for optimizing transcription using T7 RNA polymerase. For tuning transcription levels and altering tire transcription start site nucleotides to fit alternative 5' UTRs, the teachings of Davidson et al. Pac Symp Biocomput 433-443 (2010) describe T7 promoter variants, and the methods of discovery’ thereof, that fulfill both of these traits. Exemplary sequences of 5’ UTRs and 3’ UTRs for use in the nucleic acids encoding gene modifying polypeptides described herein are shown in Tables Nl, E12, and E16.

[0356] In some embodiments, a nucleic acid (e.g., an RNA) encoding a gene modifying polypeptide further comprises a poly(A) tail for enhancing expression of the polypeptide.

[0357] In some embodiments, the poly(A) tail is made of exclusively adenosine ribonucleotides. In some embodiments, the poly(A) tail comprises ribonucleotides other than adenosine, e.g.. interspersed within / between regions of polyadenosine.

[0358] In some embodiments, the poly(A) tail consists of a nucleic acid sequence comprising a pattern of

[0359] 12-18 adenosine nucleotides followed by at least two non-adenosine nucleotides, 22-28 adenosine nucleotides followed by at least two non-adenosine nucleotides, 32-38 adenosine nucleotides followed by at least two non-adenosine nucleotides, and 42-48 adenosine nucleotides.

[0360] In some embodiments, the poly(A) tail consists of a nucleic acid sequence comprising a pattern of

[0361] 13-17 adenosine nucleotides followed by 1-4 non-adenosine nucleotides, 23-27 adenosine nucleotides followed by 1-5 non-adenosine nucleotides, 33-37 adenosine nucleotides followed by 2-6 non-adenosine nucleotides, and 43-47 adenosine nucleotides.

[0362] In some embodiments, the poly(A) tail consists of a nucleic acid sequence comprising a pattern of

[0363] 14-16 adenosine nucleotides followed by at least two (e.g., 2-6) non-adenosine nucleotides, 24-26 adenosine nucleotides followed by at least two (e.g.. 2-6) non-adenosine nucleotides, 34-36 adenosine nucleotides followed by at least two (e.g., 2-6) non-adenosine nucleotides, and 44-46 adenosine nucleotides.

[0364] In some embodiments, the poly(A) tail consists of a nucleic acid sequence comprising a pattern of 15 adenosine nucleotides followed by at least two (e.g., 2-4) non-adenosine nucleotides. 25 adenosine nucleotides followed by at least two (e.g., 2-4) non-adenosine nucleotides, 35 adenosine nucleotides followed by at least two (e.g.. 2-4) non-adenosine nucleotides, and 45 adenosine nucleotides.

[0365] In some embodiments, the poly(A) tail consists of a nucleic acid sequence comprising a pattern of 15 adenosine nucleotides followed by 1-4 non-adenosine nucleotides, 25 adenosine nucleotides followed by 1-5 non-adenosine nucleotides, 35 adenosine nucleotides followed by 2-6 non-adenosine nucleotides, and 45 adenosine nucleotides.

[0366] In some embodiments, there are two to ten non-adenosine nucleotides. In some embodiments, from 5’ to 3’, the number of non-adenosine nucleotides in each group of non-adenosine nucleotides increases. In some embodiments, from 5’ to 3:the number of non-adenosine nucleotides in each group of non-adenosine nucleotides is 2, 3, and 4 non-adenosine nucleotides, respectively. In some embodiments, the non-adcnosinc nucleotides arc selected from a cytosine nucleotide or a uridine nucleotide. Exemplary sequences of poly(A) tails for use in the nucleic acids encoding gene modifying polypeptides described herein are shown in Tables Nl, E12, and E16.

[0367] Table Nl: Exemplary regulatory elements, 5’ UTRs, 3’ UTRs, and poly(A) tails

[0368] In some embodiments, a nucleic acid encoding the gene modifying polypeptide comprises a nucleic acid sequence listed in Table N2, El 1. or E15. or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, a nucleic acid encoding the gene modifying polypeptide comprises a nucleic acid sequence of SEQ ID NO: 40, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid encoding the gene modifying polypeptide comprises a nucleic acid sequence of SEQ ID NO: 101, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid encoding the gene modifying polypeptide comprises a nucleic acid sequence of SEQ ID NO: 102. or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid encoding the gene modifying polypeptide comprises a nucleic acid sequence of SEQ ID NO:

[0369] 106, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identify thereto.

[0370] Table N2: Exemplary Nucleic Acid Sequences Encoding Gene Modifying Polypeptides

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387] Template nucleic acids

[0388] The gene modifying systems described herein can modify a host target DNA site using a template nucleic acid sequence. In some embodiments, the gene modifying systems described herein transcribe an RNA sequence template into host target DNA sites by target-primed reverse transcription (TPRT). By modifying DNA sequence(s) via reverse transcription of the RNA sequence template directly into the host genome, the gene modifying system can insert an object sequence into a target genome without the need for exogenous DNA sequences to be introduced into the host cell (unlike, for example, CRISPR systems), as well as eliminate an exogenous DNA insertion step. The gene modifying system can also delete a sequence from the target genome or introduce a substitution using an object sequence. Therefore, the gene modifying system provides a platform for the use of customized RNA sequence templates containing object sequences, e.g., sequences comprising heterologous gene coding and / or function information.

[0389] In some embodiments, the template nucleic acid comprises one or more sequence (e.g., 2 sequences) that binds the gene modifying polypeptide.

[0390] In some embodiments a system or method described herein comprises a single template nucleic acid (e.g., template RNA). In some embodiments a system or method described herein comprises a plurality of template nucleic acids (e.g., template RNAs). For example, a system described herein comprises a first RNA comprising (e.g., from 5' to 3') a sequence that binds the gene modifying polypeptide (e.g., the DNA-binding domain and / or the endonuclease domain, e.g., a gRNA) and a sequence that binds a target site (e.g., a second strand of a site in a target genome), and a second RNA (e.g., a template RNA) comprising (e.g.. from 5 ' to 3 ') optionally a sequence that binds the gene modifying polypeptide (e.g., that specifically binds the RT domain), a heterologous object sequence, and a PBS sequence. In some embodiments, when the system comprises a plurality of nucleic acids, each nucleic acid comprises a conjugating domain. In some embodiments, a conjugating domain enables association of nucleic acid molecules, e.g., by hybridization of complementary sequences. For example, in some embodiments a first RNA comprises a first conjugating domain and a second RNA comprises a second conjugating domain, and the first and second conjugating domains are capable of hybridizing to one another, e.g., under stringent conditions. In some embodiments, the stringent conditions for hybridization include hybridization in 4x sodium chloride / sodium citrate (SSC), at about 65 C, followed by a wash in IxSSC, at about 65 C.

[0391] In some embodiments, tire template nucleic acid comprises RNA. In some embodiments, the template nucleic acid comprises DNA (e.g., single stranded or double stranded DNA).

[0392] In some embodiments, the template nucleic acid comprises one or more (e.g.. 2) homology domains that have homology to the target sequence. In some embodiments, the homology domains are about 10-20, 20-50, or 50-100 nucleotides in length. In some embodiments, a template RNA can comprise a gRNA sequence, e.g., to direct the gene modifying polypeptide to a target site of interest. In some embodiments, a template RNA comprises (e.g., from 5' to 3') (i) optionally a gRNA spacer that binds a target site (e.g., a second strand of a site in a target genome), (ii) optionally a gRNA scaffold that binds a polypeptide described herein (e g., a gene modifying polypeptide or a Cas polypeptide), (iii) a heterologous object sequence comprising a mutation region (optionally the heterologous object sequence comprises, from 5’ to 3 \ a first homology region, a mutation region, and a second homology region), and (iv) a primer binding site (PBS) sequence comprising a 3' target homology domain.

[0393] Tire template nucleic acid (e.g., template RNA) component of a genome editing system described herein typically is able to bind the gene modifying polypeptide of the system. In some embodiments the template nucleic acid (e.g., template RNA) has a 3' region that is capable of binding a gene modifying polypeptide. The binding region, e.g.. 3' region, may be a structured RNA region, e.g., having at least 1, 2 or 3 hairpin loops, capable of binding the gene modifying polypeptide of the system. The binding region may associate the template nucleic acid (e.g., template RNA) with any of the polypeptide modules. In some embodiments, the binding region of the template nucleic acid (e.g., template RNA) may associate with an RNA-binding domain in the polypeptide. In some embodiments, the binding region of the template nucleic acid (e.g., template RNA) may associate with tire reverse transcription domain of tire gene modifying polypeptide (e.g., specifically bind to the RT domain). In some embodiments, the template nucleic acid (e.g., template RNA) may associate with the DNA binding domain of the polypeptide, e.g., a gRNA associating with a Cas9-derived DNA binding domain. In some embodiments, the binding region may also provide DNA target recognition, e.g., a gRNA hybridizing to the target DNA sequence and binding tire polypeptide, e.g., a Cas9 domain. In some embodiments, tire template nucleic acid (e.g., template RNA) may associate with multiple components of the polypeptide, e.g., DNA binding domain and reverse transcription domain.

[0394] In some embodiments the template RNA has a poly- A tail at the 3' end. In some embodiments the template RNA does not have a poly-A tail at tire 3 ' end.

[0395] In some embodiments, the template nucleic acid is a template RNA. In some embodiments, the template RNA comprises one or more modified nucleotides. For example, in some embodiments, the template RNA comprises one or more deoxyribonucleotides. In some embodiments, regions of the template RNA are replaced by DNA nucleotides, e.g.. to enhance stability of the molecule. For example, the 3 ' end of the template may comprise DNA nucleotides, while the rest of the template comprises RNA nucleotides that can be reverse transcribed. For instance, in some embodiments, the heterologous object sequence is primarily or wholly made up of RNA nucleotides (e.g., at least 90%, 95%, 98%, or 99% RNA nucleotides). In some embodiments, the PBS sequence is primarily or wholly made up of DNA nucleotides (e.g., at least 90%, 95%, 98%, or 99% DNA nucleotides). In other embodiments, the heterologous object sequence for writing into the genome may comprise DNA nucleotides. In some embodiments, the DNA nucleotides in the template are copied into the genome by a domain capable of DNA-dependent DNA polymerase activity. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a DNA polymerase domain in the polypeptide. In some embodiments, the DNA- dependent DNA polymerase activity is provided by a reverse transcriptase domain that is also capable of DNA-dependent DNA polymerization, e.g., second strand synthesis. In some embodiments, the template molecule is composed of only DNA nucleotides.

[0396] In some embodiments, a system described herein comprises two nucleic acids which together comprise the sequences of a template RNA described herein. In some embodiments, the two nucleic acids are associated with each other non-covalently, e.g., directly associated with each other (e.g., via base pairing), or indirectly associated as part of a complex comprising one or more additional molecule.

[0397] A template RNA described herein may comprise, from 5’ to 3’: (1) a gRNA spacer; (2) a gRNA scaffold; (3) heterologous object sequence (4) a primer binding site (PBS) sequence. Each of these components is now described in more detail. gRNA spacer and gRNA scaffold

[0398] A template RNA described herein may comprise a gRNA spacer that directs the gene modifying system to a target nucleic acid, and a gRNA scaffold that promotes association of the template RNA with the Cas domain of the gene modifying polypeptide. The systems described herein can also comprise a gRNA that is not part of a template nucleic acid. For example, a gRNA that comprises a gRNA spacer and gRNA scaffold, but not a heterologous object sequence or a PBS sequence, can be used, e.g., to induce second strand nicking, e.g., as described in the section herein entitled “Second Strand Nicking'’.

[0399] In some embodiments, the gRNA is a short synthetic RNA composed of a scaffold sequence that participates in CRISPR-associated protein binding and a user-defined ~20 nucleotide targeting sequence for a genomic target. The structure of a complete gRNA was described by Nishimasu et al. Cell 156, P935-949 (2014). The gRNA (also referred to as sgRNA for single-guide RNA) consists of crRNA- and tracrRNA-derived sequences connected by an artificial tetraloop. The crRNA sequence can be divided into guide (20 nt) and repeat (12 nt) regions, whereas the tracrRNA sequence can be divided into anti- repeat (14 nt) and three tracrRNA stem loops (Nishimasu et al. Cell 156, P935-949 (2014)). In practice, guide RNA sequences are generally designed to have a length of between 17 - 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and be complementary to a targeted nucleic acid sequence. Custom gRNA generators and algorithms are available commercially for use in the design of effective guide RNAs. In some embodiments, the gRNA comprises two RNA components from the native CRISPR system, e.g. crRNA and tracrRNA. As is well known in the art, the gRNA may also comprise a chimeric, single guide RNA (sgRNA) containing sequence from both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing / binding). Chemically modified sgRNAs have also been demonstrated to be effective for use with CRISPR-associated proteins; see, for example, Hendel et al. (2015) Nature BiotechnoL, 985 - 991. In some embodiments, a gRNA spacer comprises a nucleic acid sequence that is complementary to a DNA sequence associated with a target gene.

[0400] In some embodiments, the region of the template nucleic acid, e.g., template RNA, comprising the gRNA adopts an underwound ribbon-like structure of gRNA bound to target DNA (e.g., as described in Mulepati et al. Science 19 Sep 2014:Vol. 345, Issue 6203, pp. 1479-1484). Without wishing to be bound by theory, this non-canonical structure is thought to be facilitated by rotation of even’ sixth nucleotide out of the RNA-DNA hybrid. Thus, in some embodiments, the region of the template nucleic acid, e.g., template RNA, comprising the gRNA may tolerate increased mismatching with the target site at some interval, e.g., every sixth base. In some embodiments, the region of the template nucleic acid, e.g., template RNA, comprising the gRNA comprising homology to the target site may possess wobble positions at a regular interval, e.g., every sixth base, that do not need to base pair with the target site.

[0401] In some embodiments, the template nucleic acid (e.g.. template RNA) has at least 15, 16, 17, 18, 19, 20, 21. 22. 23. or 24 bases of at least 80%. 85%. 90%. 95%. 99%, or 100% homology to the target site, e.g., at the 5 ’ end, e.g., comprising a gRNA spacer sequence of length appropriate to the Cas9 domain of the gene modifying polypeptide (Table 8).

[0402] In some embodiments, a Cas9 derivative with enhanced activity may be used in tire gene modification polypeptide. In some embodiments, a Cas9 derivative may comprise mutations that improve activity of the HNH endonuclease domain, (see, e g., Spencer and Zhang Sci Rep 7: 16836 (2017). the Cas9 derivatives and comprising mutations of which are incorporated herein by reference). In some embodiments, a Cas9 derivative may comprise one or more types of mutations described herein, e.g., PAM-modifying mutations, protein stabilizing mutations, activity enhancing mutations, and / or mutations partially or fully inactivating one or two endonuclease domains relative to the parental enzyme (e.g., one or more mutations to abolish endonuclease activity towards one or both strands of a target DNA, e.g., a nickase or catalytically dead enzyme). In some embodiments, a Cas9 enzyme used in a system described herein may comprise mutations that confer nickase activity toward the enzyme in addition to mutations improving catalytic efficiency. Table 12 provides parameters to define components for designing gRNA and / or Template RNAs to apply Cas variants listed in Table 8 for gene modifying. The cut site indicates the validated or predicted protospaccr adjacent motif (PAM) requirements, validated or predicted location of cut site (relative to the most upstream base of the PAM site). The gRNA for a given enzyme can be assembled by concatenating the crRNA, Tetraloop, and tracrRNA sequences, and further adding a 5' spacer of a length within Spacer (min) and Spacer (max) that matches a protospacer at a target site. Further, the predicted location of the ssDNA nick at the target is important for designing a PBS sequence of a Template RNA that can anneal to the sequence immediately 5' of the nick in order to initiate target primed reverse transcription. In some embodiments, a gRNA scaffold described herein comprises a nucleic acid sequence comprising, in the 5' to 3’ direction, a crRNA of Table 12, a tetraloop from the same row of Table 12, and a tracrRNA from the same row of Table 12, or a sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the gRNA or template RNA comprising the scaffold further comprises a gRNA spacer having a length within the Spacer (min) and Spacer (max) indicated in the same row of Table 12. In some embodiments, the gRNA or template RNA having a sequence according to Table 12 is comprised by a system that further comprises a gene modifying polypeptide, wherein the gene modifying polypeptide comprises a Cas domain described in the same row of Table 12

[0403] Table 12 Parameters to define components for designing gRNA and / or Template RNAs to apply Cas variants listed in Table 8 in gene modifying systems.

[0404] 318082055.1

[0405]

[0406] 318082055.1

[0407]

[0408] Herein, when an RNA sequence (e.g., a template RNA sequence) is said to comprise a particular sequence (e.g., a sequence of Table 12 or a portion thereof) that comprises thymine (T), it is of course understood that the RNA sequence may (and frequently does) comprise uracil (U) in place of T. For instance, the RNA sequence may comprise U at every position shown as T in the sequence in Table 12. More specifically, the

[0409] 5 present disclosure provides an RNA sequence according to every gRNA scaffold sequence of Table 12, wherein the RNA sequence has a U in place of each T in the sequence in Table 12. Additionally, it is understood that terminal Us and Ts may optionally be added or removed from tracrRNA sequences and may be modified or unmodified when provided as RNA. Without wishing to be bound by example, versions of gRNA scaffold sequences alternative to those exemplified in Table 12 may also function with the different Cas9 enzymes or derivatives thereof exemplified in Table 8, e.g., alternate gRNA scaffold sequences with nucleotide additions, substitutions, or deletions, e.g., sequences with stem-

[0410] 10 loop structures added or removed. It is contemplated herein that the gRNA scaffold sequences represent a component of gene modifying systems that can be similarly optimized for a given system, Cas-RT fusion polypeptide, indication, target mutation, template RNA, or delivery vehicle.

[0411] 318082055.1

[0412] Heterologous object sequence

[0413] A template RNA described herein may comprise a heterologous object sequence that the gene modifying polypeptide can use as a template for reverse transcription, to write a desired sequence into the target nucleic acid. In some embodiments, the heterologous object sequence comprises, from 5’ to 3’. a post-edit homology region, the mutation region, and a pre-edit homology region. Without wishing to be bound by theory, an RT performing reverse transcription on the template RNA first reverse transcribes the pre-edit homology region, then the mutation region, and then the post-edit homology region, thereby creating a DNA strand comprising the desired mutation with a homology region on either side.

[0414] In some embodiments, the heterologous object sequence is at least 32, 33. 34, 35, 36, 37, 38, 39, 40, 41, 42. 43. 44. 45. 46, 47, 48, 49, 50, 51. 52. 53. 54, 55, 56, 57, 58, 59, 60. 61. 62. 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 120, 140, 160, 180, 200, 500, or 1,000 nucleotides (nts) in length, or at least 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases in length. In some embodiments, the heterologous object sequence is no more than 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46. 47, 48, 49, 50, 51, 52. 53, 54, 55, 56, 57, 58, 59, 60. 61. 62, 63, 64, 65, 66, 67, 68, 69. 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 120, 140, 160, 180, 200, 500, 1,000, or 2000 nucleotides (nts) in length, or no more than 20, 15, 10, 9, 8, 7, 6, 5, 4, or 3 kilobases in length. In some embodiments, the heterologous object sequence is 30-1000, 40-1000, 50- 1000, 60-1000, 70-1000, 74-1000, 75-1000, 76-1000, 77-1000, 78-1000, 79-1000, 80-1000, 85-1000, 90- 1000, 100-1000, 120-1000, 140-1000, 160-1000, 180-1000, 200-1000, 500-1000, 30-500, 40-500, SO- SOO. 60-500, 70-500, 74-500, 75-500, 76-500. 77-500. 78-500, 79-500, 80-500, 85-500, 90-500. 100-500, 120-500, 140-500, 160-500, 180-500, 200-500, 30-200, 40-200, 50-200, 60-200, 70-200, 74-200, 75-200, 76-200, 77-200, 78-200, 79-200, 80-200, 85-200, 90-200, 100-200, 120-200, 140-200, 160-200, 180-200, 30-100, 40-100, 50-100, 60-100, 70-100, 74-100, 75-100, 76-100, 77-100, 78-100, 79-100, 80-100, 85- 100, or 90-100 nucleotides (nts) in length, or 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-20, 2-15, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-20, 3-15, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4. 4-20, 4-15, 4-10, 4-9, 4-8. 4-7, 4-6, 4-5. 5-20. 5-15, 5-10, 5-9. 5-8, 5-7, 5-6. 6-20. 6-15, 6-10, 6-9. 6-8, 6-7, 7-20, 7-15, 7- 10, 7-9, 7-8, 8-20, 8-15, 8-10, 8-9, 9-20, 9-15, 9-10, 10-15, 10-20, or 15-20 kilobases in length. In some embodiments, the heterologous object sequence is 10-100, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10- 30, or 10-20 nt in length, e.g., 10-80, 10-50, or 10-20 nt in length, e.g., aboutl0-20 nt in length. In some embodiments, the heterologous object sequence is 8-30, 9-25, 10-20, 11-16, or 12-15 nucleotides in length, e.g., is 11-16 nt in length. Without wishing to be bound by theory, in some embodiments, a larger insertion size, larger region of editing (e.g., the distance between a first edit / substitution and a second edit / substitution in the target region), and / or greater number of desired edits (e.g., mismatches of the heterologous object sequence to the target genome), may result in a longer optimal heterologous object sequence.

[0415] In certain embodiments, tire template nucleic acid comprises a customized RNA sequence template which can be identified, designed, engineered and constructed to contain sequences altering or specifying host genome function, for example by introducing a heterologous coding region into a genome: affecting or causing exon structure / altemative splicing, e.g., leading to exon skipping of one or more exons; causing disruption of an endogenous gene, e.g., creating a genetic knockout; causing transcriptional activation of an endogenous gene; causing epigenetic regulation of an endogenous DNA; causing up-regulation of one or more operably linked genes, e.g., leading to gene activation or overexpression; causing down-regulation of one or more operably linked genes, e g., creating a genetic knock-down; etc. In certain embodiments, a customized RNA sequence template can be engineered to contain sequences coding for exons and / or transgenes, provide binding sites for transcription factor activators, repressors, enhancers, etc., and combinations thereof. In some embodiments, a customized template can be engineered to encode a nucleic acid or peptide tag to be expressed in an endogenous RNA transcript or endogenous protein operably linked to the target site. In other embodiments, the coding sequence can be further customized with splice donor sites, splice acceptor sites, or poly-A tails.

[0416] The template nucleic acid (e.g., template RNA) of the system typically comprises an object sequence (e.g., a heterologous object sequence) for writing a desired sequence into a target DNA. The object sequence may be coding or non-coding. The template nucleic acid (e.g., template RNA) can be designed to result in insertions, mutations, or deletions at the target DNA locus. In some embodiments, the template nucleic acid (e.g., template RNA) may be designed to cause an insertion in the target DNA. For example, the template nucleic acid (e.g.. template RNA) may contain a heterologous sequence, wherein the reverse transcription will result in insertion of the heterologous sequence into the target DNA. In other embodiments, the RNA template may be designed to introduce a deletion into tire target DNA. For example, the template nucleic acid (e.g., template RNA) may match the target DNA upstream and downstream of the desired deletion, wherein the reverse transcription will result in the copying of the upstream and downstream sequences from the template nucleic acid (e.g., template RNA) without tire intervening sequence, e.g., causing deletion of the intervening sequence. In other embodiments, the template nucleic acid (e.g., template RNA) may be designed to introduce an edit into the target DNA. For example, the template RNA may match the target DNA sequence with the exception of one or more nucleotides, wherein the reverse transcription will result in the copying of these edits into the target DNA, e.g., resulting in mutations, e.g., transition or transversion mutations.

[0417] In some embodiments, writing of an object sequence into a target site results in the substitution of nucleotides, e.g., where the full length of the object sequence corresponds to a matching length of the target site with one or more mismatched bases. In some embodiments, a heterologous object sequence may be designed such that a combination of sequence alterations may occur, e.g., a simultaneous addition and deletion, addition and substitution, or deletion and substitution.

[0418] In some embodiments, the heterologous object sequence may contain an open reading frame or a fragment of an open reading frame. In some embodiments the heterologous object sequence has a Kozak sequence. In some embodiments the heterologous object sequence has an internal ribosome entry site. In some embodiments the heterologous object sequence has a self-cleaving peptide such as a T2A or P2A site. In some embodiments the heterologous object sequence has a start codon. In some embodiments the template RNA has a splice acceptor site. In some embodiments the template RNA has a splice donor site. Exemplary splice acceptor and splice donor sites are described in WO2016044416, incorporated herein by reference in its entirety. Exemplary splice acceptor site sequences are known to those of skill in the art. In some embodiments the template RNA has a microRNA binding site downstream of the stop codon. In some embodiments the template RNA has a polyA tail downstream of the stop codon of an open reading frame. In some embodiments the template RNA comprises one or more exons. In some embodiments the template RNA comprises one or more introns. In some embodiments the template RNA comprises a eukaryotic transcriptional tenninator. In some embodiments the template RNA comprises an enhanced translation element or a translation enhancing element. In some embodiments the RNA comprises tire human T-cell leukemia vims (HTLV-1) R region. In some embodiments the RNA comprises a posttranscriptional regulatory element that enhances nuclear export, such as that of Hepatitis B Vims (HPRE) or Woodchuck Hepatitis Vims (WPRE).

[0419] In some embodiments, the heterologous object sequence may contain a non-coding sequence. For example, the template nucleic acid (e.g.. template RNA) may comprise a regulatory element, e.g., a promoter or enhancer sequence or miRNA binding site. In some embodiments, integration of the object sequence at a target site will result in upregulation of an endogenous gene. In some embodiments, integration of the object sequence at a target site will result in downregulation of an endogenous gene. In some embodiments the template nucleic acid (e.g., template RNA) comprises a tissue specific promoter or enhancer, each of which may be unidirectional or bidirectional. In some embodiments the promoter is an RNA polymerase I promoter, RNA polymerase II promoter, or RNA polymerase III promoter. In some embodiments the promoter comprises a TATA element. In some embodiments the promoter comprises a B recognition element. In some embodiments the promoter has one or more binding sites for transcription factors.

[0420] In some embodiments, the template nucleic acid (e.g., template RNA) comprises a site that coordinates epigenetic modification. In some embodiments, tire template nucleic acid (e.g., template RNA) comprises a chromatin insulator. For example, the template nucleic acid (e.g., template RNA) comprises a CTCF site or a site targeted for DNA methylation.

[0421] In some embodiments, the template nucleic acid (e.g., template RNA) comprises a gene expression unit composed of at least one regulatory region operably linked to an effector sequence. The effector sequence may be a sequence that is transcribed into RNA (e.g., a coding sequence or a non- coding sequence such as a sequence encoding a micro RNA).

[0422] In some embodiments, the heterologous object sequence of the template nucleic acid (e.g., template RNA) is inserted into a target genome in an endogenous intron. In some embodiments, the heterologous object sequence of tire template nucleic acid (e.g., template RNA) is inserted into a target genome and thereby acts as a new exon. In some embodiments, tire insertion of the heterologous object sequence into the target genome results in replacement of a natural exon or the skipping of a natural exon.

[0423] The template nucleic acid (e.g., template RNA) can be designed to result in insertions, mutations, or deletions at the target DNA locus. In some embodiments, the template nucleic acid (e.g., template RNA) may be designed to cause an insertion in the target DNA. For example, the template nucleic acid (e.g., template RNA) may contain a heterologous object sequence, wherein the reverse transcription will result in insertion of the heterologous object sequence into the target DNA. In other embodiments, the RNA template may be designed to write a deletion into the target DNA. For example, tire template nucleic acid (e.g., template RNA) may match the target DNA upstream and downstream of the desired deletion, wherein the reverse transcription will result in the copying of the upstream and downstream sequences from the template nucleic acid (e.g., template RNA) without the intervening sequence, e.g., causing deletion of the intervening sequence. In other embodiments, the template nucleic acid (e.g., template RNA) may be designed to write an edit into the target DNA. For example, the template RNA may match the target DNA sequence with the exception of one or more nucleotides, wherein the reverse transcription will result in the copying of these edits into the target DNA, e.g.. resulting in mutations, e.g.. transition or transversion mutations.

[0424] In some embodiments, the pre-edit homology domain comprises a nucleic acid sequence having 100% sequence identity with a nucleic acid sequence comprised in a target nucleic acid molecule.

[0425] In some embodiments, tire post-edit homology domain comprises a nucleic acid sequence having 100% sequence identity with a nucleic acid sequence comprised in a target nucleic acid molecule.

[0426] PBS sequence

[0427] In some embodiments, a template nucleic acid (e.g.. template RNA) comprises a PBS sequence. In some embodiments, a PBS sequence is disposed 3 ' of the heterologous object sequence and is complementary to a sequence adjacent to a site to be modified by a system described herein, or comprises no more than 1, 2, 3, 4, or 5 mismatches to a sequence complementary to the sequence adjacent to a site to be modified by the system / gene modifying polypeptide. In some embodiments, the PBS sequence binds within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of a nick site in the target nucleic acid molecule. In some embodiments, binding of the PBS sequence to the target nucleic acid molecule permits initiation of target-primed reverse transcription (TPRT), e.g., with the 3 ' homology domain acting as a primer for TPRT. In some embodiments, the PBS sequence is 3-5, 5-10, 10-30, 10-25, 10-20, 10-19. 10-18, 10-17.

[0428] 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-30, 11-25, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14,

[0429] 11-13, 11-12, 12-30, 12-25, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-30, 13-25, 13-20,

[0430] 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-30, 14-25, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-30,

[0431] 15-25, 15-20, 15-19, 15-18, 15-17, 15-16, 16-30, 16-25, 16-20, 16-19, 16-18, 16-17, 17-30, 17-25, 17-20,

[0432] 17-19. 17-18, 18-30. 18-25, 18-20, 18-19, 19-30, 19-25, 19-20, 20-30. 20-25, or 25-30 nucleotides in length, e.g., 10-17, 12-16, or 12-14 nucleotides in length. In some embodiments, the PBS sequence is 5- 20, 8-16, 8-14, 8-13, 9-13, 9-12, or 10-12 nucleotides in length, e.g., 9-12 nucleotides in length.

[0433] The template nucleic acid (e.g., template RNA) may have some homology to the target DNA. In some embodiments, the template nucleic acid (e.g., template RNA) PBS sequence domain may serve as an annealing region to the target DNA, such that the target DNA is positioned to prime the reverse transcription of the template nucleic acid (e.g., template RNA). In some embodiments the template nucleic acid (e.g., template RNA) has at least 2, 3. 4, 5, 6. 7. 8, 9, 10, 11, 12, 13. 14. 15. 20. 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175, 200 or more bases of exact homology to the target DNA at the 3' end of the RNA. In some embodiments the template nucleic acid (e.g., template RNA) has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175, 200 or more bases of at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to the target DNA, e.g.. at the 5' end of the template nucleic acid (e.g., template RNA).

[0434] Exemplary template sequences

[0435] In some embodiments of the systems and methods herein, the template RNA comprises a gRNA spacer comprising the nucleotides of a gRNA spacer sequence of Table 1A. In some embodiments, the heterologous object sequence comprises the nucleotides of tire RT template sequence of Table 1A that corresponds to the gRNA spacer sequence. In the context of the sequence tables, a first component “corresponds to” a second component when both components are on the same line in the referenced table. In some embodiments, the primer binding site (PBS) sequence has a sequence comprising the nucleotides of a PBS sequence from the same row of Table 1A as the RT template sequence. Table 1A: Exemplary template RNAs (tgRNAs) for correcting the pathogenic R408W mutation

[0436] Table 1 A provides design of exemplary compoents of the gene modifying systems for correcting the pathogenic R408W mutation in the PAH gene to the wild-type form. This table details the sequence of a complete template RNA (tgRNA) comprising (1) a gRNA spacer (e.g., for targeting for first strand nick), (2) a gRNA scaffold, (3) a RT (heterologous object sequence) sequence, and (4) a PBS sequence (e.g., for initiating TPRT at first

[0437] 5 strand nick) gRNA spacer, gRNA scaffold, heterologous object sequence / RT template sequence, and PBS sequence designed to be paired with a gene modifying system for generating a nick at an appropriate position to enable installation of a desired genomic edit. Templates in this table employ a scaffold of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 21).

[0438] 318082055.1

[0439]

[0440] 318082055.1

[0441]

[0442] 318082055.1

[0443] Herein, when an RNA sequence (e.g., a template RNA sequence) is said to comprise a particular sequence (e.g., a sequence of Table 1A, or a portion thereof) that comprises uracil (U), it is of course understood that the RNA sequence may (and frequently does) comprise thymine (T) in place of U. For instance, the RNA sequence may comprise T at every position shown as U in the sequence in Table 1A. More specifically, the present disclosure provides an RNA sequence according to every gRNA spacer sequence shown in Table 1A, wherein the RNA sequence has a T in place of each U in the sequence in Table 1A.

[0444] In some embodiments of the systems and methods herein, the system further comprises a second strand-targeting gRNA (ngRNA) that directs a nick to the second strand of the human PAH gene. In some embodiments, the second strand-targeting gRNA comprises spacer sequence of an ngRNA from Table 2A, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%. 96%. 97%, 98%, or 99% identity thereto.

[0445] Table 2A: Exemplary second nick gRNA (ngRNA)

[0446] Table 2A provides exemplified second-nick gRNA (ngRNA) species for optional use for correcting the pathogenic R408W mutation in PAH.

[0447] These ngRNAs may be used in combination with the tgRNAs listed in Table 1A. Templates in this table employ a scaffold of

[0448] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID 5 NO: 21).

[0449] 318082055.1

[0450] In some embodiments, the systems and methods provided herein may comprise a template sequence listed in Table 1A and an optional second-nick gRNA sequence listed in Table 2A designed to be paired with a gene modifying polypeptide to correct a mutation in the PAH gene. The template RNA sequences shown in Tables 1A and 2A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3 may be customized depending on the cell being targeted. For example, in some embodiments it is desired to inactivate a PAM sequence upon editing (e.g., using a “PAM-kill” modification) to decrease the potential for further gene editing (e.g., by Cas retargeting) following the initial edit. Consequently, certain template RNAs described herein are designed to write a mutation (e.g., a substitution) into the PAM of the target site, such that upon editing, the PAM site will be mutated to a sequence no longer recognized by the gene modifying polypeptide. Thus, a mutation region within tire heterologous object sequence of the template RNA may comprise a PAM-kill sequence. Without wishing to be bound by theory, in some embodiments, a PAM-kill sequence prevents re-engagement of the gene modifying polypeptide upon completion of a genetic modification, or decreases re-engagement relative to a template RNA lacking a PAM-kill sequence. In some embodiments, a PAM-kill sequence does not alter the amino acid sequence encoded by a gene, e.g., the PAM-kill sequence results in a silent mutation. In other embodiments, it is desired to leave the PAM sequence intact (no PAM-kill).

[0451] Similarly, in some embodiments, to decrease the potential for further gene editing (e.g., by Cas retargeting) following the initial edit, it may be desirable to alter the first three nucleotides of the RT template sequence via a '‘seed-kill” motif. Consequently, certain template RNAs described herein are designed to write a mutation (e.g., a substitution) into the portion of the target site corresponding to the first three nucleotides of the RT template sequence, such that upon editing, the target site will be mutated to a sequence with lower homology to the RT template sequence. Thus, a mutation region within the heterologous object sequence of the template RNA may comprise a seed-kill sequence. Without wishing to be bound by theory, in some embodiments, a seed-kill sequence prevents re-engagement of the gene modifying polypeptide upon completion of a genetic modification, or decreases re-engagement relative to an otherwise similar template RNA lacking a seed-kill sequence. In some embodiments, a seed-kill sequence does not alter the amino acid sequence encoded by a gene, e.g., the seed-kill sequence results in a silent mutation. In other embodiments, it is desired to leave the seed region intact, and a seed-kill sequence is not used.

[0452] In further embodiments, to optimize or improve gene editing efficiency, it may be desirable to evade the target cell’s mismatch repair or nucleotide repair pathways or to bias the target cell’s repair pathways toward preservation of the edited strand. In some embodiments, multiple silent mutations (for example, silent substitutions) may be introduced within the RT template sequence to evade the target cell’s mismatch repair or nucleotide repair pathways or to bias tire target cell’s repair pathways toward preservation of the edited strand.

[0453] Table 7A provides exemplary silent mutations for various positions within the PAH gene for use with a template to correct a R408W mutation.

[0454] Table 7A. Exemplary Silent Mutation Codons for the PAH Gene for Templates to Correct a

[0455] R408W mutation

[0456] In some embodiments, the template RNA comprises one or more silent mutations.

[0457] It should be understood that the silent mutations illustrated in Table 7A may be used individually or combined in any manner in a template RNA sequence described herein. gRNAs with inducible activity

[0458] In some embodiments, a gRNA described herein (e.g., a gRNA that is part of a template RNA or a gRNA used for second strand nicking) has inducible activity. Inducible activity may be achieved by the template nucleic acid, e.g., template RNA, further comprising (in addition to the gRNA) a blocking domain, wherein the sequence of a portion of or all of the blocking domain is at least partially complementary to a portion or all of the gRNA. The blocking domain is thus capable of hybridizing or substantially hybridizing to a portion of or all of the gRNA. In some embodiments, the blocking domain and inducibly active gRNA are disposed on the template nucleic acid, e.g., template RNA, such that tire gRNA can adopt a first conformation where tire blocking domain is hybridized or substantially hybridized to the gRNA, and a second conformation where the blocking domain is not hybridized or not substantially hybridized to the gRNA. In some embodiments, in the first conformation the gRNA is unable to bind to the gene modifying polypeptide (e.g., the template nucleic acid binding domain. DNA binding domain, or endonuclease domain (e.g., a CRISPR / Cas protein)) or binds with substantially decreased affinity compared to an otherwise similar template RNA lacking the blocking domain. In some embodiments, in the second conformation the gRNA is able to bind to the gene modifying polypeptide (e.g., the template nucleic acid binding domain, DNA binding domain, or endonuclease domain (e.g., a CRISPR / Cas protein)). In some embodiments, whether the gRNA is in the first or second conformation can influence whether the DNA binding or endonuclease activities of the gene modifying polypeptide (e.g., of the CRISPR / Cas protein the gene modifying polypeptide comprises) are active.

[0459] In some embodiments, the gRNA that coordinates the second nick has inducible activity. In some embodiments, the gRNA that coordinates the second nick is induced after the template is reverse transcribed. In some embodiments, hybridization of the gRNA to the blocking domain can be disrupted using an opener molecule. In some embodiments, an opener molecule comprises an agent that binds to a portion or all of the gRNA or blocking domain and inhibits hybridization of the gRNA to the blocking domain. In some embodiments, the opener molecule comprises a nucleic acid, e.g., comprising a sequence that is partially or wholly complementary to the gRNA, blocking domain, or both. By choosing or designing an appropriate opener molecule, providing the opener molecule can promote a change in the conformation of the gRNA such that it can associate with a CRISPR / Cas protein and provide the associated functions of the CRISPR / Cas protein (e.g., DNA binding and / or endonuclease activity). Without wishing to be bound by theory, providing the opener molecule at a selected time and / or location may allow for spatial and temporal control of the activity of the gRNA, CRISPR / Cas protein, or gene modifying system comprising the same. In some embodiments, the opener molecule is exogenous to the cell comprising the gene modifying polypeptide and or template nucleic acid. In some embodiments, the opener molecule comprises an endogenous agent (e.g., endogenous to the cell comprising the gene modifying polypeptide and or template nucleic acid comprising the gRNA and blocking domain). For example, an inducible gRNA, blocking domain, and opener molecule may be chosen such that the opener molecule is an endogenous agent expressed in a target cell or tissue, e.g., thereby ensuring activity of a gene modifying system in the target cell or tissue. As a further example, an inducible gRNA, blocking domain, and opener molecule may be chosen such that the opener molecule is absent or not substantially expressed in one or more non-target cells or tissues, e.g., thereby ensuring that activity of a gene modifying system does not occur or substantially occur in the one or more non-target cells or tissues, or occurs at a reduced level compared to a target cell or tissue. Exemplary blocking domains, opener molecules, and uses thereof are described in PCT App. Publication W02020044039A1, which is incorporated herein by reference in its entirety. In some embodiments, the template nucleic acid, e.g., template RNA, may comprise one or more sequences or structures for binding by one or more components of a gene modifying polypeptide, e.g., by a reverse transcriptase or RNA binding domain, and a gRNA. In some embodiments, the gRNA facilitates interaction with the template nucleic acid binding domain (e.g., RNA binding domain) of the gene modifying polypeptide. In some embodiments, the gRNA directs the gene modifying polypeptide to the matching target sequence, e.g., in a target cell genome.

[0460] Target Nucleic Acid Site

[0461] In some embodiments, after gene modification, the target site surrounding the edited sequence contains a limited number of insertions or deletions, for example, in less than about 50% or 10% of editing events, e.g., as determined by long-read amplicon sequencing of the target site, e.g., as described in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated by reference herein in its entirety). In some embodiments, the target site does not show multiple consecutive editing events, e.g., head-to-tail or head-to-head duplications, e.g., as determined by long-read amplicon sequencing of the target site, e.g., as described in Karst et al. bioRxiv doi.org / 10.1101 / 645903 (2020) (incorporated herein by reference in its entirety). In some embodiments, the target site contains an integrated sequence corresponding to the template RNA. In some embodiments, the target site does not contain insertions resulting from endogenous RNA in more than about 1% or 10% of events, e.g., as determined by long -read amplicon sequencing of the target site, e.g., as described in Karst et al. bioRxiv doi.org / 10.1101 / 645903 (2020) (incorporated herein by reference in its entirety). In some embodiments, the target site contains the integrated sequence corresponding to the template RNA.

[0462] In certain aspects of the present invention, the host DNA-binding site integrated into by the gene modifying system can be in a gene, in an intron, in an exon, an ORF, outside of a coding region of any gene, in a regulatory region of a gene, or outside of a regulatory region of a gene. In other aspects, the polypeptide may bind to one or more than one host DNA sequence.

[0463] In some embodiments, a gene modifying system is used to edit a target locus in multiple alleles. In some embodiments, a gene modifying system is designed to edit a specific allele. For example, a gene modifying polypeptide may be directed to a specific sequence that is only present on one allele, e.g., comprises a template RNA with homology to a target allele, e.g., a gRNA or annealing domain, but not to a second cognate allele. In some embodiments, a gene modifying system can alter a haplotype-specific allele. In some embodiments, a gene modifying system that targets a specific allele preferentially targets that allele, e.g., has at least a 2, 4, 6, 8, or 10-fold preference for atarget allele.

[0464] Second Strand Nicking

[0465] In some embodiments, a gene modifying system described herein comprises a nickase activity (e.g., in the gene modifying polypeptide) that nicks the first strand, and a nickase activity (e.g., in a polypeptide separate from the gene modify ing polypeptide) that nicks the second strand of target DNA. As discussed herein, without wishing to be bound by theory, nicking of the first strand of the target site DNA is thought to provide a 3 ' OH that can be used by an RT domain to reverse transcribe a sequence of a template RNA, e.g., a heterologous object sequence. Without wishing to be bound by theory, it is thought that introducing an additional nick to the second strand may bias the cellular DNA repair machinery to adopt the heterologous object sequence-based sequence more frequently than the original genomic sequence. In some embodiments, the additional nick to the second strand is made by the same endonuclease domain (e g., nickase domain) as the nick to the first strand. In some embodiments, the same gene modifying polypeptide performs both tire nick to the first strand and the nick to the second strand. In some embodiments, the gene modifying polypeptide comprises a CRISPR / Cas domain and the additional nick to the second strand is directed by an additional nucleic acid, e.g., comprising a second gRNA directing the CRISPR / Cas domain to nick the second strand. In other embodiments, the additional second strand nick is made by a different endonuclease domain (e.g., nickase domain) than the nick to the first strand. In some embodiments, that different endonuclease domain is situated in an additional polypeptide (e.g., a system of the invention further comprises the additional polypeptide), separate from the gene modifying polypeptide. In some embodiments, the additional polypeptide comprises an endonuclease domain (e.g., nickase domain) described herein. In some embodiments, the additional polypeptide comprises a DNA binding domain, e.g.. described herein.

[0466] It is contemplated herein that the position at which the second strand nick occurs relative to the first strand nick may influence tire extent to which one or more of: desired gene modifying DNA modifications are obtained, undesired double-strand breaks (DSBs) occur, undesired insertions occur, or undesired deletions occur. Without wishing to be bound by theory, second strand nicking may occur in two general orientations: inward nicks and outward nicks.

[0467] In some embodiments, in the inward nick orientation, the RT domain polymerizes (e.g.. using the template RNA (e.g., the heterologous object sequence)) away from the second strand nick. In some embodiments, in the inward nick orientation, the location of the nick to the first strand and the location of the nick to the second strand are positioned between the first PAM site and second PAM site (e.g., in a scenario wherein both nicks are made by a polypeptide (e.g., a gene modifying polypeptide) comprising a CRISPR / Cas domain). When there are two PAMs on the outside and tw o nicks on the inside, this inward nick orientation can also be referred to as ‘TAM-out.” In some embodiments, in the inward nick orientation, the location of the nick to the first strand and the location of the nick to the second strand are between the sites where the polypeptide and the additional polypeptide bind to the target DNA. In some embodiments, in the inward nick orientation, the location of the nick to the second strand is positioned betw een the binding sites of the polypeptide and additional polypeptide, and the nick to the first strand is also located between the binding sites of the polypeptide and additional polypeptide. In some embodiments, in the inw ard nick orientation, the location of the nick to the first strand and the location of the nick to the second strand are positioned between the PAM site and the binding site of the second polypeptide which is at a distance from the target site.

[0468] An example of a gene modifying system that provides an inward nick orientation comprises a gene modifying poly peptide comprising a CRISPR / Cas domain, a template RNA comprising a gRNA that directs nicking of the target site DNA on the first strand, and an additional nucleic acid comprising an additional gRNA that directs nicking at a site a distance from the location of the first nick, wherein the location of the first nick and the location of the second nick are between the PAM sites of the sites to which the two gRNAs direct the gene modifying polypeptide. As a further example, another gene modifying system that provides an inw ard nick orientation comprises a gene modifying polypeptide comprising a zinc finger molecule and a first nickase domain wherein the zinc finger molecule binds to the target DNA in a manner that directs the first nickase domain to nick the first strand of the target site; an additional polypeptide comprising a CRISPR / Cas domain, and an additional nucleic acid comprising a gRNA that directs the additional polypeptide to nick a site a distance from the target site DNA on the second strand, wherein the location of the first nick and the location of the second nick are between the PAM site and the site to which tire zinc finger molecule binds. As a further example, another gene modifying system that provides an inward nick orientation comprises a gene modifying polypeptide comprising a zinc finger molecule and a first nickase domain wherein the zinc finger molecule binds to the target DNA in a manner that directs the first nickase domain to nick the first strand of the target site; an additional polypeptide comprising a TAL effector molecule and a second nickase domain wherein the TAL effector molecule binds to a site a distance from the target site in a manner that directs the additional polypeptide to nick the second strand, wherein tire location of the first nick and the location of the second nick are between the site to which the TAL effector molecule binds and the site to which the zinc finger molecule binds.

[0469] In some embodiments, in the outward nick orientation, the RT domain polymerizes (e.g., using the template RNA (e.g., the heterologous object sequence)) toward the second strand nick. In some embodiments, in the outward nick orientation when both the first and second nicks are made by a polypeptide comprising a CRISPR / Cas domain (e g., a gene modifying polypeptide), the first PAM site and second PAM site are positioned between the location of the nick to the first strand and the location of the nick to the second strand. When there are two PAMs on the inside and two nicks on the outside, this outward nick orientation also can be referred to as “PAM-in”. In some embodiments, in the outward nick orientation, the polypeptide (e.g., the gene modifying polypeptide) and the additional polypeptide bind to sites on the target DNA between the location of the nick to the first strand and the location of tire nick to the second. In some embodiments, in the outward nick orientation, the location of the nick to the second strand is positioned on the opposite side of the binding sites of the polypeptide and additional polypeptide relative to the location of the nick to the first strand. In some embodiments, in the outward orientation, the PAM site and the binding site of the second polypeptide which is at a distance from the target site are positioned between the location of the nick to the first strand and the location of tire nick to the second strand.

[0470] An example of a gene modifying system that provides an outward nick orientation comprises a gene modifying poly peptide comprising a CRISPR / Cas domain, a template RNA comprising a gRNA that directs nicking of the target site DNA on the first strand, and an additional nucleic acid comprising an additional gRNA that directs nicking at a site a distance from the location of the first nick, wherein the location of the first nick and tire location of the second nick arc outside of the PAM sites of the sites to which the two gRNAs direct the gene modifying polypeptide (i.e.. the PAM sites are between the location of the first nick and the location of tire second nick). As a further example, another gene modifying system that provides an outward nick orientation comprises a gene modifying polypeptide comprising a zinc finger molecule and a first nickase domain wherein tire zinc finger molecule binds to the target DNA in a manner that directs the first nickase domain to nick the first strand of the target site; an additional polypeptide comprising a CRISPR / Cas domain, and an additional nucleic acid comprising a gRNA that directs the additional polypeptide to nick a site a distance from the target site DNA on the second strand, wherein the location of the first nick and the location of the second nick are outside the PAM site and the site to which the zinc finger molecule binds (i.e., the PAM site and the site to which the zinc finger molecule binds are between the location of the first nick and the location of the second nick). As a further example, another gene modifying system that provides an outward nick orientation comprises a gene modifying polypeptide comprising a zinc finger molecule and a first nickase domain wherein the zinc finger molecule binds to the target DNA in a manner that directs the first nickase domain to nick the first strand of the target site; an additional polypeptide comprising a TAL effector molecule and a second nickase domain wherein the TAL effector molecule binds to a site a distance from the target site in a manner that directs the additional polypeptide to nick the second strand, wherein the location of tire first nick and the location of the second nick are outside the site to which the TAL effector molecule binds and the site to which the zinc finger molecule binds (i.e., tire site to which the TAL effector molecule binds and the site to which the zinc finger molecule binds are between the location of the first nick and the location of the second nick).

[0471] Without wishing to be bound by theory, it is thought that, for gene modifying systems where a second strand nick is provided, an outward nick orientation is preferred in some embodiments. As is described herein, an inward nick may produce a higher number of double -strand breaks (DSBs) than an outward nick orientation. DSBs may be recognized by the DSB repair pathways in the nucleus of a cell, which can result in undesired insertions and deletions. An outward nick orientation may provide a decreased risk of DSB formation, and a corresponding lower amount of undesired insertions and deletions. In some embodiments, undesired insertions and deletions are insertions and deletions not encoded by the heterologous object sequence, e.g., an insertion or deletion produced by the double-strand break repair pathway unrelated to the modification encoded by the heterologous object sequence. In some embodiments, a desired gene modification comprises a change to the target DNA (e g., a substitution, insertion, or deletion) encoded by the heterologous object sequence (e.g., and achieved by the gene modifying writing the heterologous object sequence into the target site). In some embodiments, the first strand nick and the second strand nick are in an outward orientation.

[0472] In addition, the distance between the first strand nick and second strand nick may influence the extent to which one or more of: desired gene modifying system DNA modifications are obtained, undesired double-strand breaks (DSBs) occur, undesired insertions occur, or undesired deletions occur. Without wishing to be bound by theory, it is thought the second strand nick benefit, the biasing of DNA repair toward incorporation of the heterologous object sequence into the target DNA, increases as the distance between the first strand nick and second strand nick decreases. However, it is thought that the risk of DSB formation also increases as the distance between the first strand nick and second strand nick decreases. Correspondingly, it is thought that the number of undesired insertions and / or deletions may increase as the distance between the first strand nick and second strand nick decreases. In some embodiments, the distance between the first strand nick and second strand nick is chosen to balance the benefit of biasing DNA repair toward incorporation of the heterologous object sequence into the target DNA and the risk of DSB fonnation and of undesired deletions and / or insertions. In some embodiments, a system where the first strand nick and the second strand nick are at least a threshold distance apart has an increased level of desired gene modifying system modification outcomes, a decreased level of undesired deletions, and / or a decreased level of undesired insertions relative to an otherwise similar inward nick orientation system where the first nick and the second nick are less than the a threshold distance apart. In some embodiments the threshold distance(s) is given below.

[0473] In some embodiments, the first nick and the second nick are at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70. 75. 80, 85, 90, 95, 100. 110, 120. 130, 140. 150, 160, 170, 180, 190, or 200 nucleotides apart. In some embodiments, the first nick and the second nick are no more than 25. 30, 35, 40, 45, 50, 55. 60. 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or 250 nucleotides apart. In some embodiments, the first nick and the second nick are 20-200, 30-200, 40-200, 50-200, 60-200, 70- 200, 80-200, 90-200, 100-200, 110-200, 120-200, 130-200, 140-200, 150-200, 160-200, 170-200, 180- 200, 190-200, 20-190, 30-190, 40-190, 50-190, 60-190, 70-190, 80-190, 90-190, 100-190, 110-190, 120- 190. 130-190, 140-190, 150-190, 160-190, 170-190. 180-190, 20-180. 30-180, 40-180, 50-180, 60-180, 70-180, 80-180. 90-180. 100-180. 110-180, 120-180, 130-180, 140-180. 150-180. 160-180, 170-180, 20- 170, 30-170, 40-170, 50-170, 60-170, 70-170, 80-170, 90-170, 100-170, 110-170, 120-170, 130-170, 140- 170, 150-170, 160-170, 20-160, 30-160, 40-160, 50-160, 60-160, 70-160, 80-160, 90-160, 100-160, 110- 160, 120-160, 130-160, 140-160, 150-160, 20-150, 30-150, 40-150, 50-150, 60-150, 70-150, 80-150, 90- 150, 100-150, 110-150, 120-150, 130-150, 140-150, 20-140, 30-140, 40-140, 50-140, 60-140, 70-140, 80- 140. 90-140, 100-140. 110-140, 120-140, 130-140, 20-130, 30-130, 40-130. 50-130, 60-130, 70-130, 80- 130. 90-130, 100-130. 110-130. 120-130, 20-120. 30-120. 40-120, 50-120, 60-120, 70-120. 80-120. 90- 120, 100-120, 110-120, 20-110, 30-110, 40-110, 50-110, 60-110, 70-110, 80-110, 90-110, 100-110, 20- 100, 30-100, 40-100, 50-100, 60-100, 70-100, 80-100, 90-100, 20-90, 30-90, 40-90, 50-90, 60-90, 70-90, 80-90, 20-80, 30-80, 40-80, 50-80, 60-80, 70-80, 20-70, 30-70, 40-70, 50-70, 60-70, 20-60, 30-60, 40-60, 50-60, 20-50, 30-50, 40-50, 20-40, 30-40, or 20-30 nucleotides apart. In some embodiments, the first nick and the second nick are 40-100 nucleotides apart.

[0474] Without wishing to be bound by theory, it is thought that, for gene modifying systems where a second strand nick is provided and an inward nick orientation is selected, increasing the distance between the first strand nick and second strand nick may be preferred. As is described herein, an inward nick orientation may produce a higher number of DSBs than an outward nick orientation, and may result in a higher amount of undesired insertions and deletions than an outward nick orientation, but increasing the distance between the nicks may mitigate that increase in DSBs, undesired deletions, and / or undesired insertions. In some embodiments, an inward nick orientation wherein the first nick and the second nick are at least a threshold distance apart has an increased level of desired gene modifying system modification outcomes, a decreased level of undesired deletions, and / or a decreased level of undesired insertions relative to an otherwise similar inward nick orientation system where the first nick and the second nick are less than the a threshold distance apart. In some embodiments the threshold distance is given below .

[0475] In some embodiments, the first strand nick and the second strand nick are in an inward orientation. In some embodiments, the first strand nick and the second strand nick are in an inward orientation and the first strand nick and second strand nick are at least 100, 110, 120, 130. 140, 150. 160, 170. 180, 190. 200, 220. 240, 260. 280, 300. 350, 400. 450, or 500 nucleotides apart, e.g.. at least 100 nucleotides apart, (and optionally no more than 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, or 120 nucleotides apart). In some embodiments, the first strand nick and the second strand nick are in an inward orientation and tire first strand nick and second strand nick are 100-200, 110-200, 120-200, 130-

[0476] 200, 140-200, 150-200, 160-200, 170-200, 180-200, 190-200, 100-190, 110-190, 120-190, 130-190, 140- 190. 150-190, 160-190, 170-190, 180-190, 100-180. 110-180, 120-180, 130-180, 140-180, 150-180, 160- 180. 170-180, 100-170, 110-170, 120-170, 130-170. 140-170. 150-170. 160-170, 100-160, 110-160, 120- 160, 130-160, 140-160, 150-160, 100-150, 110-150, 120-150, 130-150, 140-150, 100-140, 110-140, 120- 140, 130-140, 100-130, 110-130, 120-130, 100-120, 110-120, or 100-110 nucleotides apart.

[0477] Chemically modified nucleic acids and nucleic acid end features

[0478] A nucleic acid described herein (e.g., a template nucleic acid, e.g., a template RNA; or a nucleic acid (e.g., mRNA) encoding a gene modifying polypeptide; or agRNA) can comprise unmodified or modified nucleobases. Naturally occurring RNAs are synthesized from four basic ribonucleotides: ATP, CTP, UTP and GTP, but may contain post-transcriptionally modified nucleotides. Further, approximately one hundred different nucleoside modifications have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). An RNA can also comprise wholly synthetic nucleotides that do not occur in nature. A ribonucleoside having an unmodified sugar comprising a 2’OH as shown below: g a sugar having a 2’-fluoro (2’F) modification is shown below:

[0479] A nucleoside comprising a sugar having a 2’-O-Methyl (2’0-Me) modification is shown below:

[0480] A nucleotide comprising a phosphorothioate modification and a sugar having a 2’-O-Methyl

[0481] (2'0-Mc) modification is shown below:

[0482] Described herein are template RNA sequences comprising modified nucleotides in the heterologous object sequence and / or the PBS sequence. In some embodiments, the heterologous object sequence comprises one or more 2’-O-methyl (OMe) modified nucleotides. In some embodiments, the heterologous object sequence comprises one or more 2 ’-fluoro modified nucleotides. In certain embodiments, the heterologous object sequence comprises a region having a pattern in which 2‘-fluoro modified nucleotides alternate with unmodified nucleotides (e.g., unmodified ribonucleotides). In certain embodiments, the pattern begins at the 5’ end of the heterologous object sequence (e.g., the 5’-most nucleotide of the heterologous object sequence comprises a 2’-fluoro modification). In other embodiments, the pattern begins at the second nucleotide from the 5’ end of the heterologous object sequence (e.g., such that the 5’-most nucleotide of the heterologous object sequence is unmodified and the next nucleotide comprises a 2’-fluoro modification). In certain embodiments, the region having the pattern of alternating 2 ’-fluoro modified and unmodified nucleotides comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 2’-fluoro modified nucleotides. In certain embodiments, the region having the pattern of alternating 2 ’-fluoro modified and unmodified nucleotides has a length of 0- 5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100- 150, 150-200, 200-300, 300-400, 400-500, 500-600. 600-700, 700-800, 800-900, 900-1000, 1000-1500. 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000. 4000-4500. or 4500-5000 nucleotides. In certain embodiments, the region having the pattern of alternating 2 ’-fluoro modified and unmodified nucleotides has a length equal to the length of the heterologous object sequence minus 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0483] In some embodiments, the PBS sequence of the template RNA comprises one or more 2 ’-fluoro modified nucleotides. In some embodiments, the PBS sequence of the template RNA comprises one or more 2’-OMe modified nucleotides. In some embodiments, the PBS sequence of the template RNA comprises one or more nucleotides each comprising both a 2’-OMe modification and a phosphorothioate modification. In certain embodiments, the 3’ end of the PBS sequence comprises, in 5’ to 3’ order, a 2’- fluoro modified nucleotide, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) 2’-0Me modified nucleotides, and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotides each comprising both a 2’-OMe modification and a phosphorothioate modification.

[0484] In some embodiments, the nucleotides at the junction between the heterologous object sequence and the PBS sequence (e.g., one or more of the nucleotides at positions +3, +2, +1, -1, -2, and / or -3) do not comprise a 2’-fluoro modification. In some embodiments, tire nucleotides at the junction between the heterologous object sequence and the PBS sequence (e.g., one or more of the nucleotides at positions +3, +2, +1, -1. -2, and / or -3) do not comprise a 2’-OMe modification. In some embodiments, the nucleotides at the junction between the heterologous object sequence and the PBS sequence (e.g., one or more of the nucleotides at positions +3, +2, +1, -1. -2. and / or -3) are unmodified nucleotides.

[0485] A series of additional exemplary template RNA sequences comprising 2’-fluoro modifications at various positions, e.g., as tested in Example 7 herein, are shown in Table X3 below. Table X3. Exemplary template RNA sequences comprising 2’-fluoro modification patterns.

[0486] Nucleotide modifications are noted as follows: phosphorothioate linkages denoted by an asterisk, 2’-O- methyl groups denoted by an ‘m’ preceding a nucleotide, and 2’-fluoro denoted by / i2FN / where N is any nucleotide. Columns 1 and 2 list names for the sequence. Column 3 lists the nucleic acid sequence, including indicating the nucleotide modifications as described above. Column 4 lists the nucleic acid sequence without the modifications. In some embodiments, the chemical modification is one provided in WO / 2016 / 183482, US Pat. Pub. No. 20090286852, of International Application No. WO / 2012 / 019168, WO / 2012 / 045075, WO / 2012 / 135805, WO / 2012 / 158736, WO / 2013 / 039857, WO / 2013 / 039861, WO / 2013 / 052523, WO / 2013 / 090648, WO / 2013 / 096709, WO / 2013 / 101690, WO / 2013 / 106496, WO / 2013 / 130161, WO / 2013 / 151669, WO / 2013 / 151736, WO / 2013 / 151672, WO / 2013 / 151664, WO / 2013 / 151665. WO / 2013 / 151668, WO / 2013 / 151671. WO / 2013 / 151667, WO / 2013 / 151670, WO / 2013 / 151666. WO / 2013 / 151663, WO / 2014 / 028429, WO / 2014 / 081507, WO / 2014 / 093924, WO / 2014 / 093574, WO / 2014 / 113089, WO / 2014 / 144711, WO / 2014 / 144767, WO / 2014 / 144039, WO / 2014 / 152540, WO / 2014 / 152030, WO / 2014 / 152031, WO / 2014 / 152027, WO / 2014 / 152211, WO / 2014 / 158795, WO / 2014 / 159813, WO / 2014 / 164253, WO / 2015 / 006747, WO / 2015 / 034928, WO / 2015 / 034925, WO / 2015 / 038892, WO / 2015 / 048744, WO / 2015 / 051214, WO / 2015 / 051173, WO / 2015 / 051169. WO / 2015 / 058069, WO / 2015 / 085318. WO / 2015 / 089511, WO / 2015 / 105926, WO / 2015 / 164674. WO / 2015 / 196130, WO / 2015 / 196128, WO / 2015 / 196118, WO / 2016 / 011226, WO / 2016 / 011222, WO / 2016 / 011306, WO / 2016 / 014846, WO / 2016 / 022914, WO / 2016 / 036902, WO / 2016 / 077125, or WO / 2016 / 077123, each of which is herein incorporated by reference in its entirety. It is understood that incorporation of a chemically modified nucleotide into a polynucleotide can result in the modification being incorporated into a nucleobase, the backbone, or both, depending on the location of the modification in the nucleotide. In some embodiments, the backbone modification is one provided in EP 2813570, which is herein incorporated by reference in its entirety. In some embodiments, the modified cap is one provided in US Pat. Pub. No. 20050287539, which is herein incorporated by reference in its entirety.

[0487] In some embodiments, the chemically modified nucleic acid (e.g., RNA, e.g., mRNA) comprises one or more of ARCA: anti-reverse cap analog (m27.3 '-OGP3G), GP3G (Unmethylated Cap Analog), m7GP3G (Monomethylated Cap Analog). m32.2.7GP3G (Trimethylated Cap Analog), m5CTP (5 - methyl-cytidine triphosphate), m6ATP (N6-methyl-adenosine-5 -triphosphate), s2UTP (2-thio-uridine triphosphate), Cap 1 (m7GpppN2omeN), and T (pseudouridine triphosphate).

[0488] In some embodiments, the chemically modified nucleic acid comprises a 5' cap, e.g.: a 7- methylguanosine cap (e.g., a 0-Me-m7G cap); a hypermethylated cap analog; an NAD+-derived cap analog (e.g.. as described in Kiledjian. Trends in Cell Biology 28, 454-464 (2018)); or a modified, e.g., biotinylated, cap analog (e.g., as described in Bednarek et al., Phil Trans R Soc B 373, 20180167 (2018)).

[0489] In some embodiments, the chemically modified nucleic acid comprises a 3 ' feature selected from one or more of: a polyA tail; a 16-nucleotide long stem -loop structure flanked by unpaired 5 nucleotides (e.g., as described by Mannironi ct al., Nucleic Acid Research 17, 9113-9126 (1989)); a triple-helical structure (e.g., as described by Brown et al., PNAS 109, 19202-19207 (2012)); a tRNA, Y RNA, or vault RNA structure (e.g., as described by Labno et al., Biochemica et Biophysica Acta 1863, 3125-3147 (2016)); incorporation of one or more deoxyribonucleotide triphosphates (dNTPs), 2’0-Methylated NTPs, or phosphorothioate-NTPs; a single nucleotide chemical modification (e.g., oxidation of the 3' terminal ribose to a reactive aldehyde followed by conjugation of the aldehyde-reactive modified nucleotide); or chemical ligation to another nucleic acid molecule.

[0490] In some embodiments, the nucleic acid (e.g., template nucleic acid) comprises one or more modified nucleotides, e.g., selected from dihydrouridine, inosine, 7-methylguanosine, 5-mcthylcytidinc (5mC), 5' Phosphate ribothymidine. 2'-O-methyl ribothymidine, 2'-O-ethyl ribothymidine, 2'-fluoro ribothymidine, C-5 propynyl-dcoxycytidinc (pdC), C-5 propynyl-deoxyuridine (pdU), C-5 propynyl- cytidine (pC), C-5 propynyl-uridine (pU), 5-methyl cytidine, 5-methyl uridine, 5-methyl deoxy cytidine, 5-methyl deoxyuridine methoxy, 2,6-diaminopurine, 5'-Dimethoxytrityl-N4-ethyl-2'-deoxycytidine. C-5 propynyl-f-cytidine (pfC). C-5 propynyl-f-uridine (pfU), 5-methyl f-cytidine, 5-methyl f-uridine, C-5 propynyl-m-cytidine (pmC), C-5 propynyl-f-uridine (pmU), 5-methyl m-cytidine, 5-methyl m-uridine, LNA (locked nucleic acid), MGB (minor groove binder) pseudouridine (T), 1-N-methylpseudouridine (1- Me-T). or 5 -methoxyuridine (5-MO-U).

[0491] In some embodiments, the nucleic acid comprises a backbone modification, e g., a modification to a sugar or phosphate group in the backbone. In some embodiments, the nucleic acid comprises a nucleobase modification.

[0492] In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides of Table 13, one or more chemical backbone modifications of Table 14, one or more chemically modified caps of Table 15. For instance, in some embodiments, the nucleic acid comprises tw o or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 or more) different types of chemical modifications. As an example, the nucleic acid may comprise two or more (e.g., 3, 4, 5, 6, 7, 8, 9. or 10 or more) different types of modified nucleobases. e.g.. as described herein, e.g., in Table 13. Alternatively or in combination, the nucleic acid may comprise two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 or more) different types of backbone modifications, e.g., as described herein, e.g., in Table 14. Alternatively or in combination, the nucleic acid may comprise one or more modified cap, e.g., as described herein, e.g., in Table 15. For instance, in some embodiments, the nucleic acid comprises one or more type of modified nucleobase and one or more type of backbone modification; one or more type of modified nucleobase and one or more modified cap; one or more type of modified cap and one or more type of backbone modification; or one or more type of modified nucleobase, one or more type of backbone modification, and one or more type of modified cap.

[0493] In some embodiments, the nucleic acid comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, or more) modified nucleobases. In some embodiments, all nucleobases of tire nucleic acid are modified. In some embodiments, the nucleic acid is modified at one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, or more) positions in the backbone. In some embodiments, all backbone positions of the nucleic acid are modified. Table 13. Modified nucleotides Table 14. Backbone modifications

[0494] Table 15. Modified caps The nucleotides comprising the template of the gene modifying system can be natural or modified bases, or a combination thereof. For example, the template may contain pseudouridine, dihydrouridine, inosine, 7-methylguanosine, or other modified bases. In some embodiments, the template may contain locked nucleic acid nucleotides. In some embodiments, the modified bases used in the template do not inhibit the reverse transcription of the template. In some embodiments, the modified bases used in the template may improve reverse transcription, e.g., specificity or fidelity.

[0495] In some embodiments, an RNA component of the system (e.g., a template RNA or a gRNA) comprises one or more nucleotide modifications. In some embodiments, the modification pattern of a gRNA can significantly affect in vivo activity compared to unmodified or end -modified guides (e.g., as shown in Figure ID from Finn et al. Cell Rep 22(9):2227-2235 (2018); incorporated herein by reference in its entirety). Without wishing to be bound by theory, this process may be due, at least in part, to a stabilization of the RNA conferred by the modifications. Non-limiting examples of such modifications may include 2'-O-methyl (2'-O-Me). 2'-0-(2-methoxyethyl) (2 -O-MOE). 2'- fluoro (2'-F), phosphorothioate (PS) bond between nucleotides, G-C substitutions, and inverted abasic linkages between nucleotides and equivalents thereof.

[0496] In some embodiments, the template RNA (e.g., at the portion thereof that binds a target site) or the guide RNA comprises a 5' tenninus region. In some embodiments, the template RNA or the guide RNA does not comprise a 5 ' terminus region. In some embodiments, the 5 ' terminus region comprises a gRNA spacer region, e.g.. as described with respect to sgRNA in Briner AE et al, Molecular Cell 56: 333- 339 (2014) (incorporated herein by reference in its entirety; applicable herein, e.g., to all guide RNAs). In some embodiments, the 5' terminus region comprises a 5' end modification. In some embodiments, a 5' terminus region with or without a spacer region may be associated with a crRNA, trRNA, sgRNA and / or dgRNA. The gRNA spacer region can, in some instances, comprise a guide region, guide domain, or targeting domain.

[0497] In some embodiments, the template RNAs (e.g.. at the portion thereof that binds a target site) or guide RNAs described herein comprises any of the sequences shown in Table 4 of W02018107028A1, incorporated herein by reference in its entirety. In some embodiments, where a sequence shows a guide and / or spacer region, the composition may comprise this region or not. In some embodiments, a guide RNA comprises one or more of the modifications of any of the sequences shown in Table 4 of W02018107028A1, e.g., as identified therein by a SEQ ID NO. In embodiments, the nucleotides may be the same or different, and / or the modification pattern shown may be the same or similar to a modification pattern of a guide sequence as shown in Table 4 of W02018107028A1. In some embodiments, a modification pattern includes the relative position and identity of modifications of the gRNA or a region of the gRNA (e.g. 5' tenninus region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region, hairpin 2 region, 3' tenninus region). In some embodiments, the modification pattern contains at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%. 97%. 98%, 99%, or 100% of the modifications of any one of the sequences shown in the sequence column of Table 4 of W02018107028A1, and / or over one or more regions of the sequence. In some embodiments, the modification pattern is at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to tire modification pattern of any one of the sequences shown in the sequence column of Table 4 of W02018107028A1. In some embodiments, the modification pattern is at least 50%, 55%, 60%, 70%, 75%, 80%, 85%. 90%. 95%. 96%. 97%, 98%, 99%, or 100% identical over one or more regions ofthe sequence shown in Table 4 of W020I8107028AI, e.g., in a 5 ' terminus region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region, hairpin 2 region, and / or 3 ' terminus region. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the modification pattern of a sequence over the 5 ' tenninus region. In some embodiments, the modification pattern is least 50%. 55%, 60%, 70%, 75%, 80%, 85%, 90%. 95%. 96%. 97%. 98%. 99%, or 100% identical over the lower stem. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the bulge. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the upper stem. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%. 97%. 98%. 99%, or 100% identical over the nexus. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%. 95%. 96%. 97%. 98%. 99%, or 100% identical over the hairpin 1. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the hairpin 2. In some embodiments, the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. or 100% identical over the 3 ' tenninus. In some embodiments, the modification pattern differs from the modification pattern of a sequence of Table 4 of W02018107028A1. or a region (e.g. 5' terminus, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2, 3' terminus) of such a sequence, e.g., at 0, 1, 2, 3, 4, 5, 6, or more nucleotides. In some embodiments, the gRNA comprises modifications that differ from the modifications of a sequence of Table 4 of W02018107028A1, e.g., at 0, 1, 2, 3, 4, 5, 6, or more nucleotides. In some embodiments, the gRNA comprises modifications that differ from modifications of a region (e.g. 51tenninus, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2, 3' terminus) of a sequence of Table 4 of W02018107028A1, e.g.. at 0. 1, 2, 3, 4. 5, 6, or more nucleotides.

[0498] In some embodiments, the template RNAs (e.g., at the portion thereof that binds a target site) or the gRNA comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the gRNA comprises a 2'-O-(2-mcthoxy ethyl) (2'-O-moc) modified nucleotide. In some embodiments, the gRNA comprises a 2'-fluoro (2'- F) modified nucleotide. In some embodiments, the gRNA comprises a phosphorothioate (PS) bond between nucleotides. In some embodiments, the gRNA comprises a 5' end modification, a 3' end modification, or 5' and 3' end modifications. In some embodiments, the 5' end modification comprises a phosphorothioate (PS) bond between nucleotides. In some embodiments, the 5' end modification comprises a 2'-O-methyl (2'-0-Me), 2'-O-(2 -methoxy ethyl) (2'-0-M0E), and / or 2'- fluoro (2'-F) modified nucleotide. In some embodiments, the 5' end modification comprises at least one phosphorothioate (PS) bond and one or more of a 2'-O-methyl (2'-O- Me). 2'-O-(2-methoxyethyl) (2'-O- MOE), and / or 2'-fluoro (2'-F) modified nucleotide. The end modification may comprise a phosphorothioate (PS), 2'-O-methyl (2'-0-Me), 2'-O-(2- methoxyethyl) (2 -0-M0E), and / or 2'-fluoro (2'- F) modification. Equivalent end modifications are also encompassed by embodiments described herein. In some embodiments, the template RNA or gRNA comprises an end modification in combination with a modification of one or more regions of the template RNA or gRNA. Additional exemplary modifications and methods for protecting RNA, e.g.. gRNA. and fonnulae thereof, are described in WO2018126176A1. which is incorporated herein by reference in its entirety.

[0499] In some embodiments, a template RNA described herein comprises three phosphorothioate linkages at the 5’ end and three phosphorothioate linkages at the 3’ end. In some embodiments, a template RNA described herein comprises three 2’-O-mcthyl ribonucleotides at the 5’ end and three 2’-O- methyl ribonucleotides at the 3’ end. In some embodiments, tire 5’ most three nucleotides of the template RNA are 2’-O-methyl ribonucleotides, tire 5?most three intemucleotide linkages of the template RNA are phosphorothioate linkages, the 3’ most three nucleotides of the template RNA are 2’-O-methyl ribonucleotides, and the 3 ’ most three intemucleotide linkages of the template RNA are phosphorothioate linkages. In some embodiments, the template RNA comprises alternating blocks of ribonucleotides and 2’-O-methyl ribonucleotides, for instance, blocks of between 12 and 28 nucleotides in length. In some embodiments, the central portion of the template RNA comprises the alternating blocks and the 5 ' and 3 ’ ends each comprise three 2’-O-methyl ribonucleotides and three phosphorothioate linkages.

[0500] In some embodiments, structure-guided and systematic approaches are used to introduce modifications (e.g., 2'-0Me-RNA, 2'-F-RNA, and PS modifications) to a template RNA or guide RNA, for example, as described in Mir et al. Nat Commun 9:2641 (2018) (incorporated by reference herein in its entirety). In some embodiments, the incorporation of 2'-F-RNAs increases thermal and nuclease stability of RNA:RNA or RNA:DNA duplexes, e.g., while minimally interfering with C3'-endo sugar puckering. In some embodiments, 2'-F may be better tolerated than 2'-OMe at positions where the 2'-OH is important for RNA:DNA duplex stability. In some embodiments, a crRNA comprises one or more modifications that do not reduce Cas9 activity, e.g., CIO, C20, or C21 (fully modified), e.g., as described in Supplementary Table 1 of Mir et al. Nat Commun 9:2641 (2018), incorporated herein by reference in its entirety. In some embodiments, a tracrRNA comprises one or more modifications that do not reduce Cas9 activity, e.g., T2, T6, T7, or T8 (fully modified) of Supplementary Table 1 of Mir et al. Nat Commun 9:2641 (2018). In some embodiments, a crRNA comprises one or more modifications (e.g., as described herein) may be paired with a tracrRNA comprising one or more modifications, e.g., C20 and T2. In some embodiments, a gRNA comprises a chimera, e.g., of a crRNA and a tracrRNA (e.g., Jinek et al. Science 337(6096):816-821 (2012)). In embodiments, modifications from the crRNA and tracrRNA are mapped onto the single-guide chimera, e.g., to produce a modified gRNA with enhanced stability.

[0501] In some embodiments, gRNA molecules may be modified by the addition or subtraction of the naturally occurring structural components, e.g., hairpins. In some embodiments, a gRNA may comprise a gRNA with one or more 3' hairpin elements deleted, e.g., as described in WO2018106727, incorporated herein by reference in its entirety. In some embodiments, a gRNA may contain an added hairpin structure, e.g., an added hairpin structure in the spacer region, which was shown to increase specificity of a CRISPR-Cas system in the teachings of Kocak et al. Nat Biotechnol 37(6):657-666 (2019). Additional modifications, including examples of shortened gRNA and specific modifications improving in vivo activity, can be found in US20190316121, incorporated herein by reference in its entirety.

[0502] In some embodiments, structure-guided and systematic approaches (e.g., as described in Mir et al. Nat Commun 9:2641 (2018); incorporated herein by reference in its entirety) are employed to find modifications for the template RNA. In embodiments, the modifications are identified with the inclusion or exclusion of a guide region of tire template RNA. In some embodiments, a structure of polypeptide bound to template RNA is used to determine non-protein-contacted nucleotides of the RNA that may then be selected for modifications, e.g., with lower risk of disrupting the association of the RNA with the polypeptide. Secondary structures in a template RNA can also be predicted in silico by software tools, e.g., the RNAstructure tool available at ma.urmc.rochester.edu / RNAstructureWeb (Bellaousov et al. Nucleic Acids Res 41:W471-W474 (2013); incorporated by reference herein in its entirety), e.g., to determine secondary structures for selecting modifications, e.g.. hairpins, stems, and / or bulges.

[0503] Production of Compositions and Systems

[0504] As will be appreciated by one of skill, methods of designing and constructing nucleic acid constructs and proteins or polypeptides (such as the systems, constructs and polypeptides described herein) are routine in the art. Generally, recombinant methods may be used. See, in general, Smales & James (Eds ), Therapeutic Proteins: Methods and Protocols (Methods in Molecular Biology), Humana Press (2005); and Crommelin, Sindelar & Meibohm (Eds.), Pharmaceutical Biotechnology: Fundamentals and Applications, Springer (2013). Methods of designing, preparing, evaluating, purifying, and manipulating nucleic acid compositions are described in Green and Sambrook (Eds.), Molecular Cloning: A Laboratory Manual (Fourth Edition). Cold Spring Harbor Laboratory Press (2012). The disclosure provides, in part, a nucleic acid, e.g., vector, encoding a gene modifying polypeptide described herein, a template nucleic acid described herein, or both. In some embodiments, a vector comprises a selective marker, e.g., an antibiotic resistance marker. In some embodiments, the antibiotic resistance marker is a kanamycin resistance marker. In some embodiments, the antibiotic resistance marker does not confer resistance to beta-lactam antibiotics. In some embodiments, the vector does not comprise an ampicillin resistance marker. In some embodiments, the vector comprises a kanamycin resistance marker and does not comprise an ampicillin resistance marker. In some embodiments, a vector encoding a gene modifying polypeptide is integrated into a target cell genome (e.g., upon administration to a target cell, tissue, organ, or subject). In some embodiments, a vector encoding a gene modifying polypeptide is not integrated into a target cell genome (e.g., upon administration to a target cell, tissue, organ, or subject). In some embodiments, a vector encoding a template nucleic acid (e.g., template RNA) is not integrated into a target cell genome (e.g., upon administration to a target cell, tissue, organ, or subject). In some embodiments, if a vector is integrated into a target site in a target cell genome, the selective marker is not integrated into the genome. In some embodiments, if a vector is integrated into a target site in a target cell genome, genes or sequences involved in vector maintenance (e g., plasmid maintenance genes) are not integrated into tire genome. In some embodiments, if a vector is integrated into a target site in a target cell genome, transfer regulating sequences (e.g., inverted terminal repeats, e.g., from an AAV) are not integrated into the genome. In some embodiments, administration of a vector (e.g., encoding a gene modifying polypeptide described herein, a template nucleic acid described herein, or both) to a target cell, tissue, organ, or subject results in integration of a portion of the vector into one or more target sites in the genome(s) of said target cell, tissue, organ, or subject. In some embodiments, less than 99, 95, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 4, 3, 2, or 1% of target sites (e.g.. no target sites) comprising integrated material comprise a selective marker (e.g., an antibiotic resistance gene), a transfer regulating sequence (e.g.. an inverted terminal repeat, e.g., from an AAV), or both from tire vector.

[0505] Exemplary methods for producing a therapeutic pharmaceutical protein or polypeptide described herein involve expression in mammalian cells, although recombinant proteins can also be produced using insect cells, yeast, bacteria, or other cells under control of appropriate promoters. Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, a suitable promoter, and other 5' or 3' flanking non-transcribed sequences, and 5' or 3' non-translated sequences such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and termination sequences. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early promoter, splice, and polyadenylation sites may be used to provide other genetic elements required for expression of a heterologous DNA sequence. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are described in Green & Sambrook, Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor Laboratory Press (2012).

[0506] Various mammalian cell culture systems can be employed to express and manufacture recombinant protein. Examples of mammalian expression systems include CHO, COS, HEK293, HeLA, and BHK cell lines. Processes of host cell culture for production of protein therapeutics are described in Zhou and Kantardjieff (Eds.), Mammalian Cell Cultures for Biologies Manufacturing (Advances in Biochemical Engineering / Biotechnology), Springer (2014). Compositions described herein may include a vector, such as a viral vector, e.g., a lentiviral vector, encoding a recombinant protein. In some embodiments, a vector, e.g., a viral vector, may comprise a nucleic acid encoding a recombinant protein.

[0507] Purification of protein therapeutics is described in Franks, Protein Biotechnology: Isolation, Characterization, and Stabilization, Humana Press (2013); and in Cutler, Protein Purification Protocols (Methods in Molecular Biology), Humana Press (2010).

[0508] The disclosure also provides compositions and methods for the production of template nucleic acid molecules (e.g., template RNAs) with specificity for a gene modifying polypeptide and / or a genomic target site. In an aspect, tire method comprises production of RNA segments including an upstream homology segment, a heterologous object sequence segment, a gene modifying polypeptide binding motif, and a gRNA segment.

[0509] Therapeutic Applications

[0510] In some embodiments, a gene modifying system as described herein can be used to modify a cell (e.g., an animal cell, plant cell, or fungal cell). In some embodiments, a gene modifying system as described herein can be used to modify a mammalian cell (e.g., a human cell). In some embodiments, a gene modifying system as described herein can be used to modify a cell from a livestock animal (e.g., a cow, horse, sheep, goat, pig, llama, alpaca, camel, yak, chicken, duck, goose, or ostrich). In some embodiments, a gene modifying system as described herein can be used as a laboratory tool or a research tool, or used in a laboratory method or research method, e.g., to modify an animal cell, e.g.. a mammalian cell (e.g., a human cell), a plant cell, or a fungal cell.

[0511] By integrating coding genes into a RNA sequence template, tire gene modifying system can address therapeutic needs, for example, by providing expression of a therapeutic transgcnc in individuals with loss-of-function mutations, by replacing gain-of-function mutations with normal transgenes, by providing regulatory sequences to eliminate gain-of-function mutation expression, and / or by controlling the expression of operably linked genes, transgenes and systems thereof. In certain embodiments, the RNA sequence template encodes a promotor region specific to the therapeutic needs of the host cell, for example a tissue specific promotor or enhancer. In still other embodiments, a promotor can be operably linked to a coding sequence.

[0512] Accordingly, provided herein are methods for treating phenylketonuria (PKU) or hyperphenylalaninemia (e.g., mild or severe hyperphenylalaninemia) in a subject in need thereof. In some embodiments, treatment results in amelioration of one or more symptoms associated with PKU or hyperphenylalaninemia.

[0513] In some embodiments, a system herein is used to treat a subject having a mutation in R408 (e.g., R408W).

[0514] In some embodiments, treatment with a system disclosed herein results in correction of the R408W mutation in between about 5-50% (e.g., about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, or about 10%) of cells. In some embodiments, treatment with a system disclosed herein results in correction of the R408W mutation in between about 5-50% (e.g., about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, or about 10%) of DNA from the treated cells.

[0515] In some embodiments, treatment with a gene modifying system described herein results in one or more of:

[0516] (a) an increase in phenylalanine hydroxylase (PAH) activity, efficiency, and / or function;

[0517] (b) a decrease in the concentration of phenylalanine in the blood and / or cerebrospinal fluid;

[0518] (c) increase in the concentration of tyrosine in the blood

[0519] (d) a restoration of normal synthesis of dopamine, norepinephrine, and / or melanin;

[0520] (e) a reduction in ureagenesis; and / or

[0521] (f) an improvement in protein retention and / or Phe utilization as compared to a subject having PKU that has not been treated with a gene modifying system described herein.

[0522] Administration and Delivery

[0523] The compositions and systems described herein may be used in vitro or in vivo. In some embodiments the system or components of the system are delivered to cells (e.g., mammalian cells, e.g., human cells), e g., in vitro or in vivo. In some embodiments, the cells are eukaryotic cells, e.g., cells of a multicellular organism, e.g., an animal, e.g., a mammal (e.g., human, swine, bovine), a bird (e.g., poultry, such as chicken, turkey, or duck), or a fish. In some embodiments, the cells arc non-human animal cells (e.g., a laboratory animal, a livestock animal, or a companion animal). In some embodiments, the cell is a stem cell (e.g., a hematopoietic stem cell), a fibroblast, or a T cell. In some embodiments, the cell is an immune cell, e.g., a T cell (e.g., a Treg, CD4, CD8, y5, or memory T cell), B cell (e.g., memory B cell or plasma cell), or NK cell. In some embodiments, the cell is a non-dividing cell, e g., a non-dividing fibroblast or non-dividing T cell. In some embodiments, the cell is an HSC and p53 is not upregulated or is upregulated by less than 10%, 5%, 2%, or 1%, e.g., as determined according to the method described in Example 30 of PCT / US2019 / 048607. The skilled artisan will understand that the components of the gene modifying system may be delivered in tire fonn of polypeptide, nucleic acid (e.g., DNA, RNA), and combinations thereof.

[0524] In one embodiment the system and / or components of the system are delivered as nucleic acid. For example, the gene modifying polypeptide may be delivered in the form of a DNA or RNA encoding the polypeptide, and the template RNA may be delivered in the form of RNA or its complementary DNA to be transcribed into RNA. In some embodiments the system or components of the system are delivered on 1, 2, 3, 4, or more distinct nucleic acid molecules. In some embodiments the system or components of the system are delivered as a combination of DNA and RNA. In some embodiments the system or components of the system are delivered as a combination of DNA and protein. In some embodiments the system or components of the system are delivered as a combination of RNA and protein. In some embodiments the gene modifying polypeptide is delivered as a protein.

[0525] In some embodiments the system or components of the system are delivered to cells, e.g. mammalian cells or human cells, using a vector. The vector may be, e.g., a plasmid or a virus. In some embodiments, delivery is in vivo, in vitro, ex vivo, or in situ. In some embodiments the virus is an adeno associated virus (AAV), a lentivirus, or an adenovirus. In some embodiments the system or components of the system are delivered to cells with a viral-like particle or a virosome. In some embodiments the delivery uses more than one virus, viral-like particle, or virosome.

[0526] In one embodiment, the compositions and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes may be anionic, neutral, or cationic. Liposomes are biocompatible, nontoxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood brain barrier (BBB) (see, e.g., Spuch and Navarro, Journal of Drug Delivery , vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155 / 2011 / 469679 for review).

[0527] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparation of multilamellar vesicle lipids are known in the art (see for example U.S. Pat. No. 6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). Although vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited byapplying force in the fonn of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see. e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10. 1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which relating to extruded lipid preparation are incorporated herein by reference.

[0528] A variety of nanoparticles can be used for delivery, such as a liposome, a lipid nanoparticle, a cationic lipid nanoparticle, an ionizable lipid nanoparticle, a polymeric nanoparticle, a gold nanoparticle, a dendrimer, a cyclodextrin nanoparticle, a micelle, or a combination of the foregoing.

[0529] Lipid nanoparticles are an example of a carrier that provides a biocompatible and biodegradable deli very system for the pharmaceutical compositions described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the characteristics of the SLN, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a type of carrier that combines liposomes and polymers, may also be employed. These nanoparticles possess the complementary advantages of PNPs and liposomes. A PLN is composed of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell offers good biocompatibility. As such, the two components increase the drug encapsulation efficiency rate, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, e.g., Li et al. 2017. Nanomaterials 7, 122; doi: 10.3390 / nano7060122.

[0530] Exosomes can also be used as drug delivery vehicles for the compositions and systems described herein. For a review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; doi.org / 10.1016 / j.apsb.2016.02.001.

[0531] Fusosomes interact and fuse with target cells, and thus can be used as delivery’ vehicles for a variety of molecules. They generally consist of a bilayer of amphipathic lipids enclosing a lumen or cavity and a fusogen that interacts with the amphipathic lipid bilayer. The fusogen component has been shown to be engineerable in order to confer target cell specificity for the fusion and payload delivery, allowing the creation of delivery' vehicles with programmable cell specificity (see for example Patent Application W02020014209, the teachings of which relating to fusosome design, preparation, and usage are incorporated herein by reference).

[0532] In some embodiments, the protein component) s) of the gene modifying system may be pre- associated with the template nucleic acid (e.g., template RNA). For example, in some embodiments, the gene modifying polypeptide may be first combined with the template nucleic acid (e.g., template RNA) to form a ribonuclcoprotcin (RNP) complex. In some embodiments, the RNP may be delivered to cells via, e.g., transfection, nucleofection, virus, vesicle, LNP, exosome, fusosome. A gene modifying system can be introduced into cells, tissues and multicellular organisms. In some embodiments the system or components of the system are delivered to the cells via mechanical means or physical means.

[0533] Formulation of protein therapeutics is described in Meyer (Ed.), Therapeutic Protein Drug Products : Practical Approaches to formulation in the Laboratory, Manufacturing, and the Clinic. Woodhead Publishing Series (2012).

[0534] Tissue Specific Activity Administration

[0535] In some embodiments, a system described herein can make use of one or more feature (e.g., a promoter or microRNA binding site) to limit activity in off-target cells or tissues.

[0536] In some embodiments, a nucleic acid described herein (e.g.. a template RNA or a DNA encoding a template RNA) comprises a promoter sequence, e.g., a tissue specific promoter sequence. In some embodiments, the tissue-specific promoter is used to increase the target-cell specificity of a gene modifying system. For instance, the promoter can be chosen on the basis that it is active in a target cell type but not active in (or active at a lower level in) a non-target cell type. Thus, even if the promoter integrated into the genome of a non-target cell, it would not drive expression (or only drive low level expression) of an integrated gene. A system having a tissue-specific promoter sequence in the template RNA may also be used in combination with a microRNA binding site, e.g., in the template RNA or a nucleic acid encoding a gene modifying protein, e.g., as described herein. A system having a tissue- specific promoter sequence in the template RNA may also be used in combination with a DNA encoding a gene modifying polypeptide, driven by a tissue-specific promoter, e.g., to achieve higher levels of gene modifying protein in target cells than in non-target cells. In some embodiments, e.g., for liver indications, a tissue-specific promoter is selected from Table 3 of W02020014209, incorporated herein by reference.

[0537] In some embodiments, a nucleic acid described herein (e.g., a template RNA or a DNA encoding a template RNA) comprises a microRNA binding site. In some embodiments, the microRNA binding site is used to increase the target-cell specificity of a gene modify ing system. For instance, the microRNA binding site can be chosen on the basis that is recognized by a miRNA that is present in a non-target cell type, but that is not present (or is present at a reduced level relative to the non-target cell) in a target cell type. Thus, when the template RNA is present in a non-target cell, it would be bound by the miRNA, and when the template RNA is present in a target cell, it would not be bound by the miRNA (or bound but at reduced levels relative to the non-target cell). While not wishing to be bound by theory, binding of the miRNA to the template RNA may interfere with its activity, e.g., may interfere with insertion of the heterologous object sequence into the genome. Accordingly, the system would edit the genome of target cells more efficiently than it edits the genome of non-target cells, e.g.. the heterologous object sequence would be inserted into the genome of target cells more efficiently than into the genome of non-target cells, or an insertion or deletion is produced more efficiently in target cells than in non-target cells. A system having a microRNA binding site in the template RNA (or DNA encoding it) may also be used in combination with a nucleic acid encoding a gene modifying polypeptide, wherein expression of the gene modifying polypeptide is regulated by a second microRNA binding site, e.g., as described herein. In some embodiments, e.g., for liver indications, a miRNA is selected from Table 4 of W02020014209, incorporated herein by reference.

[0538] In some embodiments, the template RNA comprises a microRNA sequence, an siRNA sequence, a guide RNA sequence, or a piwi RNA sequence.

[0539] Promoters

[0540] In some embodiments, one or more promoter or enhancer elements are operably linked to a nucleic acid encoding a gene modifying protein or a template nucleic acid, e.g., that controls expression of tire heterologous object sequence. In certain embodiments, the one or more promoter or enhancer elements comprise cell-type or tissue specific elements. In some embodiments, the promoter or enhancer is the same or derived from the promoter or enhancer that naturally controls expression of the heterologous object sequence. For example, the ornithine transcarbomylase promoter and enhancer may be used to control expression of the ornithine transcarbomylase gene in a system or method provided by the invention for correcting ornithine transcarbomylase deficiencies. In some embodiments, the promoter is a promoter of Table 16 or 17 or a functional fragment or variant thereof.

[0541] Exemplary tissue specific promoters that are commercially available can be found, for example, at a unifonn resource locator (e.g., invivogen.com / tissue-specific-promoters). In some embodiments, a promoter is a native promoter or a minimal promoter, e.g., which consists of a single fragment from the 5 ' region of a given gene In some embodiments, a native promoter comprises a core promoter and its natural 5’ UTR. In some embodiments, the 5 ‘ UTR comprises an intron. In other embodiments, these include composite promoters, which combine promoter elements of different origins or were generated by assembling a distal enhancer with a minimal promoter of the same origin.

[0542] Exemplary cell or tissue specific promoters are provided in the tables, below, and exemplary nucleic acid sequences encoding them are known in the art and can be readily accessed using a variety of resources, such as the NCBI database, including RefSeq, as well as the Eukaryotic Promoter Database ( / / epd . epfl .ch / 7index .php) . Table 16. Exemplary cell or tissue-specific promoters

[0543] Table 17. Additional exemplary cell or tissue-specific promoters Depending on the bost / vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (see e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544; incorporated herein by reference in its entirety).

[0544] In some embodiments, a nucleic acid encoding a gene modifying protein or template nucleic acid is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. The transcriptional control element may. in some embodiment, be functional in either a eukaryotic cell, e.g., a mammalian cell: or a prokaryotic cell (e.g . bacterial or archaeal cell) In some embodiments, a nucleotide sequence encoding a polypeptide is operably linked to multiple control elements, e.g . that allow expression of the nucleotide sequence encoding the polypeptide in both prokaryotic and eukaryotic cells.

[0545] For illustration purposes, examples of spatially restricted promoters include, but are not limited to, neuron -specific promoters, adipocyte-specific promoters, cardiomyocyte-specific promoters, smooth muscle-specific promoters, photoreceptor-specific promoters, etc Neuron -specific spatially' restricted promoters include, but are not limited to. a neuron-specific enolase (NSE) promoter (see, e.g., EMBL HSENO2, X51956); an aromatic amino acid decarboxylase (AADC) promoter, a neurofilament promoter (see. e g., GenBank HUMNFL, 1.-04147); a synapsin promoter (see, e.g., GenBank HUMSYNIB, M55301 ): a thy- 1 promoter (see, e.g., Chen et al . ( 1987) Cell 51 :7-19: and Llewellyn, et al . (2010) Nat. Med 16(10): 1 161-1 166): a serotonin receptor promoter (see, e g., GenBank S62283); a tyrosine hydroxylase promoter (TH) (see. e.g.. Oh et al (2009) Gene Idler 16:437; Sasaoka et al. (1992) Mol. Brain Res. 16:274; Boundy et al. (1998) J. Neurosci. 18:9989; and Kaneda et al . (1991) Neuron 6:583- 594), a GnRH promoter (see, e.g., Radovick et ah (1991) Proc. ?4atl Acad. Sci. USA 38:3402-3406); an L7 promoter (see, e.g., Oberdick et al. ( 1990) Science 248:223-226); a DNMT promoter (see, e.g., Bartge et al. (1988) Proc. Natl. Acad. Sci. USA 85:3648-3652). an enkephalin promoter (see. e.g.. Comb et al. ( 1988) EMBO J. 17:3793-3805): a myelin basic protein (MBP) promoter; a Ca2+-calmoduiin-dependent protein kinase ll-alpha (CamKIIa) promoter (see, e g., Mayford et al. (1996) Proc, Nail . Acad. Sci. USA 93: 13250; and Casanova et al. (2001 ) Genesis 31:37); a CMV enhancer / platelet-denved growth factor-^ promoter (see, e.g., Liu et al. (2004) Gene Therapy 11:52-60). and tine like.

[0546] Adipocyte-specific spatially restricted promoters include, but are not limited to. the aP2 gene promoter / enhaneer. e.g.. a region from -5.4 kb to +21 bp of a human aP2 gene (see. e.g.. Tozzo el al. (1997) Endocrinol 138: 1604; Ross et al ( 1990) Proc Natl. Acad. Sci USA 87:9590; and Pavjani et al. (2005) Nat. Med. 11:797); a glucose transporter-4 (GLUT4) promoter (see, e.g., Knight et al. (2003) Proc. Natl. Acad. Sci. USA 100: 14725); a fatty acid translocase (FAT / CD36) promoter (sec, e.g., Kuriki ct al. (2002.) Biol . Pharm. Bull. 25 : 1476; and Sato et al . (2002) .1 . Biol. Chem. 277 : 15703); a stearoy 1-CoA desaturase- 1 (SCD1) promoter (Tabor et al. (1999) J. Biol. Chem. 274:20603): a leptin promoter (see. e.g., Mason ei al. (1998) Endocrinol. 139: 1013; and Chen et al. (1999) Biochem. Biophys. Res. Comm. 262:187); an adiponectin promoter (see, e.g , Kita et al. (2005) Biochem. Biophys. Res. Comm. 331:484; and Chakrabarti (2010) Endocrinol. 151 : 2408); an adipsin promoter (see. e.g., Plat et al. (1989) Proc. Natl. Acad. Sci. USA 86:7490); a resistin promoter (see, e.g.. Seo et al. (2003) Molec Endocrinol. 17: 1522), and the like.

[0547] Cardiomyocyte-specific spatially restricted promoters include, but are not limited to, control sequences derived from the following genes: myosin light chain-?., a-myosin heavy chain, AE3, cardiac troponin C, cardiac actin, and the like. Franz et al. (1997) Cardiovasc. Res. 35:560-566; Robbins et al (1995) Ann. N.Y. .Acad. Sci. 752:492-505; Linn et al. (1995) Circ. Res. 76.584-591; Pannacek et al. (1994) Mol. Cell. Biol. 14.1870-1885; Hunter et al. (1993) Hypertension 22:608-617; and Sartorelli et ai. ( 1992) Proc. Natl. Acad Ser USA 89:4047-4051.

[0548] Smooth muscle-specific spatially restricted promoters include, but are not limited to. an SM22a promoter (see, e g , Akyiirek et al (2000) Mol Med. 6:983; and U S. Pat. No. 7,169,874); a smootbelin promoter (see, e.g., WO 2001 / 018048); an a-smooth muscle actin promoter; and the like. For example, a 0.4 kb region of the SM22a promoter, within which lie two CArG elements, has been shown to mediate vascular smooth muscle cell-specific expression (see, e.g., Kim, et al. (1997) Mol. Cell. Biol. 17, 2266- 2278; Li, et al., ( 1996) J Cell Biol. 132. 849-859; and Moessler, et ai. ( 1996) Development 122, 2415- 2425).

[0549] Photoreceptor-specific spatially restricted promoters include, but are not limited to. a rhodopsin promoter; a rhodopsin kmase promoter (Young et al. (2003) Ophthalmol. Vis. Sci. 44:4076); a beta phosphodiesterase gene promoter (Nicoud et al . (2007) J. Gene Med. 9: 1015); a retinitis pigmentosa gene promoter (Nicoud et al. (20071 supra): an interphotoreceptor retinoid-binding protein (IRBP) gene enhancer (Nicoud et al. (2007) supra): an IRBP gene promoter (Yokoyama et al. (1992) Exp Eye Res. 55:225); and the like

[0550] In some embodiments, a gene modifying system, e.g., DNA encoding a gene modifying polypeptide, DNA encoding a template RNA, or DNA or RNA encoding a heterologous object sequence, is designed such that one or more elements is operably linked to a tissue-specific promoter, e.g.. a promoter that is active in T-cells. In further embodiments, the T-cell active promoter is inactive in other cell types, e.g., B-cells, NK cells. In some embodiments, the T-cell active promoter is derived from a promoter for a gene encoding a component of the T-cell receptor, e.g, TRAC, TRBC, TRGC, TRDC. In some embodiments, the T-cell active promoter is derived from a promoter for a gene encoding a component of a T-ccll-spccific cluster of differentiation protein, e.g., CD3, e.g., CD3D, CD3E, CD3G, CD3Z. In some embodiments, T-cell -specific promoters in gene modifying systems are discovered by comparing publicly available gene expression data across cell types and selecting promoters from the genes with enhanced expression in T-cells. In some embodiments, promoters may be selecting depending on the desired expression breadth, e.g., promoters that are active in T-cells only, promoters that are active in NK cells only, promoters that are active in both T-cells and NK cells.

[0551] Cell-specific promoters known in the art may be used to direct expression of a gene modifying protein, e.g., as described herein. Nonlimiting exemplary mammalian cell-specific promoters have been characterized and used in mice expressing Cre recombinase in a cell-specific manner. Certain nonlimiting exemplary mammalian cell-specific promoters are listed in Table 1 of US9845481, incorporated herein by reference .

[0552] In some embodiments, a vector as described herein comprises an expression cassete. Typically, an expression cassette comprises the nucleic acid molecule of die instant invention operatively linked to a promoter sequence. For example, a promoter is operatively linked with a coding sequence when it is capable of affecting the expression of that coding sequence (e.g.. the coding sequence is under the transcriptional control of the promoter). Encoding sequences can be operatively linked to regulatory sequences in sense or antisense orientation. In certain embodiments, the promoter is a heterologous promoter. In certain embodiments, an expression cassette may comprise additional elements, for example, an intron, an enhancer, a polyadenylation site, a woodchuck response element (WRE). and / or other elements known to affect, expression levels of the encoding sequence. A promoter typically controls the expression of a coding sequence or functional RNA. In certain embodiments, a promoter sequence comprises proximal and more distal upstream elements and can further comprise an enhancer element. An enhancer can typical ly stimu late promoter acti vity7and may7be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. In certain embodiments, the promoter is derived in iis entirety from a native gene. In certain embodiments, the promoter is composed of different elements derived from different naturally occurring promoters, in certain embodiments, the promoter comprises a synthetic nucleotide sequence It will be understood by those skilled in the art that different promoters will direct the expression of a gene in differen t tissues or cell types, or at different stages of development, or in response to different environmental conditions or to the presence or the absence of a drug or transcriptional co-factor. Ubiquitous, cell-type-specific, tissue- specific, developmental stage-specific, and conditional promoters, for example, drug-responsive promoters (e g., tetracycline-responsive promoters) are well known to those of skill in the art. Exemplary promoters include, but are not limited to, the phosphoglycerate kinase (PKG) promoter, CAG (composite of the CMV enhancer the chicken beta actin promoter (CBA) and the rabbit beta globin intron). NSE (neuronal specific enolase), synapsin or NcuN promoters, the SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP). a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), SFFV promoter, rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. Other promoters can be of human origin or from other species, including from mice. Common promoters include, e.g., the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, (he Rous sarcoma virus long terminal repeat, [beta]- actin, rat insulin promoter, the phosphoglycerate kinase promoter, the human alpha-1 antirtypsin (hAAT) promoter, the transthyretin promoter, the TBG promoter and other liver-specific promoters, the desmin promoter and similar muscle- specific promoters, the F.F1 -alpha promoter, hybrid promoters with multi-tissue specificity, promoters specific for neurons like synapsin and glyceraldebyde-3 -phosphate dehydrogenase promoter, all of which are promoters well known and readily available to those of skill in the ait, can be used to obtain high-level expression of the coding sequence of interest. In addition, sequences derived from non-viral genes, such as the murine metallothionein gene, will also find use herein. Such promoter sequences are commercially available from. e.g.. Stratagene (San Diego, CA). Additional exemplary’ promoter sequences are described, for example, in WO2018213786A1 (incorporated by reference herein in its entirety ).

[0553] In some embodiments, the apolipoprotein E enhancer (ApoE) or a functional fragment thereof is used, e.g., to drive expression in the liver. In some embodiments, two copies of the ApoE enhancer or a functional fragment thereof are used. In some embodiments, the ApoE enhancer or functional fragment thereof is used in combination with a promoter, e.g.. the human alpha- 1 antitrypsin (hAAT) promoter.

[0554] In some embodiments, the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Various tissue-specific regulatory’ sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited io, the following tissue-specific promoters: a liver-specific thyroxin binding globulin (TBG) promoter, a insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin- 1 (Syn) promoter, a creatine kinase (MCK.) promoter, a mammalian desmin (DES) promoter, a a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B vims core promoter. Sandig et al.. Gene Thor., 3: 1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et ah. Hum. Gene Ther., 7: 1503-14 (1996)). bone osteocalcin promoter (Stem et al., Mol. Biol. Rep.. 24: 185-96 ( 1997)); bone sialoprotein promoter (Chen et al.. J. Bone Miner. Res.. 11:654-64 (1996;). CD2 promoter (Hansal et al , J. Immunol., 161: 1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor en- chain promoter, neuronal such as neuron -specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Ncurobioi., 13:503-15 (1993)), ncurofilamcnt light-chain gene promoter (Piccioli ci al., Proc. Natl. Acad. Sei. USA, 88:561 1-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al.. Neuron, 15:373- 84 (1995))., and others. Additional exemplars' promoter sequences are described, for example, in U.S. Patent No. 10300146 (incorporated herein by reference in its entirety). In some embodiments, a tissue" specific regulatory element, e.g., a tissue-specific promoter, is selected from one known to be operably linked to a gene that is highly expressed in a given tissue, e.g.. as measured by RNA-seq or protein expression data, or a combination thereof. Methods for analyzing tissue specificity by expression are taught in Fagerberg et al Mol Cell Proteomics 13(2): 397-406 (2014), which is incorporated herein by reference in its entirety.

[0555] In some embodiments, a vector described herein is a multicistronic expression construct. Multi ci stronic expression constructs include, for example, constructs harboring a first expression cassette, e.g. comprising a first promoter and a first encoding nucleic acid sequence, and a second expression cassete, e.g. comprising a second promoter and a second encoding nucleic acid sequence. Such multicistronic expression constructs may, in some instances, be particularly usefill in the delivery' of non- translated gene products, such as hairpin RNAs, together with a polypeptide, for example, a gene modifying polypeptide and gene modifying template. In some embodiments, multicistronic expression constructs may exhibit reduced expression levels of one or more of the included transgenes, for example, because of promoter interference or the presence of incompatible nucleic acid elements in close proximity. If a multicistronic expression construct is part, of a viral vector, the presence of a self- complementary' nucleic acid sequence may, in some instances, interfere w ith the formation of structures necessary for viral reproduction or packaging.

[0556] In some embodiments, the sequence encodes an RNA with a hairpin. In some embodiments, the hairpin RNA is a guide RNA, a template RNA, a shRN A, or a microRNA In some embodiments, the first promoter is an RNA polymerase I promoter. In some embodiments, the first promoter is an RNA polymerase II promoter. In some embodiments, the second promoter is an RNA polymerase HI promoter. In some embodiments, the second promoter is a Li 6 or Hl promoter.

[0557] Without wishing to be bound by theory, multicistronic expression constructs may not achieve optimal expression levels as compared to expression systems containing only one cistron. One of t.be suggested causes of lower expression levels achieved with multicistronic expression constructs comprising two or more promoter elements is the phenomenon of promoter interference (see, e.g.. Curtin .1 A, Dane A P, Swanson A. Alexander 1 E, Ginn S L. Bidirectional promoter interference between two widely used internal heterologous promoters in a late -gene ration lentiviral construct. Gene Ther. 2008 March; 15(5): 384-90; and Martin-Duque P, Jezzard S, Kaftansis L, Vassaux G Direct comparison of the insulating properties of two genetic elements in an adenoviral vector containing two different expression cassettes. Hum Gene Thor. 2004 October; 15( 10): 995- 1002, both references incorporated herein by reference for disclosure of promoter interference phenomenon). In some embodiments, the problem of promoter interference may be overcome, e.g , by producing mukicistronic expression constructs comprising only one promoter dri ving transcription of multiple encoding nucleic acid sequences separated by internal ribosomal entry sites, or by separating cistrons comprising their own promoter with transcriptional insulator elements. In some embodiments, single-promoter driven expression of multiple cistrons may result in uneven expression levels of the cistrons. In some embodiments, a promoter cannot efficiently be isolated and isolation elements may not be compatible with some gene transfer vectors, for example, some retroviral vectors.

[0558] MicroRNAs

[0559] MicroRNAs (miRNAs) and other small interfering nucleic acids generally regulate gene expression via target RNA transcript cleavage / degradation or translational repression of the target messenger RNA (raRNA). miRNAs may, in some instances, be natively expressed, typically as final 19- 25 non-translated RNA products. miRNAs generally exhibit their activity through sequence-specific interactions with the 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs may form hairpin precursors that are subsequently processed into an miRNA duplex, and further mto a mature single stranded miRNA molecule This mature miRNA generally guides a multiprotein complex, miRISC, which identifies target 3 UTR regions of target mRNAs based upon their complementarity to the mature miRNA. Useful transgene products may include, for example, miRNAs or miRNA binding sites that regulate the expression of a linked polypeptide. A non-limiting list of miRNA genes: the products of these genes and their homologues are useful as iransgenes or as targets for small interfering nucleic acids (e g., miRNA sponges, antisense oligonucleotides), e.g.. in methods such as those listed in US 10300146, 22'25-25:48, are herein incorporated by reference. In some embodiments, one or more binding sites for one or more of the foregoing miRNAs are incorporated in a transgene, e.g., a trausgene delivered by a rAAV vector, e.g., to inhibit the expression of the transgene in one or more tissues of an animal harboring the transgene. In some embodiments, a binding site may be selected to control die expression of a trausgene m a tissue specific manner. For example, binding sites for the liver- specific miR-122 may be incorporated into a transgene to inhibit expression of that transgene in the liver Additional exemplary miRNA sequences are described, for example, in U.S Patent No. 10,300,146 (incorporated herein by reference in its entirety)

[0560] An miR inhibitor or miRNA inhibitor is generally an agent that blocks miRNA expression and / or processing. Examples of such agents include, but are not limited to, microRNA antagonists, microRNA specific antisense, microRNA sponges, and microRNA oligonucleotides (double-stranded, hairpin, short oligonucleotides) that inhibit miRNA interaction with a Drosba complex. MicroRNA inhibitors, e g., miRNA sponges, can be expressed in cells from transgenes (e g., as described in Ebert, M. S. Nature Methods, Epub Aug. 12. 2007; incorporated by reference herein in its entirety). In some embodiments, microRNA sponges, or other miR inhibitors, are used with the A A Vs. microRNA sponges generally specifically inhibit miRNAs through a complementary heptameric seed sequence. In some embodiments, an entire family of miRNAs can be silenced using a single sponge sequence Other methods for silencing raiRNA function (derepression of miRNA targets) in ceils will be apparent to one of ordinary ski ll in the art

[0561] In some embodiments, a gene modifying system, template RNA, or polypeptide described herein is administered to or is active in (e.g., is more active in) a target tissue, e.g., a first tissue. In some embodiments, the gene modifying system, template RNA, or polypeptide is not administered to or is less active in (e.g., not active in) a non-target tissue. In some embodiments, a gene modifying system, template RNA, or polypeptide described herein is useful for modifying DNA in a target tissue, e.g., a first tissue, (e.g., and not modifying DNA in a non-target tissue).

[0562] In some embodiments, a gene modifying system comprises (a) a polypeptide described herein or a nucleic acid encoding the same, (b) a template nucleic acid (e.g., template RNA) described herein, and (c) one or more first tissue-specific expression-control sequences specific to the target tissue, wherein tire one or more first tissue-specific expression-control sequences specific to the target tissue are in operative association with (a), (b). or (a) and (b), wherein, when associated with (a), (a) comprises a nucleic acid encoding the polypeptide.

[0563] In some embodiments, the nucleic acid in (b) comprises RNA.

[0564] In some embodiments, the nucleic acid in (b) comprises DNA.

[0565] In some embodiments, the nucleic acid in (b): (i) is single-stranded or comprises a single-stranded segment, e.g., is single-stranded DNA or comprises a single-stranded segment and one or more double stranded segments; (ii) has inverted terminal repeats; or (iii) both (i) and (ii).

[0566] In some embodiments, the nucleic acid in (b) is double -stranded or comprises a double-stranded segment.

[0567] In some embodiments, (a) comprises a nucleic acid encoding the polypeptide.

[0568] In some embodiments, the nucleic acid in (a) comprises RNA.

[0569] In some embodiments, the nucleic acid in (a) comprises DNA.

[0570] In some embodiments, the nucleic acid in (a): (i) is single-stranded or comprises a single -stranded segment, e.g., is single-stranded DNA or comprises a single-stranded segment and one or more double stranded segments; (ii) has inverted terminal repeats; or (iii) both (i) and (ii).

[0571] In some embodiments, the nucleic acid in (a) is double-stranded or comprises a double-stranded segment.

[0572] In some embodiments, the nucleic acid in (a), (b), or (a) and (b) is linear. In some embodiments, the nucleic acid in (a), (b), or (a) and (b) is circular, e.g., a plasmid or minicircle.

[0573] In some embodiments, the heterologous object sequence is in operative association with a first promoter.

[0574] In some embodiments, the one or more first tissue-specific expression-control sequences comprises a tissue specific promoter.

[0575] In some embodiments, the tissue-specific promoter comprises a first promoter in operative association with: (i) the heterologous object sequence, (ii) a nucleic acid encoding the retroviral RT, or (iii) (i) and (ii).

[0576] In some embodiments, the one or more first tissue-specific expression-control sequences comprises a tissue-specific microRNA recognition sequence in operative association with: (i) the heterologous object sequence, (ii) a nucleic acid encoding the retroviral RT domain, or (iii) (i) and (ii).

[0577] In some embodiments, a system comprises a tissue-specific promoter, and the system further comprises one or more tissue-specific microRNA recognition sequences, wherein: (i) the tissue specific promoter is in operative association with: (I) the heterologous object sequence, (II) a nucleic acid encoding the retroviral RT domain, or (III) (I) and (II); and / or (ii) the one or more tissue-specific microRNA recognition sequences are in operative association with: (I) the heterologous object sequence, (II) a nucleic acid encoding the retroviral RT, or (III) (I) and (II).

[0578] In some embodiments, wherein (a) comprises a nucleic acid encoding the polypeptide, the nucleic acid comprises a promoter in operative association with the nucleic acid encoding the polypeptide.

[0579] In some embodiments, the nucleic acid encoding the polypeptide comprises one or more second tissue-specific expression-control sequences specific to the target tissue in operative association with tire polypeptide coding sequence.

[0580] In some embodiments, the one or more second tissue-specific expression-control sequences comprises a tissue specific promoter.

[0581] In some embodiments, the tissue-specific promoter is the promoter in operative association with the nucleic acid encoding the polypeptide.

[0582] In some embodiments, the one or more second tissue-specific expression-control sequences comprises a tissue-specific microRNA recognition sequence.

[0583] In some embodiments, the promoter in operative association with the nucleic acid encoding the polypeptide is a tissue-specific promoter, the system further comprising one or more tissue-specific microRNA recognition sequences.

[0584] In some embodiments, a nucleic acid component of a sy stem provided by the invention is a sequence (e.g., encoding the polypeptide or comprising a heterologous object sequence) flanked by untranslated regions (UTRs) that modify protein expression levels. Various 5' and 3' UTRs can affect protein expression. For example, in some embodiments, the coding sequence may be preceded by a 5' UTRthat modifies RNA stability or protein translation. In some embodiments, the sequence may be followed by a 3' UTRthat modifies RNA stability or translation. In some embodiments, the sequence may be preceded by a 5 ' UTR and followed by a 3 ' UTR that modify RNA stability or translation. In some embodiments, the 5 ' and / or 3 ' UTR may be selected from the 5 ' and 3 ' UTRs of complement factor 3 (C3) (CACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACC; SEQ ID NO: 11,004) or orosomucoid 1 (0RM1) (CAGGACACAGCCTTGGATCAGGACAGAGACTTGGGGGCCATCCTGCCCCTCCAACCCGACA TGTGTACCTCAGCTTTTTCCCTCACTTGCATCAATAAAGCTTCTGTGTTTGGAACAGCTAA; SEQ ID NO: 11,005) (Asrani et al. RNA Biology 2018). In certain embodiments, the 5' UTR is the 5' UTR from C3 and the 3 ' UTR is the 3 ' UTR from 0RM1. In certain embodiments, a 5 ' UTR and 3 ' UTR for protein expression, e.g., mRNA (or DNA encoding the RNA) for a gene modifying polypeptide or heterologous object sequence, comprise optimized expression sequences. In some embodiments, the 5' UTR comprises GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC (SEQ ID NO: 11,006) and / or the 3 ' UTR comprising UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGA (SEQ ID NO: 11,007), e.g., as described in Richner et al. Cell 168(6): Pl 114-1125 (2017), the sequences of which are incorporated herein by reference. In some embodiments, a 5 ' and / or 3 ' UTR may be selected to enhance protein expression. In some embodiments, a 5 ' and / or 3 ' UTR may be selected to modify protein expression such that overproduction inhibition is minimized. In some embodiments, UTRs are around a coding sequence, e.g.. outside the coding sequence and in other embodiments proximal to the coding sequence. In some embodiments, additional regulatory elements (e.g., miRNA binding sites, cis- rcgulatory sites) are included in the UTRs.

[0585] In some embodiments, an open reading frame of a gene modify ing system, e.g., an ORF of an mRNA (or DNA encoding an mRNA) encoding a gene modifying polypeptide or one or more ORFs of an mRNA (or DNA encoding an mRNA) of a heterologous object sequence, is flanked by a 5 ' and / or 3 ' untranslated region (UTR) that enhances tire expression thereof. In some embodiments, the 5' UTR of an mRNA component (or transcript produced from a DNA component) of the system comprises the sequence 5 GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC-3 ' ; SEQ ID NO: 11,008). In some embodiments, the 3 ' UTR of an mRNA component (or transcript produced from a DNA component) of the system comprises the sequence 5 - UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGA-3 (SEQ ID NO: 11,009). This combination of 5' UTR and 3' UTR has been shown to result in desirable expression of an operably linked ORF by Richner et al. Cell 168(6): Pl 114-1125 (2017), the teachings and sequences of which are incorporated herein by reference. In some embodiments, a system described herein comprises a DNA encoding a transcript, wherein the DNA comprises the corresponding 5 ' UTR and 3 ' UTR sequences, with T substituting for U in the above-listed sequence). In some embodiments, a DNA vector used to produce an RNA component of the system further comprises a promoter upstream of the 5 ' UTR for initiating in vitro transcription, e.g, a T7, T3, or SP6 promoter. The 5' UTR above begins with GGG, which is a suitable start for optimizing transcription using T7 RNA polymerase. For tuning transcription levels and altering the transcription start site nucleotides to fit alternative 5 ' UTRs, the teachings of Davidson et al. Pae Symp Biocomput 433-443 (2010) describe T7 promoter variants, and the methods of discovery thereof, that fulfill both of these traits.

[0586] Viral vectors and components thereof

[0587] Viruses are a useful source of delivery vehicles for the systems described herein, in addition to a source of relevant enzymes or domains as described herein, e.g.. as sources of polymerases and polymerase functions used herein, e.g., DNA-dependent DNA polymerase, RNA-dependent RNA polymerase, RNA-dependent DNA polymerase, DNA-dependent RNA polymerase, reverse transcriptase. Some enzymes, e.g., reverse transcriptases, may have multiple activities, e.g., be capable of both RNA- dependent DNA polymerization and DNA-dependent DNA polymerization, e.g., first and second strand synthesis. In some embodiments, the virus used as a gene modifying delivery system or a source of components thereof may be selected from a group as described by Baltimore Bacteriol Rev 35(3) :235-241 (1971).

[0588] In some embodiments, the vims is selected from a Group I vims, e.g., is a DNA vims and packages dsDNA into virions. In some embodiments, the Group I vims is selected from, e.g., Adenoviruses, Herpesviruses, Poxvimses.

[0589] In some embodiments, the vims is selected from a Group II vims, e.g., is a DNA vims and packages ssDNA into virions. In some embodiments, the Group II vims is selected from, e.g., Parvoviruses. In some embodiments, the parvovirus is a dependoparvovirus, e g., an adeno-associated vims (AAV).

[0590] In some embodiments, the vims is selected from a Group III vims, e.g., is an RNA vims and packages dsRNA into virions. In some embodiments, the Group III vims is selected from, e.g., Reovimses. In some embodiments, one or both strands of the dsRNA contained in such virions is a coding molecule able to serve directly as mRNA upon transduction into a host cell, e.g., can be directly translated into protein upon transduction into a host cell without requiring any intervening nucleic acid replication or polymerization steps.

[0591] In some embodiments, the virus is selected from a Group IV virus, e.g., is an RNA virus and packages ssRNA(+) into virions. In some embodiments, the Group IV virus is selected from, e.g., Coronaviruses, Picomaviruses, Togaviruses. In some embodiments, the ssRNA(+) contained in such virions is a coding molecule able to serve directly as mRNA upon transduction into a host cell, e.g., can be directly translated into protein upon transduction into a host cell without requiring any intervening nucleic acid replication or polymerization steps.

[0592] In some embodiments, the virus is selected from a Group V virus, e.g., is an RNA virus and packages ssRNA(-) into virions. In some embodiments, the Group V virus is selected from, e.g., Orthomyxoviruses, Rhabdoviruses. In some embodiments, an RNA virus with an ssRNA(-) genome also carries an enzyme inside the virion that is transduced to host cells with the viral genome, e.g., an RNA- depen...

Claims

CLAIMS1. A nucleic acid molecule encoding a gene modifying polypeptide, wherein the nucleic acid comprises, e.g., from 5’ to 3’:(a) a 5’ UTR of SEQ ID NO: 41-44, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(b) a region encoding a N-terminal NLS of SEQ ID NO: 36, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(c) a region encoding a Cas domain of SEQ ID NO: 52, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(d) a region encoding a linker of SEQ ID NO: 54, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(e) a region encoding a reverse transcriptase (RT) domain of SEQ ID NO:

56. or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(f) a region encoding a C-terminal NLS of SEQ ID NO: 38, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(g) a 3’ UTR of SEQ ID NO: 45-48. or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(h) optionally, an expression element of SEQ ID NOs:

40. 101, or 102, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and(i) a poly(A) tail of SEQ ID NO: 49-51, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

2. A nucleic acid molecule encoding a gene modifying polypeptide, wherein the nucleic acid comprises, e.g.. from 5’ to 3’:(a) a 5’ UTR of SEQ ID NO: 41-44, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(b) a region encoding a N-terminal NLS of SEQ ID NO: 37, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99%identity thereto;(c) a region encoding a Cas domain of SEQ ID NO: 53, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(d) a region encoding a linker of SEQ ID NO: 55, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(e) a region encoding a reverse transcriptase (RT) domain of SEQ ID NO: 57, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(f) a region encoding a C-terminal NLS of SEQ ID NO: 39, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(g) a 3’ UTR of SEQ ID NO: 45-48, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto;(h) optionally, an expression element of SEQ ID NOs:

40. 101, or 102, or a sequence having at least 90%. 95%. 96%. 97%, 98%, or 99% identity thereto; and(i) a poly(A) tail of SEQ ID NO: 49-51, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

3. Tire nucleic acid molecule of claim 1 or 2, wherein the Cas domain comprises a Cas domain that binds to the target DNA molecule and is heterologous to the RT domain.

4. The nucleic acid molecule of any one of claims 1-3, wherein the nucleic acid molecule is an mRNA.

5. A template RNA comprising:(1) a gRNA spacer;(2) a gRNA scaffold;(3) a heterologous object sequence: and(4) a primer binding site (PBS) sequence; and wherein the template RNA comprises a nucleotide sequence of a template RNA of SEQ ID NO: 15, 17, 92, or 94, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

6. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37638, or a sequence having at least 95%, 97%, 98%, or 99% identity thereto.

7. A template RNA comprising a nucleotide sequence of SEQ ID NO: 37653, or a sequence having at least 95%, 97%, 98%. or 99% identity thereto.

8. A gene modifying system comprising:(a) a template RNA (tgRNA) comprising, from 5’ to 3’:(1) a gRNA spacer;(2) a gRNA scaffold;(3) a heterologous object sequence; and(4) a primer binding site (PBS) sequence; wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and(b) a gene modifying polypeptide, or a nucleic acid encoding the gene modifying polypeptide, the gene modifying poly peptide comprising:(1) a Cas domain;(2) a linker; and(3) a reverse transcriptase (RT) domain; wherein the gene modify ing polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

9. A gene modifying system comprising:(a) a template RNA (tgRNA) comprising, from 5 ’ to 3 ’ :(1) a gRNA spacer having a sequence of a gRNA spacer of a template RNA of Table 1A, El, E1A. E3, E3A. E5. E5A. E7. E7A. E9. E9A, E13, E13A, or X3, or a sequence with no more than 1.

2. or 3 sequence alterations (e.g., substitutions) relative thereto:(2) a gRNA scaffold having a sequence of a gRNA scaffold of the template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sequence alterations relative thereto;(3) a heterologous object sequence having a sequence of a heterologous object sequence of the template RNA of Table 1A, El, E1A, E3, E3A. E5. E5A. E7. E7A. E9. E9A. El 3, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and(4) a primer binding site (PBS) sequence having a sequence of a PBS sequence of tire template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and(b) a gene modifying polypeptide, or a nucleic acid encoding the gene modifying polypeptide, the gene modifying polypeptide comprising:(1) a Cas domain;(2) a linker; and(3) a reverse transcriptase (RT) domain; wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

10. The system of claim 8 or 9, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 95% identity thereto.

11. Tire system of claim 8 or 9, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A. El. E1A. E3. E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A. or X3, or a sequence having at least 97%. 98%, or 99% identity thereto.

12. The system of claim 8 or 9, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3.

13. The system of any one of claims 8-12, wherein tire gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 95% identity thereto.

14. The system of any one of claims 8-12, wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28, or a sequence having at least 99% identity thereto.

15. The system of any one of claims 8-12, wherein the gene modifying polypeptide comprises an amino acid sequence of a gene modifying polypeptide of SEQ ID NO: 28.

16. A gene modifying system comprising:(a) a template RNA (tgRNA) comprising, from 5 ’ to 3 ’ :(1) a gRNA spacer;(2) a gRNA scaffold;(3) a heterologous object sequence: and(4) a primer binding site (PBS) sequence;wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and(b) a nucleic acid (e.g., mRNA) encoding a gene modifying polypeptide comprising:(1) a Cas domain;(2) a linker; and(3) a reverse transcriptase (RT) domain; wherein the nucleotide encoding the gene modifying polypeptide comprises the nucleic acid of any one of claims 1-4.

17. A gene modifying system comprising;(a) a template RNA (tgRNA) comprising, from 5 ’ to 3 ’ :(1) a gRNA spacer;(2) a gRNA scaffold;(3) a heterologous object sequence: and(4) a primer binding site (PBS) sequence; wherein the tgRNA comprises a nucleotide sequence of a template RNA sequence of Table 1A. El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13. E13A, or X3. or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto: and(b) a nucleic acid (e.g., mRNA) encoding a gene modifying polypeptide comprising:(1) a Cas domain;(2) a linker; and(3) a reverse transcriptase (RT) domain: wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or E15, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

18. A gene modifying system comprising:(a) a template RNA (tgRNA) comprising, from 5 ’ to 3 ’ :(1) a gRNA spacer having a sequence of a gRNA spacer of a template RNA of Table 1 A, El , El A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, El 3, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations (e.g., substitutions) relative thereto;(2) a gRNA scaffold having a sequence of a gRNA scaffold of the template RNA of Table 1A, El. E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or asequence with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sequence alterations relative thereto;(3) a heterologous object sequence having a sequence of a heterologous object sequence of tire template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7. E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and(4) a primer binding site (PBS) sequence having a sequence of a PBS sequence of the template RNA of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence with no more than 1, 2, or 3 sequence alterations relative thereto; and(b) a nucleic acid (e g., mRNA) encoding a gene modifying polypeptide comprising:(1) a Cas domain;(2) a linker; and(3) a reverse transcriptase (RT) domain; wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or E15, or a sequence having at least 70%. 75%, 80%, 85%, 90%, 95%. 96%. 97%. 98%, or 99% identity thereto.

19. The system of any one of claims 16-18, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3, or a sequence having at least 95% identify thereto.

20. The system of any one of claims 16-18, wherein the template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A. El. E1A. E3. E3A. E5. E5A. E7. E7A, E9, E9A, E13, E13A. or X3, or a sequence having at least 97%, 98%, or 99% identity thereto.

21. The system of any one of claims 16-18, wherein tire template RNA comprises a nucleotide sequence of a template RNA sequence of Table 1A, El, E1A, E3, E3A, E5, E5A, E7, E7A, E9, E9A, E13, E13A, or X3.

22. The system of any one of claims 16-21, wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or El 5, or a sequence having at least 95% identify thereto.

23. The system of any one of claims 16-21, wherein the nucleotide encoding the gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or El 5, or a sequence having at least 99% identify thereto.

24. The system of any one of claims 16-21, wherein the nucleotide encoding tire gene modifying polypeptide comprises a nucleic acid sequence of a gene modifying polypeptide of Table N2, El 1, or E15.

25. The system of any one of claims 16-24, further comprising a second nick RNA (ngRNA) that directs a second nick to the second strand of the human PAH gene.

26. The system of claim 25, wherein the ngRNA comprises a sequence of an ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, El 4, or EMA, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

27. The system of claim 25, wherein tire ngRNA comprises, from 5' to 3’:(1) a gRNA spacer having the sequence of a gRNA spacer of a ngRNA of Table 2A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA, or a sequence with no more than 1, 2, or 3 sequence alterations (e.g., substitutions) relative thereto; and(2) a gRNA scaffold having a sequence of a gRNA scaffold of the ngRNA of Table 2 A, E2, E2A, E4, E4A, E6, E6A, E8, E8A, E10, E10A, E14, or EMA or a sequence with no more than 1, 2, 3, 4. 5, 6, 7, 8. 9, or 10 sequence alterations relative thereto.

28. The system of any one of claims 25-27, wherein the ngRNA has a "PAM-m orientation” with the template RNA of the gene modifying system.

29. The system of any one of claims 8-28, wherein the nucleic acid encoding the gene modifying polypeptide comprises RNA, e.g., mRNA.

30. The nucleic acid molecule of any one of claims 1-4 or the template RNA of claim 5-7. wherein the nucleic acid molecule is formulated in a lipid nanoparticle (LNP).

31. The system of any one of claims 8-29, wherein the tgRNA, nucleic acid molecule encoding the gene modifying polypeptide, and / or the ngRNA are formulated in an LNP.

32. A pharmaceutical composition, comprising the system of any one of claims 8-29, or one or more nucleic acids encoding the same, and a pharmaceutically acceptable excipient or carrier.

33. Tire pharmaceutical composition of claim 32, wherein the pharmaceutically acceptable excipient or carrier is selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle (LNP).

34. The pharmaceutical composition of claim 33, wherein the viral vector is an adeno-associated virus.

35. A host cell (e.g., a mammalian cell, e.g., a human cell) comprising the nucleic acid molecule, gene modifying system, or template RNA of any one of the preceding claims.

36. A method of making the nucleic acid molecule or template RNA of any one of the preceding claims, the method comprising synthesizing the nucleic acid molecule or template RNA in vitro (e.g., by in vitro transcription or solid-state synthesis) or by introducing a DNA encoding the template RNA into a host cell under conditions that allow for production of the template RNA.

37. A method for modifying a target site in the human PAH gene in a cell, the method comprising contacting the cell with the gene modifying system of any one of claims 8-29 or 31, or DNA encoding the same, or the pharmaceutical composition of any one of claims 32-34, thereby modifying the target site in the human PAH gene in a cell.

38. A method for treating a subject having a disease or condition associated with a mutation in the human PAH gene, the method comprising administering to the subject the gene modifying system of any one of claims 8-29 or 31, or DNA encoding the same, or the pharmaceutical composition of any one of claims 32-34, thereby treating the subject having a disease or condition associated with a mutation in the human PAH gene.

39. The method of claim 38. wherein the disease or condition is phenylketonuria (PKU) or hyperphenylalaninemia (e.g., mild or severe hyperphenylalaninemia).

40. Tire method of claim 38 or 39, wherein the subject has a R408W mutation.

41. A method for treating a subject having PKU the method comprising administering to the subject the gene modifying system of any one of claims 8-29 or 31, or DNA encoding the same, or the pharmaceutical composition of any one of claims 32-34, thereby treating the subject having PKU.

42. The gene modifying system or method of any one of the preceding claims, wherein introduction of tire system into a target cell results in a correction of a pathogenic mutation in the PAH gene.

43. The gene modifying system or method of any one of tire preceding claims, wherein the pathogenic mutation is a R408W mutation, and wherein the correction comprises an amino acid substitution of W408R.

44. The gene modify ing system or method of any one of the preceding claims, wherein introduction of the system into a target cell results in a mutation that causes the restoration of the function of the PAH gene.

45. The gene modifying system or method of any one of tire preceding claims, wherein correction of the mutation occurs in at least 10% (e.g., 10%, 20%, 30%, 40%, 50%. 60%, 70%, or more) of target nucleic acids.

46. The gene modifying system or method of any one of the preceding claims, wherein correction of the mutation occurs in at least 10% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, or more) of target cells.

47. The gene modify ing system or method of any one of the preceding claims, wherein the gene modifying system comprises a second strand-targeting gRNA. and wherein correction of the mutation in a population of target cells is increased relative to a population of target cells treated with a gene modifying system comprising a template RNA without a second strand-targeting gRNA.

48. The method of any one of the preceding claims, wherein the cell is a mammalian cell, such as a human cell.

49. The method of any one of the preceding claims, wherein the subject is a human.

50. The method of any one of the preceding claims, wherein tire contacting occurs ex vivo, e.g., wherein the cell’s or subject’s DNA is modified ex vivo.

51. The method of any one of the preceding claims, wherein the contacting occurs in vivo, e.g., wherein the cell’s or subject’s DNA is modified in vivo.

52. The method of any one of the preceding claims, wherein contacting the cell or tire subject with the system comprises contacting the cell or a cell within the subject with a nucleic acid (e g., DNA or RNA) encoding the gene modifying polypeptide under conditions that allow for production of the gene modifying polypeptide.