A modular system to convert therapeutic microrna expression cassettes from polymerase iii-based to polymerase ii-based promoters
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-02
- Publication Date
- 2026-03-11
AI Technical Summary
Current RNAi-based gene therapies using RNA polymerase III-driven promoters lack tissue-specific expression, which is crucial for effective therapeutic microRNA (miRNA) delivery, as they do not allow for cell or tissue-specific expression and can alter the maturation process of miRNAs, impacting specificity and efficiency.
A modular microRNA expression cassette system that converts RNA polymerase III-based promoters to RNA polymerase II-based promoters, incorporating novel secondary structure elements to facilitate tissue-specific expression while maintaining the fidelity and efficacy of miRNA processing.
Enables rapid conversion of ubiquitous to tissue-specific miRNA expression systems without rederivation of lead RNAi triggers, ensuring accurate and efficient tissue-specific expression of therapeutic miRNAs, thereby improving the specificity and efficacy of RNAi-based therapies.
Smart Images

Figure IMGF000027_0001 
Figure IMGF000028_0001 
Figure IMGF000029_0001
Abstract
Description
28335 / 58942 2023-012-02 A MODULAR SYSTEM TO CONVERT THERAPEUTIC MICRORNA EXPRESSION CASSETTES FROM POLYMERASE III-BASED TO POLYMERASE II-BASED PROMOTERS INCORPORATION BY REFERENCE OF THE SEQUENCE LISTING
[0001] This application contains, as a separate part of disclosure, a Sequence Listing in computer-readable form (Filename: 58942_SeqListing.xml; Size: 59,830 bytes; Created: April 30, 2024) which is incorporated by reference herein in its entirety. FIELD
[0002] This disclosure relates to the field of gene therapy and the use of therapeutic microRNA (miRNA). Specifically, the disclosure provides a modular system, i.e., a DNA expression cassette, designed to convert therapeutic miRNA expression cassettes from the use of ubiquitous RNA polymerase III-based promoters to RNA polymerase II-based promoters for tissue specific expression of the miRNAs while maintaining fidelity and efficacy of processing. BACKGROUND
[0003] Dominant genetic diseases may benefit from RNA interference (RNAi)-based gene therapies. Although RNAi was discovered around 1998, and many RNAi-based gene therapies have been under development since that time, the RNAi-based approach is still emerging translationally and clinically. Many RNAi-based systems rely upon first-generation expression strategies that employ ubiquitous RNA polymerase III (pol III)-driven promoters, such as U6 or H1, to drive shRNA or miRNA expression in vivo. These systems are advantageous because they produce primary miRNA transcripts from defined transcription start and termination sites, thereby enabling consistent processing of predictable mature products through endogenous miRNA biogenesis pathways. However, these pol III-based systems do not allow cell or tissue-specific expression. Commonly used tissue-specific promoters utilize RNA polymerase II (pol II) to drive transcription. These pol II-based systems often have multiple transcription start sites and require poly A signals and transcript poly-adenylation for termination. As a result of these sequence differences, converting a pol III-driven miRNA to a pol II-driven system can change the secondary structure of the primary miRNA transcript, thereby altering the maturation process by the RNAse enzymes Drosha and Dicer. This is important because even a single nucleotide change in a mature miRNA or shRNA sequence can impact specificity and efficiency. Thus, converting an existing pol III-28335 / 58942 2023-012-02 based miRNA expression system to one driven by RNA pol II, and still producing the same mature miRNA, can be challenging.
[0004] Many first-generation miRNA or shRNA expression systems use RNA polymerase III-based promoters to drive expression (e.g. U6, H1, tRNA promoters). Other first generation systems have employed RNA pol II-based promoters, but these systems are less commonly used and tend to produce primary transcripts that are less predictably processed to mature miRNAs. Thus, a system that allows conversion of a pol III-based system to a pol II-based system would allow researchers to leverage pre-clinical data already generated with first- generation RNA pol II-based promoter systems while also restricting expression of a miRNA to specific cell- or tissue-types.
[0005] This disclosure provides several novel miRNA designs which allow for the conversion from an existing U6 promoter-driven miRNA to a tissue-specific, pol II-based system. Novel secondary structure elements were incorporated in the primary transcript regions flanking Drosha and Dicer processing sites, and efficacy and expression of the mature sequences in vitro were confirmed. This system allows for rapid conversion of ubiquitous to tissue-specific miRNA expression systems without rederivation of lead RNAi triggers, while also providing a new approach to restrict expression of therapeutic miRNAs.
[0006] The development of a system and products for convert an existing pol III-based promoter-driven miRNA system to a tissue-specific, pol II-based promoter system while maintaining fidelity of processing and efficacy represents a critical unmet need in the field. SUMMARY
[0007] The disclosure provides a modular microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. As used herein, the terms “expression cassette” or “expression construct” or “DNA construct” are used interchangeably when discussing the miRNA expression cassette because the expression cassette comprises DNA encoding the miRNA and the various components required for efficient tissue-specific expression of the miRNA for use with a polymerase type II (pol II) promoter.
[0008] Thus, the disclosure provides a nucleic acid encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system, wherein the cassette comprises a DNA nucleotide sequence encoding a single stranded stem of a microRNA;28335 / 58942 2023-012-02 a 5’ double-stranded stem of a microRNA; a sense strand of a mature microRNA; a modified microRNA loop comprising a nucleotide change to facilitate folding; an antisense strand of a mature microRNA; a 3’ double-stranded stem of a microRNA; a single-stranded stem of a microRNA; and a polyA signal.
[0009] In some aspects, the cassette comprises a DNA nucleotide sequence encoding the single stranded stem of a microRNA; the 5’ double-stranded stem of a microRNA; the sense strand of mature microRNA; the modified microRNA loop comprising a nucleotide change to facilitate folding; the antisense strand of mature microRNA; the 3’ double-stranded stem of a microRNA; the single-stranded stem of a microRNA; and the polyA signal in a 5’ to 3’ order, respectively, in the expression cassette.
[0010] In some aspects, the cassette comprises a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; the sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; the antisense strand of a mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and the polyA signal.
[0011] In some aspects, the cassette comprises the DNA nucleotide sequence encoding the single stranded stem of mir30; the 5’ double-stranded stem of mir30; the sense strand of a mature microRNA; the modified mir30 loop comprising a nucleotide change to facilitate folding; the antisense strand of a mature microRNA; the 3’ double-stranded stem of mir30; the single-stranded stem of mir30; and the polyA signal in a 5’ to 3’ order, respectively, in the expression cassette.28335 / 58942 2023-012-02
[0012] In some aspects, the single-stranded stem of mir30 comprises the nucleotide sequence of any one of SEQ ID NOs: 20-24, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 20-24
[0013] In some aspects, the 5’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 25.
[0014]
[0015] In some aspects, the sense strand of mature miRNA is the sense strand of any mature miRNA.
[0016] In some aspects, the sense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 17 or 18.
[0017] In some aspects, the modified mir30 loop comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 26.
[0018] In some aspects, the antisense strand of mature miRNA is the antisense strand of any mature miRNA. In some aspects, the antisense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 27 or 28.
[0019] In some aspects, the 3’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 29.
[0020] In some aspects, the mutated single stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 30.
[0021] In some aspects, the polyadenylation (polyA) signal is wild type neuropilin-1 (WT NRP1) polyA signal.
[0022] In some aspects, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 32.
[0023] In some aspects, the cassette further comprises restriction sites for cloning, and wherein the cassette comprises a DNA nucleotide sequence encoding28335 / 58942 2023-012-02 a first restriction enzyme site; a single stranded stem of a microRNA or mir30; a 5’ double-stranded stem of a microRNA or mir30; a sense strand of a mature microRNA; a modified microRNA loop or mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of a mature microRNA; a 3’ double-stranded stem of a microRNA or mir30; a single-stranded stem of a microRNA or mir30; a second restriction enzyme site; a polyA signal; and a third enzyme restriction site.
[0024] In some aspects, the first restriction enzyme site is an AgeI site. In some aspects, the AgeI site comprises the nucleotide sequence of SEQ ID NO: 19.
[0025] In some aspects, the second restriction enzyme site is an AflII site. In some aspects, the AflII site comprises the nucleotide sequence of SEQ ID NO: 31.
[0026] In some aspects, the third restriction site is an EcoR1 site. In some aspects, the EcoR1 site comprises the nucleotide sequence of SEQ ID NO: 33.
[0027] In some aspects, the third restriction site is an MfeI site. In some aspects, the MfeI site comprises the nucleotide sequence of SEQ ID NO: 34.
[0028] In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence encoding the sequence of SEQ ID NO: 35 (ACCGGN1N2N3N4N5N6N7GCUN8N9N10N11ACAGUGAGCGAN12NNNNNNNNNNNNNNNNN NNNNNGUAAAGCCACAGAUGGGNNNNNNNNNNNNNNNNNNNNNNUGCUACUGCN13N14UUAN15N16N17N18N19N20AAUAAAAUACGAAAUN21N22N23N24CN25N26AAUUN27), or a nucleotide sequence comprising at least or about 80% sequence identity to a nucleotide sequence encoding the nucleotide sequence of SEQ ID NO: 35, wherein N1at position 6 is U or is omitted; wherein N2at position 7 is C, A, or U; wherein N3at position 8 is C or is omitted;28335 / 58942 2023-012-02 wherein N4at position 9 is C or is omitted; wherein N5at position 10 is C or is omitted; wherein N6at position 11 is A or is omitted; wherein N7at position 12 is A or U; wherein N8at position 16 is C or G; wherein N9at position 17 is C, A, or U; wherein N10at position 18 is U or G; wherein N11at position 19 is U or G; wherein N12at position 31 is U or G; wherein N13at position 104 is C or U; wherein N14at position 105 is C or U; wherein N15at position 109 is C or is omitted; wherein N16at position 110 is U or is omitted; wherein N17at position 111 is U or is omitted; wherein N18at position 112 is A or is omitted; wherein N19at position 113 is A or is omitted; wherein N20at position 114 is G or is omitted; wherein N21at position 130 is C or G; wherein N22at position 131 is C or U; wherein N23at position 132 is C or G; wherein N24at position 133 is C or A; wherein N25at position 135 is C or A; wherein N26at position 136 is C or G; wherein N27at position 141 is C or G; wherein the first or most 5’ underlined series of multiple N nucleotides represents a mature miRNA sense sequence and the second or most 3’ underlined series of multiple N nucleotides represents a mature miRNA antisense sequence, and wherein, optionally, the sense sequence is placed in the more 3’ position and antisense sequence is placed in the more 5’ position.
[0029] In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence encoding an RNA sequence comprising at least or about 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-16 or 35-53; or a nucleotide sequence that encodes the RNA sequence comprising the nucleotide sequence of any one of SEQ ID NOs: 1-16 or 35-53.28335 / 58942 2023-012-02
[0030] In some aspects, a nucleic acid of the disclosure further comprises a promoter and / or enhancer. In some aspects, the promoter is any polymerase type II (pol II) promoter. In some aspects, the promoter and / or enhancer is any of a U7 promoter and / or enhancer, an RSV promoter and / or enhancer, a human skeletal a-actin (HSA) promoter and / or enhancer, a desmin promoter and / or enhancer, a CMV promoter and / or enhancer, a minimal CMV promoter and / or enhancer, a T7 promoter and / or enhancer, an EF1-alpha promoter and / or enhancer, a minimal EF1-alpha promoter and / or enhancer, an unc45b promoter and / or enhancer, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter, a tMCK promoter and / or enhancer, a dMCK promoter and / or enhancer, a CK1 promoter and / or enhancer, a CK6 promoter and / or enhancer, a CK7 promoter and / or enhancer, a CK8 promoter and / or enhancer, a CK8e promoter and / or enhancer, a synthetic promoter and / or enhancer, a ubiquitous promoter and / or enhancer, a neuronal-specific promoter and / or enhancer, a brain-specific promoter and / or enhancer, or any other muscle- specific promoter and / or enhancer. In some aspects, the promoter and / or enhancer is a CMV promoter and / or enhancer, is an HSA promoter and / or enhancer, is an MPZ promoter and / or enhancer, or is an MCK promoter and / or enhancer. In some aspects, the synthetic promoter and / or enhancer is an SPc5-12 promoter and / or enhancer, an SP-301 promoter and / or enhancer, an MH promoter and / or enhancer, or a Sk-CRM4 / DES promoter and / or enhancer. In some aspects, the neuronal-specific promoter and / or enhancer is a synapsin promoter and / or enhancer.
[0031] The disclosure also provides a vector comprising a nucleic acid of the disclosure. In some aspects, the vector is an adeno-associated virus (AAV) vector. In some aspects, the AAV lacks rep and / or cap genes. In some aspects, the vector is a recombinant AAV (rAAV) vector. In some aspects, the vector is a self-complementary recombinant AAV (scAAV) vector or a single-stranded recombinant AAV (ssAAV) vector. In some aspects, the AAV serotype is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof. In some aspects, the AAV serotype is AAV9, mAAV9, or AAV-SLB101.
[0032] The disclosure further provides a nanoparticle, extracellular vesicle, or exosome comprising a nucleic acid of the disclosure.
[0033] The disclosure provides a composition comprising (a) a nucleic acid of the disclosure;28335 / 58942 2023-012-02 (b) a vector of the disclosure; or (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and a pharmaceutically acceptable carrier.
[0034] The disclosure further provides a method of reducing, inhibiting, and / or interfering with expression of a gene in a cell comprising contacting the cell with (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and / or (d) a composition of the disclosure. In some aspects, the gene is any gene whose expression in a cell is associated with a pathological disease or condition. In some aspects, the gene is PMP22 or DUX4.
[0035] The disclosure further provides a method of treating or ameliorating a subject suffering from or at risk of suffering from a disease associated with DUX4 expression or PMP22 expression comprising administering to the subject an effective amount of (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and / or (d) a composition of the disclosure.
[0036] In some aspects, the disease associated with DUX4 expression is facioscapulohumeral muscular dystrophy (FSHD) or cancer. In some aspects, the disease associated with PMP22 expression is Charcot-Marie-Tooth disease type 1A (CMT1A).
[0037] The disclosure provides a use of (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and / or (d) a composition of the disclosure for the preparation of a medicament for reducing or inhibiting expression of DUX4 or PMP22 in a cell.28335 / 58942 2023-012-02
[0038] The disclosure provides a use of (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and / or (d) a composition of the disclosure for treating or ameliorating facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A).
[0039] The disclosure provides a use of (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure; and / or (d) a composition of the disclosure for the preparation of a medicament for treating or ameliorating FSHD, cancer, or CMT1A.
[0040] The disclosure provides a use of (a) a nucleic acid of the disclosure; (b) a vector of the disclosure; (c) a nanoparticle, extracellular vesicle, or exosome of the disclosure and / or (d) a composition of the disclosure for reducing, inhibiting, and / or interfering with expression of a gene in a cell. In some aspects, the gene is any gene whose expression in a cell is associated with a pathological disease or condition. In some aspects, the gene is PMP22 or DUX4. In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.
[0041] The disclosure provides a (a) nucleic acid of the disclosure;; (b) vector of any one of the disclosure; (c) nanoparticle, extracellular vesicle, or exosome of the disclosure; (d) composition of the disclosure; (e) method of the disclosure; or28335 / 58942 2023-012-02 (f) use of the disclosure, wherein the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, composition, or medicament is formulated for oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebroventricular delivery or injection, intrathecal delivery or injection, transdermal delivery or injection, injection into the blood stream, or aerosol administration.
[0042] Further aspects and advantages of the disclosure will be apparent to those of ordinary skill in the art from a review of the following detailed description, taken in conjunction with the drawings. It should be understood, however, that the detailed description (including the drawings and the specific examples), while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0044] Fig.1 shows the structure of a pol II miRNA expression cassette of the disclosure (i.e., P2.mi871-4). The terminal 5’ end of the nucleic acid construct contains ACCGGT AgeI site (encoding an ACCGGU). The terminal 3’ end contains an EcoRI site (GAATTC, shown here, (encoding a GAAUUC)) in structures 1-4 and an MfeI site in structures 5-8 (CAATTG (encoding a CAAUUG)). The 3’ end of Stem 1 contains an AflII site (CTTAAG (encoding a CUUAAG)).
[0045] Fig.2 shows the U6.mi871 RNA sequence and predicted structure.
[0046] Fig.3 shows the Pol II promoter mi871.4 RNA sequence and predicted structure.
[0047] Fig.4 shows the high levels of off-target expression of mi405 and mi871 in the heart, liver, and kidneys with both Intravenous (IV) and Intrathecal (IT) routes of administration under the control of a U6, pol III, promoter.
[0048] Fig.5 shows two different muscle-specific or Schwann cell-specific promoters to drive expression of either mi405 or mi871, respectively.
[0049] Fig.6 shows the structures of eight novel miRNA designs to convert an existing U6 promoter-driven miRNA to a tissue-specific, pol II-based system. Novel secondary structural28335 / 58942 2023-012-02 elements were incorporated in the primary transcript regions flanking Drosha and Dicer processing sites.
[0050] Fig.7 shows the structure and sequence (SEQ ID NO: 9) of the mi405-1 construct.
[0051] Fig.8 shows the structure and sequence (SEQ ID NO: 10) of the mi405-2 construct.
[0052] Fig.9 shows the structure and sequence (SEQ ID NO: 11) of the mi405-3 construct.
[0053] Fig.10 shows the structure and sequence (SEQ ID NO: 12) of the mi405-4 construct.
[0054] Fig.11 shows the structure and sequence (SEQ ID NO: 13) of the mi405-5 construct.
[0055] Fig.12 shows the structure and sequence (SEQ ID NO: 14) of the mi405-6 construct.
[0056] Fig.13 shows the structure and sequence (SEQ ID NO: 15) of the mi405-7 construct.
[0057] Fig.14 shows the structure and sequence (SEQ ID NO: 16) of the mi405-8 construct.
[0058] Fig.15 shows the structure and sequence (SEQ ID NO: 1) of the mi871-1 construct.
[0059] Fig.16 shows the structure and sequence (SEQ ID NO: 2) of the mi871-2 construct.
[0060] Fig.17 shows the structure and sequence (SEQ ID NO: 3) of the mi871-3 construct.
[0061] Fig.18 shows the structure and sequence (SEQ ID NO: 4) of the mi871-4 construct.
[0062] Fig.19 shows the structure and sequence (SEQ ID NO: 5) of the mi871-5 construct.
[0063] Fig.20 shows the structure and sequence (SEQ ID NO: 6) of the mi871-6 construct.
[0064] Fig.21 shows the structure and sequence (SEQ ID NO: 7) of the mi871-728335 / 58942 2023-012-02 construct.
[0065] Fig.22 shows the structure and sequence (SEQ ID NO: 8) of the mi871-8 construct.
[0066] Fig.23 provides a detailed description of the eight novel miPMP22-871 expression construct sequences of the disclosure. Subparts of each of the sequences are identified.
[0067] Fig.24 provides a detailed description of the eight novel mi405 expression construct sequences of the disclosure. Subparts of each of the sequences are identified.
[0068] Fig.25 provides a clustal alignment of the 16 novel sequences of the miRNA expression cassettes of the disclosure showing the similarities between the sequences and a consensus sequence (SEQ ID NO: 35).
[0069] Fig.26 provides a clustal alignment the miRNA expression cassettes comprising the nucleotide sequences of SEQ ID NOs: 1-8 showing the similarities between the sequences and a consensus sequence (SEQ ID NO: 36).
[0070] Fig.27 provides a clustal alignment the miRNA expression cassettes comprising the nucleotide sequences of SEQ ID NOs: 9-16 showing the similarities between the sequences and a consensus sequence (SEQ ID NO: 37).
[0071] Fig.28 shows that converting a pol III-driven miRNA to a pol II-driven system can change the secondary structure of the primary miRNA transcript, thereby altering the maturation process by the RNAse enzymes Drosha and Dicer.
[0072] Fig.29 shows that pol II-driven miRNAs can be efficiently expressed in vitro, and measured by a droplet digital PCR (ddPCR) assay targeting the mature miRNA sequence.
[0073] Fig.30 shows that knockdown of gene targets was measured using a dual- luciferase assay where either DUX4 or Human PMP22 was cloned into the 3’ UTR of the Renilla Luciferase gene within the Psicheck2 vector.
[0074] Fig.31 shows that the eight constructs designed to knockdown human PMP22 were effective in knockdown with the CMV promoter.
[0075] Fig.32 shows that the eight constructs designed to knockdown human 405 were effective in knockdown with the CMV promoter.
[0076] Fig.33 shows two different muscle-specific pol II promoters (CK6 and HSA) and two different Schwann cell-specific pol II promoters (rat MPZ and human MPZ) that were used to drive expression of mi405 or mi871.28335 / 58942 2023-012-02
[0077] Fig.34 shows that human and rat pol II MPZ promoters were each able to drive expression of mi871 in a rat Schwann cell culture, leading to the reduction of endogenous rat PMP22. Fig.34 also shows that expression of mi871 in rat Schwann Cells was able to reduce relative luciferase assay when co-transfected with Psicheck.HuPMP22 construct. Human skeletal actin (HSA) and creatine kinase 6 (CK6) promoters were sufficient in driving mi405 expression in differentiated C2C12 myotubes with the novel expression cassettes disclosed herein, and both pol II promoters were effective in reducing reduce relative luciferase expression from Psicheck.DUX4. DETAILED DESCRIPTION
[0078] The disclosure provides a novel system for the accurate and rapid conversion of an ubiquitous RNA polymerase III-driven microRNA (miRNA) expression system to an ubiquitous or tissue-specific miRNA expression system relying upon RNA polymerase II. This system is modular, so any pol II-based promoter can be swapped into the expression cassette without rederivation of lead RNAi triggers, while also providing a new approach to restrict expression of therapeutic miRNAs.
[0079] RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi is a gene silencing mechanism that is mediated by small RNAs. Effective and stable gene knockdown can be achieved by the expression of engineered, artificial miRNAs (also called miRNA shuttles) or short hairpin RNAs (shRNAs), both of which are processed into small interfering RNAs (siRNAs). Thus, miRNA and shRNA expression cassettes have been designed to mimic natural miRNA genes and to deliver therapeutic miRNAs. The major distinction between engineered miRNAs and shRNAs is the amount of processing required within the cell to yield a mature, siRNA-like product. Specifically, miRNAs are processed by the enzymes Drosha, Exportin-5 and Dicer, while shRNAs are only processed by Exportin-5 and Dicer. MiRNAs or shRNAs, driven by RNA polymerase II or RNA polymerase III promoters, can induce efficient, stable, and regulated silencing in cultured cells as well as in animal models. The expression of such shRNAs is dependent upon the presence of miRNA biogenesis factors. Therefore, a mechanistic understanding of miRNA processing is crucial for the rational design of accurate and efficient engineered miRNAs or shRNAs.
[0080] RNAi refers to post-transcriptional control of gene expression mediated by microRNAs (miRNAs). The miRNAs are small (21-25 nucleotides), noncoding RNAs that share sequence homology and base-pair with 3' untranslated regions of cognate messenger RNAs (mRNAs). The interaction between the miRNAs and mRNAs directs cellular gene28335 / 58942 2023-012-02 silencing machinery to reduce target mRNA levels in the cell or prevent the translation of the mRNAs. The RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science + Business Media, LLC (2010).
[0081] As an understanding of natural RNAi pathways has developed, researchers have designed artificial miRNAs for use in regulating expression of target genes for treating disease. MiRNAs are small endogenous single-stranded noncoding RNA molecules able to modulate gene expression at the post-transcriptional level. In their mature form, they bind target mRNAs by base pairing their seed sequence to a region located in the target 3′ untranslated region (3′-UTR). This binding leads to repression of gene expression by inhibiting mRNA translation and / or promoting its degradation. Artificial miRNAs can be transcribed from DNA expression cassettes, as disclosed herein. The miRNA sequence specific for a target gene is transcribed along with sequences required to direct processing of the miRNA in a cell.
[0082] MiRNA biogenesis starts with transcription of a long primary transcript, called a pri- miRNA, that, in the canonical pathway, is processed in the nucleus by Drosha and DiGeorge syndrome critical region gene 8 (DCGR8) enzymes (forming the microprocessor complex) and converted into a shorter transcript, called pre-miRNA, after a stem-loop cropping. Inside the cytoplasm, the pre-miRNA transcript is further processed by the endonuclease Dicer, which generates a small RNA duplex intermediate (about 22 nucleotides). Together with the Argonaute (AGO) proteins, an RNA-induced silencing complex (RISC) is formed, which incorporates one strand of miRNA duplex as a template to complementarily bind a region in the 3′-UTR of the target mRNAs. The binding is mediated by a conserved heptametrical sequence, named seed sequence, typically spanning nucleotides 2–7 at the 5′-end of the microRNA sequence.
[0083] The Drosha-DGCR8 complex initiates microRNA maturation by precise cleavage of the stem loops that are embedded in primary transcripts (pri-miRNAs). Han et al. (Cell 125(5): P887-901, 2006; “Han”) proposed a model for this process based on evidence from both computational and biochemical analyses. Han explained that a typical metazoan pri- miRNA consists of a stem of ∼33 bp, with a terminal loop and flanking segments. Han concluded that the terminal loop is unessential, whereas the flanking ssRNA segments are critical for processing. Han published that the cleavage site is determined mainly by the distance (∼11 bp) from the stem-ssRNA junction and that purified DGCR8 interacts with pri- miRNAs both directly and specifically, and the flanking ssRNA segments are vital for this28335 / 58942 2023-012-02 binding to occur. Thus, DGCR8 may function as the molecular anchor that measures the distance from the dsRNA-ssRNA junction.
[0084] miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (precursor miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30)and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA.
[0085] Converting a pol III-driven miRNA to a pol II-driven system (i.e., expression cassette) can change the secondary structure of the primary miRNA transcript, thereby altering the maturation process by the RNAse enzymes Drosha and Dicer. For example, various features of the system need to be converted to accommodate the use of a pol III promoter. For example, a U6 pol III promoter is used with an RNA pol III termination signal whereas a tissue-specific pol II promoter, like CMV, is used with an RNA pol III poly A signal (Fig.5). The use of a pol II promoter is important in the new modular expression cassette construct disclosed herein because it allows for tissue-specific expression of therapeutic miRNAs. Thus, the disclosure provides modular expression cassettes which were designed to take these factors into consideration and allow for the substitution of various miRNAs into the cassettes more readily.
[0086] MiRNA expression cassettes were designed to accurately position the RNAse III enzyme Drosha at a junction between Stem 2 and Stem 1, where Stem 1 is designed to contain as much single-stranded structure as possible. The Drosha / DGCR8 complex (called the microprocessor) is positioned at the junction of single and double-stranded RNA structures (Han et al., Cell 125(5): P887-901, 2006).
[0087] Eight novel miRNA expression cassettes were designed to convert an existing U6 promoter-driven miRNA to a tissue-specific, pol II-based system. Novel secondary structural elements were incorporated in the primary transcript regions flanking Drosha and Dicer processing sites. Fig.6 shows a comparative drawing of the structures of these eight constructs with incorporation of a DNA sequence encoding mi405 (a DUX4-specific miRNA), an exemplary miRNA of interest. The structures of the new mi405 constructs are shown in Figs.7-14, and the structures of the new mi871 constructs are shown in Figs.15-22. The RNA nucleotide sequences encoded by the new miPMP22-871 constructs (SEQ ID NOs: 1-28335 / 58942 2023-012-02 8) are shown in Fig.23, and the RNA nucleotide sequences encoded by the new miDUX4- 405 constructs (SEQ ID NOs: 9-16) are shown in Fig.24.
[0088] The disclosed DNA expression cassette(s) is designed to be used to express any miRNA of interest, and is not limited to an expression cassette(s) comprising the exemplary miRNAs used herein to test the efficacy of the disclosed expression cassette(s). There are numerous miRNA known in the art and the disclosed expression cassette is designed to be used with each of these miRNAs including, but not limited to, miRNAs listed in the microRNA database, known as miRBase (https_colon_forward slash_forward slash_www.mirbase.org. In some aspects, these miRNAs include, but are not limited to, the microRNAs listed at www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism=hsa (Homo sapiens miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =mmu (Mus musculus miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =rno (Rattus norvegicus miRNAs). Thus, the disclosure includes the use of any of these microRNAs in the modular system, i.e., a DNA expression cassette, designed to convert therapeutic miRNA expression cassettes from the use of ubiquitous RNA polymerase III-based promoters to RNA polymerase II-based promoters for tissue specific expression of the miRNAs while maintaining fidelity and efficacy of processing as described herein.
[0089] Clustal alignment of the constructs was carried out (see Figs.25-27) to show sequence similarity and to derive consensus sequences of the novel constructs (SEQ ID NOs: 35-53) such that these constructs may be used with an miRNA of interest.
[0090] Each of the miRNA expression cassettes for converting an RNA polymerase III- based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and a polyadenylation (polyA) signal.
[0091] In some aspects, each of the miRNA expression cassettes for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising in a 5’ to 3’ order a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an28335 / 58942 2023-012-02 antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and a polyadenylation (polyA) signal.
[0092] This pol II-driven miRNA expression cassette was designed to be modular, thereby allowing for its use with (1) any desired RNA polymerase II-based promoter, and (2) any mature sense and antisense strands of microRNA sequence of interest (not only limited to exemplary miRNA sequences disclosed herein. In various aspects, expression cassettes of the disclosure are chemically synthesized.
[0093] In some aspects, an expression cassette of the disclosure also may comprise restriction enzyme sites for cloning. Thus, in some aspects, the expression cassette is a nucleic acid comprising in a 5’ to 3’ order a DNA nucleotide sequence encoding a first restriction enzyme site; a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; a second restriction enzyme site; a polyadenylation (polyA) signal; and a third enzyme restriction site.
[0094] In some aspects, a pol II-driven miRNA expression cassette of the disclosure was designed to be modular, thereby allowing for the cutting and pasting in of (1) any desired RNA polymerase II-based promoter at the indicated AgeI site and (2) any mature sense and antisense strands of microRNA sequence of interest (not only limited to exemplary miRNA sequences disclosed herein) in between the AgeI and Afl II sites in the expression cassette.
[0095] Thus, a modular expression cassette as described herein is designed to be used with any microRNA known in the art. The expression cassette of the disclosure not only allows for the cutting and pasting in of (1) any desired RNA polymerase II-based promoter at the indicated AgeI site but also allows for the cutting and pasting in of (2) any mature sense and antisense strands of microRNA sequence of interest. As such, a nucleotide sequence encoding any mature sense and antisense strands of miRNA of interest may simply be swapped into the expression cassette of the disclosure. Although exemplary microRNA of miDUX4-450 and miPMP22-871 have been described and have been used in the examples provided herein, the modular expression cassette of the disclosure is designed and intended to be used with any microRNA of interest and any pol II-based promoter that is relevant for the particular miRNA.28335 / 58942 2023-012-02
[0096] It is important to note that an expression cassette construct, as disclosed herein may be chemically synthesized. Therefore, there is no requirement for restriction enzyme sites to be present in the construct.
[0097] Thus, in some aspects, the pol II-driven expression cassette is not restricted only to the use of AgeI and AflII restriction sties. For example, to produce constructs shown in SEQ ID NO:8 and SEQ ID NO:16, the AflI site was removed to facilitate unfolding of stem 1 into 5’ and 3’ single-stranded regions. In an exemplary embodiment, where this design is desired, microRNAs can be designed to include the Nrp I poly A signal and cloned into AgeI and EcoRI sites. This is a strategy which can be applied to the insertion of various miRNAs of interest.
[0098] In an exemplary aspect, the first restriction enzyme site is an AgeI site. In an exemplary aspect, the AgeI site comprises a nucleotide sequence encoding ACCGGU (SEQ ID NO: 19).
[0099] In an exemplary aspect, the single-stranded stem of mir30 comprises a nucleotide sequence encoding GGUUGCUGUUGA (SEQ ID NO: 20), GGUUUGCUGAGGA (SEQ ID NO: 21), GGUUUGCUCCUUA (SEQ ID NO: 22), GGUAAGCUCCUUA (SEQ ID NO: 23), or GGUCCCCAAGCUCCUUA (SEQ ID NO: 24).
[0100] In an exemplary aspect, the 5’ double-stranded stem of mir30 comprises a nucleotide sequence encoding CAGUGAGCGAN (SEQ ID NO: 25), wherein N is A, U, C, or G. In the miPMP22-871 constructs, the N is G. In the miDUX4-405 constructs, the N is U).
[0101] In various aspects, the sense strand of mature miRNA and the antisense strand of mature miRNA are strands of mature miRNA of any gene of interest. Thus, this is the purpose of the design of the disclosed modular system, i.e., to allow one to simply insert the sequences encoding any miRNA into the construct for pol II tissue-specific expression of the miRNA.
[0102] Any miRNA includes those found in databases known in the art including, but not limited to, the microRNAs listed in miRBase (https_colon_forward slash_forward slash_www.mirbase.org. In some aspects, these miRNAs include, but are not limited to, the microRNAs listed at www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism=hsa (Homo sapiens miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =mmu (Mus musculus miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =rno (Rattus norvegicus miRNAs). Thus, the disclosure includes the use of28335 / 58942 2023-012-02 any of these microRNAs in the modular system, i.e., a DNA expression cassette, designed to convert therapeutic miRNA expression cassettes from the use of ubiquitous RNA polymerase III-based promoters to RNA polymerase II-based promoters for tissue specific expression of the miRNAs while maintaining fidelity and efficacy of processing as described herein.
[0103] In exemplary aspects, the sense strand of mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17) or miDUX4-405 (i.e., CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18).
[0104] In an exemplary aspect, the modified mir30 loop comprises a nucleotide sequence encoding GUAAAGCCACAGAUGGG (SEQ ID NO: 26).
[0105] In various aspects, the antisense strand of mature miRNA are strands of mature miRNA of any gene of interest. As discussed herein above, this is the purpose of the design of the disclosed modular expression system, i.e., to allow one to simply insert the sequences encoding any miRNA into the construct for pol II tissue-specific expression of the miRNA. In exemplary aspects, the antisense strand of mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., UCUUCAAUCAACAGCAAUCCCC (SEQ ID NO: 27) or miDUX4-405 (i.e., AAACCAGAUCUGAAUCCUGGAC (SEQ ID NO: 28).
[0106] In an exemplary aspect, the 3’ ds stem of mir30 comprises a nucleotide sequence encoding UGCCUACUG (SEQ ID NO: 29).
[0107] In an exemplary aspect, the ss stem of mir30 (mutated) comprises a nucleotide sequence encoding CCUUUUACUU (SEQ ID NO: 30).
[0108] In an exemplary aspect, the second restriction enzyme site is an AflII site. In an exemplary aspect, the AflII site comprises a nucleotide sequence encoding CUUAAG (SEQ ID NO: 31).
[0109] In an exemplary aspect, the polyA signal is wild type neuropilin-1 polyadenylation (WT NRP1 polyA) signal. In an exemplary aspect, the WT NRP1 poly A signal comprises a nucleotide sequence encoding AAUAAAAUACGAAAUGUGACAGA (SEQ ID NO: 32).
[0110] In an exemplary aspect, the third restriction site is an EcoR1 site. In an exemplary aspect, the EcoR1 site comprises a nucleotide sequence encoding GAAUUC (SEQ ID NO: 33). In an exemplary aspect, the third restriction site is an MfeI site. In an exemplary aspect, the MfeI site comprises a nucleotide sequence encoding AAUUG (SEQ ID NO: 34).28335 / 58942 2023-012-02
[0111] The disclosure provides eight exemplary structures designed for the substitution of pol II promoters with pol II promoters, and each of the eight structures was tested with two exemplary miRNAs, miPMP22-871, or mi-871 (GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17), and miDUX4-405, or mi-405 (CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18). See, for example, WO 2022 / 119826 and U.S. Patent Nos.9,469,851 and 10,301,649; and Marina Stavrou et al., (2022) A miRNA-based gene silencing approach for the treatment of CMT1A. Journal of Clinical Investigation Jul 1;132(13):e159814; Wallace et al., (2012) RNA interference inhibits DUX4-induced muscle toxicity in vivo: Implications for a targeted FSHD therapy. Molecular Therapy July;20(7):1417-23; Wallace et al., Pre-clinical safety studies to support translation of AAV-mediated RNAi therapy for FSHD. Mol Ther Methods Clin Dev. Dec 24, 8:121-130; Amini-Chermahini et al., (2019) RNAscope in situ hybridization-based method for detecting DUX4 expression in vitro. RNA Sep;25(19):1211- 1217; and Saad et al., (2021) Human microRNA mir-675 inhibits DUX4 expression and may be exploited as a potential treatment for FSHD. Nature Communications. Dec 8;12(1):7128
[0112] Mi871 is used to induce silencing of overexpressed peripheral myelin protein-22 (PMP22) and constructs of the disclosure are designed to do the same. Mi405 is used to induce silencing of DUX4 protein and constructs of the disclosure are designed to do the same.
[0113] Exemplary embodiments of the system were designed to contain a small poly- adenylation signal derived from the human neuropilin-1 (Nrp1) gene or a modified human neuropilin-1 poly adenylation signal in which the 7 indicated nucleotides (5’-GTGACAG-3’ (SEQ ID NO: 54) , DNA; 5’ GUGACAG (SEQ ID NO: 55), RNA) were mutated to C nucleotides to improve the potential single-strandedness of Stem 1.
[0114] Exemplary embodiments of the system were designed so that the Stem 1 region of the cassette comprises nucleotide sequences with 5’ and 3’ ends ranging from about 15 to about 46 nucleotides in length. In various aspects, however, the Stem 1 region may comprise nucleotide sequences less than or exceed these indicated lengths.
[0115] Exemplary embodiments of the 5’ end of the Stem 1 region comprise base pairs, including G:U RNA wobble base-pairs, ranging from about 0-50% base pairing. Thus, in some aspects, the base pairing is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%. In some aspects, however, the Stem 1 region also comprises base-pairing that exceeds about 50% base pairing.28335 / 58942 2023-012-02
[0116] Exemplary embodiments of the 3’ end of the Stem 1 region comprise base pairs, including G:U RNA wobble base-pairs, ranging from about 0-30% base pairing. Thus, in some aspects, the base pairing is about 5%, about 10%, about 15%, about 20%, about 25%, or about 30%. In some aspects, however, the Stem 1 region also comprises base-pairing that exceeds about 30% base-pairing, and in some aspects, may exceed about 50% base pairing.
[0117] Exemplary embodiments of the microRNA (miRNA) region of the cassette comprises miRNA nucleotide sequences ranging from about 100 to about 200 nucleotides, but the miRNA encoding region may comprise sequences less than or greater than the indicated lengths. In some aspects, the miRNA nucleotide sequences ranges in length from about 120 to about 180 nucleotides. In exemplary aspects of the disclosure, the miRNA region ranges in length from about 136-167 nucleotides in length (see Table 1). The cassettes were designed to contain either natural or artificial microRNAs.
[0118] The disclosure provides nucleic acids comprising nucleotide sequences encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. In some aspects, the cassette comprises a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and a polyA signal.
[0119] In some aspects, the single-stranded stem of mir30 comprises the nucleotide sequence of any one of SEQ ID NOs: 20-24, or a nucleotide sequence comprising at least or about 90% identity to any one of SEQ ID NOs: 20-24.
[0120] In some aspects, the 5’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence comprising at least or about 90% identity to SEQ ID NO: 25.
[0121] In some aspects, the sense strand of mature miRNA is the sense strand of any mature miRNA.
[0122] In some aspects, the sense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 17 or 18.28335 / 58942 2023-012-02
[0123] In some aspects, the modified mir30 loop comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 26.
[0124] In some aspects, the antisense strand of mature miRNA is the antisense strand of any mature miRNA.
[0125] In some aspects, the antisense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 27 or 28.
[0126] In some aspects, the 3’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 29.
[0127] In some aspects, the mutated single stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 30.
[0128] In some aspects, the polyadenylation (polyA) signal is wild type neuropilin-1 polyA signal.
[0129] In some aspects, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 32.
[0130] In some aspects, the cassette comprises each of the above-recited components in a 5’ to 3’ order. Thus, in some aspects, the disclosure provides in a 5’ to 3’ order a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and a polyA signal.28335 / 58942 2023-012-02
[0131] In some aspects, the disclosure provides nucleic acids comprising nucleotide sequences encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. In some aspects, the cassette comprises a DNA nucleotide sequence encoding a first restriction enzyme site; a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; a second restriction enzyme site; a polyA signal; and a third enzyme restriction site.
[0132] In some aspects, the first restriction enzyme site is an AgeI site. In some aspects, the AgeI site comprises the nucleotide sequence of SEQ ID NO: 19.
[0133] In some aspects, the single-stranded stem of mir30 comprises the nucleotide sequence of any one of SEQ ID NOs: 20-24, or a nucleotide sequence comprising at least or about 90% identity to any one of SEQ ID NOs: 20-24.
[0134] In some aspects, the 5’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence comprising at least or about 90% identity to SEQ ID NO: 25.
[0135] In some aspects, the sense strand of mature miRNA is the sense strand of any mature miRNA.
[0136] In some aspects, the sense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 17 or 18.28335 / 58942 2023-012-02
[0137] In some aspects, the modified mir30 loop comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 26.
[0138] In some aspects, the antisense strand of mature miRNA is the antisense strand of any mature miRNA.
[0139] In some aspects, the antisense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 27 or 28.
[0140] In some aspects, the 3’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 29.
[0141] In some aspects, the mutated single stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 30.
[0142] In some aspects, the second restriction enzyme site is an AflII site. In some aspects, the AflII site comprises the nucleotide sequence of SEQ ID NO: 31.
[0143] In some aspects, the polyadenylation (polyA) signal is wild type neuropilin-1 polyA signal.
[0144] In some aspects, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO: 32.
[0145] In some aspects, the third restriction site is an EcoR1 site. In some aspects, the EcoR1 site comprises the nucleotide sequence of SEQ ID NO: 33.
[0146] In some aspects, the third restriction site is an MfeI site. In some aspects, the MfeI site comprises the nucleotide sequence of SEQ ID NO: 34.
[0147] Further provided herein is a nucleic acid comprising a nucleotide sequence encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III- based promoter system to an RNA polymerase II-based promoter system. In some aspects, the cassette comprises a nucleotide sequence encoding the sequence of SEQ ID NO: 35 (ACCGGN1N2N3N4N5N6N7GCUN8N9N10N11ACAGUGAGCGAN12NNNNNNNNNNNNNNNNN NNNNNGUAAAGCCACAGAUGGGNNNNNNNNNNNNNNNNNNNNNNUGCUACUGCN13N14UUAN15N16N17N18N19N20AAUAAAAUACGAAAUN21N22N23N24CN25N26AAUUN27), or a28335 / 58942 2023-012-02 nucleotide sequence comprising at least or about 80% identity to the nucleotide sequence encoding the sequence of SEQ ID NO: 35, wherein N1at position 6 is U or is omitted; wherein N2at position 7 is C, A, or U; wherein N3at position 8 is C or is omitted; wherein N4at position 9 is C or is omitted; wherein N5at position 10 is C or is omitted; wherein N6at position 11 is A or is omitted; wherein N7at position 12 is A or U; wherein N8at position 16 is C or G; wherein N9at position 17 is C, A, or U; wherein N10at position 18 is U or G; wherein N11at position 19 is U or G; wherein N12at position 31 is U or G; wherein N13at position 104 is C or U; wherein N14at position 105 is C or U; wherein N15at position 109 is C or is omitted; wherein N16at position 110 is U or is omitted; wherein N17at position 111 is U or is omitted; wherein N18at position 112 is A or is omitted; wherein N19at position 113 is A or is omitted; wherein N20at position 114 is G or is omitted; wherein N21at position 130 is C or G; wherein N22at position 131 is C or U; wherein N23at position 132 is C or G; wherein N24at position 133 is C or A; wherein N25at position 135 is C or A; wherein N26at position 136 is C or G; wherein N27at position 141 is C or G; and wherein each of the underlined series of multiple N nucleotides represents mature sense and antisense sequences, respectively.
[0148] The disclosure, in exemplary aspects, includes miRNA expression cassettes, wherein the sense strand of the miRNA is 5’ to the antisense strand of the miRNA in the expression cassette. Theoretically, however, since many microRNAs naturally express both strands, an miRNA expression cassette of the disclosure might also comprise the antisense strand of the miRNA 5’ to the sense strand of the miRNA in the expression cassette.
[0149] In the exemplary designs disclosed herein, however, more A:U base pairs were incorporated at the 5’ end of the mature sequence and more G:C base pairs were incorporated at the 3’ end of the antisense sequence to bias incorporation of the antisense strand into the RNA-induced silencing complex (RISC). Since AU has only 2 hydrogen bonds, and GC has three hydrogen bonds, GC base pairs are stronger, and the more thermodynamically unstable end of the mature miRNA can be preferentially incorporated into RISC.
[0150] In various aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system, wherein the nucleic acid comprises a nucleotide sequence set forth in any of SEQ ID NOs: 1-16 or 35-53, or a nucleotide sequence comprising 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%,28335 / 58942 2023-012-02 76%, 75%, 74%, 73%, 72%, 71%, or about 70% identity to a nucleotide sequence set forth in any of SEQ ID NOs: 1-16 or 35-53 (see Table 1).
[0151] Table 1. Sequences of the Disclosure.28335 / 58942 2023-012-0228335 / 58942 2023-012-02wherein N21at position 130 is C or G; wherein N22at position 131 is C or U;28335 / 58942 2023-012-0228335 / 58942 2023-012-0228335 / 58942 2023-012-02
[0152] The disclosure includes various nucleic acids comprising, consisting essentially of, or consisting of the various nucleotide sequences described herein. In some aspects, the nucleic acid comprises the nucleotide sequence. In some aspects, the nucleic acid consists essentially of the nucleotide sequence. In some aspects, the nucleic acid consists of the nucleotide sequence.
[0153] Exemplary nucleotide sequences used in miRNA targeting are described herein and include, but are not limited to, those identified in Table 1 and in the Figures. As disclosed herein, the miRNA expression cassettes of the disclosure are designed to be used with any miRNA and are not limited to the exemplary miRNA disclosed herein.
[0154] Such miRNA include those disclosed in microRNA databases known in the art including, but not limited to, the microRNAs listed in the microRNA database, known as miRBase (https_colon_forward slash_forward slash_www.mirbase.org. In some aspects, these miRNAs include, but are not limited to, the microRNAs listed at www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism=hsa (Homo sapiens miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =mmu (Mus musculus miRNAs), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =rno (Rattus norvegicus miRNAs). Thus, the disclosure includes the use of any of these microRNAs in the modular system, i.e., a DNA expression cassette, designed to convert therapeutic miRNA expression cassettes from the use of ubiquitous RNA polymerase III-based promoters to RNA polymerase II-based promoters for tissue specific expression of the miRNAs while maintaining fidelity and efficacy of processing as described herein.
[0155] In some aspects, the disclosure includes constructs for RNA interference to reduce or inhibit the expression of a gene associated with a detrimental effect when it is expressed. In some aspects, the disclosure provides constructs to be used with any such miRNA to reduce or inhibit expression of the gene for which the miRNA is designed to target.
[0156] In some exemplary aspects, the disclosure provides constructs to be used in inhibiting PMP22 or DUX4 expression. In some exemplary aspects, the miRNA targeting PMP22 is mi871.
[0157] Mi871 is a microRNA which targets the PMP22 gene and is used in treating CMT1A (see WO 2022 / 119826, incorporated herein by reference in its entirety). Thus, the28335 / 58942 2023-012-02 disclosure provides constructs and methods for targeting PMP22 and treating CMT1A. CMT1A is thought to depend on gene dosage effects of PMP22 because CMT1A patients have increased PMP22 mRNA [Yoshikawa et al., Ann. Neurol., 35(4): 445-450 (1994)] and protein [Gabriel et al., Neurology, 49(6): 1635-1640 (2015)] levels in their sural nerve biopsies. Individuals who carry a combination of one deleted and one duplicated PMP22 allele do not present CMT1A-like phenotype as they have a balanced gene dosage. Some CMT1A phenotypes may also result from a different size or type of duplication on chromosome 17p that affects PMP22 expression [Pantera, supra]. CMT1A patients with 1.4 Mb duplication may have variable PMP22 levels in skin biopsies not necessarily correlating with disease severity [Nobbio et al., Brain, 137(Pt 6): 1614-1620 (2014) and Katona et al., Brain, 132(Pt 7): 1734-1740 (2014)]. Nevertheless, supporting the PMP22 gene dosage effect as the driving mechanism of CMT1A, rodent models overexpressing PMP22 reproduced a CMT1A-like phenotype [Sereda et al., Neuron, 16(5): 1049-60 (1996); Huxley et al., Hum. Mol. Genet., 5(5): 563-569 (1996); Huxley et al., Hum. Mol. Genet., 7(3): 449- 458 (1998); Magyar et al., J. Neuroscience, 16(17): 5351-5360 (1996); Perea et al., Hum. Mol. Genet., 10(10): p.1007-1018 (2001); Robaglia-Schlupp et al., Brain, 125(Pt 10): 2213- 2221 (2002); and Robertson et al., J. Anat., 200(4): 377-390 (2002)], which was ameliorated after interrupting PMP22 overexpression [Fledrich et al., Nat. Med., 20(9): 1055-1061 (2014); Lee, supra; Perea, supra; Sereda et al., Nat. Med., 9(12): 1533-1537 (2003); Passage et al., Nat. Med., 10(4): 396-401 (2004); Meyer et al., Ann. Neurology, 61(1): 61-72 (2007); Chumakov et al., Orphanet Journal of Rare Diseases, 9(1): 201 (2014); Lee et al., Neurobiology of Disease, 100: 99-107 (2017); Zhao et al., J. Clin. Invest., 128(1): 359-368 (2018); Prukop et al., PLoS One, 14(1): e0209752 (2019); and Lee et al., Nuc. Acids Res., 48(1): 130-140 (2020)].
[0158] Overexpressed PMP22 has been shown to saturate the proteasomal capacity for degradation, leading to perinuclear or cytoplasmic PMP22 accumulation, decreased overall proteasomal activity, and ER stress. PMP22 is also involved in early steps of myelinogenesis, in the determination of myelin thickness and maintenance. PMP22 duplication destabilizes the architecture, protein stoichiometry and function of the myelin sheath and SC, leading to demyelination, remyelination, the characteristic onion bulb formation and SC apoptosis. As a consequence, impairment in SC-axon interactions and dysfunctional neurofilament structure result in higher packing density and less phosphorylation of neurofilaments accompanied by slower axonal transport and myelination rates.28335 / 58942 2023-012-02
[0159] Current treatments for CMT1A remain geared toward general symptom management in the form of physical therapy or corrective surgery.
[0160] Methods are provided of preventing or treating CMT1A comprising administering a delivery vehicle (such as rAAV) comprising DNA encoding a miPMP22 as described herein The methods provided result in restoration of PMP22 expression to at least or about 25 percent, at least or about 30, at least or about 40, at least or about 50, at least or about 60, at least or about 70, at least or about 80, at least or about 90, at least or about 95, at least or about 98 percent, at least or about 99 percent, or 100 percent or more, of normal PMP22 expression in an unaffected subject.
[0161] In some aspects, the miRNA targeting DUX4 is mi405. Thus, the disclosure provides constructs and methods for inhibiting the expression of DUX4 and, thus, for treating facioscapulohumeral muscular dystrophy. The role of DUX4 in FSHD pathogenesis can be explained as follows. First, D4Z4 repeats are not pseudogenes. The DUX4 locus produces 1.7 kb and 2.0 kb full-length mRNAs with identical coding regions, and D4Z4 repeats also harbor smaller sense and antisense transcripts, including some resembling microRNAs. Over-expressed DUX4 transcripts and a ~50 kDa full-length DUX4 protein are found in biopsies and cell lines from FSHD patients. These data are consistent with a transcriptional de-repression model of FSHD pathogenesis. In addition, unlike pseudogenes, D4Z4 repeats and DUX4 likely have functional importance, since tandemly-arrayed D4Z4 repeats are conserved in at least eleven different placental mammalian species (non-placental animals lack D4Z4 repeats), with the greatest sequence conservation occurring within the DUX4 ORF. Second, over-expressed DUX4 is toxic to tissue culture cells and embryonic progenitors of developing lower organisms in vivo. This toxicity occurs at least partly through a pro-apoptotic mechanism, indicated by Caspase-3 activation in DUX4 transfected cells, and presence of TUNEL-positive nuclei in developmentally arrested Xenopus embryos injected with DUX4 mRNA at the two-cell stage. These findings are consistent with studies showing some pro-apoptotic proteins, including Caspase-3, are present in FSHD patient muscles. In addition to stimulating apoptosis, DUX4 may negatively regulate myogenesis. Human DUX4 inhibits differentiation of mouse C2C12 myoblasts in vitro, potentially by interfering with PAX3 and / or PAX7, and causes developmental arrest and reduced staining of some muscle markers when delivered to progenitor cells of zebrafish or Xenopus embryos. Finally, aberrant DUX4 function is directly associated with potentially important molecular changes seen in FSHD patient muscles. Specifically, full-length human DUX4 encodes an approximately 50 kDa double homeodomain transcription factor, and its only28335 / 58942 2023-012-02 known target, Pitx1, was elevated in DUX4 over-expressing FSHD patient muscles. These data support that DUX4 catalyzes numerous downstream molecular changes that are incompatible with maintaining normal muscle integrity. See additionally, U.S. Patent Nos. 9,469,851, 10, 301,649, incorporated herein by reference in their entirety.
[0162] RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post- transcriptional control of gene expression mediated by miRNAs. MiRNAs are small (about 21-25 nucleotides), noncoding RNAs that share sequence homology and base-pair with sequence target sites of cognate messenger RNAs (mRNAs). In exemplary aspects the miRNAs are about 22 nucleotides. The interaction between the miRNAs and mRNAs directs cellular gene silencing machinery inducing mRNA decay and / or preventing mRNA translation into protein.
[0163] As an understanding of natural RNAi pathways has developed, researchers have designed artificial shRNAs and snRNAs for use in regulating expression of target genes for treating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells, including short (or small) interfering RNA (siRNA), and short (or small) hairpin RNA (shRNA) and microRNA (miRNA), which constitute a similar class of vector- expressed triggers [Davidson et al., Nat. Rev. Genet.12:329-40, 2011; Harper, Arch. Neurol. 66:933-8, 2009]. shRNA and miRNA are expressed in vivo from plasmid- or virus-based vectors and may thus achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active (Davidson et al., Methods Enzymol.392:145-73, 2005). Importantly, this vector-expressed approach leverages the decades-long advancements already made in the gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial shRNA or miRNA cassettes targeting disease genes-of-interest.
[0164] The disclosure provides new constructs for the delivery of microRNA (miRNA) with a pol II tissue-specific promoter. MicroRNAs (miRNAs) are a class of non-coding RNAs that play important roles in RNA silencing and in regulating gene expression. The majority of miRNAs are transcribed from DNA sequences into primary miRNAs and processed into precursor miRNAs, and finally mature miRNAs. In most cases, miRNAs interact with the 3′ untranslated region (3′ UTR) of target mRNAs to induce mRNA degradation and translational repression. However, interaction of miRNAs with other regions, including the 5′ UTR, coding sequence, and gene promoters, have also been reported. Under certain conditions, miRNAs can also activate translation or regulate transcription. The interaction of miRNAs with their28335 / 58942 2023-012-02 target genes is dynamic and dependent on many factors, such as subcellular location of miRNAs, the abundancy of miRNAs and target mRNAs, and the affinity of miRNA-mRNA interactions.
[0165] Most studies to date have shown that miRNAs bind to a specific sequence at the 3′ UTR of their target mRNAs to induce translational repression and mRNA deadenylation and decapping. miRNA binding sites have also been detected in other mRNA regions including the 5′ UTR and coding sequence, as well as within promoter regions. The binding of miRNAs to 5′ UTR and coding regions have silencing effects on gene expression while miRNA interaction with promoter region has been reported to induce transcription.
[0166] As disclosed herein, the miRNA constructs of the disclosure were designed to be modular constructs to substitute any miRNA into the construct for expression with an RNA pol II promoter. Thus, the miRNA constructs of the disclosure are expressed under various promoters and / or enhancers including, but not limited to any RNA polymerase type II (pol II) promoters and / or enhancers. Thus, in some aspects, the promoter and / or enhancer is a U7 promoter and / or enhancer, an RSV promoter and / or enhancer, a human skeletal a-actin (HSA) promoter and / or enhancer, a desmin promoter and / or enhancer, a CMV promoter and / or enhancer, a minimal CMV promoter and / or enhancer, a T7 promoter and / or enhancer, an EF1-alpha promoter and / or enhancer, a minimal EF1-alpha promoter and / or enhancer, an unc45b promoter and / or enhancer, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter, a tMCK promoter and / or enhancer, a dMCK promoter and / or enhancer, a CK1 promoter and / or enhancer, a CK6 promoter and / or enhancer, a CK7 promoter and / or enhancer, a CK8 promoter and / or enhancer, a CK8e promoter and / or enhancer, a myelin protein zero (MPZ) promoter and / or enhancer, a synthetic promoter and / or enhancer, a ubiquitous promoter and / or enhancer, a neuronal- specific promoter and / or enhancer, a brain-specific promoter and / or enhancer, or any other muscle-specific promoter.
[0167] In some aspects, the promoter and / or enhancer is any of the promoters and / or enhancers disclosed by Skopenova et al. (Acta Naturae.2021; 13(1):47-58) incorporated herein by reference in its entirety).
[0168] In some aspects, the synthetic promoter is an SPc5-12 promoter, an SP-301 promoter, an MH promoter, or a Sk-CRM4 / DES promoter.
[0169] In some aspects, a neuronal-specific or brain-specific promoter is human Synapsin1 (hSyn1), neuron-specific enolase (Nse), MeCP2, mDLX, mDLX5 / 6, calmodulin-28335 / 58942 2023-012-02 dependent kinase II (CaMKII or Camk2a), or an MPZ promoter. In some aspects, the promoter and / or enhancer is any of the promoters and / or enhancers disclosed by Haery et al. (Front Neuroanat.2019; 13:93; PMID: 31849618, incorporated herein by reference in its entirety; “Haery”) including, but not limited to, the promoters and enhancers disclosed in Tables 3 and 4 of Haery.
[0170] In some embodiments, the disclosure includes a vector comprising any of the nucleic acids described herein to deliver nucleic acids encoding the miRNA. Thus, embodiments of the disclosure utilize vectors (for example, viral vectors, such as adeno- associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.
[0171] In some aspects, the disclosure utilizes adeno-associated virus (AAV) to deliver nucleic acids encoding the miRNA. AAV is a replication-deficient parvovirus, the single- stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 {1983); the complete genome of AAV3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV4 is provided in GenBank Accession No. NC_001829; the AAV5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV6 is provided in GenBank Accession No. NC_001862; at least portions of AAV7 and AAV8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos.7,282,199 and 7,790,449 relating to AAV8); the AAV9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); the AAV11 genome is provided in Virology, 330(2): 375-383 (2004); the AAV12 genome is provided in J. Virol.2008 Feb; 82(3): 1399-406; and the AAV13 genome is provided in J. Virol.2008; 82: 8911. Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the28335 / 58942 2023-012-02 differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka (Current Topics in Microbiology and Immunology, 158: 97-129 (1992)).
[0172] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56º to 65ºC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.
[0173] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are28335 / 58942 2023-012-02 contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56º to 65ºC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.
[0174] In some aspects, the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and / or AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and / or AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and / or AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and / or AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and / or AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and / or AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and / or AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and / or AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and / or AAV9 capsid proteins), AAV.rh74 (i.e., an AAV containing AAV.rh74 ITRs and / or AAV.rh74 capsid proteins), AAV.rh8 (i.e., an AAV containing AAV.rh8 ITRs and / or AAV.rh8 capsid proteins), AAV.rh10 (i.e., an AAV containing AAV.rh10 ITRs and / or AAV.rh10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and / or AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and / or AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 ITRs and / or AAV13 capsid proteins), AAV14 (i.e., an AAV containing AAV14 ITRs and / or AAV14 capsid proteins), AAV15 (i.e., an AAV containing AAV15 ITRs and / or AAV15 capsid proteins), AAV16 (i.e., an AAV containing AAV16 ITRs and / or AAV16 capsid proteins), AAV-anc80 (i.e., an AAV containing AAV-anc80 ITRs and / or AAV-anc80 capsid proteins), AAV-B1 (i.e., an AAV containing AAV-B1 ITRs and / or AAV-B1 capsid proteins), AAV.PHP.EB (i.e., an AAV containing AAV- PHP.EB ITRs and / or AAV- PHP.EB capsid proteins), AAVv66 (i.e., an AAV containing AAVv66 ITRs and / or AAVv66 capsid proteins), MYOAAV, or AAVMYO (i.e., an AAV containing AAVMYO ITRs and or AAVMYO capsid proteins), and accordingly the same with MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof. In some aspects, the AAV is a laboratory-engineered AAV not normally isolated in nature.
[0175] Thus, in some aspects, the AAV is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8,28335 / 58942 2023-012-02 or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof.
[0176] Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900- 1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.
[0177] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking the novel nucleic acid constructs of the disclosure. Such AAV genome of the disclosure includes any of the various AAV serotypes known in the art. In some aspects, the AAV vectors are single stranded AAV vectors. In some aspects the AAV is recombinant AAV (rAAV). In some aspects, the rAAV lack rep and cap genes. In some aspects, rAAV are self-complementary (sc)AAV.
[0178] DNA plasmids of the disclosure comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV- anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV- SLB101, or any derivative thereof. In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any28335 / 58942 2023-012-02 derivative thereof. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.
[0179] In some embodiments, packaging cells are provided. Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors
[0180] For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081], addition of synthetic linkers containing restriction endonuclease cleavage sites [Laughlin et al., 1983, Gene, 23:65-73] or by direct, blunt-end ligation [Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.
[0181] In some embodiments, therefore, a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-28335 / 58942 2023-012-02 2081], addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy et al., 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.
[0182] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbiol. and Immunol.158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol.4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mo1. Cell. Biol.5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol., 63:3822- 3828 (1989); U.S. Patent No.5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Human Gene Therapy, 4:609-615 (1993); Clark et al., Gene Therapy, 3:1124-1132 (1996); U.S. Patent. No.5,786,211; U.S. Patent No.5,871,982; U.S. Patent. No.6,258,595; and McCarty, Mol. Ther., 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of various types of rAAV are specifically contemplated and exemplified. Recombinant AAV (i.e., infectious encapsidated rAAV particles) are thus provided herein. In some aspects, genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).
[0183] The disclosure thus provides in some embodiments packaging cells that produce infectious rAAV. In one embodiment, packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal28335 / 58942 2023-012-02 fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
[0184] The rAAV, in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69427-443 (2002); U.S. Patent No.6,566,118 and WO 98 / 09657.
[0185] In some embodiments, the disclosure includes a composition comprising any of the nucleic acids or any of the vectors described herein in combination with a diluent, excipient, or buffer. In some embodiments, the disclosure provides a composition comprising a vector, e.g., such as a viral vector, as described herein. Thus, compositions comprising delivery vehicles (such as rAAV) described herein are provided. In various aspects, such compositions also comprise a pharmaceutically acceptable carrier. In general, as used herein, "pharmaceutically acceptable carrier" means all aqueous and non- aqueous solutions, sterile solutions, solvents, buffers, e.g. phosphate buffered saline (PBS) solutions, water, suspensions, emulsions, such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media and coatings, which are compatible with pharmaceutical administration, in particular with parenteral administration. The use of such media and agents in pharmaceutical compositions is well known in the art, and the compositions comprising such carriers can be formulated by well-known conventional methods.
[0186] In various aspects, any composition of the disclosure also comprises other ingredients, such as a diluent, excipients, and / or adjuvant. Acceptable carriers, diluents, excipients, and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
[0187] In some other aspects, the nucleic acids are introduced into the cell via non- vectorized delivery. Thus, in an embodiment, the disclosure includes non-vectorized delivery28335 / 58942 2023-012-02 of any of the miRNA expression cassette constructs disclosed herein. In some aspects, in this context, synthetic carriers able to form complexes with nucleic acids, and protect them from extra- and intracellular nucleases, are an alternative to viral vectors. In some aspects, such non-vectorized delivery includes the use of nanoparticles, extracellular vesicles, or exosomes comprising the nucleic acids of the disclosure. The disclosure also includes compositions comprising any of the constructs described herein alone or in combination.
[0188] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
[0189] Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1x106, about 1x107, about 1x108, about 1x109, about 1x1010, about 1x1011, about 1x1012, about 1x1013to about 1x1014or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) (e.g., 1x107vg, 1x108vg, 1x109vg, 1x1010vg, 1x1011vg, 1x1012vg, 1x1013vg, and 1x1014vg, respectively).
[0190] In some aspects, therefore, the disclosure provides a method of delivering to a cell or to a subject any one or more of the miRNA expression cassette constructs disclosed herein. In some aspects, the method comprises delivering the nucleic acid constructs in one or more AAV vectors. In some aspects, the method comprises delivering the nucleic acids to the cell in non-vectorized delivery.
[0191] In some aspects, the method comprises administering to a cell or to a subject an AAV comprising any one or more miRNA expression cassette constructs disclosed herein.
[0192] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids encoding the miRNA as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step28335 / 58942 2023-012-02 of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of a symptom of the disease, or other symptom of the disease or disorder associated with mutant or pathogenic expression of the gene, the administration is prophylactic. If the dose is administered after the development of a symptom of the disease or disorder, the administration is therapeutic or ameliorative. In embodiments of the disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom of the disease or disorder associated with mutant or pathogenic expression of the gene being targeted by the miRNA, that slows or prevents progression of a symptom of the disease or disorder associated with mutant or pathogenic expression of the gene, and / or that results in remission (partial or total) of the symptom(s) of the disease or disorder associated with mutant or pathogenic expression of the gene.
[0193] In some aspects, the disclosure provided non-vectorized delivery of nucleic acids encoding the miRNA as described herein. In some aspects, the nucleic acids or compositions comprising the nucleic acids are delivered in nanoparticles, extracellular vesicles, or exosomes.
[0194] Combination therapies are also contemplated by the disclosure. Thus, the disclosure includes possible combination therapy or therapies comprising one or more other compounds or compositions comprising other RNA inhibitory compounds or small molecule compounds for downregulating gene expression. Combination as used herein includes simultaneous treatment or sequential treatments. Combinations of methods of the disclosure with standard medical treatments and supportive care are specifically contemplated, as are combinations of therapies, such as physical and occupational therapies, speech & language therapy, therapy by developmental specialists for their neurodevelopmental delay and autistic symptoms, medications to address behavioral problems (including, but not limited to, alpha-2 adrenergic agonists, antipsychotics, selective serotonin reuptake inhibitors (SSRIs), and the like), medications to address sleep problems (including, but not limited to, melatonin, trazodone, benzodiazepines, doxepine, eszopiclone, lemborexant, ramelteon, suvorexant, zaleplon, zolpidem, and the like) and medications to address seizures and / or EEG abnormalities (including, but not limited to, any of the many anti-seizure medications known in the art including, but not limited to, carbamazepine, eslicarbazepine, ethosuximide, everolimus, gabapentin, lacosamide, oxcarbazepine, lamotrigine, phenobarbital, phenytoin, pregabalin, tiagabine, vigabatrin, valproic acid,28335 / 58942 2023-012-02 acetazolamide, brivaracetam, cannabidiol, cenobamate, clobazam, clonazepam, clorazepate, diazepam, divalproex, felbamate, fenfluramine, lamotrigine, levetiracetam, lorazepam, methsuximide, perampanel, primidone, rufinamide, stiripentol, topiramate valproic acid, or zonisamide) or with other inhibitory RNA constructs are specifically contemplated.
[0195] Administration of an effective dose of the compositions, including AAV, nanoparticles, extracellular vesicles, and exosomes comprising the compositions and nucleic acids of the disclosure, may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. Route(s) of administration and serotype(s) of AAV components of rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure may be chosen and / or matched by those skilled in the art taking into account the disease state being treated and the target cells / tissue(s), such as cells that express a gene to be downregulated, which in some aspects of the disclosure is DUX4 or PMP22. In some embodiments, the composition or medicament is formulated for intracerebroventricular injection, intrathecal injection, intramuscular injection, oral administration, subcutaneous, intradermal, or transdermal transport, injection into the blood stream, or for aerosol administration. In some embodiments, the route of administration is intracerebroventricular. In some embodiments, the route of administration is intravenous.
[0196] In some aspects, actual administration of rAAV of the present disclosure may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal. Administration according to the disclosure includes, but is not limited to, injection directly into the brain, the bloodstream, the central nervous system, and / or other organ. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for expression in the brain, and there are no known restrictions on the carriers or other components that can be co- administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as the brain. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared for oral administration, as injectable formulations, or as topical formulations to be delivered to the muscles by subcutaneous, intradermal, and / or transdermal transport. Numerous formulations for both intramuscular injection and28335 / 58942 2023-012-02 transdermal transport have been previously developed and can be used in the practice of the disclosure. The rAAV can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
[0197] For purposes of injection, in some aspects, solutions such as sterile aqueous solutions are used. Such aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxpropylcellulose. A dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
[0198] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. In some aspects, proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0199] In some aspects, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient which protects the formulation from adverse conditions, such as those which occur during heating or freezing, and / or prolongs the stability or shelf- life of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars, such as sucrose, lactose and mannose; sugar alcohols, such as mannitol; amino28335 / 58942 2023-012-02 acids, such as glycine or glutamic acid; and proteins, such as human serum albumin or gelatin.
[0200] In some aspects, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance which is added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated puncture of the vial or container being used. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.
[0201] The term "transduction" is used to refer to the administration / delivery of one or more of the nucleic acid constructs encoding a miRNA, as described herein, to a recipient cell either in vivo or in vitro, via a replication-deficient rAAV of the disclosure resulting in decreased expression of the targeted gene by the recipient cell.
[0202] In one aspect, transduction with rAAV is carried out in vitro. In one embodiment, desired target cells are removed from the subject, transduced with rAAV and reintroduced into the subject. Alternatively, syngeneic or xenogeneic cells can be used where those cells will not generate an inappropriate immune response in the subject.
[0203] Suitable methods for the transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells are transduced in vitro by combining rAAV with cells, e.g., in appropriate media, and screening for those cells harboring the DNA of interest using conventional techniques such as Southern blots and / or PCR, or by using selectable markers. Transduced cells can then be formulated into pharmaceutical compositions, and the composition introduced into the subject by various techniques, such as by intracerebroventricular, intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into the brain or smooth and cardiac muscle, using e.g., a catheter.
[0204] The disclosure provides methods of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV that comprise DNA that encodes microRNA designed to reduce or inhibit the expression of a gene targeted for inhibition by the miRNA. In some aspects, the microRNA is designed to reduce or inhibit the expression of any gene whose expression in a cell or in a cell of a subject (including but not limited to a human subject) is associated with a pathological disease or condition. In some aspects, the microRNA is mi405 for targeting DUX4.
[0205] In some aspects, the microRNA is mi871 for targeting PMP22, to a cell or to a subject in need thereof. In some aspects, the effective dose is therefore a therapeutically28335 / 58942 2023-012-02 effective dose.
[0206] In some embodiments, the dose or effective dose of rAAV administered is about 1.0x1010vg / kg to about 1.0x1016vg / kg. In some aspects, 1.0x1010vg / kg is also designated 1.0 E10 vg / kg, which is simply an alternative way of indicating the scientific notation. Likewise, 1011is equivalent to E11, and the like. In some aspects, the dose of rAAV administered is about 1.0x1011vg / kg to about 1.0x1015vg / kg. In some aspects the dose of rAAV is about 1.0x1010vg / kg, about 2.0x1010vg / kg, about 3.0x1010vg / kg, about 4.0x1010vg / kg, about 5.0x1010vg / kg, about 6.0x1010vg / kg, about 7.0x1010vg / kg, about 8.0x1010vg / kg, about 9.0x1010about 1.0x1011vg / kg, about 2.0x1011vg / kg, about 3.0x1011vg / kg, about 4.0x1011vg / kg, about 5.0x1011vg / kg, about 6.0x1011vg / kg, about 7.0x1011vg / kg, about 8.0x1011vg / kg, about 9.0x1011vg / kg, about 1.0x1012vg / kg, about 2.0x1012vg / kg, about 3.0x1012vg / kg, about 4.0x1012vg / kg, about 5.0x1012vg / kg, about 6.0x1012vg / kg, about 7.0x1012vg / kg, about 8.0x1012vg / kg, about 9.0x1012vg / kg, about 1.0x1013vg / kg, about 2.0x1013vg / kg, about 3.0x1013vg / kg, about 4.0x1013vg / kg, about 5.0x1013vg / kg, about 6.0x1013vg / kg, about 7.0x1013vg / kg, about 8.0x1013vg / kg, about 9.0x1013vg / kg, about 1.0x1014vg / kg, about 2.0x1014vg / kg, about 3.0x1014vg / kg, about 4.0x1014vg / kg, about 5.0x1014vg / kg, about 6.0x1014vg / kg, about 7.0x1014vg / kg, about 8.0x1014vg / kg, about 9.0x1014vg / kg, about 1.0x1015vg / kg, about 2.0x1015vg / kg, about 3.0x1015vg / kg, about 4.0x1015vg / kg, about 5.0x1015vg / kg, about 6.0x1015vg / kg, about 7.0x1015vg / kg, about 8.0x1015vg / kg, about 9.0x1015vg / kg, or about 1.0x1016vg / kg.
[0207] In some aspects, the dose is about 1.0x1011vg / kg to about 1.0x1015vg / kg. In some aspects, the dose is about 1.0x1013vg / kg to about 5.0x1013vg / kg. In some aspects, the dose is about 2.0x1013vg / kg to about 4.0x1013vg / kg. In some aspects, the dose is about 3.0x1013vg / kg.
[0208] In some aspects, an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.
[0209] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. Transduction of cells with an rAAV of the disclosure results in sustained expression of the miRNA sequence. The disclosure thus provides rAAV and methods of administering / delivering rAAV which express the miRNA sequence in the cell(s) in vitro or in vivo in a subject. In some aspects, the subject is a mammal. In some aspects, the mammal is a human. These methods include transducing cells and tissues28335 / 58942 2023-012-02 (including, but not limited to, tissues such as the brain) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements. The term “transduction” is used to refer to, as an example, the administration / delivery of a nucleic acid comprising a nucleotide sequence encoding the miRNA sequence, e.g., the DUX4 or PMP22 miRNA, i.e., mi405 or mi871, respectively, to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the manipulating expression of the target gene, e.g., DUX4 or PMP22, by the target cell.
[0210] The in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human subject) in need thereof. Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subject in need thereof. If the dose or doses is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival.
[0211] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease or disorder associated with expression of a DUX4 or PMP22 gene, such as FSHD or CMT1A disease.
[0212] In some embodiments, the level of target gene expression or protein expression in a cell of the subject is decreased after administration of the nucleic acid encoding the miRNA or the vector, e.g., rAAV, comprising the nucleic acid encoding the miRNA as compared to the level of miRNA gene expression or protein expression before administration of the nucleic acid encoding the miRNA or the vector, e.g. rAAV. In some aspects, expression of the target gene is changed by at least or about 10%, at least or about 20%, at least or about 30%, at least or about 40%, at least or about 50%, at least or about 60%, at least or about 70%, at least or about 80%, at least or about 90%, at least or about 95%, at least or about 98%, at least or about 99%, at least or about 100% percent, or at least about greater than 100%.
[0213] Administration of an effective dose of a nucleic acid, viral vector, nanoparticle, extracellular vesicle, exosome, or composition of the disclosure may be by routes standard28335 / 58942 2023-012-02 in the art including, but not limited to, intracerebroventricular, intrathecal, intravenous, intracranial, oral, buccal, nasal, intraosseous, intramuscular, parenteral, intravascular, pulmonary, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, in various aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various aspects, an effective dose is delivered by a combination of routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously.
[0214] In some aspects, the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, composition, or medicament is formulated for the delivery of an effective dose by oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebroventricular delivery or injection, intrathecal delivery or injection, transdermal delivery or injection, injection into the blood stream, or aerosol administration.
[0215] Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.
[0216] In particular, actual administration of delivery vehicle (such as rAAV) may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal. Administration includes, but is not limited to, injection into the brain, the nervous system, the liver, or the bloodstream. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for expression in the brain, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable28335 / 58942 2023-012-02 formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
[0217] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.
[0218] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0219] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.28335 / 58942 2023-012-02
[0220] "Treating" includes ameliorating, reducing, or inhibiting any one or more symptoms of the disease or condition associated with expression of the target gene, i.e., the gene that the microRNA is designed to knockdown expression. “Preventing” includes prohibiting or blocking any one or more symptoms of the disease or condition associated with expression of the target gene, i.e., the gene that the microRNA is designed to knockdown expression. Such preventing, in some aspects, includes prohibiting expression of the gene at a level to not allow the manifestation of symptoms of the disease or condition associated with expression of the gene.
[0221] Thus, in some aspects methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subject in need thereof. If the dose or doses is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival.
[0222] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease, such as a muscular dystrophy (MD) associated with the expression of the double homeobox 4 (DUX4) gene.
[0223] In various aspects, such MD is facioscapulohumeral muscular dystrophy (FSHD). FSHD is caused by aberrant expression of the DUX4 gene which produces a transcription factor that is toxic to skeletal muscle. DUX4 is normally functional during the two-cell stage of human development but repressed thereafter in essentially all other tissues, except perhaps the testes. In skeletal muscles of people with FSHD, specific genetic and epigenetic factors conspire to permit DUX4 de-repression, where it then initiates several aberrant gene expression cascades, including those involved in differentiation abnormalities, oxidative stress, inflammatory infiltration, cell death and muscle atrophy.
[0224] FSHD is among the most commonly inherited muscular dystrophies, estimated to affect as many as 870,000 individuals. Classical descriptions of FSHD presentation include progressive muscle weakness in the face, shoulder-girdle and arms, but disease can manifest more broadly, including in muscles of the trunk and lower extremities. Variability is also commonly seen within individuals, as asymmetrical weakness is common. Age-at-onset28335 / 58942 2023-012-02 can range from early childhood to adulthood, and is usually related to disease severity, where earlier onset is often associated with more severe muscle weakness. Although most patients with FSHD have a normal life span, respiratory insufficiency can occur, and the disease can be debilitating, as approximately 25% of affected individuals may become wheelchair dependent by their fifties, and even earlier in more severe forms of the disease, while others maintain lifelong ambulation.
[0225] In families known to carry pathological FSHD, the methods of the disclosure, in various aspects, are methods of preventing disease and they are carried out before the onset of disease. In other various aspects, the methods of the disclosure are carried out after diagnosis and, therefore, are methods of treating or ameliorating disease.
[0226] In some additional embodiments, nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, and compositions of the disclosure are used in treating, ameliorating, or preventing a disease, such as a cancer. DUX4 has been shown to be activated in some cancer types, where it functions to mask tumor cells from the immune system [Chew et al., Dev. Cell 50(5):658-71 (2019)]. For example, DUX4 protein fusions are known to cause cancer, such as rhabdomyosarcoma and Ewing's sarcoma. A CIC-DUX4 gene fusion induces sarcomas and drives sarcoma metastasis [Yoshimoto et al., Cancer Res.2017 Jun 1; 77(11): 2927-2937; Okimoto et al., J Clin Invest.2019; 129(8):3401-3406)]. Other cancer tissues, such as those tissues from the adrenal, B-cell lymphoma, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain (e.g., lower grade glioma), lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, and thymus, also were shown to express DUX4 [Chew et al., Dev. Cell 50(5):658-71 (2019)]. Thus, the nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, and compositions of the disclosure described herein are used in inhibiting DUX4 expression in the treatment, amelioration, or prevention of cancer.
[0227] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the products and methods disclosed herein for decreasing the expression of the DUX4 gene and protein and treating muscular dystrophies, such as FSHD. Outcome measures are described, for example, in Chapters 32, 35 and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4th Edition, Volume 1 (2005) and in Burgess et al., Methods Mol. Biol., 602: 347-393 (2010). Outcome measures include, but are not limited to, reduction or elimination of DUX4 mRNA or protein in affected tissues. The lack of expression of DUX4 and / or the downregulation of expression of DUX4 in the cell is detected by measuring the level of DUX4 protein by methods known in28335 / 58942 2023-012-02 the art including, but not limited to, RT-PCR, QRT-PCR, RNAscope, Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV to determine the improvement.
[0228] In some embodiments, the level of DUX4 gene expression or protein expression in a cell of the subject is decreased after administration of the nucleic acid encoding the DUX4 miRNA or the vector, e.g., rAAV, comprising the nucleic acid encoding the DUX4 miRNA as compared to the level of DUX4 gene expression or protein expression before administration of the nucleic acid encoding the DUX4 miRNA or the vector, e.g. rAAV. In some aspects, expression of a DUX4 is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%. In various aspects, improved muscle strength, improved muscle function, and / or improved mobility and stamina show an improvement by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.
[0229] Other outcome measures include measuring the level of serum creatinine kinase (CK) in the subject before and after treatment. Increased CK levels are a hallmark of muscle damage. In muscular dystrophy patients, CK levels are significantly increased above the normal range (10 to 100 times the normal level since birth). When elevated CK levels are found in a blood sample, it usually means muscle is being disintegrated by some abnormal process, such as a muscular dystrophy or inflammation. Thus, a positive therapeutic outcome for treatment with the methods of the disclosure is a reduction in the level of serum creatinine kinase after administration of the rAAV as compared to the level of serum creatinine kinase before administration of the rAAV.
[0230] Other outcome measures include, but are not limited to, measuring to determine if there is improved muscle strength, improved muscle function, improved mobility, improved stamina, or a combination of two or more thereof in the subject after treatment. Such outcome measures are important in determining muscular dystrophy progression in the subject and are measured by various tests known in the art. Some of these tests include, but are not limited to, the six minute walk test, time to rise test, ascend 4 steps test, ascend and descend 4 steps test, North Star Ambulatory Assessment (NSAA) test, 10 meter timed28335 / 58942 2023-012-02 test, 100 meter timed test, hand held dynamometry (HHD) test, Timed Up and Go test, Gross Motor Subtest Scaled (Bayley-III) score, maximum isometric voluntary contraction test (MVICT), or a combination of two or more thereof.
[0231] Combination therapies are also contemplated by the disclosure. A combination therapy, as used herein, includes both simultaneous treatment(s) and sequential treatment(s). Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated, as are combinations with therapies, such as glucocorticoids. All types of glucocorticoids are included for use in the combination therapies disclosed herein. Such glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.
[0232] Other combination therapies included in the disclosure are the DUX4 miRNAs, as described herein, in combination with other miRNAs, or in combination with U7-snRNA- based gene therapy, a small molecule inhibitor of DUX4 expression, oligonucleotides to inhibit DUX4 through RNAi or RNAse H or exon skipping mechanisms, U7-snRNA plus a theoretical CRISPR-based gene therapy approach.
[0233] In some embodiments, nucleic acids, vectors, nanoparticles, extracelllulare vesicles, endosomes, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease, such as Charcot-Marie-Tooth disease (CMT), including but not limited to CMT1A, associated with the expression of the PMP22 gene. In families known to carry pathological PMP22 gene duplications or mutations, the subject is treated before the onset of disease and, thus, the disease is prevented. In other aspects, the subject is diagnosed as having a pathological PMP22 gene duplication or mutation, and the subject is treated after the onset of disease and, thus, the disease is treated or ameliorated.
[0234] CMT disease refers to a heterogeneous group of hereditary peripheral neuropathies that affect 1 in 2500 people. The most common type, CMT Type 1, is a demyelinating peripheral neuropathy. The CMT Type 1 subtype that affects more than 50% of all CMT cases and about 70-80% of CMT Type 1 cases is autosomal dominant demyelinating CMT neuropathy type 1A [CMT1A (MIM 118220)]. CMT1A is most frequently caused by a dominantly inherited 1.4 Mb tandem intra-chromosomal duplication on chromosome 17p11.2-p12. The duplication results in three copies of the peripheral myelin protein-22 (PMP22) gene which are translated into PMP22 protein [Timmerman et al., Nature Genetics, 1(3): 171-175 (1992) and Valentijn et al., Nature Genetics, 1(3): 166-170 (1992)]. In some cases, point mutations in PMP22 may also lead to dominant CMT1A and28335 / 58942 2023-012-02 generally present with the most severe phenotype [Matsunami et al., Nature Genetics, 1(3):176-179 (1992), Patel et al., Nature Genetics, 1(3): 159-165 (1992), Timmerman et al., supra]. Patients with CMT1A develop slowly progressive distal muscle weakness and atrophy, sensory loss, and absent reflexes with a typical onset at adolescence. CMT1A shows high variability in disease severity even within the same family. Sensory responses are usually absent while motor nerve conduction velocities (MNCVs) are slowed, ranging from 5 to 35 m / s in the forearm, but most average around 20 m / s, with uniform and symmetric findings in different nerves. Although MNCVs do not change significantly over decades, motor amplitudes and the number of motor units decrease slowly, reflecting axonal loss, which correlates with clinical disability.
[0235] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the methods. Outcome measures are described, for example, in Chapters 32, 35 and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4th Edition, Volume 1 (2005) and in Burgess et al., Methods Mol. Biol., 602: 347-393 (2010). Outcome measures include, but are not limited to, one or more of the reduction or elimination of mutant PMP22 mRNA or protein in affected tissues, PMP22 gene knockdown, increased body weight and improved muscle strength. Others include, but are not limited to, nerve histology (axon number, axon size and myelination), neuromuscular junction analysis, and muscle weights and / or muscle histology. Others include, but are not limited to, nerve conduction velocity-ncv, electromyography-emg, and synaptic physiology.
[0236] In the methods of the disclosure, expression of PMP22 in a subject is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent compared to expression in the subject before treatment.
[0237] Combination therapies are also contemplated by the invention. Combination as used herein includes both simultaneous treatment and sequential treatments. Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated.
[0238] The disclosure also provides a kit comprising a nucleic acid, vector, or composition of the disclosure or produced according to a process of the disclosure. In the context of the disclosure, the term "kit" means two or more components, one of which corresponds to a nucleic acid, vector, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise. A kit, therefore, in various28335 / 58942 2023-012-02 aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.
[0239] The kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above). The kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and / or means for diluting the nucleic acid, vector, or composition.
[0240] In some aspects, the kit comprises a label and / or instructions that describes use of the reagents provided in the kit. The kits also optionally comprise catheters, syringes or other delivering devices for the delivery of one or more of the compositions used in the methods described herein.
[0241] The disclosure also provides kits for a single dose of administration unit or for multiple doses. In some embodiments, the disclosure provides kits containing single- chambered and multi-chambered pre-filled syringes.
[0242] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed with "a" or "an," it should be understood that these terms mean "one or more" unless context unambiguously requires a more restricted meaning.
[0243] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the disclosure.28335 / 58942 2023-012-02
[0244] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term."
[0245] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 10 includes 10.
[0246] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having."
[0247] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.
[0248] In each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms.
[0249] It should be understood that this disclosure is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the subject matter of the disclosure, which is defined solely by the claims.
[0250] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.
[0251] A better understanding of the disclosure and of its advantages will be obtained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and28335 / 58942 2023-012-02 are to be included within the spirit and purview of this application and scope of the appended claims. EXAMPLES
[0252] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting. Example 1 Materials and Methods
[0253] Study Design.
[0254] U6 promoter-driven systems were previously developed and reported which were shown to express therapeutic miRNAs that target and reduce several dominant disease genes. See at least U.S. Patents No.9,469,851 and 10,301,649 (i.e., DUX4 miRNA, e.g., mi405), which provide miRNAs that target the DUX4 gene, and WO 2022 / 119826 (PMP22 miRNA, e.g. mi-871) which target the PMP22 gene, which are associated with facioscapulohumeral muscular dystrophy (FSHD) and Charcot-Marie-Tooth disease type 1A (CMT1A), respectively. In vitro and in vivo testing of these RNAi therapies targeting DUX4 and PMP22 have shown the ability of specifically designed synthetic miRNAs to reduce mRNA and protein levels while alleviating disease-associated outcomes in targeted tissues.
[0255] While these therapies have shown efficacy in targeting genes associated with dominant genetic diseases, high levels of off-target expression in the heart, liver, and kidneys have also been observed with both Intravenous (IV) and Intrathecal (IT) routes of administration of scAAV9 comprising these miRNAs (Fig.4).
[0256] The objective of this study, therefore, was to design modular expression cassettes (i.e., modular constructs) which allow a researcher to convert previously developed and reported pol III (e.g., U6- and H1) promoter-driven miRNA expression cassettes to novel tissue-specific pol II promoter-driven miRNA expression cassettes to more specifically express therapeutic miRNAs in target tissue to treat diseases associated with aberrant genes.
[0257] Converting a pol III-driven miRNA to a pol II-driven system (i.e., expression cassette) can change the secondary structure of the primary miRNA transcript, thereby altering the maturation process by the RNAse enzymes Drosha and Dicer. For example, various features of the system need to be converted to accommodate the use of a pol III promoter. For example, a U6 pol III promoter is used with an RNA pol III termination signal whereas a tissue-specific pol II promoter, like CMV, is used with an RNA pol III poly A signal28335 / 58942 2023-012-02 (Fig.5). The use of a pol II promoter is important in the new modular expression cassette construct disclosed herein because it allows for tissue-specific expression of therapeutic miRNAs. Thus, the disclosure provides modular expression cassettes which were designed to take these factors into consideration and allow for the substitution of various miRNAs into the cassettes more readily.
[0258] In this study, novel miRNA expression cassettes were designed to accurately position the RNAse III enzyme Drosha at a junction between Stem 2 and Stem 1, where Stem 1 is designed to contain as much single-stranded structure as possible. The Drosha / DGCR8 complex (called the microprocessor) is positioned at the junction of single and double-stranded RNA structures (Han et al., Cell 125(5): P887-901, 2006). In this study, eight novel miRNA expression cassettes were designed to convert an existing U6 promoter- driven miRNA to a tissue-specific, pol II-based system. Novel secondary structural elements were incorporated in the primary transcript regions flanking Drosha and Dicer processing sites. Fig.6 shows a comparative drawing of the structures of these eight constructs with incorporation of a DNA sequence encoding mi405 (a DUX4-specific miRNA), an exemplary miRNA of interest. The structures of the new mi405 constructs are shown in Figs.7-14, and the structures of the new mi871 constructs are shown in Figs.15-22. The RNA nucleotide sequences encoded by the new miPMP22-871 constructs (SEQ ID NOs: 1-8) are shown in Fig.23, and the RNA nucleotide sequences encoded by the new miDUX4-405 constructs (SEQ ID NOs: 9-16) are shown in Fig.24. The novel generic structures for each of the eight constructs are shown in Figs.25-27 and the nucleotide sequences are set out in SEQ ID NOs: 38-53.
[0259] Each of the miRNA expression cassettes for converting an RNA polymerase III- based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising in a 5’ to 3’ order a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and a polyadenylation (polyA) signal. The cassettes designed in our laboratory comprised restriction sites for cloning, but these restriction sites are not required in the expression cassettes of the disclosure. It is important to note that an expression cassette construct, as disclosed herein may be chemically synthesized and, thus, the restriction sites discussed in this example are not required in the final product.28335 / 58942 2023-012-02
[0260] Nonetheless, in various aspects, in the experimental design, each of the miRNA expression cassettes comprised in a 5’ to 3’ order a DNA nucleotide sequence encoding a first restriction enzyme site; a single stranded stem of mir30; a 5’ double-stranded stem of mir30; a sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; a second restriction enzyme site; a polyadenylation (polyA) signal; and a third enzyme restriction site.
[0261] The pol II-driven miRNA expression cassettes of the disclosure were designed to be modular, thereby allowing for the cutting and pasting in of (1) any desired RNA polymerase II-based promoter at the indicated AgeI site and (2) any mature sense and antisense strands of microRNA sequence of interest (not only limited to exemplary miRNA sequences disclosed herein) in between the AgeI and Afl II sites in the expression cassette.
[0262] Thus, in some aspects, the pol II-driven expression cassette is not restricted only to the use of AgeI and AflII restriction sties. For example, to produce constructs shown in SEQ ID NO:8 and SEQ ID NO:16, the AflI site was removed to facilitate unfolding of stem 1 into 5’ and 3’ single-stranded regions. In an exemplary embodiment, where this design is desired, microRNAs can be designed to include the Nrp I poly A signal and cloned into AgeI and EcoRI sites. This is a strategy which can be applied to the insertion of various miRNAs of interest.
[0263] In an exemplary aspect, the first restriction enzyme site is an AgeI site. In an exemplary aspect, the AgeI site comprises a nucleotide sequence encoding ACCGGU (SEQ ID NO: 19).
[0264] In an exemplary aspect, the single-stranded stem of mir30 comprises a nucleotide sequence encoding GGUUGCUGUUGA (SEQ ID NO: 20), GGUUUGCUGAGGA (SEQ ID NO: 21), GGUUUGCUCCUUA (SEQ ID NO: 22), GGUAAGCUCCUUA (SEQ ID NO: 23), or GGUCCCCAAGCUCCUUA (SEQ ID NO: 24).
[0265] In an exemplary aspect, the 5’ double-stranded stem of mir30 comprises a nucleotide sequence encoding CAGUGAGCGAN (SEQ ID NO: 25), wherein N is A, U, C, or G. In the miPMP22-871 constructs, the N is G. In the miDUX4-405 constructs, the N is U).
[0266] In various aspects, the sense strand of mature miRNA and the antisense strand of mature miRNA are strands of mature miRNA of any gene of interest. Thus, this is the purpose of the design of the disclosed modular system, i.e., to allow one to simply insert the sequences encoding any miRNA into the construct for pol II tissue-specific expression of the28335 / 58942 2023-012-02 miRNA. In exemplary aspects, the sense strand of mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17) or miDUX4-405 (i.e., CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18).
[0267] In an exemplary aspect, the modified mir30 loop comprises a nucleotide sequence encoding GUAAAGCCACAGAUGGG (SEQ ID NO: 26).
[0268] In various aspects, the antisense strand of mature miRNA are strands of mature miRNA of any gene of interest. As discussed herein above, this is the purpose of the design of the disclosed modular expression system, i.e., to allow one to simply insert the sequences encoding any miRNA into the construct for pol II tissue-specific expression of the miRNA. In exemplary aspects, the antisense strand of mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., UCUUCAAUCAACAGCAAUCCCC (SEQ ID NO: 27) or miDUX4-405 (i.e., AAACCAGAUCUGAAUCCUGGAC (SEQ ID NO: 28).
[0269] In an exemplary aspect, the 3’ ds stem of mir30 comprises a nucleotide sequence encoding UGCCUACUG (SEQ ID NO: 29).
[0270] In an exemplary aspect, the ss stem of mir30 (mutated) comprises a nucleotide sequence encoding CCUUUUACUU (SEQ ID NO: 30).
[0271] In an exemplary aspect, the second restriction enzyme site is an AflII site. In an exemplary aspect, the AflII site comprises a nucleotide sequence encoding CUUAAG (SEQ ID NO: 31).
[0272] In an exemplary aspect, the polyA signal is wild type neuropilin-1 polyadenylation (WT NRP1 polyA) signal. In an exemplary aspect, the WT NRP1 poly A signal comprises a nucleotide sequence encoding AAUAAAAUACGAAAUGUGACAGA (SEQ ID NO: 32).
[0273] In an exemplary aspect, the third restriction site is an EcoR1 site. In an exemplary aspect, the EcoR1 site comprises a nucleotide sequence encoding GAAUUC (SEQ ID NO: 33). In an exemplary aspect, the third restriction site is an MfeI site. In an exemplary aspect, the MfeI site comprises a nucleotide sequence encoding AAUUG (SEQ ID NO: 34).
[0274] Various exemplary structures were designed for substituting the pol II promoter with a pol II promoter. Each of eight structures were tested with two exemplary miRNAs, miPMP22-871, or mi-871 (GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17), and miDUX4-405, or mi-405 (CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18). The sense strand of the miPMP22-871 comprises the nucleotide sequence of SEQ ID NO: 17. The28335 / 58942 2023-012-02 antisense strand of the miPMP22-871 comprises the nucleotide sequence of SEQ ID NO: 27. The sense strand of the miDUX4-405 comprises the nucleotide sequence of SEQ ID NO: 18. The antisense strand of the miDUX4-405 comprises the nucleotide sequence of SEQ ID NO: 28. See, for example, WO 2022 / 119826 and U.S. Patent Nos.9,469,851 and 10,301,649; and Marina Stavrou et al., (2022) A miRNA-based gene silencing approach for the treatment of CMT1A. Journal of Clinical Investigation Jul 1;132(13):e159814; Wallace et al., (2012) RNA interference inhibits DUX4-induced muscle toxicity in vivo: Implications for a targeted FSHD therapy. Molecular Therapy July;20(7):1417-23; Wallace et al., Pre-clinical safety studies to support translation of AAV-mediated RNAi therapy for FSHD. Mol Ther Methods Clin Dev. Dec 24, 8:121-130; Amini-Chermahini et al., (2019) RNAscope in situ hybridization-based method for detecting DUX4 expression in vitro. RNA Sep;25(19):1211- 1217; and Saad et al., (2021) Human microRNA mir-675 inhibits DUX4 expression and may be exploited as a potential treatment for FSHD. Nature Communications. Dec 8;12(1):7128Mi871 is used to induce silencing of overexpressed peripheral myelin protein-22 (PMP22) and constructs of the disclosure are designed to do the same. PMP22 is a transmembrane glycoprotein component of myelin, important for myelin functioning. Mutation of PMP22 gene cause Charcot-Marie-Tooth Disease. Mi405 is used to induce silencing of double homeobox 4, also known as DUX4, a protein which in humans is encoded by the DUX4 gene and which the misexpression of is the cause of facioscapulohumeral muscular dystrophy (FSHD).
[0275] The expression cassette construct was designed to contain a small poly- adenylation signal derived from the human neuropilin-1 (Nrp1) gene or a modified human neuropilin-1 poly adenylation signal in which the 7 indicated nucleotides (5’-GTGACAG-3’ (SEQ ID NO: 54) , DNA; 5’ GUGACAG (SEQ ID NO: 55), RNA) were mutated to C nucleotides to improve the potential single-strandedness of Stem 1.
[0276] The expression cassette construct was designed so that the Stem 1 region of the cassette comprises nucleotide sequences with 5’ and 3’ ends ranging from about 15 to about 46 nucleotides in length. In various aspects, however, the Stem 1 region may comprise nucleotide sequences less than or exceed these indicated lengths.
[0277] Exemplary embodiments of the 5’ end of the Stem 1 region comprise base pairs, including G:U RNA wobble base-pairs, ranging from about 0-50% base pairing. In some aspects, however, the Stem 1 region also comprises base-pairing that exceeds about 50% base pairing.28335 / 58942 2023-012-02
[0278] Exemplary embodiments of the 3’ end of the Stem 1 region comprise base pairs, including G:U RNA wobble base-pairs, ranging from about 0-30% base pairing. In some aspects, however, the Stem 1 region also comprises base-pairing that exceeds about 30% base-pairing, and in some aspects, may exceed about 50% base pairing.
[0279] Exemplary embodiments of the microRNA (miRNA) region of the cassette comprises miRNA nucleotide sequences ranging from about 100 to about 200 nucleotides, but the miRNA encoding region may comprise sequences less than or greater than the indicated lengths. In some aspects, the miRNA nucleotide sequences ranges in length from about 120 to about 180 nucleotides. In exemplary aspects of the disclosure, the miRNA region ranges in length from 136-167 nucleotides in length (see Table 2). The cassettes were designed to contain either natural or artificial microRNAs.
[0280] Table 2. Secondary Structure of Various Nucleotide Constructs. Secondary structure Stem 1 region % paired Construct Size (nucleotides) 5' end 3' end 5' end 3' end U6.mi871 167 34 46 20.59 19.57 pol II - 1 137 15 40 37.50 30.00 pol II - 2 138 16 40 31.25 27.50 pol II - 3 138 16 40 43.75 17.50 pol II - 4 138 16 40 50.00 30.00 pol II - 5 138 16 40 31.25 27.50 pol II - 6 138 16 40 12.50 20.00 pol II - 7 142 20 40 10.00 20.00 pol II - 8 136 20 34 0.00 0.00
[0281] Several novel miRNA designs were developed to show how this works by converting an existing U6 promoter-driven miRNA to a tissue-specific, pol II-based system. Novel secondary structure elements were incorporated in the primary transcript regions flanking Drosha and Dicer processing sites, and then efficacy and expression of the mature sequences was confirmed in vitro.
[0282] This novel system was designed to allow for rapid conversion of ubiquitous to tissue-specific miRNA expression systems without rederivation of lead RNAi triggers, while also providing a new approach to restrict expression of therapeutic miRNAs.
[0283] HEK-293 Cell Culture. HEK-293 (ATCC) cells were grown at 37°C in GibcoTMDMEM, high glucose, no glutamine (ThermoFisher) supplemented with 1% L-glutamine, 1% Penicillin / Streptomycin, and 10% FBS by volume. Cells were passaged at 90% confluency28335 / 58942 2023-012-02 with Trypsin-EDTA (0.25%), phenol red (ThermoFisher). For the Dual-Luciferase assay, 65,000 cells were pre-plated in a white 96-well plate, and 200 ng total DNA was transfected using Lipofectamine™ 2000 Transfection Reagent (ThermoFisher) according to the manufacturer’s protocol.
[0284] Rat Schwann Cell Culture. RT4-D6P2T Rat Schwann cells (ATCC) were grown at 37°C in GibcoTMDMEM, high glucose, no glutamine (ThermoFisher) supplemented with 1% L-glutamine, 1% Sodium Pyruvate, 1% Penicillin / Streptomycin, and 10% FBS by volume. Cells were passaged at 90% confluency with GibcoTMTrypLE™ Express Enzyme (1X), phenol red (ThermoFisher). For the Dual-Luciferase assay, 65,000 cells were pre-plated in a white 96-well plate, and 200 ng total DNA was transfected using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher) according to the manufacturer’s protocol. For the ddPCR expression and knockdown assays, 250,000 cells were pre-plated in a white 96-well plate, and 500 ng total DNA was transfected using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher) according to the manufacturer’s protocol.
[0285] RNA Extraction. Total RNA was extracted following the total RNA isolation protocol for the mirVana™ miRNA Isolation Kit (Invitrogen) using 600 µL lysis buffer and eluting RNA in 100 µL of upH2O (Invitrogen). After elution, 10 µL of 3 M Sodium Acetate pH 5.5 (Invitrogen) and 200 µL of 190 Proof EtOH (Decon) were added to samples, mixed, and placed at -20oC overnight. Samples were spun at maximum speed at 4oC for 30 min and the supernatant was discarded without disturbing the precipitated RNA.100 µL of 70% EtOH was added and samples were spun at maximum speed at 4oC for 15 min and the supernatant was discarded without disturbing the precipitated RNA. Samples were placed in a DNA Speed Vac and spun on low speed for 3 min.50 µL of upH2O was used to resuspend samples and the concentration was subsequently measured by Nanodrop.200 ng of RNA were DNase treated according the manufacturer’s protocol for the DNA-free™ DNA Removal kit (Invitrogen) with the addition of 20 U of RNase Inhibitor, Human Placenta (New England Biolabs) and using heat inactivation of the enzyme at 75oC for 10 min instead of the included inactivation reagent. After DNase treatment, cDNA was generated using the High- Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and oligo(dT)18 Primer (Thermo Scientific) instead of 10x RT random primers following manufacturer’s instructions.
[0286] Droplet Digital PCR (ddPCR). The ddPCR reaction mixture (25 µL) contained 1x ddPCR Supermix for Probes (No dUTP), 1x TaqMan probes for Pmp22 and Rpl13a (ThermoFisher) and 0.5 ng of synthesized cDNA. For the mi871 ddPCR reaction (25 µL), 1x ddPCR Supermix for Probes (No dUTP), 0.25 ng of cDNA, 1.5 µM forward primer (IDT), 0.7028335 / 58942 2023-012-02 µM reverse primer (IDT), and 0.20 µM probe (Applied Biosystems) were used. Reaction mixtures were partitioned into droplets by the AutoDG Droplet Generator (BioRad). Amplification of the droplets was carried out according to the following PCR conditions: 95oC for 10 min, 40 cycles of 94oC for 30 sec and 60oC for 1 min, 98oC for 10 min, and hold at 12oC with all steps maintaining ramp rates of 2oC / s. The fluorescent intensity of all samples was measured using the QX200 droplet reader and the concentration of each target (copies / µL) was determined by using the Qx Manager Software 2.0 Standard Edition with Poisson distribution analysis. Wells with less than 10,000 droplets were considered unsuitable for further analysis and marked for rerun. The copies of mi871 and Pmp22 per µL were normalized to the copies of Rpl13a per µL and graphed using the Prism 9 Software (Prism).
[0287] Dual-luciferase assay. The dual-luciferase plasmids were created from the Psicheck2 vector (Promega). Briefly, DUX4.V5 or Human full-length PMP22 cDNA were cloned into the XhoI and NotI sites located within the 3’ UTR region of the Renilla Luciferase gene before the synthetic polyA sequence. Each construct was then co-transfected with its corresponding set of test miRNAs as described before. After 24-48 hrs, media was removed from the cells, 30 µl of Passive Lysis Buffer was added, and the cells were placed on a plate shaker at 425 rpm for 20 min at RT. The plate was then transferred to a GloMax Discover (Promega) plate reader where the Renilla and Firefly expression was quantified according to the Dual-Luciferase® Reporter Assay System Technical Manual (Promega). The ratio of Renilla:Firefly expression was quantified and normalized to a control well of the Dual- Luciferase plasmid and an empty U6T6 construct. These ratios were then graphed and presented with Prism 9 (Graphpad). Example 2 Testing expression and knockdown efficiency of pol II promoter-driven miRNAs
[0288] Pol II-driven miRNAs were efficiently expressed in vitro, as measured by droplet digital PCR (ddPCR) assay targeting the mature miRNA sequence. Briefly, HEK-293 cells were transfected with plasmids expressing mi871 / mi405 structures 1-8 driven by a CMV promoter. Control conditions included HEK-293 cells undergoing a mock transfection, transfection with a plasmid expressing mi871 / mi405 under the pol III U6 promoter system, and transfection of a non-targeting miRNA, miGFP, driven by the pol III U6 promoter system. Each condition was run in triplicate according to the conditions described above. At 48 hours post-transfection, total RNA was isolated, samples were rDNase-treated, and cDNA was synthesized following the aforementioned protocols. Finally, the expression of mi871 / mi40528335 / 58942 2023-012-02 (in addition to that of the normalizer gene Rpl13a) was measured for each sample using ddPCR. The copies of mi871 / mi405 per µL are normalized to copies of Rpl13a per µL and plotted using Prism 9 (Graphpad).
[0289] Knockdown of gene target was measured using a dual-luciferase assay where either DUX4 or Human PMP22 was cloned into the 3' UTR of the Renilla Luciferase gene within the Psicheck2 vector. Briefly, each CMV-driven miRNA variant was co-transfected into HEK293 cells with a Psicheck2 vector containing the target sequence. After 24 hours, Renilla and Firefly luciferase expression was measured by a GloMax Discover Luminescence Plate Reader (Promega) and percent knockdown was calculated by normalizing each ratio of Renilla:Firefly expression to the positive control, and empty U6T6 vector (Figs.31, 32). CMV.mi871-4 exhibited the highest knockdown of the human PMP22 target at 83%, compared to 90% knockdown by the Pol III U6.mi871 system (Fig 31). CMV.mi405-4 had the highest knockdown of the DUX4 target at 64%, compared to 58% for U6.mi405 (Fig.32). Pol II-driven miRNA systems, thus, show comparable target knockdown to their Pol III counterparts. Example 3 Testing miRNA expression and knockdown efficiency from tissue-specific promoters
[0290] To measure miRNA expression and knockdown efficiency of tissue-specific promoter in the new constructs, two different muscle-specific or Schwann cell-specific promoters were tested for their ability to drive expression of either mi405 or mi871, respectively. Briefly, Rat Schwann Cells or C2C12 cells were transfected with plasmids expressing mi871 or mi405 structures 4 and 8, respectively, driven by the hMPZ / rMPZ or CK6 / HSA promoters, respectively. Control conditions included HEK-293 cells undergoing a mock transfection, transfection with a plasmid expressing mi871 / mi405 under the pol III U6 promoter system, and transfection of a non-targeting miRNA, miLacZ, driven by the pol III U6 promoter system. Each condition was run in triplicate according to the conditions described above. At 48 hours post-transfection, total RNA was isolated, samples were rDNase-treated, and cDNA was synthesized following the aforementioned protocols disclosed herein above.
[0291] Finally, the expression of mi871 / mi405, target genes rPmp22 and DUX4, and the normalizer gene Rpl13a were measured for each sample using ddPCR. The copies of mi871 / mi405 and target genes rPmp22 / DUX4 per µL were normalized to copies of Rpl13a per µL and plotted using Prism 9 (Graphpad). Human and rat MPZ promoters were each able to drive expression of mi871 in a rat Schwann cell culture (Fig.34). The pol II tissue28335 / 58942 2023-012-02 specific systems demonstrated comparable knockdown (hMPZ.mi871-4: 49% knockdown; rMPZ.mi871-4: 51% knockdown) of rat Pmp22 to the pol III system (U6.mi871: 66% knockdown) (Fig.34). The data for the expression of mi405 from CK6 and HSA promoters in C2C12 cells as well as the knockdown of DUX4 is currently being generated.
[0292] The expression of mi871 in rat Schwann cells was able to reduce relative luciferase expression when co-transfected with the Psicheck.Human-PMP22 construct. Briefly, The Human PMP22 was cloned into the 3’ UTR of the Renilla Luciferase gene in the Psicheck2 plasmid (Promega). The CMV promoter in the aforementioned mi871-4 and mi871-8 constructs were replaced with either human or rat MPZ promoter sequences with the 3’ end of the promoter sequence being cloned into the AgeI site of each miRNA construct (Fig.33). The resulting constructs were co-transfected with Psicheck.Human- PMP22 into rat Schwann cells in addition to testing their CMV-driven predecessors, U6.mi871, an empty U6T6 vector, and a control U6-driven miRNA. After 48 hours, Renilla and Firefly luciferase expression was measured by a GloMax Discover Luminescence Plate Reader (Promega) and percent knockdown was calculated by normalizing each ratio of Renilla:Firefly expression to the positive control -- the empty U6T6 vector (Fig.34). hMPZ.mi871-4 showed a knockdown efficiency of 85% compared with 93% for U6.mi871 (Fig.34). This showed that we were able to achieve a similar level of knockdown while driving mi871 expression from Schwann cell-specific promoter compared to the Pol III system.
[0293] The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.
[0294] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise” and variations such as “comprises” and “comprising” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0295] Throughout the specification, where compositions are described as including components or materials, it is contemplated that the compositions can also consist essentially of, or consist of, any combination of the recited components or materials, unless described otherwise. Likewise, where methods are described as including particular steps, it is contemplated that the methods can also consist essentially of, or consist of, any combination of the recited steps, unless described otherwise. The invention illustratively disclosed herein suitably may be practiced in the absence of any element or step which is28335 / 58942 2023-012-02 not specifically disclosed herein.
[0296] The practice of a method disclosed herein, and individual steps thereof, can be performed manually and / or with the aid of or automation provided by electronic equipment. Although processes have been described with reference to particular embodiments, a person of ordinary skill in the art will readily appreciate that other ways of performing the acts associated with the methods may be used. For example, the order of various of the steps may be changed without departing from the scope or spirit of the method, unless described otherwise. In addition, some of the individual steps can be combined, omitted, or further subdivided into additional steps.
[0297] All patents, publications and references cited herein are hereby fully incorporated by reference. In case of conflict between the present disclosure and incorporated patents, publications and references, the present disclosure should control.
Claims
28335 / 58942 2023-012-02 CLAIMS We claim:
1. A nucleic acid encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system, wherein the cassette comprises a DNA nucleotide sequence encoding a single stranded stem of a microRNA; a 5’ double-stranded stem of a microRNA; a sense strand of a mature microRNA; a modified microRNA loop comprising a nucleotide change to facilitate folding; an antisense strand of a mature microRNA; a 3’ double-stranded stem of a microRNA; a single-stranded stem of a microRNA; and a polyA signal.
2. The nucleic acid of claim 1, wherein the cassette comprises a DNA nucleotide sequence encoding the single stranded stem of a microRNA; the 5’ double-stranded stem of a microRNA; the sense strand of mature microRNA; the modified microRNA loop comprising a nucleotide change to facilitate folding; the antisense strand of mature microRNA; the 3’ double-stranded stem of a microRNA; the single-stranded stem of a microRNA; and the polyA signal in a 5’ to 3’ order, respectively, in the expression cassette.
3. The nucleic acid of claim 1, wherein the cassette comprises a DNA nucleotide sequence encoding a single stranded stem of mir30; a 5’ double-stranded stem of mir30; the sense strand of a mature microRNA; a modified mir30 loop comprising a nucleotide change to facilitate folding; the antisense strand of a mature microRNA; a 3’ double-stranded stem of mir30; a single-stranded stem of mir30; and28335 / 58942 2023-012-02 the polyA signal.
4. The nucleic acid of claim of any one of claims 1-3, wherein the cassette comprises the DNA nucleotide sequence encoding the single stranded stem of mir30; the 5’ double- stranded stem of mir30; the sense strand of a mature microRNA; the modified mir30 loop comprising a nucleotide change to facilitate folding; the antisense strand of a mature microRNA; the 3’ double-stranded stem of mir30; the single-stranded stem of mir30; and the polyA signal in a 5’ to 3’ order, respectively, in the expression cassette.
5. The nucleic acid of claim 4, wherein the single-stranded stem of mir30 comprises the nucleotide sequence of any one of SEQ ID NOs: 20-24, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 20-24.
6. The nucleic acid of claim 4 or 5, wherein the 5’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO:
25.
7. The nucleic acid of any one of claims 1-6, wherein the sense strand of mature miRNA is the sense strand of any mature miRNA.
8. The nucleic acid of any one of claims 1-7, wherein the sense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 17 or 18.
9. The nucleic acid of any one of claims 4-8, wherein the modified mir30 loop comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence comprising at least or about 90% identity to the nucleotide sequence of SEQ ID NO:
26.
10. The nucleic acid of claim 1, wherein the antisense strand of mature miRNA is the antisense strand of any mature miRNA.
11. The nucleic acid of any one of claims 1-10, wherein the antisense strand of mature miRNA comprises the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 27 or 28.
12. The nucleic acid of any one of claims 4-11, wherein the 3’ double-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence28335 / 58942 2023-012-02 comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO:
29.
13. The nucleic acid of any one of claims 4-12, wherein the mutated single stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO:
30.
14. The nucleic acid of any one of claims 1-13, wherein the polyadenylation (polyA) signal is wild type neuropilin-1 (WT NRP1) polyA signal.
15. The nucleic acid of claim 12, wherein the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence comprising at least or about 90% sequence identity to the nucleotide sequence of SEQ ID NO:
32.
16. The nucleic acid of claim 1 or 3, wherein the cassette further comprises restriction sites for cloning, and wherein the cassette comprises a DNA nucleotide sequence encoding a first restriction enzyme site; a single stranded stem of a microRNA or mir30; a 5’ double-stranded stem of a microRNA or mir30; a sense strand of a mature microRNA; a modified microRNA loop or mir30 loop comprising a nucleotide change to facilitate folding; an antisense strand of a mature microRNA; a 3’ double-stranded stem of a microRNA or mir30; a single-stranded stem of a microRNA or mir30; a second restriction enzyme site; a polyA signal; and a third enzyme restriction site.
17. The nucleic acid of claim 16, wherein the first restriction enzyme site is an AgeI site.
18. The nucleic acid of claim 17, wherein the AgeI site comprises the nucleotide sequence of SEQ ID NO: 19.28335 / 58942 2023-012-02 19. The nucleic acid of claim 16, wherein the second restriction enzyme site is an AflII site.
20. The nucleic acid of claim 19, wherein the AflII site comprises the nucleotide sequence of SEQ ID NO:
31.
21. The nucleic acid of claim 16, wherein the third restriction site is an EcoR1 site.
22. The nucleic acid of claim 21, wherein the EcoR1 site comprises the nucleotide sequence of SEQ ID NO:
33.
23. The nucleic acid of claim 16, wherein the third restriction site is an MfeI site.
24. The nucleic acid of claim 23, wherein the MfeI site comprises the nucleotide sequence of SEQ ID NO:
34.
25. The nucleic acid of any one of claims 1-24 comprising a nucleotide sequence encoding the sequence of SEQ ID NO: 35 (ACCGGN1N2N3N4N5N6N7GCUN8N9N10N11ACAGUGAGCGAN12NNNNNNNNNNNNNNNNN NNNNNGUAAAGCCACAGAUGGGNNNNNNNNNNNNNNNNNNNNNNUGCUACUGCN13N14UUAN15N16N17N18N19N20AAUAAAAUACGAAAUN21N22N23N24CN25N26AAUUN27), or a nucleotide sequence comprising at least or about 80% sequence identity to a nucleotide sequence encoding the nucleotide sequence of SEQ ID NO: 35, wherein N1at position 6 is U or is omitted; wherein N2at position 7 is C, A, or U; wherein N3at position 8 is C or is omitted; wherein N4at position 9 is C or is omitted; wherein N5at position 10 is C or is omitted; wherein N6at position 11 is A or is omitted; wherein N7at position 12 is A or U; wherein N8at position 16 is C or G; wherein N9at position 17 is C, A, or U; wherein N10at position 18 is U or G; wherein N11at position 19 is U or G; wherein N12at position 31 is U or G; wherein N13at position 104 is C or U; wherein N14at position 105 is C or U; wherein N15at position 109 is C or is omitted; wherein N16at position 110 is U or is omitted;28335 / 58942 2023-012-02 wherein N17at position 111 is U or is omitted; wherein N18at position 112 is A or is omitted; wherein N19at position 113 is A or is omitted; wherein N20at position 114 is G or is omitted; wherein N21at position 130 is C or G; wherein N22at position 131 is C or U; wherein N23at position 132 is C or G; wherein N24at position 133 is C or A; wherein N25at position 135 is C or A; wherein N26at position 136 is C or G; wherein N27at position 141 is C or G; wherein the first or most 5’ underlined series of multiple N nucleotides represents a mature miRNA sense sequence and the second or most 3’ underlined series of multiple N nucleotides represents a mature miRNA antisense sequence, and wherein, optionally, the sense sequence is placed in the more 3’ position and antisense sequence is placed in the more 5’ position.
26. The nucleic acid of any one of claims 1-25 comprising a nucleotide sequence encoding an RNA sequence comprising at least or about 80% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-16 or 35-53; or a nucleotide sequence that encodes the RNA sequence comprising the nucleotide sequence of any one of SEQ ID NOs: 1-16 or 35-53.
27. The nucleic acid of any one of claims 1-26 further comprising a promoter and / or enhancer.
28. The nucleic acid of claim 27, wherein the promoter is any polymerase type II (pol II) promoter.
29. The nucleic acid of claim 27 or 28, wherein the promoter and / or enhancer is any of a U7 promoter and / or enhancer, an RSV promoter and / or enhancer, a human skeletal a-actin (HSA) promoter and / or enhancer, a desmin promoter and / or enhancer, a CMV promoter and / or enhancer, a minimal CMV promoter and / or enhancer, a T7 promoter and / or enhancer, an EF1-alpha promoter and / or enhancer, a minimal EF1-alpha promoter and / or enhancer, an unc45b promoter and / or enhancer, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter, a tMCK promoter and / or enhancer, a dMCK promoter and / or enhancer, a CK1 promoter and / or enhancer, a CK6 promoter and / or enhancer, a CK7 promoter and / or enhancer, a CK8 promoter and / or enhancer, a CK8e28335 / 58942 2023-012-02 promoter and / or enhancer, a synthetic promoter and / or enhancer, a ubiquitous promoter and / or enhancer, a neuronal-specific promoter and / or enhancer, a brain-specific promoter and / or enhancer, or any other muscle-specific promoter and / or enhancer.
30. The nucleic acid of any one of claims 27-29, wherein the promoter and / or enhancer is a CMV promoter and / or enhancer, is an HSA promoter and / or enhancer, is an MPZ promoter and / or enhancer, or is an MCK promoter and / or enhancer.
31. The nucleic acid of any one of claims 27-29, wherein the synthetic promoter and / or enhancer is an SPc5-12 promoter and / or enhancer, an SP-301 promoter and / or enhancer, an MH promoter and / or enhancer, or a Sk-CRM4 / DES promoter and / or enhancer.
32. The nucleic acid of any one of claims 27-29, wherein the neuronal-specific promoter and / or enhancer is a synapsin promoter and / or enhancer.
33. A vector comprising the nucleic acid of any one of claims 1-32.
34. The vector of claim 33, wherein the vector is an adeno-associated virus (AAV) vector.
35. The vector of claim 34, wherein the AAV lacks rep and / or cap genes.
36. The vector of claim 34 or 35, wherein the vector is a recombinant AAV (rAAV) vector.
37. The vector of any one of claims 34-36, wherein the vector is a self-complementary recombinant AAV (scAAV) vector or a single-stranded recombinant AAV (ssAAV) vector.
38. The vector of any one of claims 34-37, wherein the AAV serotype is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof.
39. The vector of any one of claims 34-38, wherein the AAV serotype is AAV9, mAAV9, or AAV-SLB101.
40. A nanoparticle, extracellular vesicle, or exosome comprising the nucleic acid of any one of claims 32.
41. A composition comprising (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; or (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and28335 / 58942 2023-012-02 a pharmaceutically acceptable carrier.
42. A method of reducing, inhibiting, and / or interfering with expression of a gene in a cell comprising contacting the cell with (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41.
43. The method of claim 42, wherein the gene is any gene whose expression in a cell is associated with a pathological disease or condition.
44. The method of claim 42 or 43, wherein the gene is PMP22 or DUX4.
45. A method of treating or ameliorating a subject suffering from or at risk of suffering from a disease associated with DUX4 expression or PMP22 expression comprising administering to the subject an effective amount of (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41.
46. The method of claim 45, wherein the disease associated with DUX4 expression is facioscapulohumeral muscular dystrophy (FSHD) or cancer.
47. The method of claim 45, wherein the disease associated with PMP22 expression is Charcot-Marie-Tooth disease type 1A (CMT1A).
48. Use of (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41 for the preparation of a medicament for reducing or inhibiting expression of DUX4 or PMP22 in a cell.28335 / 58942 2023-012-02 49. Use of (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41 for treating or ameliorating facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A).
50. Use of (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41 for the preparation of a medicament for treating or ameliorating facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A).
51. Use of (a) the nucleic acid of any one of claims 1-32; (b) the vector of any one of claims 33-39; (c) the nanoparticle, extracellular vesicle, or exosome of claim 40; and / or (d) the composition of claim 41 for reducing, inhibiting, and / or interfering with expression of a gene in a cell.
52. The use of claim 51, wherein the gene is any gene whose expression in a cell is associated with a pathological disease or condition.
53. The use of claim 51 or 52, wherein the gene is PMP22 or DUX4.
54. The use of any one of claims 51-53, wherein the cell is in a subject.
55. The use of claim 54, wherein the subject is a human subject.
56. The (a) nucleic acid of any one of claims 1-32;28335 / 58942 2023-012-02 (b) vector of any one of claims 33-39; (c) nanoparticle, extracellular vesicle, or exosome of claim 40; (d) composition of claim 41 (e) method of any one of claims 42-47; or (f) use of any one of claims 48-55, wherein the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, composition, or medicament is formulated for oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebroventricular delivery or injection, intrathecal delivery or injection, transdermal delivery or injection, injection into the blood stream, or aerosol administration.