Manufacturing and use of recombinant self-complementary aav vectors

Abstract

Presented herein are technologies and methods for improved production of self-complementary AAV (scAAV) vectors.

Description

MANUFACTURING AND USE OF RECOMBINANT SELF-COMPLEMENTARY AAV VECTORSBackground

[0001] Genetic diseases caused by dysfunctional genes account for a large fraction of diseases worldwide. Gene therapy is emerging as a promising form of treatment aiming to mitigate the effects of genetic diseases.Summary

[0002] The present disclosure provides methods and technologies for improving the design and / or production of viral vectors, including adeno-associated virus (AAV) vectors (e.g., self- complementary AAV (scAAV) vectors. In accordance with various embodiments, the present disclosure provides an insight that certain design elements of expression constructs (e.g., plasmids) and / or transfection conditions may significantly impact one or more properties and / or characteristics of viral (e.g., AAV (e.g., scAAV)) production (including, e.g., one or more of viral vector yield, packaging efficiency, and / or replication-competent AAV levels).

[0003] The present disclosure demonstrates, among other things, that two-plasmid transfection systems with particular combinations of sequence elements (e.g., rep genes or gene variants, cap genes or gene variants, one or more helper virus genes or gene variants, and / or one or more genes of interest) can be effective in enhancing downstream production of, inter alia, viral vectors (e.g., AAV (e.g., scAAV)) for use in gene therapy. For example, in some embodiments, the present disclosure provides an insight that two-plasmid transfection systems with particular combinations of wild-type sequence elements (e.g., rep genes or gene variants, one or more helper virus genes or gene variants, one or more viral promoters) can be effective in enhancing production of viral vectors (e.g., AAV (e.g., scAAV)).

[0004] In some embodiments, the present disclosure demonstrates that two-plasmid transfection systems with particular combinations of sequence elements may be combined with various transfections reagents (e.g., chemical transfection reagents, including lipids, polymers, and cationic molecules (e.g., one or more cationic lipids)) can be effective in enhancing production of scAAV vectors.

[0005] In some embodiments, the present disclosure provides an insight that optimization of plasmid ratios in a two-plasmid system can provide still further improved production of one or more aspects of viral vectors, for example, AAV vectors (e.g., scAAV vectors) (including, e.g., one or more of viral vector yield, packaging efficiency, and / or replication-competent AAV levels). Without wishing to be bound by any particular theory, the present disclosure demonstrates that transfection with a two-plasmid system comprising a first plasmid with viral helper genes (e.g., Adenovirus genes or Herpesvirus genes) and either AAV rep gene or AAV cap gene, and a second plasmid with a payload and either AAV rep gene or AAV cap gene can produce improved viral vector (e.g., AAV (e.g., scAAV)) yield relative to a reference.

[0006] In some embodiments, the present disclosure provides plasmids, including at least one of a polynucleotide sequence encoding an AAV cap gene, a polynucleotide sequence encoding an AAV rep gene, a polynucleotide sequence encoding a payload and flanking ITRs, and / or a polynucleotide sequence encoding one or more viral helper genes. In some embodiments, provided plasmids further include a polynucleotide sequence encoding a promoter, for example, a native p5 promoter, a native p40 promoter, a CMV promoter, and / or one or more wild-type promoters. In some embodiments, providedplasmids further include a polyA sequence. In some embodiments, provided plasmids further include an intron, for example, an intron between a promoter and an AAV rep gene. In some embodiments, provided plasmids further comprise polynucleotide sequences encoding wild-type viral helper genes. In some embodiments, provided plasmids further comprise a transgene, for example, one or more of methylmalonyl CoA mutase (MUT), UDP-glucuronosyltransferase 1 -1 (UGT1 A1 ), cystathionine beta synthase (CBS), galactose-1 -phosphate uridyl transferase (GALT), or variants thereof. In some embodiments, provided plasmids do not include a polynucleotide sequence encoding a nuclease.

[0007] In some embodiments, a first and second provided plasmid are present in a composition, wherein each plasmid includes different sequence elements (e.g., a polynucleotide sequence encoding an AAV cap gene, a polynucleotide sequence encoding an AAV rep gene, a polynucleotide sequence encoding a payload and flanking ITRs, and / or a polynucleotide sequence encoding one or more viral helper genes). In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding an AAV cap gene and a second plasmid comprising a polynucleotide sequence encoding an AAV rep gene. In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding a payload and flanking ITRs and a second plasmid comprising a polynucleotide sequence encoding one or more viral helper genes. In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding one or more viral helper genes and a second plasmid comprising a polynucleotide sequence encoding a payload and flanking ITRs. In some embodiments, provided compositions are formulated for co-delivery of a first and second plasmid to a cell. In some embodiments, provided compositions include a particular ratio of a first and second plasmid to achieve a particular ratio between the two plasmids. In some embodiments, provided compositions include a greater amount of a first plasmid relative to a second plasmid. In some embodiments, provided compositions include a first and second plasmid, wherein the ratio of the first plasmid to the second plasmid is greater than or equal to 1 .5:1 up to 10:1 . In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding one or more viral helper genes and a second plasmid comprising a polynucleotide sequence encoding a payload and flanking ITRs. In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding one or more viral helper genes and a rep gene and a second plasmid comprising a polynucleotide sequence encoding a payload and flanking ITRs and a cap gene. In some embodiments, provided compositions include a first plasmid comprising a polynucleotide sequence encoding one or more viral helper genes and a cap gene and a second plasmid comprising a polynucleotide sequence encoding a payload and flanking ITRs and a rep gene.

[0008] In some embodiments, provided compositions include one or more of a polynucleotide sequence encoding one or more enhancer sequences, a polynucleotide sequence encoding one or more promoter sequences, a polynucleotide sequence encoding one or more intron sequences, a polynucleotide sequence encoding a gene, and a polynucleotide sequence comprising a polyA sequence. In some embodiments, provided polynucleotide sequences encoding a payload include a polynucleotide sequence comprising a first nucleic acid sequence and a second nucleic acid sequence, wherein the first nucleic acid sequence comprises at least one gene and the second nucleic acid sequence is positioned 5’ or 3’ to the first nucleic acid sequence and promotes the production of two independent gene productsupon integration into a target integration site, a third nucleic acid sequence positioned 5’ to the polynucleotide and comprising a sequence that is homologous to a genomic sequence 5’ of the target integration site, and a fourth nucleic acid sequence positioned 3’ to the polynucleotide and comprising a sequence that is homologous to a genomic sequence 3’ of the target integration site. In some embodiments, provided target integration sites comprise the 3’ end of an endogenous gene. In some embodiments, provided third nucleic acid sequences are homologous to DNA sequences upstream of a stop codon in an endogenous gene. In some embodiments, provided fourth nucleic acid sequences are homologous to DNA downstream of a stop codon in an endogenous gene. In some embodiments, provided target integration sites are in the genome of a cell. In some embodiments, provided target integration sites are in the genome of a liver, muscle, or CNS cell.

[0009] In some embodiments, provided compositions include compositions for use in packaging an AAV vector. In some embodiments, provided compositions are used in a method of manufacturing a packaged AAV vector. In some embodiments, provided compositions are delivered to a cell, including a mammalian cell, a liver cell, a muscle cell, a CNS cell, or a cell isolated from a subject. In some embodiments, provided compositions are delivered to a cell by means of a chemical transfection reagent, including a cationic molecule and / or a cationic lipid. In some embodiments, provided compositions include a packaged AAV vector composition. In some embodiments, provided compositions may be administered in a method of treatment to a subject in need thereof, including a subject having or suspected of having one or more of propionic acidemia, Wilson’s Disease, hemophilia, Crigler-Najjar syndrome, methylmalonic acidemia (MMA), alpha-1 anti-trypsin deficiency (A1 ATD), a glycogen storage disease (GSD), Duchenne’s muscular dystrophy, limb girdle muscular dystrophy, X-linked myotubular myopathy, Parkinson’s Disease, Mucopolysaccharidosis, hemophilia A, hemophilia B, hereditary angioedema (HAE), galactosemia, a viral infection, cancer, chronic kidney disease, diabetes (e.g., type II diabetes), muscle wasting, a neurodegenerative disorder, severe combined immunodeficiency (SCID), growth hormone deficiency, a wound, obesity, an inflammatory disorder, a cardiovascular disease, rheumatoid arthritis, neutropenia, asthma, or hemophila (e.g., hemophilia A). In some embodiments, provided compositions do not comprise a nuclease.

[0010] In one aspect, provided herein is a Payload / Cap plasmid comprising: a polynucleotide sequence encoding a cap gene; and a polynucleotide sequence encoding an scAAV, wherein the Payload / Cap plasmid does not comprise a polynucleotide encoding a rep gene.

[0011] In some embodiments, the polynucleotide sequence encoding an scAAV comprises a left end ITR and a right end ITR, wherein: (i) the left end ITR comprises the sequence of CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTC GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG (SEQ ID NO: 18); (ii) the right end ITR comprises the sequence of AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGC GACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG AGAGGGAGTGGCC (SEQ ID NO: 19); or (iii) the left end ITR comprises the sequence of SEQ ID NO: 18 and the right end ITR comprises the sequence of SEQ ID NO: 19.

[0012] In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 11 , or SEQ ID NO: 12. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding a cap gene is inserted before position 550 of SEQ ID NO: 20.

[0013] In some embodiments, the polynucleotide sequence encoding an scAAV comprises a polynucleotide sequence encoding a transgene. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, and the polynucleotide sequence encoding a transgene is inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is or comprises one or more of Propionyl-CoA Carboxylasemethylmalonyl-CoA mutase (MUT), UDP- glucuronosyltransferase 1 -1 (UGT1 A1 ), cystathionine beta synthase (CBS), galactose-1 -phosphate uridyl transferase (GALT), or variants thereof.

[0014] In some embodiments, the cap gene is selected from the cap gene of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02, AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11 .10, AAVC11 .11 , AAVC11 .12, AAVC11 .13, AAVC11 .14, AAVC11 .15, AAVC11 .16, AAVC11 .17, AAVC11 .18, AAVC11 .19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, or a hybrid AAV.

[0015] In another aspect, provided herein is a composition comprising any one of thePayload / Cap plasmids disclosed herein; and a Rep / Helper plasmid comprising a polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1 , or SEQ ID NO: 2, wherein the Rep / Helper plasmid does not comprise a polynucleotide sequence encoding a cap gene.

[0016] In some embodiments, the composition comprises no more than two distinct plasmids.

[0017] In some embodiments, the composition is for use in producing an AAV vector.

[0018] In another aspect, provided herein is a host cell comprising any one of the Payload / Cap plasmids disclosed herein or any one of the compositions disclosed herein.

[0019] In some embodiments, the host cell is a mammalian host cell.

[0020] In some embodiments, the mammalian host cell is a HEK293F cell or a derivative of aHEK293F cell. In some embodiments, the mammalian host cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers of greater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293 cell is a Viral Production Cells (VPC) 2.0 cell.

[0021] In another aspect, provided herein is a method of manufacturing a packaged scAAV vector, comprising delivering to a cell any one of the compositions disclosed herein and incubating the cell for a time and under conditions sufficient for producing a packaged scAAV vector.

[0022] In some embodiments, the delivering comprises use of a chemical transfection reagent. In some embodiments, the chemical transfection reagent comprises a cationic lipid-based transfection reagent. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cellis a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the mammalian cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers of greater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293 cell is a VPC 2.0 cell.

[0023] In another aspect, provided herein is a population of purified self-complementary adeno- associated virus (scAAV) particles, the scAAV particles comprising capsid proteins and polynucleotides encoding a payload sequence and flanking inverted terminal repeats (ITRs), wherein the population of scAAV viral particles has a non-empty capsid percentage of greater than or equal to 85%.

[0024] In some embodiments, the population has a non-empty capsid percentage of between 90% and 99%. In some embodiments, the population has a non-empty capsid percentage of between 92% and 97%. In some embodiments, the population has a non-empty capsid percentage of about 95%.

[0025] In some embodiments, the capsid proteins are selected from the capsid proteins of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02,AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11 .10, AAVC11 .11 , AAVC11 .12, AAVC11 .13, AAVC11 .14, AAVC11 .15, AAVC11 .16, AAVC11 .17, AAVC11 .18, AAVC11 .19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, or a hybrid AAV.Brief Description of the Drawings

[0026] FIG. 1 is a graph showing the results of a ratio test comparing the indicated ratios of Rep / Helper to Payload / Cap for 2-plasmid (2P) production of scAAV compared to 3-plasmid (3P) production. The graph shows that the best ratio of Rep / Helper to Payload / Cap in this experiment was 1 :3, and that molar ratios from 1 :5:1 to 1 :6 showed improved yield compared to the 3-plasmid system.

[0027] FIG. 2 is a graph showing the percentage of non-empty capsids for the indicated conditions. The non-empty capsid percentage was higher for purified scAAV from 2P production of scAAV compared to 3P production.

[0028] FIG. 3 is an image of a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE) gel showing that the purity of purified 2P scAAV and purified 3P scAAV was 100%.

[0029] FIG. 4 is an image of an alkaline gel validating the target genome size of scAAV9 produced by the 2-plasmid system and 3-plasmid system.

[0030] FIG. 5 is a series of graphs showing that scAAV9-SMN1 produced by 2-plasmid system and 3-plasmid system showed similar potency in vivo.

[0031] FIG. 6 is a graph showing results of 2P scAAV and 3P scAAV production in different cell lines.Definitions

[0032] For the present disclosure to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification. The publications and other reference materials referenced herein to describe the background of the disclosure and to provide additional detail regarding its practice are hereby incorporated by reference.

[0033] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0034] About: The term “about” or “approximately,” when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context. For example, in some embodiments, the term “about” or “approximately” may encompass a range of values that within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0035] Codon optimization: As used herein, the term “codon optimization” refers to a process of changing codons of a given gene in such a manner that the polypeptide sequence encoded by the gene remains the same while the changed codons improve the process of expression of the polypeptide sequence. For example, if the polypeptide is of a human protein sequence and expressed in E. coli, expression will often be improved if codon optimization is performed on the DNA sequence to change the human codons to codons that are more effective for expression in E. coli.

[0036] Combination Therapy: As used herein, the term “combination therapy” refers to a clinical intervention in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, the two or more therapeutic regimens may be administered simultaneously. In some embodiments, the two or more therapeutic regimens may be administered sequentially (e.g., a first regimen administered prior to administration of any doses of a second regimen). In some embodiments, the two or more therapeutic regimens are administered in overlapping dosing regimens. In some embodiments, administration of combination therapy may involve administration of one or more therapeutic agents or modalities to a subject receiving the other agent(s) or modality. In some embodiments, combination therapy does not necessarily require that individual agents be administered together in a single composition (or even necessarily at the same time). In some embodiments, two or more therapeutic agents or modalities of a combination therapy are administered to a subject separately, e.g., in separate compositions, via separate administration routes (e.g., one agent orally and another agent intravenously), and / or at different time points. In some embodiments, two or more therapeutic agents may be administered together in a combination composition, or even in a combination compound (e.g., as part of a single chemical complex or covalent entity), via the same administration route, and / or at the same time.

[0037] Comparable: As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusionsmay reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.

[0038] Comprising: A composition or method described herein as “comprising” one or more named elements or steps is open-ended, meaning that the named elements or steps are essential, but other elements or steps may be added within the scope of the composition or method. To avoid prolixity, it is also understood that any composition or method described as “comprising” (or that “comprises”) one or more named elements or steps also describes the corresponding, more limited composition or method “consisting essentially of” (or that “consists essentially of”) the same named elements or steps, meaning that the composition or method includes the named essential elements or steps and may also include additional elements or steps that do not materially affect the basic and novel characteristic(s) of the composition or method. It is also understood that any composition or method described herein as “comprising” or “consisting essentially of” one or more named elements or steps also describes the corresponding, more limited, and closed-ended composition or method “consisting of” (or “consists of”) the named elements or steps to the exclusion of any other unnamed element or step. In any composition or method disclosed herein, known or disclosed equivalents of any named essential element or step may be substituted for that element or step.

[0039] Corresponding to: As used herein, the term “corresponding to” may be used to designate the position / identity of a structural element in a compound or composition through comparison with an appropriate reference compound or composition. For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) may be identified as “corresponding to” a residue in an appropriate reference polymer. For example, those of ordinary skill will appreciate that, for purposes of simplicity, residues in a polypeptide are often designated using a canonical numbering system based on a reference related polypeptide, so that an amino acid “corresponding to a residue at position 190, for example, need not actually be the 190thamino acid in a particular amino acid chain but rather corresponds to the residue found at 190 in the reference polypeptide; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids. For example, those skilled in the art will be aware of various sequence alignment strategies, including software programs such as, for example, BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS,SWIMM, or SWIPE that can be utilized, for example, to identify “corresponding” residues in polypeptides and / or nucleic acids in accordance with the present disclosure.

[0040] Derivative: As used herein, the term “derivative” refers to a structural analogue of a reference substance. That is, a “derivative” is a substance that shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, a derivative is a substance that can be generated from the reference substance by chemical manipulation. In some embodiments, a derivative is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance.

[0041] Engineered: In general, the term “engineered” refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be “engineered” when two or more sequences, that are not linked together in that order in nature, are manipulated by the hand of man to be directly linked to one another in the engineered polynucleotide. For example, in some embodiments of the present disclosure, an engineered polynucleotide comprises a regulatory sequence that is found in nature in operative association with a first coding sequence but not in operative association with a second coding sequence, is linked by the hand of man so that it is operatively associated with the second coding sequence. Comparably, a cell or organism is considered to be “engineered” if it has been manipulated so that its genetic information is altered (e.g., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, or by mating protocols). As is common practice and is understood by those in the art, progeny of an engineered polynucleotide or cell are typically still referred to as “engineered” even though the actual manipulation was performed on a prior entity.

[0042] Excipient: As used herein, refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example to provide or contribute to a desired consistency or stabilizing effect. In some embodiments, suitable pharmaceutical excipients may include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

[0043] Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1 ) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and / or 3’ end formation); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0044] Gene: As used herein, the term “gene” refers to a DNA sequence in a chromosome that encodes a gene product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (e.g., a sequence that encodes a particular gene product); in some embodiments, a gene includes a non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, agene may include one or more regulatory elements (e.g., promoters, enhancers, silencers, termination signals) that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type- specific expression, inducible expression).

[0045] Gene product or expression product: As used herein, the term “gene product” or “expression product” generally refers to an RNA transcribed from the gene (pre-and / or post-processing) or a polypeptide (pre- and / or post-modification) encoded by an RNA transcribed from the gene.

[0046] Homology: As used herein, the term “homology” refers to the overall relatedness between polymeric molecules, e.g., between polypeptide molecules or between polynucleotide molecules. In some embodiments, polymeric molecules are considered to be “homologous” to one another if their sequences are at least 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymeric molecules are considered to be “homologous” to one another if their sequences are at least 80%, 85%, 90%, 95%, or 99% similar, or achieve such similarity over a desired stretch of the overall sequence.

[0047] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11 -17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0048] “Improved," “increased" or “reduced”: As used herein, these terms, or grammatically comparable comparative terms, indicate values that are relative to a comparable reference measurement. For example, in some embodiments, an assessed value achieved with an agent of interest (e.g., a therapeutic agent) may be “improved” relative to that obtained with a comparable reference agent.Alternatively or additionally, in some embodiments, an assessed value achieved in a subject or system of interest may be “improved” relative to that obtained in the same subject or system under different conditions (e.g., prior to or after an event such as administration of an agent of interest), or in a different, comparable subject (e.g., in a comparable subject or system that differs from the subject or system of interest in presence of one or more indicators of a particular disease, disorder or condition of interest, or in prior exposure to a condition or agent, etc). In some embodiments, comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and / or prevalence of difference that is required or sufficient to achieve such statistical significance.

[0049] In vitro: The term “in vitro’’ as used herein refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.

[0050] In vivo: as used herein refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).

[0051] Marker: A marker, as used herein, refers to an entity or moiety whose presence or level is a characteristic of a particular state or event. In some embodiments, presence or level of a particular marker may be characteristic of presence or stage of a disease, disorder or condition. To give but one example, in some embodiments, the term refers to a gene expression product that is characteristic of a particular tumor, tumor subclass, stage of tumor, etc. Alternatively or additionally, in some embodiments, a presence or level of a particular marker correlates with activity (or activity level) of a particular signaling pathway, for example that may be characteristic of a particular class of tumors. The statistical significance of the presence or absence of a marker may vary depending upon the particular marker. In some embodiments, detection of a marker is highly specific in that it reflects a high probability that the tumor is of a particular subclass. Such specificity may come at the cost of sensitivity (i.e., a negative result may occur even if the tumor is a tumor that would be expected to express the marker). Conversely, markers with a high degree of sensitivity may be less specific that those with lower sensitivity. A useful marker need not distinguish tumors of a particular subclass with 100% accuracy.

[0052] Nucleic acid: As used herein, in its broadest sense, refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, “nucleic acid’ refers to an individual nucleic acid residue (e.g., a nucleotide and / or nucleoside); in some embodiments, “nucleic acid’ refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a nucleic acid is or comprises RNA; in some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consistsof one or more “peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 - methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.

[0053] Peptide: The term “peptide” as used herein refers to a polypeptide that is typically relatively short, for example having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 40 amino acids less than about 30 amino acids, less than about 25 amino acids, less than about 20 amino acids, less than about 15 amino acids, or less than 10 amino acids.

[0054] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials that can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol,mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0055] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0056] Polypeptide: The term “polypeptide,” as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional fragments ( / .e., fragments retaining at least one activity) of such complete polypeptides. Moreover, those of ordinary skill in the art understand that protein sequences generally tolerate some substitution without destroying activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and further usually including at least one region of much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99% in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term “polypeptide” as used herein. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, biologically active portions thereof, and / or characteristic portions thereof.

[0057] Prevent or prevention: as used herein when used in connection with the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing the disease, disorder and / or condition and / or to delaying onset of one or more characteristics, signs, or symptoms of thedisease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.

[0058] Risk: as will be understood from context, “risk’ of a disease, disorder, and / or condition refers to a likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is from 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or up to 100%. In some embodiments risk is expressed as a risk relative to a risk associated with a reference sample or group of reference samples. In some embodiments, a reference sample or group of reference samples have a known risk of a disease, disorder, condition and / or event. In some embodiments a reference sample or group of reference samples are from individuals comparable to a particular individual. In some embodiments, relative risk is 0,1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

[0059] Subject: As used herein, the term “subject” refers an organism, typically a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered.

[0060] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0061] Susceptible to: An individual who is “susceptible to” a disease, disorder, and / or condition is one who has a higher risk of developing the disease, disorder, and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0062] Therapeutic agent: As used herein, the phrase “therapeutic agent” refers to an agent that, when administered to a subject, has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used toalleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition.

[0063] Treatment: As used herein, the term “treatment” (also “treat” or “treating”) refers to administration of a therapy that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and / or reduces incidence of one or more signs, symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition. Thus, in some embodiments, treatment may be prophylactic; in some embodiments, treatment may be therapeutic.

[0064] Variant: As used herein, the term “variant” refers to an entity that shows significant structural identity with a reference entity but differs structurally from the reference entity in the presence or absence or in the level of one or more chemical moieties as compared with the reference entity. In some embodiments, a variant also differs functionally from its reference entity. In general, whether a particular entity is properly considered to be a “variant” of a reference entity is based on its degree of structural identity with the reference entity. As will be appreciated by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. A variant, by definition, is a distinct chemical entity that shares one or more such characteristic structural elements. To give but a few examples, a polypeptide may have a characteristic sequence element comprised of a plurality of amino acids having designated positions relative to one another in linear or three-dimensional space and / or contributing to a particular biological function, a nucleic acid may have a characteristic sequence element comprised of a plurality of nucleotide residues having designated positions relative to on another in linear or three-dimensional space. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., that are attached to the polypeptide or nucleic acid backbone). In some embodiments, a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. ). In some embodiments, a variant polypeptide or nucleic acid shows an overall sequence identity with a portion of a reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. Alternatively or additionally, in some embodiments, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some embodiments, a reference polypeptide or nucleic acid has one or more biological activities that could differ from a variant. For example, in some embodiments, a variant polypeptide or nucleic acidshares one or more of the biological activities of the reference polypeptide or nucleic acid and further comprises one or more sequence variations (e.g., deletion, insertion, truncation, codon optimization, etc.). In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid shows a reduced level of one or more biological activities as compared to the reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered to be a “variant” of a parent or reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference but for a small number of sequence alterations at particular positions. Typically, fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue(s) as compared with a reference. Often, a variant polypeptide or nucleic acid comprises a very small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1 ) number of substituted, inserted, or deleted, functional residues (i.e., residues that participate in a particular biological activity) relative to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises not more than about 5, about 4, about 3, about 2, or about 1 addition(s) or deletion(s), and, in some embodiments, comprises no additions or deletions, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and commonly fewer than about 5, about 4, about 3, or about 2 additions or deletions as compared to the reference. In some embodiments, a reference polypeptide or nucleic acid is one found in nature. In some embodiments, a reference polypeptide or nucleic acid is a human polypeptide or nucleic acid.Detailed DescriptionGene Therapy

[0065] Genetic diseases caused by dysfunctional genes have been reported to account for nearly 80% of approximately 7,136 diseases reported as of 2019 (See, Genetic and rare Diseases Information Center and Global Genes). More than 330 million people worldwide are affected by a genetic disease, and almost half of these cases are estimated to be children. However, only about 500 human diseases are estimated to be treatable with available drugs, indicating that new therapies and options for treatment are necessary to address a substantial proportion of these genetic disorders. Gene therapy is an emerging form of treatment that aims to mediate the effects of genetic disorders through transmission of genetic material into a subject. In some embodiments, gene therapy may comprise transcription and / or translation of transferred genetic material, and / or by integration of transferred genetic material into a host genome through administration of nucleic acids, viruses, or genetically engineered microorganisms (See, FDA Guidelines). Gene therapy can allow delivery of therapeutic genetic material to any specific cell, tissue, and / or organ of a subject for treatment. In some embodiments, gene therapy involves transfer of atherapeutic gene, or transgene, to a host cell. In any of the embodiments disclosed below, the AAV may be an sc A AV.Viral Gene Therapy

[0066] Viruses have emerged as an appealing vehicle for gene therapy due to their ability to express high levels of a payload (e.g., a transgene) and, in some embodiments, their ability to stably express a payload (e.g., transgene) within a host’s genome. Recombinant AAVs are popular viral vectors for gene therapy, as they often produce high viral yields, mild immune response, and are able to infect different cell types.

[0067] In conventional AAV gene therapy, rAAVs can be engineered to deliver therapeutic payloads (e.g., transgenes) to target cells without integrating into chromosomal DNA. One or more payloads (e.g., transgenes) may be expressed from a non-integrated genetic element called an episome that exists within the cell nucleus. Although conventional gene therapy may be effective in initially transduced cells, episomal expression is transient and gradually decreases over time, inter alia, with cell turnover. For cells with a longer lifespan (e.g., cells that exist for a significant portion of a subject’s lifetime), episomal expression can be effective. However, conventional gene therapy can have drawbacks when applied to a subject early in life (e.g., during childhood), as rapid tissue growth during development can result in dilution and eventual loss of therapeutic benefit of a payload (e.g., transgene).

[0068] A second type of AAV gene therapy, GENERIDE™, harnesses homology directed repair (HDR), a naturally occurring DNA repair process that ordinarily helps maintain the integrity of a cell genome. GENERIDE™ uses HDR to insert one or more payloads (e.g., transgenes) into specific target loci within a genomic sequence. In some embodiments, GENERIDE™ makes use of endogenous promoters at one or more target loci to drive high levels of tissue-specific expression. GENERIDE™ does not require use of exogenous nucleases or promoters, thereby reducing detrimental effects often associated with these elements. Furthermore, GENERIDE™ platform technology has potential to overcome some of the key limitations of both traditional gene therapy and conventional gene editing approaches in a way that is well positioned to treat genetic diseases, particularly in pediatric subjects. GENERIDE™ uses, for example, an AAV vector to deliver a gene into the nucleus of the cell. It then utilizes the cellular HDR machinery to stably integrate a corrective gene into the genome of a subject at a location where it is regulated by an endogenous promoter, allowing sustained protein production, even as the body’s cells divide over time, which is not feasible with conventional AAV gene therapy.

[0069] Previous work on non-disruptive gene targeting is described in WO 2013 / 158309, incorporated herein by reference. Previous work on genome editing without nucleases is described in WO 2015 / 143177, incorporated herein by reference. Previous work on non-disruptive gene therapy for the treatment of MMA is described in WO 2020 / 032986, incorporated herein by reference. Previous work on monitoring of gene therapy is described in WO 2020 / 214582, incorporated herein by reference.Viral Structure and FunctionViral Vectors

[0070] Viral vectors comprise virus or viral chromosomal material, within which a heterologous nucleic acid sequence can be inserted for transfer into a target sequence of interest (e.g., for transfer intogenomic DNA within a cell). Various viruses can be used as viral vectors, including, e.g., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) viruses, and / or RNA viruses with a DNA stage in their lifecycle. In some embodiments, a viral vector is or comprises an adeno-associated virus (AAV) or AAV variant. In some embodiments, a viral vector is or comprises an scAAV or an scAAV variant.

[0071] In some embodiments, a vector particle is a single unit of virus comprising a capsid encapsidating a virus-based polynucleotide (e.g., a wild-type viral genome or a recombinant viral vector). In some embodiments, a vector particle is or comprises an AAV vector particle. In some embodiments, an AAV vector particle refers to a vector particle comprised of at least one AAV capsid protein and an encapsidated AAV vector. In some embodiments, a vector particle (also referred to as a viral vector) comprises at least one AAV capsid protein and an encapsidated AAV (e.g., scAAV) vector, wherein the vector further comprises one or more heterologous polynucleotide sequences.Capsid proteins

[0072] In some embodiments, an expression construct comprises polynucleotide sequences encoding capsid proteins from one or more AAV subtypes, including naturally occurring and recombinant AAVs. In some embodiments, an expression construct comprises polynucleotide sequences encoding capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02, AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11.10, AAVC11.11 (referred to interchangeably herein as sL65), AAVC11.12, AAVC11.13, AAVC11.14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV- LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, a hybrid AAV (e.g., an AAV comprising one more sequences of one AAV subtype and one or more sequences of a second subtype), and / or an AAV comprising a mutant AAV capsid protein or a chimeric AAV capsid (e.g., a capsid with polynucleotide sequences derived from two or more different serotypes of AAV), or variants thereof.

[0073] In some embodiments, viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) are packaged within capsid proteins (e.g., capsid proteins from one or more AAV subtypes). In some embodiments, capsid proteins provide increased or enhanced transduction of cells (e.g., human or murine cells) relative to a reference capsid protein. In some embodiments, capsid proteins provide increased or enhanced transduction of certain cells or tissue types (e.g., liver tropism, muscle tropism, CNS tropism) relative to a reference capsid protein. In some embodiments, capsid proteins increase or enhance transduction of cells or tissues (e.g., liver, muscle, and / or CNS)by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more relative to a reference capsid protein. In some embodiments, capsid proteins increase or enhance transduction of cells or tissues (e.g., liver, muscle, and / or CNS) by at least about 1 .2x, 1 ,5x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, or more relative to a reference capsid protein.AAV Structure and Function

[0074] AAV is a parvovirus composed of an icosahedral protein capsid and a single-stranded DNA genome. The AAV viral capsid comprises three subunits, VP1 , VP2, and VP3 and two invertedterminal repeat (ITR) regions, which are at the ends of the genomic sequence. The ITRs serve as origins of replication and play a role in viral packaging. The viral genome also comprises rep and cap genes, which are associated with replication and capsid packaging, respectively. In most wild-type AAV, the rep gene encodes four proteins required for viral replication, Rep 78, Rep68, Rep52, and Rep40. The cap gene encodes the capsid subunits as well as the assembly activating protein (AAP), which promotes assembly of viral particles. AAVs are generally replication-deficient, requiring the presence of a helper virus or helper virus functions (e.g., herpes simplex virus (HSV) and / or adenovirus (AdV)) to replicate within an infected cell. For example, in some embodiments AAVs require adenoviral E1 A, E2A, E4, and VA RNA genes to replicate within a host cell.Recombinant A A V

[0075] In general, recombinant AAV (rAAV) vectors can comprise many of the same elements found in wild-type AAVs, including similar capsid sequences and structures, as well as polynucleotide sequences that are not of AAV origin (e.g., a polynucleotide heterologous to AAV). In some embodiments, rAAVs will replace native, wild-type AAV sequences with polynucleotide sequences encoding a payload. For example, in some embodiments an rAAV will comprise polynucleotide sequences encoding one or more genes intended for therapeutic purposes (e.g., for gene therapy). rAAVs may be modified to remove one or more wild-type viral coding sequences. For example, rAAVs may be engineered to comprise only one ITR, and / or one or more fewer genes necessary for packaging (e.g., rep and cap genes) than would be found in a wild type AAV. Gene expression with rAAVs is generally limited to one or more genes that total 5kb or less, as larger sequences are not efficiently packaged within the viral capsid. For an scAAV, in some examples, the coding sequence of a transgene is about 1 .4 kb or less (e.g., 1 bp to 1 .4 kb, 10 bp to 1 .4 kb, 100 bp to 1 .4 kb, 200 bp to 1 .4 kb, 300 bp to 1 .4 kb, 400 bp to 1 .4 kb, 500 bp to 1 .4 kb, 600 bp to 1 .4 kb, 700 bp to 1 .4 kb, 800 bp to 1 .4 kb, 900 bp to 1 .4 kb, 1 kb to 1 .4 kb, 1 .1 kb to 1 .4 kb, 1 .2 kb to 1 .4 kb, or 1 .3 kb to 1 .4 kb). In some embodiments, two or more rAAVs can be used to provide portions of a larger payload, for example, to provide an entire coding sequence for a gene that would normally be too large to fit in a single AAV.

[0076] Among other things, the present disclosure provides viral vectors comprising one or more polypeptides described herein. In some embodiments, rAAVs may comprise one or more capsid proteins (e.g., one or more capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02, AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11 .10, AAVC11 .11 (referred to interchangeably herein as sL65), AAVC11 .12, AAVC11 .13, AAVC11 .14, AAVC11 .15, AAVC11 .16, AAVC11 .17, AAVC11 .18, AAVC11 .19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, a hybrid AAV (e.g., an AAV comprising one more sequences of one AAV subtype and one or more sequences of a second subtype), and / or an AAV comprising a mutant AAV capsid protein or a chimeric AAV capsid (e.g., a capsid with polynucleotide sequences derived from two or more different serotypes of AAV). In some embodiments, rAAVs may comprise one or more polynucleotide sequences encoding a gene or nucleic acid of interest (e.g., a gene for treatment of a genetic disease I disorder and / or an inhibitory nucleic acid sequence).

[0077] AAV vectors may be capable of being replicated in an infected host cell (replication competent) or incapable of being replicated in an infected host cell (replication incompetent). A replication competent AAV (rcAAV) requires the presence of one or more functional AAV packaging genes. Recombinant AAV vectors are generally designed to be replication-incompetent in mammalian cells to reduce the possibility that rcAAV are generated through recombination with sequences encoding AAV packaging genes. In some embodiments, rAAV vector preparations as described herein are designed to comprise few, if any, rcAAV vectors. In some embodiments, rAAV vector preparations comprise less than about 1 rcAAV per 102rAAV vectors. In some embodiments, rAAV vector preparations comprise less than about 1 rcAAV per 104rAAV vectors. In some embodiments, rAAV vector preparations comprise less than about 1 rcAAV per 108rAAV vectors. In some embodiments, rAAV vector preparations comprise less than about 1 rcAAV per 1012rAAV vectors. In some embodiments, rAAV vector preparations comprise no rcAAV vectors. scAAV VectorsPayload / Cap Plasmids

[0078] Provided herein are Payload / Cap plasmids that may be used for production of scAAV vectors. For example, provided herein is a Payload / Cap plasmid comprising: a polynucleotide sequence encoding a cap gene; and a polynucleotide sequence encoding an scAAV, wherein the Payload / Cap plasmid does not comprise a polynucleotide encoding a rep gene.

[0079] In some embodiments, the polynucleotide sequence encoding an scAAV comprises a left end ITR and a right end ITR. In some embodiments: (i) the left end ITR comprises the sequence of SEQ ID NO: 18; (ii) the right end ITR comprises the sequence of SEQ ID NO: 19; or (iii) the left end ITR comprises the sequence of SEQ ID NO: 18 and the right end ITR comprises the sequence of SEQ ID NO: 19.

[0080] In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 11 , or SEQ ID NO: 12, or a sequence having at least 80% identity (e.p., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 11 , or SEQ ID NO: 12. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding a cap gene is inserted before position 550 of SEQ ID NO: 20.

[0081] In some embodiments, the polynucleotide sequence encoding an scAAV comprises a polynucleotide sequence encoding a transgene. Any suitable transgene may be used. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, and the polynucleotide sequence encoding a transgene is inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is or comprises a gene listed in Fig. 29 of WO 2022 / 182986, or a variant thereof.Compositions

[0082] Also provided herein is a composition comprising any of the Payload / Cap plasmids disclosed herein. For example, provided herein is a composition comprising; any one of the Payload / Cap plasmids disclosed herein; and a Rep / Helper plasmid comprising a polynucleotide sequence of SEQ IDNO: 22, SEQ ID NO: 23, SEQ ID NO: 1 , or SEQ ID NO: 2, wherein the Rep / Helper plasmid does not comprise a polynucleotide sequence encoding a cap gene.

[0083] In some embodiments, the composition comprises no more than two distinct plasmids.

[0084] In some embodiments, the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is from 1 .5:1 to 1 :10. In some embodiments, the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is from 1 .5:1 to 1 :6. In some embodiments, the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is 1 :3.

[0085] In some embodiments, the Rep / Helper plasmid lacks a polynucleotide sequence encoding 23K endoprotease (which contributes to assembly of the adenovirus virion) and / or a polynucleotide sequence encoding fiber element (which is one of the three major adenovirus capsid proteins).

[0086] For example, in another aspect, provided herein is a composition comprising: (i) aPayload / Cap plasmid comprising: a polynucleotide sequence encoding a cap gene and a polynucleotide sequence encoding an scAAV, wherein the Payload / Cap plasmid does not comprise a polynucleotide encoding a rep gene; and (ii) a Rep / Helper plasmid comprising a polynucleotide sequence encoding a rep gene and a polynucleotide sequence comprising one or more viral helper genes, wherein the Rep / Helper plasmid does not comprise a polynucleotide sequence encoding a cap gene, wherein the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is from 1 .5:1 to 1 :10.

[0087] In some embodiments, the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is from 1 .5:1 to 1 :6. In some embodiments, the plasmid ratio of the Rep / Helper plasmid to the Payload / Cap plasmid is 1 :3.

[0088] In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 11 , or SEQ ID NO: 12. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding a cap gene is inserted before position 550 of SEQ ID NO: 20.

[0089] In some embodiments, the polynucleotide sequence encoding an scAAV encodes a payload flanked by a left end inverted terminal repeat (ITR) and a right end ITR. Any suitable ITRs may be used, including any ITRs disclosed herein (e.g., in Table 5) or variants thereof. In some embodiments: (i) the left end ITR comprises the sequence of SEQ ID NO: 18; (ii) the right end ITR comprises the sequence of SEQ ID NO: 19; or (Hi) the left end ITR comprises the sequence of SEQ ID NO: 18 and the right end ITR comprises the sequence of SEQ ID NO: 19.

[0090] In some embodiments, the payload comprises a transgene. In some embodiments, the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, and a polynucleotide sequence encoding the transgene is inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is or comprises a gene listed in Fig. 29 of WO 2022 / 182986, or a variant thereof.

[0091] Any suitable transgene may be included in an scAAV vector as disclosed herein, including any of the transgenes disclosed herein.

[0092] Any suitable cap gene may be used in an scAAV vector as disclosed herein. In some embodiments, the cap gene is selected from the cap gene of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6,AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02, AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11.10, AAVC11.11 , AAVC11.12, AAVC11.13, AAVC11 .14, AAVC11 .15, AAVC11 .16, AAVC11 .17, AAVC11 .18, AAVC11 .19, AAV-DJ, AAV-LK03, AAV- LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, or a hybrid AAV.

[0093] Any suitable Rep / Helper plasmid may be used to produce an scAAV vector as disclosed herein. In some embodiments, the Rep / Helper plasmid comprises a polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1 , or SEQ ID NO: 2

[0094] In some embodiments, the composition comprises no more than two distinct plasmids.Host Cells and Methods of Production for scAAV

[0095] In some embodiments, any one of the compositions disclosed herein is for use in producing an AAV (e.g., scAAV) vector.

[0096] In another aspect, provided herein is a host cell comprising any one of the compositions disclosed herein. In some embodiments, the host cell is a mammalian host cell. In some embodiments, the mammalian host cell is a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the mammalian host cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers of greater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293 cell is a Viral Production Cells (VPC) 2.0 cell.

[0097] In another aspect, provided herein is a method of manufacturing a packaged scAAV vector, comprising delivering to a cell any one of the compositions disclosed herein and incubating the cell for a time and under conditions sufficient for producing a packaged scAAV vector.

[0098] In some embodiments, the delivery comprises use of a chemical transfection reagent. In some embodiments, the chemical transfection reagent comprises a cationic lipid-based transfection reagent. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the mammalian cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers of greater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293F cell is a VPC 2.0 cell.In another aspect, provided herein is a host cell comprising any one of the Payload / Cap plasmids disclosed herein or any one of the compositions disclosed herein. In some embodiments, the host cell is a mammalian cell. In some embodiments, the mammalian cell is a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the mammalian cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers ofgreater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293F cell is a VPC 2.0 cell.Heterologous Nucleic AcidsPayloads

[0099] In some embodiments, one or more vectors or constructs described herein may comprise a polynucleotide sequence encoding one or more payloads. In accordance with various aspects, any of a variety of payloads may be used (e.g., those with a diagnostic and / or therapeutic purpose), alone or in combination. In some embodiments, a payload may be or comprise a polynucleotide sequence encoding a peptide or polypeptide. In some embodiments, a payload is a peptide that has cell-intrinsic or cell- extrinsic activity that promotes a biological process to treat a medical condition. In some embodiments, a payload may be or comprise a transgene (also referred to herein as a gene of interest (GOI)). In some embodiments, a payload may be or comprise one or more inverted terminal repeat (ITR) sequences (e.g., one or more AAV ITRs). In some embodiments, a payload may be or comprise one or more transgenes with flanking ITR sequences. The ITR sequence may be a sequence set forth in Table 5 or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to a sequence set forth in Table 5. In some embodiments, the ITR sequences include a left end ITR comprising the sequence of SEQ ID NO: 18, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 18. In some embodiments, the ITR sequences include a right end ITR comprising the sequence of SEQ ID NO: 19, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 19. In some embodiments, the ITR sequences include (i) a left end ITR comprising the sequence of SEQ ID NO: 18, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 18 and (ii) a right end ITR comprising the sequence of SEQ ID NO: 19, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 19. In some embodiments, a payload may be or comprise one or more transgenes with flanking homology arm sequences. In some embodiments, a payload may be or comprise one or more transgenes with flanking homology arm sequences and flanking ITRs. In some embodiments, a payload may be or comprise one or more heterologous nucleic acid sequences encoding a reporter gene (e.g., a fluorescent or luminescent reporter). In some embodiments, a payload may be or comprise one or more biomarkers (e.g., proxy for payload expression). In some embodiments, expression constructs comprise one or more transcription termination sequences (e.g., a polyA sequence). In some embodiments, expression constructs comprise one or more promoter sequences. In some embodiments, expression constructs comprise one or more enhancer sequences. In some embodiments, expression constructs comprise one or more intron sequences. In some embodiments, a payload may comprise a sequence for polycistronic expression (including, e.g., a 2A peptide, or intronic sequence, internal ribosomal entry site). In some embodiments, 2A peptides are small (e.g., approximately 18-22 amino acids) peptide sequences enabling co-expression of two or more discrete protein products within a single coding sequence. In some embodiments, 2A peptides allows co-expression of two or more discrete protein products regardless of arrangement of protein coding sequences. In some embodiments, 2A peptides are or comprise a consensus motif (e.g., DVEXNPGP). In some embodiments, 2A peptides promote protein cleavage. In some embodiments, 2A peptides are or comprise viral sequences (e.g., foot-and-mouth diseases virus (F2A), equine Rhinitis A virus, porcine teschovirus-1 (P2A), or Thosea asigna virus (T2A)).

[0100] In some embodiments, biomarkers are or comprise a 2A peptide (e.g., P2A, T2A, E2A, and / or F2A). In some embodiments, biomarkers are or comprise a Furin cleavage motif (See, Tian et al., FurinDB: A Database of 20-Residue Furin Cleavage Site Motifs, Substrates and Their Associated Drugs, (2011 ), Int. J. Mol. Sci., vol. 12: 1060-1065). In some embodiments, biomarkers are or comprise a tag (e.g., an immunological tag). In some embodiments, a payload may comprise one or more functional nucleic acids (e.g., one or more siRNA or miRNA). In some embodiments, a payload may comprise one or more inhibitory nucleic acids (including, e.g., ribozyme, miRNA, siRNA, or shRNA, among other things). In some embodiments, a payload may comprise one or more nucleases (e.g., Cas proteins, endonucleases, TALENs, ZFNs).Transgenes

[0101] In some embodiments, a transgene is a corrective gene chosen to improve one or more signs and / or symptoms of a disease, disorder, or condition. In some embodiments, a transgene may integrate into a host cell genome through use of vector(s) encompassed by the present disclosure. In some embodiments, transgenes are functional versions of disease associated genes (i.e., gene isoform(s) that are associated with the manifestation or worsening of a disease, disorder or condition) found in a host cell. In some embodiments, transgenes are an optimized version of disease-associated genes found in a host cell (e.g., codon optimized or expression-optimized variants). In some embodiments, transgenes are variants of disease-associated genes found in a host cell (e.g., functional gene fragment or variant thereof). In some embodiments, a transgene is a gene that causes expression of a peptide that is normally expressed in one or more healthy tissues. In some embodiments, a transgene is a gene that causes expression of a peptide that is normally expressed in liver cells. In some embodiments, a transgene is a gene that causes expression of a peptide that is normally expressed in muscle cells. In some embodiments, a transgene is a gene that causes expression of a peptide that is normally expressed in central nervous system cells.

[0102] In some embodiments, a transgene may be or comprise a gene that causes expression of a peptide that is not normally expressed in one or more healthy tissues (e.g., peptide expressed ectopically). In some embodiments, a transgene is a gene that causes expression of a peptide that is ectopically expressed in one or more healthy tissues (e.g., liver, muscle, central nervous system (CNS)). In some embodiments, a transgene is a gene that causes expression of a peptide that is ectopically expressed in one or more healthy tissues and normally expressed in one or more healthy tissues (e.g., liver, muscle, central nervous system (CNS)).

[0103] In some embodiments, a transgene may be or comprise a gene encoding a functional nucleic acid. In some embodiments, a therapeutic agent is or comprises an agent that has a therapeutic effect upon a host cell or subject (including, e.g., a ribozyme, guide RNA (gRNA), antisense oligonucleotide (ASO), miRNA, siRNA, and / or shRNA). For example, in some embodiments, atherapeutic agent promotes a biological process to treat a medical condition, e.g., at least one symptom of a disease, disorder, or condition.

[0104] In some embodiments, transgene expression in a subject results substantially from integration at a target locus. In some embodiments, 75% or more (e.g., 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, 99.5% or more) of total transgene expression in a subject is from transgene integration at a target locus. In some embodiments, 25% or less (e.g., 20% or less, 15% or less, 10% or less, 5% or less, 1% or less, 0.5% or less, 0.1% or less) of total transgene expression in a subject is from a source other than transgene integration at a target locus (e.g., episomal expression, integration at a non-target locus).

[0105] In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.). In some embodiments, 75% or more (e.g., 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, 99.5% or more) of total transgene expression in a subject is from transient expression. In some embodiments, 25% or less (e.g., 20% or less, 15% or less, 10% or less, 5% or less, 1% or less, 0.5% or less, 0.1% or less) of total transgene expression in a subject is from a source other than transient expression (e.g., integration at a non-target locus). In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for one or more weeks after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for one or more months after treatment.

[0106] In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) one or more weeks after treatment at a level comparable to that observed within one or more days after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) one or more months after treatment at a level comparable to that observed within one or more days after treatment.

[0107] In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) one or more weeks after treatment at a level that is reduced relative to that observed within one or more days after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) one or more months after treatment at a level that is reduced relative to that observed within one or more days after treatment.

[0108] In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for no more than one month after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for no more than two months after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for no more than three months after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for no more than four months after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression fromplasmids, minicircle DNAs, viruses, etc.) for no more than five months after treatment. In some embodiments, transgenes are transiently expressed in a subject (e.g., episomal expression from plasmids, minicircle DNAs, viruses, etc.) for no more than six months after treatment.Homology arms

[0109] In some embodiments, viral vectors described herein comprise one or more flanking polynucleotide sequences with significant sequence homology to a target locus (e.g., homology arms). In some embodiments, homology arms flank a polynucleotide sequence encoding a payload (e.g., transgene). In some embodiments, homology arms flank a polynucleotide sequence encoding a transgene. In some embodiments, homology arms direct site-specific integration of a payload (e.g., transgene). In some embodiments, a payload may comprise homology arms and a transgene, wherein the homology arms direct site-specific integration of the transgene.

[0110] In some embodiments, homology arms are of the same length (also referred to herein as balanced homology arms or even homology arms). In some embodiments, viral vectors comprising homology arms of the same length, wherein the homology arms are at least a certain length, provide improved effects (e.g., improved rate of target integration). In some embodiments, homology arms are between 50 nt and 500 nt in length. In some embodiments, homology arms are between 50 nt and 100 nt in length. In some embodiments, homology arms are between 100 nt and 1000 nt in length. In some embodiments, homology arms are between 200 nt and 1000 nt in length. In some embodiments, homology arms are between 500 nt and 1500 nt in length. In some embodiments, homology arms are between 1000 nt and 2000 nt in length. In some embodiments, homology arms are greater than 2000 nt in length. In some embodiments, each homology arm is at least 750 nt in length. In some embodiments, each homology arm is at least 1000 nt in length. In some embodiments, each homology arm is at least 1250 nt in length. In some embodiments, homology arms are less than 1000 nt in length.

[0111] In some embodiments, homology arms are of different lengths (also referred to herein as unbalanced homology arms or uneven homology arms). In some embodiments, viral vectors comprising unbalanced homology arms of different lengths provide improved effects (e.g., increased rate of target site integration) as compared to a reference sequence. In some embodiments, viral vectors comprising homology arms of different lengths, wherein each homology arm is at least a certain length, provide improved effects (e.g., increased rate of target site integration) as compared to a reference sequence (e.g., a viral vector comprising homology arms of the same length or a viral vector comprising one or more homology arms less than 1000 nt in length).

[0112] In some embodiments, each homology arm is greater than 50 nt in length. In some embodiments, each homology arm is greater than 100 nt in length. In some embodiments, each homology arm is greater than 200 nt in length. In some embodiments, each homology arm is greater than 500 nt in length. In some embodiments, each homology arm is at least 750 nt length. In some embodiments, each homology arm is at least 1000 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1000 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1100 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1200 nt in length. In some embodiments, one homology arm is at least 750 nt in lengthand another homology arm is at least 1300 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1400 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1500 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1600 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1700 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1800 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 1900 nt in length. In some embodiments, one homology arm is at least 750 nt in length and another homology arm is at least 2000 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1100 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1200 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1300 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1400 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1500 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1600 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1700 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1800 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 1900 nt in length. In some embodiments, one homology arm is at least 1000 nt in length and another homology arm is at least 2000 nt in length. In some embodiments, one homology arm is at least 1300 nt in length and another homology arm is at least 1400 nt in lengthin some embodiments, a 5’ homology arm is longer than a 3’ homology arm. In some embodiments, a 3’ homology arm is longer than a 5’ homology arm.

[0113] In some embodiments, homology arms contain at least 70% homology to a target locus. In some embodiments, homology arms contain at least 80% homology to a target locus. In some embodiments, homology arms contain at least 90% homology to a target locus. In some embodiments, homology arms contain at least 95% homology to a target locus. In some embodiments, homology arms contain at least 99% homology to a target locus. In some embodiments, homology arms contain 100% homology to a target locus.

[0114] In some embodiments, viral vectors comprising homology arms provide an increased rate of target site integration as compared to a reference sequence (e.g., viral vectors lacking homology arms). In some embodiments, viral vectors comprising homology arms provide rates of target site integration of 0.01% or more (e.g., 0.05% or more, 0.1 % or more, 0.2% or more, 0.3% or more, 0.4% or more, 0.5% or more, 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more, 1% or more, 1 .5% or more, 2% or more, 5% or more, 10% or more, 20% or more, 30% or more). In some embodiments, viral vectors comprising homology arms provide increasing rates of target site integration over time. In some embodiments, rates of target site integration increase over time relative to an initial measurement of target site integration. In some embodiments, rates of target site integration over time are at least 1 .5Xhigher than an initial measurement of target site integration (e.g., 1 .5X, 2X, 3X, 4X, 5X, 10X, 20X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X, 200X). In some embodiments, rates of target site integration are measured after one or more days. In some embodiments, rates of target site integration are measured after one or more weeks. In some embodiments, rates of target site integration are measured after one or more months. In some embodiments, rates of target site integration are measured after one or more years. In some embodiments, rates of target site integration are measured through assessment of one or more biomarkers (e.g., biomarkers comprising a 2A peptide). In some embodiments, rates of target site integration are measured through assessment of one or more isolated nucleic acids (e.g., mRNA, gDNA). In some embodiments, rates of target site integration are measured through assessment of gene expression (e.g., through immunohistochemical staining).

[0115] Table 1 : Exemplary methods for assessment of target site integration0116] In some embodiments, viral vectors comprising homology arms of different lengths may provide improved gene editing in a species or a model system for a species (e.g., mouse, human, or models thereof). In some embodiments, viral vectors may comprise different combinations of homology arm lengths when optimized for expression in a particular species or a model system for a particular species (e.g., mouse, human, or models thereof). In some embodiments, viral vectors comprising specific combinations of homology arm lengths may provide improved gene editing in one species or a model system of one species (e.g., human, humanized mouse model) as compared to a second species or a model system of a second species (e.g., mouse, pure mouse model). In some embodiments, viralvectors comprising specific combinations of homology arm lengths may be optimized for high levels of gene editing in one species or a model of one species (e.g., human, humanized mouse model) as compared to a second species or a model system of a second species (e.g., mouse, pure mouse model).

[0117] In some embodiments, homology arms direct integration of a transgene immediately behind a highly expressed endogenous gene. In some embodiments, homology arms direct integration of a transgene without disrupting endogenous gene expression (non-disruptive integration).Methods of Treatment

[0118] Compositions and constructs disclosed herein may be used in any in vitro or in vivo application wherein expression of a payload (e.g., transgene) from a particular target locus in a cell while maintaining expression of endogenous genes at and surrounding the target locus. For example, compositions and constructs disclosed herein may be used to treat a disorder, disease, or medical condition in a subject (e.g., through gene therapy).

[0119] In some embodiments, treatment comprises obtaining or maintaining a desired pharmacologic and / or physiologic effect. In some embodiments, a desired pharmacologic and / or physiologic effect may comprise completely or partially preventing a disease (e.g., preventing symptoms of disease). In some embodiments, a desired pharmacologic and / or physiologic effect may comprise completely or partially curing a disease (e.g., curing adverse effects associated with a disease). In some embodiments, a desired pharmacologic and / or physiologic effect may comprise preventing recurrence of a disease. In some embodiments, a desired pharmacologic and / or physiologic effect may comprise slowing progression of a disease. In some embodiments, a desired pharmacologic and / or physiologic effect may comprise relieving symptoms of a disease. In some embodiments, a desired pharmacologic and / or physiologic effect may comprise preventing regression of a disease. In some embodiments, a desired pharmacologic and / or physiologic effect may comprise stabilizing and / or reducing symptoms associated with a disease.In some embodiments, treatment comprises administering a composition before, during, or after onset of a disease (e.g., before, during, or after appearance of symptoms associated with a disease). In some embodiments, treatment comprises combination therapy (e.g., with one or more therapies, including different types of therapies).Diseases of interest

[0120] In some embodiments, compositions and constructs disclosed herein may be used to treat any disease of interest that includes a genetic deficiency or abnormality as a component of the disease.

[0121] In some embodiments, compositions and constructs disclosed herein may be used to treat homocystinuria (HCU). In some embodiments, treatment comprises introduction of a polynucleotide sequence encoding one or more transgenes of interest (e.g., cystathionine beta synthase (CBS), and / or variants thereof). In some embodiments, treatment comprises reduction of aberrant proteins (e.g., nonfunctional proteins) associated with HCU. In some embodiments, treatment comprises reduction of signs and / or symptoms associated with HCU (e.g., ectopia lentis, myopia, iridodenesis, cataracts, optic atrophy, glaucoma, retinal detachment, retinal damage, delayed developmental milestones, intellectual disability,depression, anxiety, obsessive-compulsive disorder, dolichostenomelia, genu valgum, pes cavus, scoliosis, pectus carinatum, pectus excavatum, osteoporosis, increased clot development, thromboembolism, pulmonary embolism, fragile skin, hypopigmentation, malar flushing, inguinal hernia, pancreatitis, kyphosis, spontaneous pneumothorax).

[0122] In some embodiments, compositions and constructs disclosed herein may be used to treat hereditary tyrosinemia. In some embodiments, treatment comprises introduction of a polynucleotide sequence encoding one or more transgenes of interest (e.g., fumarylacetoacetate hydrolase (FAH), and / or variants thereof). In some embodiments, treatment comprises reduction of aberrant proteins (e.g., non-functional proteins) associated with hereditary tyrosinemia. In some embodiments, treatment comprises reduction of signs and / or symptoms associated with hereditary tyrosinemia (e.g., hepatomegaly, jaundice, liver disease, cirrhosis, hepatocarcinoma, fever, diarrhea, melena, vomiting, splenomegaly, edema, coagulopathy, abnormal kidney function, rickets, weakness, hypertonia, ileus, tachycardia, hypertension, neurological crises, respiratory failure, cardiomyopathy).

[0123] In some embodiments, compositions and constructs disclosed herein may be used to treat Wilson disease. In some embodiments, treatment comprises introduction of a polynucleotide sequence encoding one or more transgenes of interest (e.g., ATP7B, and / or variants thereof). In some embodiments, treatment comprises reduction of aberrant proteins (e.g., non-functional proteins) associated with Wilson disease. In some embodiments, treatment comprises reduction of signs and / or symptoms associated with Wilson disease (e.g., fatigue, lack of appetite, abdominal pain, jaundice, Kayser-Fleischer rings, edema, speech problems, problems swallowing, loss of physical coordination, uncontrolled movements, muscle stiffness, liver disease, anemia, depression, schizophrenia, ammenorrhea, infertility, kidney stones, renal tubular damage, arthritis, osteoporosis, osteophytes).Targeted Integration

[0124] In some embodiments, compositions and constructs provided herein direct integration of a payload (e.g., a transgene and / or functional nucleic acid) at a target locus (e.g., an endogenous gene). In some embodiments, compositions and constructs provided herein direct integration of a payload at a target locus in a specific cell type (e.g., tissue-specific loci). In some embodiments, integration of a payload occurs in a specific tissue (e.g., liver, central nervous system (CNS), muscle, kidney, vascular). In some embodiments, integration of a payload occurs in multiple tissues (e.g., liver, central nervous system (CNS), muscle, kidney, vascular).

[0125] In some embodiments, compositions and constructs provided herein direct integration of a payload at a target locus that is considered a safe-harbor site (e.g., albumin, Apolipoprotein A2 (ApoA2), haptaglobin). In some embodiments, a target locus may be selected from any genomic site appropriate for use with methods and compositions provided herein. In some embodiments, a target locus encodes a polypeptide. In some embodiments, a target locus encodes a polypeptide that is highly expressed in a subject (e.g., a subject not suffering from a disease, disorder, or condition, or a subject suffering from a disease, disorder, or condition). In some embodiments, integration of a payload occurs at a 5’ or 3’ end of one or more endogenous genes (e.g., genes encoding polypeptides). In someembodiments, integration of a payload occurs between a 5’ or 3’ end of one or more endogenous genes (e.g., genes encoding polypeptides).

[0126] In some embodiments, compositions and constructs provided herein direct integration of a payload at a target locus with minimal or no off-target integration (e.g., integration at a non-target locus). In some embodiments, compositions and constructs provided herein direct integration of a payload at a target locus with reduced off-target integration compared to a reference composition or construct (e.g., relative to a composition or construct without flanking homology sequences).

[0127] In some embodiments, integration of a transgene at a target locus allows expression of a payload without disrupting endogenous gene expression. In some embodiments, integration of a transgene at a target locus allows expression of a payload from an endogenous promoter. In some embodiments, integration of a transgene at a target locus disrupts endogenous gene expression. In some embodiments, integration of a transgene at a target locus disrupts endogenous gene expression without adversely affecting a target cell and / or subject (e.g., by targeting a safe-harbor site). In some embodiments, integration of a transgene at a target locus does not require use of a nuclease (e.g., Cas proteins, endonucleases, TALENs, ZFNs). In some embodiments, integration of a transgene at a target locus is assisted by use of a nuclease (e.g., Cas proteins, endonucleases, TALENs, ZFNs).

[0128] In some embodiments, integration of a transgene at a target locus confers a selective advantage (e.g., increased survival rate in a plurality of cells relative to other cells in a tissue). In some embodiments, a selective advantage may produce an increased percentage of cells in one or more tissues expressing a transgene.Compositions

[0129] In some embodiments, compositions can be produced using methods and constructs provided herein (e.g., viral vectors (e.g., AAV vectors (e.g., scAAV vectors))). In some embodiments, compositions include liquid, solid, and gaseous compositions. In some embodiments, compositions comprise additional ingredients (e.g., diluents, stabilizer, excipients, adjuvants). In some embodiments, additional ingredients can comprise buffers (e.g., phosphate, citrate, organic acid buffers), antioxidants (e.g., ascorbic acid), low molecular weight polypeptides (e.g., less than 10 residues), various proteins (e.g., serum albumin, gelatin, immunoglobulins), hydrophilic polymers (e.g., polyvinylpyrrolidone), amino acids (e.g., glycine, glutamine, asparagine, arginine, lysine), carbohydrates (e.g., monosaccharides, disaccharides, glucose, mannose, dextrins), chelating agents (e.g., EDTA), sugar alcohols (e.g., mannitol, sorbitol), salt-forming counterions (e.g., sodium, potassium), and / or nonionic surfactants (e.g. Tween™, Pluronics™, polyethylene glycol (PEG)), among other things. In some embodiments, an aqueous carrier is an aqueous pH buffered solution.

[0130] In some embodiments, compositions provided herein may be provided in a range of dosages. In some embodiments, compositions provided herein may be provided in a single dose. In some embodiments, compositions provided herein may be provided in multiple dosages. In some embodiments, compositions are provided over a period of time. In some embodiments, compositions are provided at specific intervals (e.g., varying intervals, set intervals). In some embodiments, dosages may vary depending upon dosage form and route of administration. In some embodiments, compositions provided herein may be provided in dosages between 1 e11 and 1 e14 vg / kg. In some embodiments,compositions provided herein may be provided in dosages between 1 e12 and 1 e13 vg / kg. In some embodiments, compositions provided herein may be provided in dosages between 1 e12 and 1 e14 vg / kg. In some embodiments, compositions provided herein may be provided in dosages between 1 e14 and 1 e15 vg / kg. In some embodiments, compositions provided herein may be provided in dosages of no more than 1 e14 vg / kg. In some embodiments, compositions provided herein may be provided in dosages of no more than 1 e15 vg / kg.Routes of Administration

[0131] In some embodiments, compositions provided herein may be administered to a subject via any one (or more) of a variety of routes known in the art (e.g., parenteral, subcutaneous, intravenous, intracranial, intraspinal, intraocular, intramuscular, intravaginal, intraperitoneal, epicutaneous, intradermal, rectal, pulmonary, intraosseous, oral, buccal, intraportal, intra-arterial, intratracheal, or nasal). In some embodiments, compositions provided herein may be introduced into cells, which are then introduced into a subject (e.g., liver, muscle, central nervous system (CNS), hematologic cells). In some embodiments, compositions provided herein may be introduced via delivery methods known in the art (e.g., injection, catheter).Methods of Producing Viral VectorsProduction of Viral Vectors

[0132] Prior to the present disclosure, production of viral vectors (e.g., AAV (e.g., scAAV)) typically involves the use of three separate expression constructs (e.g., plasmids), one comprising a viral rep gene or gene variant (e.g., AAV rep gene) and a viral cap gene or gene variant (e.g., AAV cap gene), one comprising one or more viral helper genes or gene variants (e.g., adenovirus helper genes), and one comprising a payload (e.g., transgene with flanking ITRs). As used herein, upstream production processes refer to steps involved in generation of viral vectors and downstream production processes refer to steps involved in subsequent processing of viral vectors once generated (i.e., once the desired payload and other components have been integrated into the vector). Among other things, the present disclosure recognizes limitation in previous three-plasmid systems for production or viral vectors. In some embodiments, constructs and methods described in the present disclosure are designed to overcome limitations in previous three-plasmid systems for production of viral vectors through use of the two plasmid systems described herein.

[0133] In some embodiments, production of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) may include both upstream steps to generate viral vectors (e.g., cell-based culturing) and downstream steps to process viral vectors (e.g., purification, formulation, etc.). In some embodiments, upstream steps may comprise one or more of cell expansion, cell culture, cell transfection, cell lysis, viral vector production, and / or viral vector harvest.

[0134] In some embodiments, downstream steps may comprise one or more of separation, filtration, concentration, clarification, purification, chromatography (e.g., affinity, ion exchange, hydrophobic, mixed-mode), centrifugation (e.g., ultracentrifugation), and / or formulation.

[0135] In some embodiments, constructs and methods described herein are designed to increase viral vector yields (e.g., AAV vector yields (e.g., scAAV vector yields)), reduce levels ofreplication-competent viral vectors (e.g., replication competent AAV (rcAAV)), improve viral vectors packaging efficiency (e.g., AAV vector capsid packaging (e.g., scAAV vector capsid packaging)), and / or any combinations thereof, relative to a reference construct or method, for example those in Xiao et al. 1998 and Grieger et al. 2015, each of which is incorporated herein by reference in its entirety.Cell Lines and Transfection Reagents

[0136] In some embodiments, production of viral vectors comprises use of cells (e.g., cell culture ). In some embodiments, production of viral vectors comprises use of cell culture of one or more cell lines (e.g., mammalian cell lines). In some embodiments, production of viral vectors comprises use of HEK293F cell lines or variants thereof (e.g., HEK293T, HEK293F cell lines). In some embodiments, cells are capable of being grown in suspension. In some embodiments, cells are comprised of adherent cells. In some embodiments, cells are capable of being grown in media that does not comprise animal components (e.g., animal serum). In some embodiments, cells are capable of being grown in serum-free media (e.g., F17 media, Expi293 media). In some embodiments, the cell is a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) absence of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or (iii) capable of production of AAV titers of greater than 5 x 1010vg / mL. In some embodiments, the clonal derivative of a HEK293F cell is a VPC 2.0 cell. In some embodiments, production of viral vectors comprises transfection of cells with expression constructs (e.g., plasmids). In some embodiments, cells are selected for high expression of viral vectors (e.g., AAV vectors). In some embodiments, cells are selected for high packaging efficiency of viral vectors (e.g., capsid packaging of AAV vectors). In some embodiments, cells are selected for improved transfection efficiency (e.g., with chemical transfection reagents, including cationic molecules). In some embodiments, cells are engineered for high expression of viral vectors (e.g., AAV vectors). In some embodiments, cells are engineered for high packaging efficiency of viral vectors (e.g., capsid packaging of AAV vectors). In some embodiments, cells are engineered for improved transfection efficiency (e.g., with chemical transfection reagents, including cationic molecules). In some embodiments, cells may be engineered or selected for two or more of the above attributes. In some embodiments, cells are contacted with one or more expression constructs (e.g., plasmids). In some embodiments, cells are contacted with one or more transfection reagents (e.g., chemical transfection reagents, including lipids, polymers, and cationic molecules) and one or more expression constructs. In some embodiments, cells are contacted with one or more cationic molecules (e.g., cationic lipid, PEI reagent) and one or more expression constructs. In some embodiments, cells are contacted with a PEIMAX reagent and one or more expression constructs. In some embodiments, cells are contacted with a FectoVir-AAV reagent and one or more expression constructs. In some embodiments, cells are contacted with an AAV-MAX reagent (e.g., an AAV-MAX transfection reagent, an AAV MAX booster, and / or an AAV-MAX enhancer) and one or more expression constructs. In some embodiments, cells are contacted with one or more transfection reagents and one or more expression constructs at particular ratios. In some embodiments, ratios of transfection reagents to expression constructs improvesproduction of viral vectors (e.g., improved vector yield, improved packaging efficiency, and / or improved transfection efficiency).Expression Constructs

[0137] In some embodiments, expression constructs are or comprise one or more polynucleotide sequences (e.g., plasmids). In some embodiments, expression constructs comprise particular polynucleotide sequence elements (e.g., payloads, promoters, viral genes, etc.). In some embodiments, expression constructs comprise polynucleotide sequences encoding viral genes (e.g., a rep or cap gene or gene variant, one or more helper virus genes or gene variants). In some embodiments, expression constructs of a particular type comprise specific combinations of polynucleotide sequence elements. In some embodiments, expression constructs of a particular type do not comprise specific combinations of polynucleotide sequence elements. In some embodiments, a particular expression construct does not comprise polynucleotide sequence elements encoding both rep and cap genes and / or gene variants.

[0138] In some embodiments, expression constructs comprise polynucleotide sequences encoding wild-type viral genes (e.g., wild-type rep genes, cap genes, viral helper genes, or combinations thereof). In some embodiments, expression constructs comprise polynucleotide sequences encoding viral helper genes or gene variants (e.g., herpesvirus genes or gene variants, adenovirus genes or gene variants). In some embodiments, expression constructs comprise polynucleotide sequences encoding one or more gene copies that express one or more wild-type Rep proteins (e.g., 1 copy, 2 copies, 3 copies, 4 copies, 5 copies, etc.). In some embodiments, expression constructs comprise polynucleotide sequences encoding a single gene copy that expresses one or more wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, Rep78, or combinations thereof). In some embodiments, expression constructs comprise polynucleotide sequences encoding one or more wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, Rep78, or combinations thereof). In some embodiments, expression constructs comprise polynucleotide sequences encoding at least four wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, Rep78). In some embodiments, expression constructs comprise polynucleotide sequences encoding each of Rep68, Rep40, Rep52, and Rep78. In some embodiments, expression constructs comprise polynucleotide sequences encoding one or more wild-type adenoviral helper proteins (e.g., E2 and E4).

[0139] In some embodiments, expression constructs comprise wild-type polynucleotide sequences encoding wild-type viral genes (e.g., rep genes, cap genes, helper genes). In some embodiments, expression constructs comprise modified polynucleotide sequences (e.g., codon- optimized) encoding wild-type viral genes (e.g., rep genes, cap genes, helper genes). In some embodiments, expression constructs comprise modified polynucleotide sequences encoding modified viral genes (e.g., rep genes, cap genes, helper genes). In some embodiments, modified viral genes are designed and / or engineered for certain improvements (e.g., improved transduction, tissue specificity, reduced size, reduced immune response, improved packaging, reduced rcAAV levels, etc.).

[0140] In accordance with various embodiments, expression constructs disclosed herein may offer increased flexibility and modularity as compared to previous technologies. In some embodiments, expression constructs disclosed herein may allow swapping of various polynucleotide sequences (e.g.,different rep genes, cap genes, payloads, helper genes, promoters, etc.) while providing certain improvements (e.g., increased viral vector yield, increased packaging, reduced rcAAV levels, etc.). In some embodiments, expression constructs disclosed herein are compatible with various upstream production processes (e.g., different cell culture conditions, different transfection reagents, etc.) while providing certain improvements (e.g., increased viral vector yield, increased packaging, reduced rcAAV levels, etc.).

[0141] In some embodiments, expression constructs of different types comprise different combinations of polynucleotide sequences. In some embodiments, an expression construct of one type comprises one or more polynucleotide sequence elements (e.g., payloads, promoters, viral genes, etc.) that is not present in an expression construct of a different type. In some embodiments, an expression construct of one type comprises polynucleotide sequence elements encoding a viral gene (e.g., a rep or cap gene or gene variant) and polynucleotide sequence elements encoding a payload (e.g., a transgene and / or functional nucleic acid). In some embodiments, an expression construct of one type comprises polynucleotide sequence elements encoding one or more viral genes (e.g., a rep or cap gene or gene variant and / or one or more helper virus genes). In some embodiments, an expression construct of one type comprises polynucleotide sequence elements encoding one or more viral genes, wherein the viral genes are from one or more virus types (e.g., genes or gene variants from AAV and adenovirus). In some embodiments, viral genes from adenovirus are genes and / or gene variants. In some embodiments, viral genes from adenovirus are one or more of E2A (e.g., E2A DNA Binding Protein (DBP), E4 (e.g., E4 Open Reading Frame (ORF) 2, ORF3, ORF4, ORF6 / 7), VA, and / or variants thereof. In some embodiments, expression constructs are used for production of viral vectors (e.g., through cell culture). In some embodiments, expression constructs are contacted with cells in combination with one or more transfection reagents (e.g., chemical transfection reagents). In some embodiments, expression constructs are contacted with cells at particular ratios in combination with one or more transfection reagents. In some embodiments, expression constructs of different types are contacted with cells at particular ratios (e.g., weight ratios) in combination with one or more transfection reagents. In some embodiments, expression constructs of different types are contacted with cells at about a 10:1 , 9:1 , 8:1 , 7:1 , 6:1 , 5:1 , 4:1 , 3:1 , 2:1 , 1 .5:1 , 1 :1 , 1 :1 .5, 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, or 1 :10 ratio (e.g., weight ratio). In some embodiments, expression constructs of different types are contacted with cells at about a 1 :3 ratio (e.g., weight ratio). In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at about a 10:1 , 9:1 , 8:1 , 7:1 , 6:1 , 5:1 , 4:1 , 3:1 , 2:1 , 1 .5:1 , 1 :1 , 1 :1 .5, 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, or 1 :10 ratio (e.g., weight ratio) of the first expression construct to the second expression construct. In some embodiments, a first expression construct comprising one or more payloads and a second expression construct comprising one or more viral helper genes are contacted with cells at about a 10:1 , 9:1 , 8:1 , 7:1 , 6:1 , 5:1 , 4:1 , 3:1 , 2:1 , 1.5:1 , 1 :1 , 1 :1.5, 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, or 1 :10 ratio (e.g., weight ratio) of the first expression construct to the second expression construct. In some embodiments, particular ratios of expression constructs improve production of AAV (e.g., scAAV) (e.g., increased viral vector yields, increased packaging efficiency, and / or increased transfection efficiency. In some embodiments, cells are contacted with two or more expression constructs (e.g., sequentially orsubstantially simultaneously). In some embodiments, three or more expression constructs are contacted with cells. In some embodiments, expression constructs comprise one or more promoters (e.g., one or more exogenous promoters). In some embodiments, promoters are or comprise CMV, RSV, CAG, EF1 alpha, PGK, A1 AT, C5-12, MCK, desmin, p5, p40, or combinations thereof. In some embodiments, expression constructs comprise one or more promoters upstream of a particular polynucleotide sequence element (e.g., a rep or cap gene or gene variant). In some embodiments, expression constructs comprise one or more promoters downstream of a particular polynucleotide sequence element (e.g., a rep or cap gene or gene variant).

[0142] In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio greater than or equal to 1 :1 up to 3:1 , wherein viral titer yields are at at least 1 .5X greater than those obtained through administration of a reference system (e.g., a three-plasmid comprising separate plasmids, each encoding one of: 1 ) an AAV rep and AAV cap sequence, 2) relevant sequence from a helper virus, and 3) a payload). In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio greater than or equal to 1 :1 up to 5:1 , wherein viral titer yields are at at least 1 .5X greater than those obtained through administration of a reference system (e.g., a three-plasmid comprising separate plasmids, each encoding one of: 1 ) an AAV rep and AAV cap sequence, 2) relevant sequence from a helper virus, and 3) a payload). In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio greater than or equal to 1 :1 up to 6:1 , wherein viral titer yields are at at least 1 .5X greater than those obtained through administration of a reference system (e.g., a three-plasmid comprising separate plasmids, each encoding one of: 1 ) an AAV rep and AAV cap sequence, 2) relevant sequence from a helper virus, and 3) a payload). In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio greater than or equal to 1 :1 up to 8:1 , wherein viral titer yields are at at least 1 .5X greater than those obtained through administration of a reference system (e.g., a three-plasmid comprising separate plasmids, each encoding one of: 1 ) an AAV rep and AAV cap sequence, 2) relevant sequence from a helper virus, and 3) a payload). In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio greater than or equal to 1 :1 up to 10:1 , wherein viral titer yields are at at least 1 .5X greater than those obtained through administration of a reference system (e.g., a three-plasmid comprising separate plasmids, each encoding one of: 1 ) an AAV rep and AAV cap sequence, 2) relevant sequence from a helper virus, and 3) a payload).

[0143] In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 10:1 and 1 :1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio of 1 :3. In some embodiments, a first expression construct comprising one or moreviral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 9:1 and 1 :1. In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 8:1 and 1 :1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 7:1 and 1 :1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 6:1 and 1 :1. In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 5:1 and 1 :1. In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 4:1 and 1 :1. In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 3:1 and 1 :1. In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 2:1 and 1 :1 .

[0144] In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 2:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 3:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 4:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 5:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 6:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 7:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 8:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 9:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio between 1 :1 and 10:1 . In some embodiments, a first expression construct comprising one or more viral helper genes and a second expression construct comprising one or more payloads are contacted with cells at a ratio of 1 .5:1 .

[0145] In some embodiments, expression constructs comprise one or more polynucleotide sequences encoding elements (e.g., selection markers, origins of replication) necessary for cell culture (e.g., bacterial cell culture, mammalian cell culture). In some embodiments, expression constructs comprise one or more polynucleotide sequences encoding antibiotic resistance genes (e.g., kanamycin resistance genes, ampicillin resistance genes). In some embodiments, expression constructs comprise one or more polynucleotide sequences encoding a bacterial original of replication (e.g., colE1 origin of replication).

[0146] In some embodiments, expression constructs comprise one or more transcription termination sequences (e.g., a polyA sequence). In some embodiments, expression constructs comprise one or more of BGH polyA, FIX polyA, SV40 polyA, synthetic polyA, or combinations thereof. In some embodiments, expression constructs comprise one or more transcription termination sequences downstream of a particular sequence element (e.g., a rep or cap gene or gene variant). In some embodiments, expression constructs comprise one or more transcription termination sequences upstream of a particular sequence element (e.g., a rep or cap gene or gene variant).

[0147] In some embodiments, expression constructs comprise one or more intron sequences. In some embodiments, expression constructs comprise one or more of introns of different origins (e.g., known genes), including but not limited to FIX intron, Albumin intron, or combinations thereof. In some embodiments, expression constructs comprise one or more introns of different lengths (e.g., 133 bp to 4 kb). In some embodiments, expression constructs comprise one or more intron sequences upstream of a particular sequence element (e.g., a rep or cap gene or gene variant). In some embodiments, expression constructs comprise one or more intron sequences within a particular sequence element (e.g., a rep or cap gene or gene variant). In some embodiments, expression constructs comprise one or more intron sequences downstream of particular sequence element (e.g., a rep or cap gene or gene variant). In some embodiments, expression constructs comprise one or more intron sequences after a promoter (e.g., a p5 promoter). In some embodiments, expression constructs comprise one or more intron sequences before a rep gene or gene variant. In some embodiments, expression constructs comprise one or more intron sequences between a promoter and a rep gene or gene variant. In some embodiments, compositions provided herein comprise expression constructs. In some embodiments, compositions comprise: (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wild-type adenoviral helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding one or more cap genes and one or more payloads.

[0148] In some embodiments, compositions comprise a first expression construct that comprises a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 3 below or a variant thereof. In some embodiments, compositions comprise a first expression construct that comprises a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a a portion of a sequence in Table 3 below or a variant thereof. In some embodiments, compositions comprise a first expression construct that consists of a sequence in Table 3 below. In some embodiments, compositions comprise a first expression construct that consists of asequence in Table 3 below. In some embodiments, compositions comprise a first expression construct that consists of a portion of a sequence in Table 3 below.

[0149] Table 3: Exemplary expression construct sequences comprising one or more helper genes and a rep gene.

[0150] In some embodiments, compositions provided herein comprise expression constructs. In some embodiments, compositions comprise: (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wildtype adenoviral helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding one or more cap genes and one or more payloads.

[0151] In some embodiments, compositions comprise a second expression construct comprising a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 4 below or a variant thereof. In some embodiments, compositions comprise a second expression construct comprising a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a portion of a sequence in Table 4 below or a variant thereof. In some embodiments, compositions comprise a second expression construct that consists of a sequence in Table 4 below. In some embodiments, compositions comprise a second expression construct that consists of a portion of a sequence in Table 4 below.

[0152] In some embodiments, compositions comprise a second expression construct comprising a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with SEQ ID NO: 11 . In some embodiments, compositions comprise a second expression construct that consists of: (i) SEQ ID NO: 11 ; (ii) a polynucleotide sequence encoding a cap gene; and (iii) a polynucleotide sequence encoding a payload (e.g., a transgene, ITR, 2A peptide, homology arms, or combinations thereof). In some embodiments, compositions comprise a second expression construct that comprises SEQ ID NO: 11 , wherein a polynucleotide sequence comprising a secquence encoding a cap gene is inserted before position 2025 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a transgene is inserted after position 2663. In some embodiments, compositions comprise a second expression construct that consists of SEQ ID NO: 11 , wherein a polynucleotide sequence encoding a cap gene is inserted before position 2025 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a transgene is inserted after position 2663.

[0153] In some embodiments, compositions comprise a second expression construct comprising a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with SEQ ID NO: 20. In some embodiments, compositions comprise a second expression construct that consists of: (i) SEQ ID NO: 20; (ii) a polynucleotide sequence encoding a cap gene; and (iii) a polynucleotide sequence encoding a payload (e.p., a transgene, ITR, 2A peptide, homology arms, or combinations thereof). In some embodiments, compositions comprise a second expression construct that comprises SEQ ID NO: 20, wherein a polynucleotide sequence comprising a secquence encoding a cap gene is inserted before position 550 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a transgene is inserted before position 626. In some embodiments, compositions comprise a second expression construct that consists of SEQ ID NO: 20, wherein a polynucleotide sequence encoding a capgene is inserted before position 550 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a transgene is inserted before position 626.

[0154] Table 4: Exemplary expression construct sequences, optionally comprising a payload and a cap gene.

[0155] In some embodiments, compositions comprise: (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wild-type adenoviral helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding a capsid protein and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof). In some embodiments, compositions comprise: (i) a first expression construct comprising a sequence outlined in Fig. 29 of WO 2022 / 182986, which is incorporated herein by reference in its entirety; and (ii) a second expression construct comprising a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986. In some embodiments, compositions comprise: (i) a first expression construct comprising a sequence outlined in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct comprising a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986, wherein the first and second expression construct are present in a combination as outlined in a single row of Fig. 29 of WO 2022 / 182986. In some embodiments, compositions comprise: (i) a first expression construct comprising a sequence outlined in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct comprising a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 and a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986, wherein the first and second expression construct are present in a combination as outlined in a single row of Fig. 29 of WO 2022 / 182986, and wherein compositions comprising such a combination of a first expression construct and second expression construct may be administered to one or more cells to produce an exemplary viral vector product, as outlined in Fig. 29 of WO 2022 / 182986.

[0156] In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence outlined in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 11 , wherein a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted after position 2663 of SEQ ID NO: 11 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted before position 2025 of SEQ ID NO: 11 . In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 11 , wherein a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted after position 2663 of SEQ ID NO: 11 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted before position 2025 of SEQ ID NO: 11 , wherein the first and second expression construct are present in a combination as outlined in a single row in Fig. 29 of WO 2022 / 182986. In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 11 , whereina polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted after position 2663 of SEQ ID NO: 11 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted before position 2025 of SEQ ID NO: 11 , wherein the first and second expression construct are present in a combination as outlined in a single row in Fig. 29 of WO 2022 / 182986 and wherein compositions comprising such a combination of a first expression construct and second expression construct may be administered to one or more cells to produce an exemplary viral vector product, as outlined in Fig. 29 of WO 2022 / 182986.

[0157] In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence outlined in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 12, wherein a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2011 -2026 of SEQ ID NO: 12 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2446-2453 of SEQ ID NO: 12. In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 12, wherein a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2011 -2026 of SEQ ID NO: 12 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2446-2453 of SEQ ID NO: 12, wherein the first and second expression construct are present in a combination as outlined in a single row in Fig. 29 of WO 2022 / 182986. In some embodiments, compositions comprise: (i) a first expression construct consisting of a sequence in Fig. 29 of WO 2022 / 182986; and (ii) a second expression construct consisting of a sequence of SEQ ID NO: 12, wherein a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a gene (or variant thereof) outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2011 -2026 of SEQ ID NO: 12 and a polynucleotide sequence encoding a capsid outlined in Fig. 29 of WO 2022 / 182986 is inserted between positions 2446-2453 of SEQ ID NO: 12, wherein the first and second expression construct are present in a combination as outlined in a single row in Fig. 29 of WO 2022 / 182986 and wherein compositions comprising such a combination of a first expression construct and second expression construct may be administered to one or more cells to produce an exemplary viral vector product, as outlined in Fig. 29 of WO 2022 / 182986. In some embodiments insertion of a polynucleotide sequence into SEQ ID NO: 12 results in removal, replacement, and / or deletion of intervening portions of the polynucleotide sequence (e.g., insertion between positions 2011 -2026 results in deletion of former nucleotides at positions 2012-2025 and insertion of a polynucleotide sequence).

[0158] In some embodiments, compositions comprise a first expression construct (e.g. plasmid) that comprises a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 3 or a variant thereof and a second expression construct (e.g. plasmid) that comprises a sequence that has at least 70%, at least75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 4 or a variant thereof. In some embodiments, compositions comprise a first plasmid (e.g. Rep / Helper Plasmid) that comprises a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 3 or a variant thereof and a second plasmid (e.g. Payload / Cap Plasmid) that comprises a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 4 or a variant thereof.ITR Sequences

[0159] Exemplary ITR sequences are provided in Table 5. In some embodiments, an ITR as disclosed herein includes a sequence set forth in Table 5 or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a sequence in Table 5 or a variant thereof.

[0160] In some embodiments, for an scAAV vector, the ITR sequences include a left end ITR comprising the sequence of SEQ ID NO: 18, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 18. In some embodiments, the ITR sequences include a right end ITR comprising the sequence of SEQ ID NO: 19, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 19. In some embodiments, the ITR sequences include (i) a left end ITR comprising the sequence of SEQ ID NO: 18, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 18 and (ii) a right end ITR comprising the sequence of SEQ ID NO: 19, or a sequence having at least 80% identity (e.g., 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity) to SEQ ID NO. 19. In some embodiments, the ITR sequences include (i) a left end ITR comprising the sequence of SEQ ID NO: 18 and (ii) a right end ITR comprising the sequence of SEQ ID NO: 19.

[0161] Table 5: ITR variants and their sequences (left end ITR in 5’ to 3’ orientation)Methods of Characterizing AAV Viral Vectors

[0162] In accordance with various embodiments, viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) may be characterized through assessment of various characteristics and / or features. In some embodiments, assessment of viral vectors can be conducted at various points in a production process. In some embodiments, assessment of viral vectors can be conducted after completion of upstream production steps. In some embodiments, assessment of viral vectors can be conducted after completion of downstream production steps.Viral yields

[0163] In some embodiments, characterization of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprises assessment of viral yields (e.g., viral titer). In some embodiments, characterization of viral vectors comprises assessment of viral yields prior to purification and / or filtration. In some embodiments, characterization of viral vectors comprises assessment of viral yields after purification and / or filtration. In some embodiments, characterization of viral vectors comprises assessing whether viral yield is greater than or equal to 1 e10 vg / mL. In any of the preceding embodiments, the viral vector may be an scAAV vector.

[0164] In some embodiments, characterization of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprises assessing whether viral yield in crude cell lysates is greater than or equal to 1 e11 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude cell lysates is greater than or equal to 5e11 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude cell lysates is greater than or equal to 1 e12 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude lysates is between 5e9vg / mL and 5e11 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude lysates is between 5e9vg / mL and 1 e10 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude lysates is between 1 e10 vg / mL and 1 e11 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crude lysates is between 1 e11 vg / mL and 1 e12 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in crudelysates is between 1 e12 vg / mL and 1 e13 vg / mL. In any of the preceding embodiments, the viral vector may be an scAAV vector.

[0165] In some embodiments, characterization of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprises assessing whether viral yield in purified drug product is greater than or equal to 1 e11 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in purified drug product is greater than or equal to 1 e12 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in purified drug product is between 1 e10 vg / mL and 1 e15 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in purified drug product is between 1 e11 vg / mL and 1 e15 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in purified drug product is between 1 e12vg / mL and 1 e14 vg / mL. In some embodiments, characterization of viral vectors comprises assessing whether viral yield in purified drug product is between 1 e13 and 1 e14 vg / mL. In any of the preceding embodiments, the viral vector may be an scAAV vector.

[0166] In some embodiments, methods and compositions provided herein can provide comparable or increased viral vector (e.g., AAV vectors (e.g., scAAV vectors)) yields as compared to previous methods known in the art. For example, in some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system provide comparable or increased viral vector yields as compared to a three-plasmid system. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular combinations of sequence elements provide comparable or increased viral vector yields as compared to a two-plasmid system with a different combination of sequence elements. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular plasmid ratios provide comparable or increased viral vector yields as compared to a two-plasmid system with different plasmid ratios. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular plasmid ratios provide comparable or increased viral vector yields as compared to a reference (e.g., two-plasmid system with different plasmid ratios, three-plasmid system) under particular culture conditions. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular plasmid ratios provide comparable or increased viral vector yields as compared to a reference (e.g., two-plasmid system with different plasmid ratios, three-plasmid system) under large- scale culture conditions (e.g., greater than 100 mL, greater than 250 mL, greater than 1 L, greater than 10 L, greater than 20 L, greater than 30 L, greater than 40 L, greater than 50 L, etc.). In any of the preceding embodiments, the viral vector may be an scAAV vector.Viral Packaging

[0167] In some embodiments, characterization of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprises assessment of viral packaging efficiency (e.g., percent of full versus empty capsids). In some embodiments, characterization of viral vectors comprises assessment of viral packaging efficiency prior to purification and / or full capsid enrichment (e.g., cesium chloride-based density gradient, iodixanol-based density gradient or ion exchange chromatography). In some embodiments,characterization of viral vectors comprises assessing whether viral packaging efficiency is greater than or equal to 20% prior to purification and / or filtration (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%). In some embodiments, characterization of viral vectors comprises assessment of viral packaging efficiency after purification and / or full capsid enrichment. In some embodiments, characterization of viral vectors comprises assessing whether viral packaging efficiency is greater than or equal to 50% after purification and / or filtration (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%). In any of the preceding embodiments, the viral vector may be an scAAV vector.In some embodiments, methods and compositions provided herein can provide comparable or increased packaging efficiency as compared to previous methods known in the art. For example, in some embodiments, provided methods for producing and / or manufacturing viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprising use of a two-plasmid transfection system provide comparable or increased packaging efficiency as compared to a three-plasmid system. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular combinations of sequence elements provide comparable or increased packaging efficiency as compared to a two-plasmid system with a different combination of sequence elements. In some embodiments, provided methods for producing and / or manufacturing viral vectors comprising use of a two-plasmid transfection system with particular plasmid ratios provide comparable or increased packaging efficiency as compared to a two-plasmid system with different plasmid ratios. In any of the preceding embodiments, the viral vector may be an scAAV vector.Replication competent vector levels

[0168] In some embodiments, characterization of viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprises assessment of levels of replication competent vectors. In some embodiments, characterization of viral vectors comprises assessment of levels of replication competent vectors prior to purification and / or filtration. In some embodiments, characterization of viral vectors comprises assessment of levels of replication competent vectors after purification and / or filtration. In some embodiments, characterization of viral vectors comprises assessing whether replication competent vector levels are less than or equal to 1 rcAAV in 1 E10 vg. In any of the preceding embodiments, the viral vector may be an scAAV vector.

[0169] In some embodiments, methods and compositions provided herein can provide comparable or reduced replication competent vector levels as compared to previous methods known in the art. For example, in some embodiments, provided methods for producing viral vectors (e.g., AAV vectors (e.g., scAAV vectors)) comprising use of a two-plasmid transfection system provide comparable or reduced replication competent vector levels as compared to a three-plasmid system. In some embodiments, provided methods for producing viral vectors comprising use of a two-plasmid transfection system with particular combinations of sequence elements provide comparable or reduced replication competent vector levels as compared to a two-plasmid system with a different combination of sequence elements. In some embodiments, provided methods for producing viral vectors comprise use of a two- plasmid transfection system with one or more intronic sequences inserted in the rep gene provide comparable or reduced replication competent vector levels as compared to a two-plasmid system withoutsaid intronic sequence(s). In any of the preceding embodiments, the viral vector may be an scAAV vector.ExemplificationExample 1 : Determination of optimized molar ratios of Rep / Helper : Payload / Cap plasmids to achieve improved volumetric yield in 2-plasmid scAAV system

[0170] The present example demonstrates that an optimal molar ratio of Rep / Helper : Payload / Cap plasmids to achieve highest volumetric yield for scAAV9-SMN1 is 1 :3, with molar ratios from 1 :5:1 to 1 :6 showing improved yield compared to a 3-plasmid system.

[0171] The volumetric yield of AAV vectors in HEK293F cells using transient transfection by a 2- plasmid system as described herein was tested. The first plasmid Payload / Cap contained a payload with a gene of interest (GOI) flanked by inverted terminal repeats (ITRs) originating from AAV genome, and an AAV cap gene encoding the capsid viral proteins of a particular AAV serotype. In this experiment, the serotype was AAV9 and the GOI was the transgene survival motor neuron (SMN)1 . The second plasmid Rep / Helper contained an AAV rep gene, and E2A, E4 and VA helper genes from adenovirus. Different molar ratios for Rep / Helper : Payload / Cap were tested. In the 3-plasmid system, three individual plasmids including helper plasmid, Rep / Cap plasmid, and Payload plasmid were used. The molar ratio of these three plasmids in the transfection was 1 .31 :1 .54:1 .

[0172] HEK293F cells were expanded in 125 mL shake flasks for use in AAV vector volumetric yield assessment. Cells were counted using ViCell™ XR Cell Counter to ensure viable cell density was between 2.0e6 - 2.6e6 cells / mL and viability was above 95% at the time of transfection. Transfection mixes were then prepared by sterile filtration of plasmid DNA with Expi293 media as “DNA media.” Plasmids were filtered through a Corning 0.22um polyethersulfone (PES) bottle-top filter by first wetting the membrane with Expi293 media, adding appropriate amount of pDNA to the bottle-top, turning on the vacuum for the filter, and finally flushing the residual DNA on the filter with the remaining media based on the calculation. Transfection reagent FectoVIR®-AAV was then added to DNA media bottle. The transfection mix was kept at room temperature for 30 min. Once the time elapsed, the transfection mix was added to the culture medium at a 10% culture volume fraction (e.g., 10 mL transfection mix was added to 100 mL culture) and cells were incubated at 37eC for 72 hr. Different molar ratio of the Rep / Helper plasmid and Payload / Cap plasmid were tested (Table 6). Transfection parameters are shown in Table 7.

[0173] Table 6: Experimental conditions to determine optimized molar ratios of Rep / Helper : Payload / Cap for scAAV9-SMN1 .

[0174] Table ?: Transfection parameters.

[0175] Cells were harvested 72 h after transfection. 5 mL of culture was transferred to a 15 mL centrifuge tube and 50 pL of a 10 units / pL benzonase in Expi293 media solution was added to the tube and shaken in the incubator horizontally at 37eC and 145 RPM for 15 min. 500 pL of lysis buffer (500 mM Tris pH 8, 20 mM MgCl2, 10% polysorbate-20) was then added to the tube and incubated under the same conditions for 90 min. Finally, 500 pL of 5M NaCI was added to the tubes and incubated for 30 min under the same conditions. After the NaCI incubation, cell lysate was spun down in a centrifuge at 3200g to clarify the harvested culture media. 1 mL of the supernatant, which contained the AAV particles, was collected in 1 .5 mL Eppendorf tubes and stored at -80eC until preparation for sample analysis.

[0176] Vector genome titers were quantified by droplet digital polymerase chain reaction (ddPCR) in lysed crude harvest samples. In this assay, test samples were treated with and without salt active nuclease to confirm that residual plasmid DNAwas packaged in AAV capsids (and thus nuclease resistant). Samples were then subjected to treatment with proteinase K to extract DNA from capsids. Samples were diluted and mixed with ddPCR master mix containing a primers / probe set that binds specifically to the vector payload. A Bio-Rad Automated Droplet Generator was used to generate droplets for each sample, which were then thermocycled to amplify DNA of interest using standard PCR. Positive and negative droplets were quantified using Bio Rad QX200 Droplet Reader and analyzed using Poisson distribution analysis. The number of copies of vector amplicon was corrected by sample preparation to yield concentration of vector genome in units of copies / mL.Example 2: scAAV produced using 2-plasmid system has higher non-empty capsid percentage than scAAV produced from 3-plasmid system

[0177] The present example demonstrates that, before and after full-capsid enrichment by CsCI gradient ultracentrifugation, a 2-plasmid system as described herein has advantages in packaging efficiency compared to 3-plasmid system when producing scAAV (e.g., scAAV9-SMN1 ).

[0178] HEK293F cells were expanded in 2.8 L shake flasks for use in vector production. Cells were counted using ViCell™ XR Cell Counter to ensure viable cell density was between 2.0e6 - 2.6e6 cells / mL and viability was above 95% at the time of transfection. Transfection mixes were then prepared by sterile filtration of plasmid DNA with Expi293 media as “DNA media.” Plasmids were filtered through a Corning 0.22um PES bottle-top filter by first wetting the membrane with Expi293 media, adding appropriate amount of pDNA to the bottle-top, turning on the vacuum for the filter, and finally flushing the residual DNA on the filter with the remaining media based on the calculation. Transfection reagent FectoVIR®-AAV was then added to DNA media bottle. The transfection mix was kept at room temperature for 30 min. Once the time elapsed, the transfection mix was added to the culture medium at a 10% culture volume fraction (e.g., 10 mL transfection mix added to 100 mL culture) and cells were incubated at 37eC for 72 hr. The molar ratio of the Rep / Helper plasmid and Payload / Cap plasmid were 1 :3. The molar ratio of the three plasmids helper : Rep / Cap : Payload in the 3-plasmid system was 1 .31 :1 .54:1 . Lysates were purified by affinity chromatography and packaging efficiency was measured before and after CsCI-based density gradient ultracentrifugation. Size exclusion chromatography with dual wavelength detection measured by high-performance liquid chromatography (HPLC) was utilized to determine the empty-full capsid percentage of the AAV vectors. The two detection wavelengths selected to represent encapsidated transgenes and capsid proteins are 260 nm and 230 nm, respectively. 260nm was to monitor the DNA while the 230nm was to monitor capsid protein. Because this method cannot differentiate partial capsid from full capsid, the result is shown as non-empty capsid percentage. The results are shown in FIG. 2 and Table 8.

[0179] Table 8: Packaging efficiency for selected ratios with two-plasmid system as compared to three-plasmid system.Example 3: Vector purity is comparable between the purified scAAV produced by 2-plasmid system and 3-plasmid system

[0180] Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to determine the purity of the three AAV structural proteins (VP1 , VP2, and VP3) that were present in the samples. Purified scAAV9-SMN1 produced by 2-plasmid system and 3-plasmid system were mixed with lithium dodecyl sulfate (LDS) sample buffer and dithiothreitol (DTT), and then were subjected to heat denaturation. Denatured samples and molecular weight marker were loaded onto a Bis-Tris gel and subsequent application of an electrical field separated protein species based on relative size. Following electrophoresis, the gel was stained with Imperial Protein Stain, washed, and imaged on the LI-COR Odyssey® CLx imager. Imaged software was used to quantify the protein intensity of each band present in every test sample. Viral protein purity was determined by the percentage of the ratio of the sum of VP1 , VP2, and VP3 product peak areas to the total sum of all peak areas. Any peak that was not a product (VP1 , VP2, VP3) peak was considered an impurity. The results are shown in FIG. 3, in which the SDS-PAGE gel shows the purity of purified 2P scAAV and purified 3P scAAV was 100%.Example 4: Double strand AAV genome was packaged in scAAV9-SMN1 vector produced in both 2-plasmid and 3-plasmid system

[0181] In the present example, alkaline agarose gel analysis was used to confirm the vector genome sized packaged in the AAV capsid. 2E10 vg of each vector was loaded in the alkaline gel, which was run at 40V for approximately 16 h in a cold room. The gel was stained by SYBR Gold nucleic acid gel stainand imaged using a BioRad ChemiDoc™ MP Imager. The results are shown in FIG. 4, which shows that the alkaline gel validated the target genome size of scAAV9 produced by the 2-plasmid system and 3-plasmid system.Example 5: scAAV9-SMN1 produced by 2-plasmid system and 3-plasmid system possessed comparable potency in vivo

[0182] The vectors produced in 2-plasmid system and 3-plasmid system were purified by affinity chromatography using POROS™ AAVX affinity resin. Full capsid vectors were enriched by cesium chloride-based density gradient ultracentrifugation and dialysed against PBS using Amicon® cartridges.

[0183] Mice (C57BL / 6) were injected at a dosage of 1 e13 vg / kg with compositions comprising packaged viral vectors produced using 2-plasmid system and 3-plasmid system. The payload contained a CAG promoter sequence followed by human SMN1 gene. Liver, brain, and muscle tissues were harvested 3 days and 1 , 2, 4, and 8 weeks after dosing.

[0184] The vector efficacy in vivo was demonstrated by measuring in the episomal copy number (ECN) and hSMN1 RNA level in the different tissues (FIG. 5). The results showed that scAAV9-SMN1 produced by 2-plasmid system and 3-plasmid system showed similar potency in vivo.Example 6: Evaluation of scAAV production using 2-plasmid approach in different cell lines

[0185] In the present example, production of scAAV using a 2-plasmid system compared to a 3- plasmid system was evaluated in different cell lines. 3P scAAV and 2P scAAV (Rep / Helper to Payload / Cap ratio of 1 :3) showed 2-3 times enhancement in the VPC2.0 cell line when compared to theHek293F cell line (FIG. 6). These results indicate that scAAV can be produced using different cell lines, and that the VPC2.0 cell line can increase the crude titer by 2-3 times.

[0186] VPC2.0 cells and HEK293F cells were expanded in 2.8 L shake flasks for use in vector production. Cells were counted using ViCell™ XR Cell Counter to ensure viable cell density was between 2.0e6 - 2.6e6 cells / mL and viability was above 95% at the time of transfection.VPC2.0 cells were expanded and diluted to a final density of 3 x 106viable cells / m in Viral Production Medium supplemented with 4 mM GlutaMAX™ Supplement. AAV-MAX Enhancer was added to the cells using 1 :100 dilution factor (i.e. 1000 pL was added to transfect 100 mL of cells). The cells were incubated on the shaker in a 37°C incubator while preparing the transfection mix.

[0187] Transfection mixes were then prepared by sterile filtration of plasmid DNA with Expi293 media for Hek293F cell line, Viral-Plex™ Complexation Buffer for VPC2.0 celll line as “DNA media.” Plasmids were filtered through a Corning 0.22 pm PES bottle-top filter by first wetting the membrane with Expi293 media for Hek293F cell line and Viral-Plex™ Complexation Buffer for VPC2.0 celll line, adding appropriate amount of pDNA to the bottle-top, turning on the vacuum for the filter, and finally flushing the residual DNA on the filter with the remaining media based on the calculation. Transfection reagent FectoVIR®-AAV was then added to DNA media bottle for Hek293F cell line. For VPC2.0 cells, AAV-MAX Transfection Booster and AAV-MAX Transfection reagent were mixed in a new tube to form AAV-MAX Transfection Booster / AAV-MAX Transfection Reagent complex. For 100 mL culture, 300 pL AAV-MAX Transfection Booster was added followed by 600 pL AAV-MAX Transfection Reagent and then mixed by gentle pipetting. The premixed AAV-MAX Transfection Booster / AAV-MAX Transfection Reagent complex was then added to DNA media bottle for VPC2.0 cell line.

[0188] The transfection mix for both cell lines was kept at room temperature for 30 min. Once the time elapsed, the transfection mix was added to the culture medium at a 10% culture volume fraction (e.g., 10 mL transfection mix was added to 100 mL culture) and cells were incubated at 37eC for 72 h. The molar ratio of the Rep / Helper plasmid and Payload / Cap plasmid was 1 :3. The molar ratio of the three plasmids helper : Rep / Cap : Payload in the 3-plasmid system was 1 .31 :1 .54:1 .

[0189] Cells were harvested 72 h after transfection. 5 mL of culture was transferred to a 15 mL centrifuge tube and 50 pL of a 10 units / pL benzonase in media solution was added to the tube and shaken in the incubator horizontally at 37eC and 145 RPM for 15 min. 500 pL of lysis buffer (500 mM Tris pH 8, 20 mM MgCL, 10% polysorbate-20) was then added to the tube and incubated under the same conditions for 90 min. Finally, 500 pL of 5M NaCI was added to the tubes and incubated for 30 min under the same conditions. After the NaCI incubation, cell lysate was spun down in a centrifuge at 3200g to clarify the harvested culture media. 1 mL of the supernatant, which contained the AAV particles, was collected in 1 .5 mL Eppendorf tubes and stored at -80eC until preparation for sample analysis.

[0190] Vector genome titers were quantified by droplet digital polymerase chain reaction (ddPCR) in lysed crude harvest samples. In this assay, test samples were treated with and without salt active nuclease to confirm that residual plasmid DNA was packaged in AAV capsids (and thus nuclease resistant). Samples were then subjected to treatment with proteinase K to extract DNA from capsids. Samples were diluted and mixed with ddPCR master mix containing a primers / probe set that binds specifically to the vector payload. A Bio-Rad Automated Droplet Generator was used to generate dropletsfor each sample, which were then thermocycled to amplify DNA of interest using standard PCR. Positive and negative droplets were quantified using Bio Rad QX200 Droplet Reader and analyzed using Poisson distribution analysis. The number of copies of vector amplicon was corrected by sample preparation to yield concentration of vector genome in units of copies / mL.EquivalentsThose skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the following claims:

Claims

ClaimsWe claim:1 . A Payload / Cap plasmid comprising: a polynucleotide sequence encoding a cap gene; and a polynucleotide sequence encoding an scAAV, wherein the Payload / Cap plasmid does not comprise a polynucleotide encoding a rep gene.

2. The Payload / Cap plasmid of claim 1 , wherein the polynucleotide sequence encoding an scAAV comprises a left end ITR and a right end ITR, wherein:(i) the left end ITR comprises the sequence of CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTC GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG (SEQ ID NO: 18);(ii) the right end ITR comprises the sequence of AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGC GACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG AGAGGGAGTGGCC (SEQ ID NO: 19); or(Hi) the left end ITR comprises the sequence of SEQ ID NO: 18 and the right end ITR comprises the sequence of SEQ ID NO: 19.

3. The Payload / Cap plasmid of claim 1 or 2, wherein the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 11 , or SEQ ID NO: 12.

4. The Payload / Cap plasmid of claim 3, wherein the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20.

5. The Payload / Cap plasmid of claim 4, wherein the polynucleotide sequence encoding a cap gene is inserted before position 550 of SEQ ID NO: 20.

6. The Payload / Cap plasmid of any one of claims 1 -5, wherein the polynucleotide sequence encoding an scAAV comprises a polynucleotide sequence encoding a transgene.

7. The Payload / Cap plasmid of claim 6, wherein the Payload / Cap plasmid comprises a polynucleotide sequence of SEQ ID NO: 20, and the polynucleotide sequence encoding a transgene is inserted before position 626 of SEQ ID NO: 20.

8. The Payload / Cap plasmid of claim 6 or 7, wherein the transgene is or comprises one or more of methylmalonyl-CoA mutase (MUT), UDP-glucuronosyltransferase 1 -1 (UGT1A1 ), cystathionine beta synthase (CBS), galactose-1 -phosphate uridyl transferase (GALT), or variants thereof.

9. The Payload / Cap plasmid of any one of claims 1 -8, wherein the cap gene is selected from the cap gene of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAVC11 .01 , AAVC11 .02, AAVC11 .03, AAVC11 .04, AAVC11 .05, AAVC11 .06, AAVC11 .07, AAVC11 .08, AAVC11 .09, AAVC11 .10, AAVC11 .11 , AAVC11 .12, AAVC11 .13, AAVC11 .14, AAVC11 .15, AAVC11 .16, AAVC11 .17, AAVC11 .18, AAVC11 .19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV 13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, or a hybrid AAV.

10. A composition comprising: the Payload / Cap plasmid of any one of claims 1 -9; and a Rep / Helper plasmid comprising a polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1 , or SEQ ID NO: 2, wherein the Rep / Helper plasmid does not comprise a polynucleotide sequence encoding a cap gene.11 . The composition of claim 10, wherein the composition comprises no more than two distinct plasmids.

12. The composition of claim 10 or 11 , for use in producing an AAV vector.

13. A host cell comprising the Payload / Cap plasmid of any one of claims 1 -9 or the composition of any one of claims 10-12.

14. The host cell of claim 13, wherein the host cell is a mammalian host cell.

15. The host cell of claim 13 or 14, wherein the mammalian host cell is a HEK293F cell or a derivative of a HEK293F cell.

16. The host cell of claim 15, wherein the mammalian host cell is a HEK293F cell.

17. The host cell of claim 15, wherein the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties:(i) absence of SV40 large T antigen;(ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or(iii) capable of production of AAV titers of greater than 5 x 1010vg / mL.

18. The host cell of claim 17, wherein the clonal derivative of a HEK293 cell is a Viral Production Cells (VPC) 2.0 cell.

19. A method of manufacturing a packaged scAAV vector, comprising delivering to a cell a composition of any one of claims 10-12 and incubating the cell for a time and under conditions sufficient for producing a packaged scAAV vector.

20. The method of claim 19, wherein the delivering comprises use of a chemical transfection reagent.21 . The method of claim 20, wherein the chemical transfection reagent comprises a cationic lipid-based transfection reagent.

22. The method of any one of claims 19-21 , wherein the cell is a mammalian cell.

23. The method of claim 22, wherein the mammalian cell is a HEK293F cell or a derivative of a HEK293F cell.

24. The method of claim 23, wherein the mammalian cell is a HEK293F cell.

25. The method of claim 23, wherein the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties:(i) absence of SV40 large T antigen;(ii) capable of growth in suspension culture at a density of > 12 million cells / mL in chemically defined medium; and / or(iii) capable of production of AAV titers of greater than 5 x 1010vg / mL.

26. The method of 25, wherein the clonal derivative of a HEK293 cell is a VPC 2.0 cell.

Images